behavioral/systems/cognitive spinal5-ht3 ... · intrathecal injection and termination of...

Behavioral/Systems/Cognitive

Spinal 5-HT3 Receptor Activation Induces BehavioralHypersensitivity via a Neuronal-Glial-Neuronal SignalingCascade

Ming Gu,1 Kan Miyoshi,2 Ronald Dubner,1 Wei Guo,1 Shiping Zou,1 Ke Ren,1 Koichi Noguchi,2 and Feng Wei1

1Department of Neural and Pain Sciences, Program in Neuroscience, Dental School, University of Maryland, Baltimore, Maryland 21201 and 2Departmentof Anatomy and Neuroscience, Institute for Advanced Medical Sciences, Hyogo University, Hyogo 663-8501, Japan

Recent studies indicate that the descending serotonin (5-HT) system from the rostral ventromedial medulla (RVM) in the brainstem andthe 5-HT3 receptor subtype in the spinal dorsal horn are involved in enhanced descending pain facilitation after tissue and nerve injury.However, the mechanisms underlying the activation of the 5-HT3 receptor and its contribution to facilitation of pain remain unclear. Inthe present study, activation of spinal 5-HT3 receptor by intrathecal injection of a selective 5-HT3 receptor agonist, SR57227, inducedspinal glial hyperactivity, neuronal hyperexcitability, and pain hypersensitivity in rats. We found that there was neuron-to-microgliasignaling via chemokine fractalkine, microglia to astrocyte signaling via the cytokine IL-18, astrocyte to neuronal signaling by IL-1�, andenhanced activation of GluN (NMDA) receptors in the spinal dorsal horn. In addition, exogenous brain-derived neurotrophic factor-induced descending pain facilitation was accompanied by upregulation of CD11b and GFAP expression in the spinal dorsal horn aftermicroinjection in the RVM, and these events were significantly prevented by functional blockade of spinal 5-HT3 receptors. Enhancedexpression of spinal CD11b and GFAP after hindpaw inflammation was also attenuated by molecular depletion of the descending 5-HTsystem by intra-RVM Tph-2 shRNA interference. Thus, these findings offer new insights into the cellular and molecular mechanisms atthe spinal level responsible for descending 5-HT-mediated pain facilitation during the development of persistent pain after tissue andnerve injury. New pain therapies should focus on prime targets of descending facilitation-induced glial involvement, and in particular theblocking of intercellular signaling transduction between neuron and glia.

IntroductionRecent studies indicate that behavioral hypersensitivity and neu-ronal hyperexcitability in the CNS in animal models of persistentpain are closely linked to long-lasting activation of descendingmodulatory circuits involving descending facilitation (Per-tovaara et al., 1996; Urban et al., 1999; Wei et al., 1999; Burgess etal., 2002; Suzuki et al., 2002; for review, see Pertovaara, 2000;Porreca et al., 2002; Gebhart, 2004; Ren and Dubner, 2007). It hasbeen well established that the descending serotonin (5-HT) sys-tem from the rostral ventromedial medulla (RVM) of the brain-stem is involved in the modulation of spinal nociceptivetransmission (Roberts, 1984; Fields et al., 1991; Zhuo and Geb-hart, 1991; Sawynok and Reid, 1996). Selective lesions of spinal5-HT fibers (Geranton et al., 2008) or molecular depletion of5-HT in RVM neurons (Wei et al., 2010) have been reported toattenuate behavioral hypersensitivity by injury. These effects ofthe descending 5-HT system resulted from the activation of di-verse 5-HT receptor subtypes found in the spinal dorsal horn

(Hamon and Bourgoin, 1999; Millan, 2002; Lopez-Garcia, 2006).5-HT3 receptors, the only ligand-gated cation channel with excit-atory functions in the 5-HT receptor family, are expressed inspinal dorsal horn neurons and the central terminals of primaryafferent neurons (Kia et al., 1995; Conte et al., 2005). Spinal5-HT3 receptor-dependent descending pain facilitation has re-cently been implicated in the development of inflammatory andneuropathic pain (Suzuki et al., 2002; Lopez-Garcia, 2006; Rah-man et al., 2006; Aira et al., 2010; Lagraize et al. 2010). However,the signaling cascade underlying the contribution of spinal 5-HT3

receptors to descending pain facilitation remains unclear.Ample evidence suggests that glial cells in the spinal cord con-

tribute to pain hypersensitivity after injury (Scholz and Woolf,2007; Ren and Dubner, 2008, 2010; Milligan and Watkins, 2009;Gao and Ji, 2010). In addition to glutamate, spinal neurons andthe central terminals of primary afferents release chemokines,such as fractalkine (CX3CL1), activating nearby glial cells (Milli-gan et al., 2004, 2008). Furthermore, hyperactivated glia amplifyneuronal excitability and facilitate nociceptive transmission inspinal cord via release of proinflammatory cytokines (e.g., IL-1�and TNF-�) (DeLeo and Yezierski, 2001; Hansson and Ronn-back, 2004; Guo et al., 2007). Increasing attention has been givento neuron-glia-neuron signaling as a driving force in the devel-opment and maintenance of persistent pain (Scholz and Woolf,2007; Ren and Dubner, 2008, 2010; Milligan and Watkins, 2009;Gao and Ji, 2010).

Received March 28, 2011; revised July 15, 2011; accepted July 18, 2011.Author contributions: R.D., K.R., and F.W. designed research; M.G., K.M., W.G., S.Z., and F.W. performed research;

M.G., K.M., W.G., K.R., K.N., and F.W. analyzed data; R.D. and F.W. wrote the paper.This work was supported by National Institutes of Health Grants DE18573, NS059028, and NS060735.Correspondence should be addressed to Feng Wei at the above address. E-mail: [email protected]:10.1523/JNEUROSCI.1564-11.2011

Copyright © 2011 the authors 0270-6474/11/3112823-14$15.00/0

The Journal of Neuroscience, September 7, 2011 • 31(36):12823–12836 • 12823

RETRACTED

Utilizing a model of 5-HT3 receptor agonist-induced hyperalge-sia, we tested the hypothesis that neuron–glial interactions involvingchemokine/cytokine signaling molecules underlies mechanisms ofpain hypersensitivity after spinal 5-HT3 receptor activation. Ourfindings provide evidence that a spinal neuron-glia-neuron sig-naling cascade including endogenous fractalkine, the cytokinesIL-18 and IL-1�, and neuronal GluN (NMDA) receptor activa-tion, contribute to 5-HT3 receptor-mediated hyperalgesia. Thus,spinal neuronal-glial interactions underlying the development ofhyperalgesia and allodynia not only depend on nociceptive drivefrom primary afferents after tissue and nerve injury (Guo et al.,2007; Wang et al., 2010), but also require a maintenance of de-scending facilitation from RVM 5-HT-spinal 5-HT3 receptorsystems.

Materials and MethodsAnimals. Adult male Sprague Dawley rats weighing 200 –300 g (Harlan)were used in all experiments. Rats were on a 12 h light/dark cycle andreceived food and water ad libitum. The experiments were approved bythe Institutional Animal Care and Use Committee of the University ofMaryland Dental School (Baltimore, MD).

Intrathecal injection. A lumber puncture procedure was adapted ac-cording to Hylden and Wilcox (1980). Briefly, rats were anesthetizedwith 2–3% isoflurane in a gas mixture of 30% O2 balanced with nitrogenand placed in a prone position on a Styrofoam board with the forelimbsextended rostrally and the hind limbs hanging off the board. A portion ofthe caudal half of the rat’s back was shaved and scrubbed with providone-iodine solution. A disposable 25 gauge, 1 inch needle connected to a 25 �lluer tip Hamilton syringe was inserted slowly at the intervertebral spacebetween the L4 and L5 vertebrae, and the needle was allowed to penetratethe dura. A quick flick of the tail or a limb indicated entrance into theintrathecal space. Rats awoke within minutes upon the completion ofintrathecal injection and termination of anesthesia.

Intra-RVM microinjection and gene transfer. For intra-RVM microin-jection, rats under anesthesia with 3% isoflurane were placed in a Kopfstereotaxic instrument (Kopf Instruments). A midline incision was madeafter infiltration of lidocaine (2%) into the skin. A midline opening wasmade in the skull with a dental drill to insert a microinjection needle intothe target site. The RVM is termed for collective structures that consist ofthe midline nucleus raphe magnus (NRM) and the adjacent gigantocel-lular reticular nucleus � part (NGC�). The coordinates for the NRMwere as follows: 10.5 mm caudal to bregma, midline, and 9.0 mm ventralto the surface of the cerebellum (Paxinos and Watson, 2005). To avoidpenetration of the transverse sinus, the incisor bar was set at 4.7 mmbelow the horizontal plane passing through the interaural line. Animalswere subsequently maintained at 1% halothane. Microinjections wereperformed by delivering drug solutions slowly over a 10 min period usinga 0.5 �l Hamilton syringe with a 32 gauge needle. Human recombinantbrain-derived neurotrophic factor (BDNF, 100 fmol; Amgen) (Guo et al.,2006) was dissolved in ACSF. The sham group underwent identical pro-cedures with injection of the same volume of the vehicle. All woundmargins were covered with a local anesthetic ointment (Nupercainal;Rugby Laboratories), the wound was closed, and animals were returnedto their cages after they recovered from anesthesia. For gene transfer asdescribed previously (Wei et al., 2010), SureSilencing shRNA plas-mids (TCAACATGCTCCATATTGAAT) for rat neuronal tryptophanhydroxylase-2 (Tph-2), the rate-limiting enzyme in the synthesis of 5-HTin the CNS, or scrambled control (GGAATCTCATTCGATGCATAC)(0.5 �g/0.5 �l; SuperArray) was injected into the RVM. Focal electropo-ration around the RVM area was delivered by seven square wave electricpulses (50 ms, 40 V, 1 Hz; model 2100, A-M Systems). The wound wasclosed and animals returned to their cages after they recovered fromanesthesia.

Pain models and behavioral testing. To establish a persistent pain modelwith L5 spinal nerve ligation (L5 SNL), rats were anesthetized with 2–3%isoflurane in a gas mixture of 30% O2 balanced with nitrogen, and the leftL5 spinal nerve was exposed and tightly ligated with 4 – 0 soft silk thread.

Sham surgery was used as a control. To examine whether there wereeffects of descending 5-HT depletion on spinal glial hyperactivity in-duced by peripheral inflammation, complete Freund’s adjuvant (CFA)(50 �l, 25 �g Mycobacterium tuberculosis) was injected subcutaneouslyinto the plantar surface of the left hindpaw 3 d following gene transfer.

Animals were placed in clear plastic chambers on an elevated table andallowed to acclimate for �30 min. Nociceptive responses to thermal andmechanical stimuli were measured. Thermal hyperalgesia was assessed bymeasuring the latency of paw withdrawal in response to a radiant heatsource. A radiant heat stimulus was applied from underneath the glassfloor with a high-intensity projector lamp bulb (8 V, 50 W; Osram). Theheat stimulus was focused on the plantar surface of each hindpaw, andthe paw withdrawal latency (PWL) was determined by an electronic clockcircuit. The bulb voltage was adjusted to derive a baseline withdrawallatency (10 –12 s) in naive animals. A 20 s cutoff was used to preventtissue damage. The PWL was tested for three trials with 5 min intervalsbetween each trial. The average of the three trials was then determined.The mechanical sensitivity was measured with a series of calibrated vonFrey filaments before and after gene transfer and tissue or nerve in-jury. An EF50 value was defined as the von Frey filament force (g) thatproduced a 50% frequency of the paw withdrawal responses and wasused as a measure of mechanical sensitivity. Body weight and hindpawdiameters were determined before and after gene transfer as well as at1 and 3 d after inflammation. All behavioral tests were conductedunder blind conditions.

Intra-RVM electrical stimulation. Rats were anesthetized with 1.5%isoflurane and mounted in a stereotaxic apparatus. The stimulation sitein the RVM was located stereotaxically as described above (see Intra-RVM microinjection and gene transfer). A concentric bipolar stimulat-ing electrode was introduced into the RVM. Trains (2 min on and 30 soff) of stimuli of 0.5 ms square wave pulse were applied with low (10 �A)or high (100 �A) intensity at 10 Hz for 15 min. The sham group wasreceived an electrode placement without stimulation. At 30 min afterstimulation, sham and treated rats were anesthetized with 2% halothaneand decapitated. The spinal dorsal horn tissues at L4-L5 were removedfor Western blot to examine the expression of CD11b and glial fibrillaryacidic protein (GFAP).

Immunohistochemistry. One, two, and four hours after intrathecal in-jection of drugs, rats were deeply anesthetized with pentobarbital sodium(100 mg/kg, i.p.) and transcardially perfused with 200 ml of normalsaline followed by 500 ml of 0.1 M phosphate buffer containing 4% para-formaldehyde, pH 7.4. The lumber spinal cord was removed, postfixed,and transferred to 20% sucrose overnight. Transverse sections (free-floating, 20 – 40 �m) were cut with a cryostat. The free-floating sectionswere incubated with relevant antibodies with 1% normal goat sera and0.3% Triton X-100 overnight at 4°C. After washes in PBS, the sectionswere incubated with relevant IgGs conjugated to Cy3 or Cy2 (1:500;Jackson ImmunoResearch) for 4 h at room temperature or overnight at4°C. For the double immunofluorescent staining for IL-18 and NeuN,GFAP, or Iba-1, the tyramide signal amplification (PerkinElmer LifeSciences) fluorescence procedures (Michael et al., 1997) were used todetect staining for goat anti-IL-18 polyclonal antibody (1:10000; R &D Systems). Following washes, the stained sections were mounted ongelatin-coated slides and coverslipped with Vectashield (Vector Lab-oratories). Slides were examined with a Nikon fluorescence micro-scope and images were captured with a CCD Spot camera. A Bio-Radlaser scanning confocal microscope was also used for higher magni-fication and colocalization.

Western blot. Rats were killed1 h, 2 and 4 h after intrathecal injection ofdrugs. The L5-L6 spinal cord was rapidly removed and the dorsal half wasseparated and frozen on dry ice. The tissues were homogenized in solu-bilization buffer (50 mM Tris HCl, pH 8.0, 150 mM NaCl, 1 mM EDTA,1% NP-40, 0.5% deoxycholic acid, 0.1% SDS, 1 mM Na3VO4, 1 U/mlaprotinin, 20 �g/ml leupeptin, 20 �g/ml pepstatin A). The homogenatewas centrifuged at 14,000 rpm for 10 min at 4°C. The supernatant wasremoved. The protein concentration was determined using a detergent-compatible protein assay with a bovine serum albumin standard. Eachsample contains proteins from one animal. Protein samples (35 �g) wereseparated using 7.5% SDS-PAGE and blotted on a nitrocellulose mem-

12824 • J. Neurosci., September 7, 2011 • 31(36):12823–12836 Gu et al. • Spinal Mechanisms of Descending Pain Facilitation

RETRACTED

brane (GE Healthcare). The blots were blocked with 5% milk in Tris-buffered saline (TBS) for 30 min and then incubated with respectiveantibodies overnight at 4°C. The membrane was washed with TBS andincubated with anti-goat/mouse/rabbit IgG (1:1000; Santa Cruz Biotech-nology) for 1.5 h at room temperature. The immunoreactivity was de-tected using enhanced chemiluminescence (ECL; GE Healthcare). Someblots were further stripped in a stripping buffer (Thermo Scientific) for30 min at 50°C. The loading and blotting of equal amounts of proteinwere verified by reprobing the membrane with anti-�-actin antiserum(Sigma).

Data analysis. Data were presented as means � SEM and analyzedusing one-way or two-way ANOVA. The significant differences betweenthe groups were determined by a post hoc test. p � 0.05 is consideredsignificant for all cases. For Western blot analysis, the ECL-exposed filmswere digitized and immunoreactive bands were quantified by U-SCAN-IT gel (version 4.3; Silk Scientific). The relative protein levels wereobtained by comparing the respective specific band to the �-actin controlfrom the same membrane. The deduced ratios were further normalizedto that of the naive rats on the same membrane and illustrated as thepercentage of the naive controls. Raw data (ratios of the respective bandover �-actin) were used for statistical comparisons.

Drugs and antibodies. The following drugs were used for intrathecalinjection: 5-HT3 receptor agonist SR-57227 hydrochloride (Tocris Bio-science); 5-HT3 receptor antagonist Y-25130 (Tocris Bioscience), frac-talkine (aa 22–100, R & D Systems), neutralizing antibody against ratCX3CR1 (CX3CR1 Ab, Torrey Pines Biolabs); IL-1� receptor (IL-1ra,Amgen); anti-IL-18 receptor (IL-18R Ab, R & D Systems); recombinantrat IL-18 (R & D Systems); and IL-1� (PeproTech).

The following antibodies were used for Western blot and immuno-histochemistry, The polyclonal primary antibodies were used in thefollowing dilutions: anti-5-HT3 receptor (1:500, Calbiochem); anti-GFAP (1:10,000 from Millipore or 1:1000 from Millipore BioscienceResearch Reagents); anti-S100� (1:1000, Millipore); anti-Iba-1 (1:1000, Wako); anti-fractalkine (1:1000, Novus Biological); anti-CX3CR1(1:1000, Torrey Pines Biolabs); anti-IL-18 (1:400, R & D Systems); anti-IL-18R (1:500, R & D Systems); anti-IL-1� (1:500, Endogen); anti-IL-1R(1:500, Santa Cruz Biotechnology); and anti-p-GluN1 (or NR1) Ser896(1:1000, Millipore). The monoclonal primary antibodies were used in thefollowing dilutions: anti-CD11b (clone OX-42, 1:1000, Serotec); anti-NeuN (1:1000 from Millipore or 1:2000 from Millipore Bioscience Re-search Reagents); anti-GluN1 (1:1000, Millipore); and anti-�-actin(Sigma-Aldrich).

ResultsActivation of spinal 5-HT3 receptors induces hyperalgesiaand allodyniaOur previous study demonstrated that descending 5-HT-dependentpain facilitation contributes to behavioral hyperalgesia and allodyniaafter peripheral inflammation and nerve injury (Wei et al., 2010).Recently, we also found that the spinal 5-HT3 receptor mediatedthe development of pain hypersensitivity after inflammation in-duced by hindpaw injection of CFA (Lagraize et al., 2010). Toidentify an involvement of the spinal 5-HT3 receptor in neuro-pathic pain, we further examined the effect of the blockade ofspinal 5-HT3 receptor function on the maintenance of neuro-pathic pain. Intrathecal injection (i.t.) of the selective 5-HT3 re-ceptor antagonist Y25130 (30 fmol) alone did not produce aneffect on the baseline of thermal and mechanical sensitivity insham animals (Fig. 1A,B) as shown by withdrawal latencies(PWLs) to noxious heat (Fig. 1A) and withdrawal threshold(EF50) to mechanical stimulation (Fig. 1B), suggesting the ab-sence of tonic activation of spinal 5-HT3 receptors in the ratswithout injury. However, this dose of Y25130 significantly andreversibly attenuated nerve injury-induced thermal hyperalgesiaand mechanical allodynia for at least 24 h when compared withthe response in vehicle-treated rats (Fig. 1A,B). To investigatewhether the spinal 5-HT3 receptor directly mediated descending

pain facilitation, we also examined the effect of Y25130 on intra-RVM exogenous BDNF-induced hyperalgesia and allodynia. Asreported previously (Guo et al., 2006; Wei et al., 2010), microin-jection of BDNF (100 fmol) into the RVM produced long-lasting,

Figure 1. Attenuation of nerve injury-, intra-RVM BDNF-, or intrathecal 5-HT3 receptor agonistSR57227-induced behavioral hypersensitivity by intrathecal treatment of the 5-HT3 receptor antag-onist Y25130. A, B, Nerve injury-induced thermal hyperalgesia (A) and mechanical allodynia (B) 2weeks (2w) after the left L5 spinal nerve ligation was significantly attenuated for 24 h after post-treatment of Y25130 (30 fmol, i.t.) compared with vehicle; ***p � 0.001, **p � 0.01, SNL �Y25130 vs SNL � vehicle; n � 4 – 6 per group. C, D, Intra-RVM microinjections of BDNF-inducedhyperalgesia (C) and allodynia (D) were completely eliminated by pretreatment of Y25130 (30 fmol,i.t., 30 min before BDNF injection); **p�0.01, *p�0.05, Y25130�BNDF vs vehicle�BDNF, n�6 per group. E, F, SR57227 (10 pmol–1 nmol) induced significant decreases in thermal paw with-drawal latencies (E) and mechanical EF50 values (F ) at 1 h after injection compared with vehicle saline(*p�0.05, n�6 rats per group). Note that SR57227 at the 10 pmol dose produced a longer thermalhyperalgesia and mechanical allodynia lasting for 4 h; at a higher dose (10 nmol) SR57227 induced atransient hypoalgesia, and at a lower dose (1 pmol) it did not change thermal nociception (E). G, H, At1,2,and4htimepoints,SR57227-inducedthermalhyperalgesiawascompletelyblockedbypretreat-ment of the 5-HT3 receptor antagonist Y25130 (30 fmol, i.t.) but not saline, each of which was injected30 min before the injection of SR57227 (10 pmol, i.t.) (G). SR57227-induced mechanical hypersensi-tivity was totally reversed by pretreatment of Y25130 (30 fmol, i.t.) at 2 h after injection (H ); *p �0.05, ***p � 0.001, vs saline � saline; #p � 0.05, ###p � 0.001, vs saline � SR57227; n � 4 – 6per group).

Gu et al. • Spinal Mechanisms of Descending Pain Facilitation J. Neurosci., September 7, 2011 • 31(36):12823–12836 • 12825

RETRACTED

shorter PWLs (Fig. 1C) and bottom EF50

(Fig. 1D), which were completely blockedby pretreatment with Y25130 (30 fmol,i.t.) (Fig. 1C,D). These data suggest thatthe spinal 5-HT3 receptor mediates de-scending pain facilitation during the de-velopment of persistent pain. In addition,to identify the direct effect of activatingthe spinal 5-HT3 receptor on the behav-ioral pain response, we also intrathecallyinjected the selective 5-HT3 receptor ago-nist SR57227 and measured its influence onthermal and mechanical sensitivity of thehindpaw of the rat (Fig. 1E,F). After injec-tion, SR57227 induced significant thermalhyperalgesia as compared to vehicle (p �0.05, n � 6 rats per group) in a range ofdoses from 10 pmol to 1 nmol (Fig. 1E).This hypersensitive effect was maximal at adose of 10 pmol, peaking at 1–2 h and lastingat least for 4 h. A lower dose (1 pmol) waswithout effect on PWLs. Conversely, ahigher dose (10 nmol) of SR57227 pro-duced a transient increase of thermalthresholds to noxious heat. Meanwhile, in-trathecal SR57227 significantly resulted inmechanical hypersensitivity at 1–4 h afterinjection in a similar range of doses. To verifywhether SR57227-induced behavioral hy-persensitivity was mediated by 5-HT3 re-ceptors, Y25130 (30 fmol) was injectedintrathecally at 30 min before SR57227(10 pmol). The pretreatment of Y25130completely blocked the thermal hypersen-sitive effect of SR57227 at 1– 4 h (Fig. 1G;p � 0.05, n � 6) and mechanical allodyniaat 2 h compared to pretreatment with ve-hicle (Fig 1H; p � 0.001, n � 4). This doseexploration study in rats indicates that ac-tivation of the spinal 5-HT3 receptor in-duces long-lasting hyperalgesia andallodynia, supporting recent findings thatspinal 5-HT3 receptor activation is in-volved in the development of descending pain facilitation.

Selective activation of spinal 5-HT3 receptor increasesexpression of microglial CD11b and astrocytic GFAPWhat are the possible mechanisms underlying spinal 5-HT3 re-ceptor activation-induced hyperalgesia and allodynia? In thespinal cord, glial activity is critical for the induction and mainte-nance of hyperalgesia after tissue and nerve injury. Thus, wehypothesized that 5-HT3 receptor-induced hyperalgesia and al-lodynia involved changes in the activity of spinal glial cells. Bio-chemical markers for microglia (CD11b) and astrocytic cells(GFAP) were used to determine the location of glial expressionwith immunohistochemistry (Fig. 2A) and to assess the changesin expression using Western blotting (Fig. 2B) after spinal 5-HT3

receptor activation. The microglia and astrocytes exhibited hy-pertrophy with thicker processes and larger and densely stainedcell bodies in spinal dorsal horn at L5 2 h after intrathecal injec-tion of SR57227 (10 pmol) in comparison with vehicle treatment(Fig. 2A). Consistently, a significantly enhanced expression pat-tern of both GFAP and CD11b was identified in the lumbar spinal

dorsal horn at 1 and 2 h after application of SR57227 (Fig. 2B).Furthermore, blockade of spinal 5-HT3 receptor activation bypretreatment with Y25130 (30 fmol, i.t.) prevented SR57227-induced increase of GFAP and CD11b expression in the spinaldorsal horn 2 h after injections (Fig. 2C). These results indicateenhanced expression of microglial CD11b and astrocytic GFAPafter direct activation of 5-HT3 receptors in the spinal dorsalhorn.

Selective expression of 5-HT3 receptors in neurons but notin gliaSince SR57227 induced astrocytic and microglial hyperactivity,we wondered whether this compound directly acted on glial cellsto produce its effects. Although the existence of the 5-HT3 recep-tor has been reported in neuronal soma and terminals in thedorsal horn (Kia et al., 1995; Conte et al., 2005), it is not knownwhether the 5-HT3 receptor is also expressed in spinal glial cells.Therefore, we examined the distribution of the 5-HT3A receptorin the spinal cord and its possible expression in glial cells. Asshown in Figure 3Ba, intense immunoreactivity of the 5-HT3A

Figure 2. Selective activation of 5-HT3 A receptors induces increase of both GFAP and CD11b expression in the spinal dorsal horn. A,Immunoreactivity of GFAP, a marker of astrocytes, and CD11b, a marker of microglia. Top panels show the spinal dorsal horn of rats at 2 hafterreceiving10pmolofSR57227orvehicle.AnincreasedexpressionofGFAPorCD11bwasobservedinanenlargedsuperficialdorsalhorn(bottom panels) corresponding to the small rectangle area in the top panels when compared to the vehicle-treated rats. B, Western blotsillustrate significant increases in the levels of GFAP and CD11b in the spinal dorsal horn of rats receiving 10 pmol of SR57227 compared withrats receiving saline. Representative blots are shown above and relative protein levels (percentage of naive) are shown in the bottomhistograms (*p�0.05, **p�0.01, vs saline group; n�3 per group). C, Further Western blot analysis shows that enhanced expressionsof GFAP and CD11b at 2 h after intrathecal injection of SR57227 were blocked by pretreatment with 5-HT3 receptor antagonist Y25130 (30fmol, i.t.) (*p � 0.05, **p � 0.01, vs saline group; #p � 0.05, ##p � 0.01, vs SR57227 treated group; n � 3 per group).


RETRACTED

receptor was observed in the superficial layers of the spinal dorsalhorn. In addition, weak to moderate expression of 5-HT3 recep-tors was scattered throughout the spinal cord. Western blot anal-ysis showed no significant differences in the level of 5-HT3

receptor among groups of naive rats and rats in which SR57227 orsaline was intrathecally injected (n � 3 per group, data notshown). Double immunolabeling with 5-HT3A receptor andGFAP or CD11b showed no expression of the 5-HT3 receptor inastrocytes and microglia, including glial soma and processes (Fig.3A). Similarly, labeling for the 5-HT3 receptor was not seen in

both hyperactive astrocytic and microglialelements in the spinal dorsal horn follow-ing administration of SR57227 (data notshown). In contrast, 5-HT3A receptors weredistributed throughout neuronal soma andmany neurites in the spinal dorsal horn, typ-ically as small clusters associated with thecell membrane of the neurons labeled withNeuN (Fig. 3Bb). Consistent with previousreports (Kia et al., 1995; Conte et al., 2005),these data confirm that 5-HT3 receptors areprimarily expressed in some neuronal somaand terminals but not in glial cells in thespinal dorsal horn.

5-HT3 receptor-labeled neurons expressfractalkine in the dorsal hornIn view of the absence of 5-HT3A receptorsin glial cells of the spinal dorsal horn, wereasoned that 5-HT3 receptor-expressingneurons or terminals may mediateSR57227-induced glial hyperactivity byreleasing neuroactive substances. Thechemokine fractalkine (CX3CL1) hasbeen found in sensory afferents and in-trinsic spinal cord neurons (Bazan et al.,1997), whereas its receptor, CX3CR1, isexpressed predominantly in microglia(Imai et al., 1997; Verge et al., 2004; Clarket al., 2009) and may act as a specificneuron-to-glia signal in the spinal cord(Milligan et al., 2008). Therefore, to iden-tify the possible participation of frac-talkine as a signaling molecule betweenneuron and glia in SR57227-induced be-havioral hypersensitivity and glial hyper-activity, we investigated the expression offractalkine in 5-HT3A receptor-labeledneurons in the spinal dorsal horn. Immuno-reactivity of fractalkine was observed in nu-merous dorsal horn neurons (Fig. 3C) andterminals (data not shown). Double stain-ing indicated that all 5-HT3A receptor-labeledneuronal soma in the dorsal horn strongly ex-pressed fractalkine (Fig. 3C). Consistent withprevious observations (Imai et al., 1997;Verge et al. 2004), we identified the colocal-ization of CX3CR1 in microglia in the spinaldorsal horn by double labeling for CX3CR1and CD11b (Fig. 4A). These data suggestthat fractalkine may directly mediate signal-ing from 5-HT3 receptor-expressing neu-rons to microglia.

Upregulated CX3CR1 and activated microglia contribute toSR57227-induced hyperalgesia/allodynia and glialhyperactivityTo assess the role of CX3CR1 in downstream events subsequentto 5-HT3 receptor activation, we measured the change of tissueCX3CR1 expression in the spinal dorsal horn after intrathecalinjection of SR57227. Western blot analysis showed an upregula-tion of CX3CR1 level at 1–2 h after application of SR57227 (10pmol, i.t.) compared with saline (p � 0.05, n � 3 for each

Figure 3. 5-HT3A receptor expression in neurons but not glial cells in the spinal dorsal horn. A, Double immunostaining shows thatSR57227 (10 pmol, i.t.)-induced GFAP or CD11b expression in the dorsal horn astrocytes or microglial cells was not colocalized with 5-HT3Areceptor immunoreactivity. Ba, Distribution of 5-HT3A receptor expression in the spinal dorsal horn under low magnification. Intenseexpression of 5-HT3A receptor immunoreactivity was mainly observed in the superficial layers of the spinal dorsal horn. Bb, Double immu-nostaining showing 5-HT3A receptor profiles also labeled with NeuN, a neuronal marker in the dorsal horn cells (arrows), from the inset ofBa. C, Colocalization of immunoreactivity of 5-HT3A receptor and fractalkine in the spinal dorsal horn cells. Arrows indicate examples ofdouble-labeled profiles. Scale bar, 100 �m (Ba) and 25 �m (A, Bb, C).


RETRACTED

group) (Fig. 4B). Furthermore, to iden-tify whether CX3CR1 activation mediatesSR57227-induced increase of expressionof CD11b protein, we examined the effectof a neutralizing antibody for CX3CR1 onSR57227-induced microglial hyperactiv-ity. This neutralizing antibody (CX3CR1Ab), intrathecally (20 �g) injected at 1 dbefore and concurrently with SR57227(10 pmol), significantly attenuated an en-hancement of spinal CD11 expression at2 h induced by application of SR57227(Fig. 4C) (p � 0.05, n � 3). Next, we alsoexamined the effect of CX3CR1 Ab onSR57227-induced behavioral hypersensitiv-ity. Consistent with a recent finding thatCX3CR1 knock-out (KO) mice showed anattenuation of mechanical and thermal hy-persensitivity after nerve injury when com-pared with CX3CR1 wild-type (WT) mice(Staniland et al., 2010), the pretreatmentwith CX3CR1 Ab (20 �g, i.t.) significantlyattenuated the thermal hypersensitivity at 1,2, and 4 h (Fig. 4D, left) (p � 0.05, n � 5 foreach group) and the mechanical allodynia at2 h (Fig. 4D, right) (p � 0.001, n � 5 foreach groups) after application of SR57227.Injection of the antibody alone did not affectPWLs and EF50 (Fig. 4D). However, this isin contrast to the finding reported by Stani-land et al. (2010) that CX3CR1 KO micedisplayed only a loss of thermal hypersensi-tivity in a model of inflammation inducedby intraplantar injection of zymosan (Stani-land et al., 2010), suggesting that thefractalkine-CX3CR1 signaling cascade canbe differentially affected depending on thepathological pain model and the stimulusmodality. All of the above findings implicatethe fractalkine-CX3CR1 signaling cascadein neuron-microglial interaction duringglial hyperactivity and behavioral hypersen-sitivity after neuronal 5-HT3 receptor acti-vation at the spinal level.

We then tested whether the effect in-duced by endogenous fractalkine releasefrom 5-HT3 receptor-activated neuronswas mimicked by application of exogenous fractalkine. Intrathe-cal delivery of fractalkine (40 ng/10 �l), but not vehicle, produceda significant mechanical allodynia that developed within 20 minand lasted for up to 3 h (p � 0.05 or 0.01 vs saline � saline, n � 4per group) (Fig. 5A), and a similar pattern of thermal hyperalge-sia that peaked at 40 – 60 min after injection (data not shown). Inaddition, both immunostaining and Western blotting analysisshowed an enhanced hyperactivity of microglia at 1 h after thedelivery of fractalkine, along with increased expression of CD11b(Fig. 5B,C) and another functional marker of microglia, Iba1(Fig. 5B) in the spinal dorsal horn. Moreover, the hyperalgesiceffect of fractalkine or the induced enhancement of CD11b expres-sion in the spinal dorsal horn was significantly attenuated by pre-treatment with CX3CR1 Ab at 20–140 min (p � 0.05 vs saline �fractalkine) (Fig. 5A) or 1 h (Fig. 5C) after injection, respectively.Thus, the functional effects of blockade of CX3CR1 activation on

fractalkine-induced increase of CD11b and behavioral hypersen-sitivity further support our hypothesis that endogenous frac-talkine released from 5-HT3 receptor-containing neurons orterminals results in microglial activation by acting on its receptorCX3CR1, mainly expressed on microglia in the dorsal horn.

Upregulated IL-18 in microglia and IL-18 receptor inastrocytes mediate microglia-astrocytic interaction duringSR57227-induced hyperalgesia and allodyniaHyperactive microglia are known to synthesize and secrete manyglioactive substances such as proinflammatory cytokines in-volved in microglia-astrocytic interaction, the modulation ofneuronal activity, and the enhancement of hypersensitivity tonoxious input. Thus, we further identified possible downstreameffects of spinal microglial activation after intrathecal adminis-tration of SR57227 or fractalkine. Although many chemical me-diators, including proinflammatory cytokines, have been found

Figure 4. Attenuation of SR57227-induced upregulation of fractalkine receptor CX3CR1 in spinal microglia and behavioralhypersensitivity to a neutralizing antibody against CX3CR1. A, CX3CR1immunoractivity exists in all dorsal horn microglial cells(arrows) expressing CD11b at 2 h after intrathecal SR57227 (10 pmol). Scale bar, 25 �m. B, Western blot analysis showing asignificant upregulation in the levels of CX3CR1 in the spinal dorsal horn tissue in rats at 1 and 2 h after intrathecal injection ofSR57227 (10 pmol) but not of vehicle saline (*p � 0.05, vs saline; n � 3 per group). C, SR57227-induced increases in the proteinlevels of CD11b in the spinal dorsal horn tissue were partially suppressed by a neutralizing antibody against CX3CR1 (CX3CR1 Ab, 20�g) at 2 h after coadministration (**p � 0.01, vs saline � saline; #p � 0.05, CX3CR1 Ab � SR57227 vs saline � SR57227; n �3 per group). D, Thermal (left) and mechanical (right) hypersensitivity induced by SR57227 (10 pmol, i.t.) was completely orpartially eliminated by pretreatment with a CX3CR1-neutralizing antibody (Ab) (20 �g, i.t.) 1 d before and concurrently withSR57227 at all time points or at 2 h measured, respectively. *p � 0.05, vs saline � saline; #p � 0.05, CX3CR1 Ab � SR57227 vssaline � SR57227; n � 5 per group).


RETRACTED

to be involved in microglia-dependent signaling cascades, wespeculated that IL-18 may contribute to the downstream effectsbecause of its unique expression in microglia and its receptor thatis primarily found in astrocytes in the spinal dorsal horn, as wellas its crucial role in glial mechanisms underlying the develop-ment and maintenance of mechanical allodynia (Miyoshi et al.,2008). Thus, we determined whether the IL-18/IL-18 receptorsignaling pathway in spinal microglia-astrocyte interaction con-

tributed to SR57227- or fractalkine-induced pain hypersensitivity. Westernblot analysis demonstrated that selectiveactivation of CX3CR1 by intrathecal frac-talkine resulted in a significant increase ofIL-18 expression in the spinal dorsal horn(Fig. 5C) when compared with vehicletreatment (p � 0.05, n � 3 for eachgroup), which was also suppressed by pre-treatment with CX3CR1 Ab (p � 0.05, vssaline � fractalkine) (Fig. 5C). Consis-tently, higher intensity of IL-18 immuno-reactivity was visualized in the dorsal horncells at 2 h after intrathecal fractalkine, butnot vehicle, compared to that in the naivecondition (Fig. 5D). Double immuno-staining further confirmed that IL-18 waspredominantly expressed in microglia la-beled by Iba1 immunoreactivity in thedorsal horn (Fig. 5E), consistent with pre-vious observations (Miyoshi et al., 2008).There was little or no colocalization ofIL-18 with GFAP or NeuN (Fig. 5E).Moreover, we evaluated the changes ofIL-18 during microglial hyperactivity af-ter intrathecal injection of SR57227. Sim-ilar to the effect of fractalkine, activationof spinal 5-HT3 receptors induced a sig-nificant increase of IL-18 immunoreactiveintensities as shown by immunostaining(Fig. 5D) or IL-18 protein levels measuredby Western blots (Fig. 5F) in the dorsalhorn. Compared to that in vehicle group,SR57227-enhanced IL-18 expression wassignificantly prevented by pretreatmentwith intrathecal CX3CR1 Ab (Fig. 5F) orblocked by Y25130 (p � 0.05, 136.7 �3.5% in Y25130 � SR57227 vs 187.2 �6.7% in saline � SR57227). Treatment ofY25130 alone did not change baseline ex-pression of IL-18 in spinal dorsal horn(96.7 � 4.5%, p � 0.05, vs vehicle group)(n � 3 for each group).

In contrast to IL-18 expression in mi-croglia, the IL-18 receptor, IL-18R, waspresent in GFAP-labeled astrocytes butnot in microglia and neurons (Fig. 6A).Thus, spinal IL-18R expression during glialhyperactivity after intrathecal injection ofSR57227 or fractalkine was examined. Im-munostaining showed an increase of GFAPexpression accompanied by enhanced in-tensity of IL-18R immunoreactivity in thedorsal horn cells after intrathecal injec-tion of fractalkine (40 ng) when compared

to that treated by vehicle (Fig. 6C). Pretreatment with CX3CR1Ab reduced fractalkine-induced increases of spinal GFAP andIL-18R expression (Fig. 6C). Quantification of this effect wasobtained with Western blotting for fractalkine-induced upregu-lation of astrocytic IL-18R in the dorsal horn, which was signifi-cantly blocked by pretreatment with CX3CR1 Ab (Fig. 6D). Toverify whether a hyperactivity of spinal astrocytes was down-stream of spinal microglial activation, we also analyzed the effects

Figure 5. Fractalkine-induced pain behavior and upregulation of IL-18 is mediated by spinal microglia. A, Intrathecal injectionof fractalkine (40 ng) induced mechanical hyperalgesia and allodynia at 20 –140 min after injection (p � 0.001, one-way ANOVA,n � 4 for each group; *p � 0.05, **p � 0.01, vs baseline). This fractalkine-induced hypersensitivity was significantly attenuatedby pretreatment with a neutralizing antibody against CX3CR1 (CX3CR1 Ab, 20 �g, i.t.) ( #p � 0.05, ##p � 0.01 vs saline �fractalkine), suggesting that activation of CX3CR1 expressed in spinal microglia are involved in the mechanical hypersensitivityinduced by fractalkine. B, Fractalkine (40 ng) increased CD11b or Iba1 expression, markers of microglia (bottom panels); bottompanels are from the insets of the spinal dorsal horn (top panels, respectively) at 1 h after intrathecal injection when compared withvehicle treatment. Scale bar, 100 �m (top panels) and 25 �m (bottom panels). C, Western blot analysis showing a significantincrease in the levels of CD11b and IL-18 in the tissue of spinal dorsal horn of rats at 2 h after injection of fractalkine (40 ng, i.t.) whencompared with saline group (*p � 0.05; n � 3 per group); such upregulation was significantly attenuated by pretreatment ofCX3CR1 Ab (20 �g, i.t.) ( #p � 0.05, n � 3). D, Immunoreactivity of IL-18 in the spinal dorsal horn was upregulated 2 h afterintrathecal injection of SR57227 (10 pmol) or fractalkine (40 ng) but not vehicle when compared with that in naive rat (n � 3– 4for each group). Scale bar, 100 �m. E, Increased expression of Iba1 but not GFAP in the dorsal horn glial cells was colocalized withimmunoreactivity of IL-18 at 2 h after fractalkine treatment (40 ng, i.t.; n � 3– 4). There was no coexpression of IL-18 and NeuN.The top right panel is an enlargement of the inset from the dorsal horn in the left top panel. Scale bar, 100 �m (the top left panel)and 25 �m (the top right, middle, and bottom panels). F, Western blot analysis showed a significant increase in the level of IL-18in the spinal dorsal horn of rats at 2 h after intrathecal injection of SR57227 (10 pmol, n � 3) (*p � 0.05) compared with that withsaline (i.t., n � 3). The pretreatment with CX3CR1 Ab (20 �g, i.t., n � 3) prevented the effects of SR57227 on IL-18 expression( #p � 0.05). CX3CR1 Ab alone did not impair basal expression of IL-18 in spinal dorsal horn (n � 3).


RETRACTED

of functional blockade of these cytokinereceptors primarily expressed on micro-glia or astrocytes on the enhanced expres-sion of GFAP induced by SR57227 andfractalkine. We found that SR57227-induced elevation of GFAP expressionwas significantly attenuated after blockingthe fractalkine-mediated signal transduc-tion cascade with anti-CX3CR1 antibody(p � 0.05, Fig. 6B). Also, fractalkine-induced GFAP increase was significantlyattenuated after functional blockades ofeither CX3CR1 expression in microglia(Fig. 6D) or IL-18 receptors expressing inastrocytes (Fig. 6E). These data suggest anincrease in the functional interaction be-tween microglial and astrocytic hyperac-tivity via a key signaling pathway, IL-18/IL-18R, during the development of hyper-algesia induced by 5-HT3 receptor activa-tion and exogenous fractalkine.

Upregulated IL-1� in astrocytesmediates SR57227-induced painbehavior through phosphorylation ofneuronal GluNRs (NMDARs)Hyperactivated microglia and astrocytes inthe spinal dorsal horn and the brainstem tri-geminal transition zone are known to se-crete prototypic inflammatory cytokinessuch as IL-1� and are involved in centralsensitization and behavioral pain hyper-sensitivity (Reeve et al., 2000; Raghaven-dra et al., 2003; Sung et al., 2005; Guo et al.2007). To test whether SR57227-inducedhyperalgesia and allodynia involve IL-1�,we examined the effect of 5-HT3 receptoractivation on spinal IL-1� expression andfound that spinal delivery of SR57227 (10pmol) but not vehicle induced a signifi-cant increase in IL-1� expression in dorsalhorn cells (Fig. 7A) or in the dorsal horntissues (Fig. 7B; p � 0.05 at 1 and 4 h, p �0.01 at 2 h, vs saline groups, n � 3 pergroup). A similar effect of exogenous frac-talkine (40 ng) on spinal IL-1� expressionwas observed (Fig. 7A). Next, we showed with double labelingthat the IL-1� was mainly expressed in hyperactivated astrocytesimmunoreactive for GFAP but rarely in microglia immunoreac-tive for CD11b in the spinal dorsal horn after injection ofSR57227 (Fig. 7C). We then examined whether IL-1� contributesto behavioral hypersensitivity induced by SR57227. IL-1ra (100�g/10 �l), an IL-1 receptor antagonist, was injected intrathecally1 d before and concurrently with SR57227. The SR57227-induced mechanical allodynia was significantly attenuated bypretreatment with IL-1ra measured at 2 h (Fig. 7D). Thermalhyperalgesia induced by spinal 5-HT3 receptor activation wasalso reversed by intrathecal IL-1ra for 4 h (data not shown; p �0.01 at 1 h or p � 0.05 at 2– 4 h, n � 5 for each group). Todemonstrate a one-way intercellular communication involvingupregulation of IL-1� evoked by spinal microglial and astrocyticactivation, we blocked the microglial receptor CX3CR1 or astro-cytic IL-18 receptors and evaluated their effects on the increased

expression of spinal IL-1� after intrathecal SR57227 or frac-talkine. Western blotting showed that SR57227-induced en-hancement of IL-1� expression in the dorsal horn tissue 2 h afterinjection, when compared with vehicle treatment, was signifi-cantly reduced with pretreatment using the CX3CR1 neutralizingantibody (p � 0.05, n � 3 for each group; Fig. 7E). Meanwhile,fractalkine-induced increase of IL-1� level in the spinal dorsalhorn was partially blocked by pretreatment with IL-18R Ab (p �0.05, n � 3 for each group; Fig. 7F). Thus, these data confirm thatthe enhanced expression of IL-1� in spinal astrocytes was in-duced by hyperactivated microglia and activated IL-18 receptorsin astrocytes in the dorsal horn.

It has been shown that the glutamate receptor subunit GluN(NMDA) receptors (GluNRs) are widely expressed in rat dorsalhorn neurons and are upregulated and phosphorylated in thedorsal horn by locally released proinflammatory cytokines afterinjury, contributing to pain hypersensitivity (Guo et al., 2002,

Figure 6. Astrocytic hyperactivity and upregulation of IL-18R in spinal astrocytes induced by SR57227 and fractalkine. A, IL-18Rexpression in the spinal dorsal horn (a�, b�) and its colocalization (d�) with GFAP (c�) but not with CD11b (e�) or NeuN (f�),suggesting that IL-18R is only expressed in spinal astrocytes of normal rats. Scale bar, 100 �m (a�) and 25 �m (b�–f�). B, SR57227(10 pmol, i.t.) induced a significant enhancement of GFAP expression in spinal dorsal horn tissue at 1 h (*p � 0.05, vs vehicle; n �3 per group), which was suppressed by pretreatment with CX3CR1 Ab (20 �g; n � 3) ( #p � 0.05 vs saline � SR57227). C,Fractalkine (40 ng, i.t.; n � 4)-induced increases of both GFAP (top panels) and IL-18R (bottom panels) expression were signifi-cantly attenuated by pretreatment with CX3CR1 Ab (Ab, 20 �g, i.t.; n � 3) at 1 h after injection of fractalkine. Scale bar, 25 �m.D, Western blot analysis showed a significant increase in the levels of IL-18R and GFAP in the spinal dorsal horn of rats 1 h afterfractalkine treatment (40 ng, i.t.; n � 3) compared with that treated by saline (*p � 0.05, or **p � 0.01; n � 3 for each group);such upregulation for GFAP was significantly reduced by pretreatment with CX3CR1 Ab (20 �g, #p � 0.05, vs saline � fractalkine;n � 3 per group); fractalkine-induced increase of IL-18R expression was also attenuated by CX3CR1 Ab ( #p � 0.05, n � 3) but notreturned to basal expression found in the saline � saline-treated group (*p � 0.05). E, Fractalkine-induced increase of GFAPexpression in the dorsal horn was partially suppressed by pretreatment with IL-18 Ab (20 �g, i.t.) (*p � 0.05, vs saline � saline;# p � 0.05, vs saline � fractalkine; n � 3 for each group). These data suggest that SR57227 or fractalkine-induced upregulationof GFAP is mediated by activation of CX3CR1 expression in spinal microglia and of IL-18R in astrocytes.


RETRACTED

2007; Kawasaki et al., 2008; Zhang et al., 2008). As a possiblemechanism of glial-neuronal interactions, we examined whetherIL-1RI, the receptor for IL-1�, was distributed in dorsal hornneurons containing GluNRs. Double labeling showed that IL1RIcolocalized with the GluN1R subunit, a principal component ofGluNRs in rat dorsal horn neurons (Fig. 8A). To test whetherspinal 5-HT3 receptor activation also induced GluNR activation,the phosphorylation levels of GluN1R (pGluN1R), a functionalmarker of neuronal excitability in the CNS, were measured inspinal dorsal horn tissues. As shown in Figure 8B, the expression ofpGluN1R ser896 in the spinal dorsal horn was robustly increased by

threefold at 2 h after intrathecal injection ofSR57227 (10 pmol) when compared withthe sham group (p � 0.001, n � 3 eachgroup). Moreover, SR57227-induced in-crease of the pGluN1R expression was sig-nificantly attenuated by pretreatment withthe neutralizing antibodies for CX3CR1, IL-18R, or IL1RI (p � 0.001; Fig. 8B), Mean-while, these pretreatments alone had noeffect on baseline expression of pGluN1 inthe spinal dorsal horn (Fig. 8B). These find-ings confirm that the increase of pGluN1observed above was mediated mainly byfractalkine to CX3CR1, IL-18 to IL-18R,and IL-1� to IL1RI signaling pathways,suggesting that spinal 5-HT3 receptor-mediated hyperalgesia and allodynia in ratprimarily depend on a neuron-microglia-astrocyte-neuronal signal cascade.

Descending 5-HT and spinal 5-HT3

receptors involved in dorsal horn glialhyperactivity underlying descendingpain facilitation and inflammatory painEarlier studies indicated that low or highintensity of electrical stimulation (ES) inthe RVM produced temporary descend-ing facilitation or inhibition in behavioralnociceptive tests, respectively, and in-creased spinal 5-HT release in some cases(Yaksh and Wilson, 1979; Hammond andYaksh, 1984; Hammond et al., 1985; Zhuoand Gebhart, 1991). We questionedwhether this focal ES evoked spinal glialhyperactivity by activation of RVM-spinalprojection neurons in naive animals. Totest this possibility, we performed West-ern blot to examine CD11b and GFAP ex-pressions in the spinal dorsal horn at 30min after intra-RVM ES, a time point thathas previously been shown to increase tri-geminal GFAP following ES of the masse-teric nerve (Wang et al., 2010). A low (10�A for 15 min) intensity of ES in the RVMinduced a significant increase in GFAP ex-pression [185.0 � 9.7%, p � 0.05 vs shamgroup (103.3 � 10%)] but not CD11b ex-pression [110.7 � 12.0%, p � 0.05 vssham group (89.5 � 14.4%)] in the spinaldorsal horn (n � 3 for each group). Incontrast, a higher (100 �A) intensity of ESin the RVM produced enhancement of

spinal CD11b (207.7 � 19.1%, p � 0.05 vs sham group) but notGFAP expression (110.7 � 11.6%, p � 0.05 vs sham group) (n �3 for each group). These data suggest that transient activation ofglobal RVM neurons by ES produces rapid spinal glial hyperac-tivity, which may reflect the functional impact of glial changes onmechanisms of descending pain modulation during the ES, in-cluding pain facilitation in naive animals.

In previous studies, we demonstrated that the BDNF receptorTrkB predominately existed in RVM 5-HT-containing neuronsprojecting to the spinal dorsal horn (Guo et al., 2006) and thatintra-RVM injection of BDNF (100 fmol) produced mild hyper-

Figure 7. Upregulation of IL-1� in the dorsal horn astrocytes and its involvement in pain behavior after intrathecal injection ofSR57227. A, SR57227 (10 pmol, i.t., n � 4) or fractalkine (40 ng, i.t., n � 4) produced an increased expression of IL-1� (bottompanels) in the area from the inset in the spinal dorsal horn (top panels) compared to saline at 2 or 1 h after injection, respectively.Scale bar, 100 �m (top panels) and 25 �m (bottom panels). B, Western blot analysis showed increases in the levels of IL-1� in thespinal dorsal horn tissue of rats treated with SR57227 (10 ng, i.t., *p � 0.05 at 1 and 4 h, **p � 0.01 at 2 h, vs saline; n � 3 pergroup). C, Dense colocalization of IL-1� and GFAP (bottom panels) but not CD11b in glial cells (top panels) in the spinal dorsal hornin rats treated with SR57227 (10 pmol, i.t., n � 3) at 2 h after injection, suggesting that IL-1� was predominantly expressed inspinal astrocytes. Scale bar, 25 �m. D, SR57227 (10 pmol, i.t.)-induced mechanical hypersensitivity was attenuated 2 h after theinjection by the antagonist of IL-1 receptor, IL1-ra (10 �g, i.t.) 1 d before and concurrently with SR57227 (***p � 0.001, saline �SR57227 vs saline �saline; #p � 0.05, IL1-ra � SR57227 vs saline � SR57227; n � 5 per group). E, SR57227 (10 ng, i.t.)significantly induced upregulation of IL-1� at 2 h after injection (**p � 0.01, vs saline � saline), which was attenuated bypretreatment with CX3CR1 Ab (20 �g, i.t.) ( #p � 0.05, vs saline � SR57227) (n � 3 per group). F, Intrathecal fractalkine (40 ng)also resulted in a significant increase of IL-1� expression in the dorsal horn at 1 h after injection (**p � 0.01, vs saline � saline),which was partially suppressed by IL-18R Ab pretreatment (20 �g, i.t., #p � 0.05, vs saline � SR57227; *p � 0.01, vs saline �saline) (n � 3 per group).


RETRACTED

algesia and allodynia for 1 d, which wasdependent on descending 5-HT systemsfrom the RVM (Guo et al., 2006; Wei et al.,2010). In the present study, intrathecalY25130 significantly attenuated BDNF-induced behavioral hypersensitivity, fur-ther suggesting that BDNF may inducedescending pain facilitation by evokingdescending 5-HT release and the conse-quent activation of spinal 5-HT3 receptors.To examine the effects of long-lasting activedescending pain facilitation on spinal glialchanges and mimic glial hyperactivity medi-ated by the activation of spinal 5-HT3 recep-tors after intrathecal application of the5-HT3 receptor agonist, we examinedwhether endogenous 5-HT released fromRVM-spinal projection neurons after BDNFinjection produces spinal 5-HT3 receptor-mediated glial hyperactivity. As shown inFigure 9A, intra-RVM BDNF (100 fmol) in-duced increases of spinal CD11b expressionat 6 and 24 h and GFAP expression only at24 h after microinjection when compared tovehicle treatment (p � 0.05, n � 3 for eachgroup) that were completely eliminated bypretreatment with intrathecal application ofY25130 (30 fmol, n � 3 for each group).Coinciding with the behavioral observationin Figure 1, C and D, these data suggest thatspinal 5-HT3 receptor-dependent glial hy-peractivity is involved in molecular andcellular mechanisms responsible for intra-RVM BDNF-induced long-lasting descending pain facilitation.

Recently, It has been well recognized that microglial hyperac-tivity and astrocytic hyperactivity in the dorsal horn play a criticalrole in the development of inflammatory pain after tissue injury(for review, see Milligan and Watkins, 2009; Gao and Ji, 2010;Ren and Dubner, 2008, 2010). We previously found that theRVM-spinal 5-HT system is also implicated in descending painfacilitation involved in central mechanisms of persistent pain af-ter peripheral inflammation (Wei et al., 2010). To confirm theeffect of the descending 5-HT system on glial hyperactivity toperipheral inflammation in rats with persistent pain, we exam-ined changes of spinal glial markers in a model of inflammatorypain induced by intraplantar injection of CFA from 3 d aftermolecular depletion of the intra-RVM 5-HT system manipulatedby local gene transfer of Tph-2 shRNA as shown previously (Weiet al., 2010). In the control shRNA-treated rats, Western blotshowed that there were robust increases of CD11b and GFAPexpression in the spinal dorsal horn at 1 d after unilateral intra-plantar CFA injection, compared with that in the saline group(p � 0.01, n � 3 for each group, Fig. 9B). However, Tph-2shRNA-treated animals exhibited significant attenuation ofCD11b and GFAP expression after CFA injection as compared torats treated with control shRNA (p � 0.05, n � 3 for each group;Fig. 9B), suggesting that active 5-HT-dependent descending painfacilitation contributes to the maintenance of spinal glial hyper-activity underlying the development of inflammatory pain afterinjury. Thus, the spinal glial changes appear to be involved in thedescending facilitation underlying the maintenance of persistentpain via descending 5-HT release and spinal 5-HT3 receptor ac-tivation after injury.

DiscussionOur findings demonstrate that a neuronal-glial-cytokine-neu-ronal signaling cascade is involved in the mechanisms underlyingspinal 5-HT3 receptor-mediated hyperalgesia. The developmentof persistent pain after inflammation and nerve injury appears tobe dependent, in part, upon 5-HT pathways originating from therostral ventromedial medulla leading to activation of 5-HT3 re-ceptors at the spinal level (Suzuki et al., 2002; Lopez-Garcia, 2006;Rahman et al., 2006; Lagraize et al., 2010; Wei et al., 2010). Con-sistent with these views and a recent study (Dogrul et al., 2009),our data showed that blockade of spinal 5-HT3 receptor functionby intrathecal Y25130, a selective 5-HT3 receptor antagonist, at-tenuated mechanical and thermal hypersensitivity following L5SNL in rats. Interestingly, recent studies reported that intrathecalinjection of 5-HT3 receptor antagonists such as CGP35348 (Oka-zaki et al., 2008) or ondansetron (Peters et al., 2010) had nopreventive effects on mechanical allodynia and/or thermal hyper-algesia in a rat with L5-L6 SNL, which conflicts with the studywith the same drug, ondansetron, in the same SNL model (Do-grul et al., 2009) and with our results. However, we noticed thatthere were no expected plastic changes of both 5-HT immunore-active intensity and 5-HT3 receptor innervation in the lumbarspinal dorsal horn at 14 d after L5/L6 SNL in the study reportedby Peters et al. (2010). In contrast, we found a robust increase oftissue Tph-2 level in the RVM (Wei et al., 2010) at 14 d and aprogressive enhancement of tissue 5-HT3 receptor expression inthe spinal dorsal horn from 1 to 28 d following L5 SNL whencompared with that in the sham group (our unpublished obser-vations). We suspect that the discrepancies between our positivefindings and those reported by Peters et al. (2010) are due to the

Figure 8. Coexpression for IL-1RI and GluNR subunit GluN1R in the dorsal horn (A) and SR57227-induced upregulation ofGluN1R phosphorylation (pGluN1R) (B). A, Immunoreactivity of IL-1RI, the receptor of IL-1� was colocalized with the GluN1R inthe spinal dorsal horn neurons. Enlarged regions (the three right panels) correspond to the rectangle area in the left panel. Scalebar, 50 �m (the left panel) and 25 �m (the three right panels). B, Western blot illustrating a significant increase in the levels ofp-GluN1R in the spinal dorsal horn tissue of rats treated with SR57227 (10 pmol, i.t.; ***p � 0.001; n � 3) when compared withsaline group (n � 3) at 2 h after injection. The upregulation of spinal pGluN1 was significantly attenuated by neutralization ofendogenous fractalkine or IL-18 or inhibition of IL-1� when pretreated with CX3CR1 Ab (20 �g, i.t.; n � 3), IL-18R Ab (20 �g, i.t.;n � 3), or IL-1ra (10 �g, i.t.; n � 3) ( ####p � 0.001 vs saline � SR57227; but *p � 0.05 or **p � 0.01, vs saline � saline),respectively. These pretreatments alone did not affect baseline expression of pGluN1 in the spinal dorsal horn (p � 0.05 vs saline� saline; n � 3 per group).


RETRACTED

utilization of different neuropathic pain models and different5-HT3 receptor antagonists, as well as the absence of the morequantitative measures used for the 5-HT3 receptor expressionand of more time points measured after injury in their study. Inthe present study, our data indicate that the effective dose ofintrathecal Y25130 for attenuation of behavioral hypersensitivityfollowing SNL did not alter thermal and mechanical thresholds inthe sham animals at 14 d after surgery. Thus, we propose thatincreased descending 5-HT drive and spinal 5-HT3 receptor ex-pression after tissue and nerve injury contribute to maintenanceof central sensitization, including glial hyperactivity and neuro-nal hyperexcitability at the spinal level underlying the develop-ment of persistent pain.

We have determined that a number ofchemical mediators contribute to the spi-nal 5-HT3 receptor-induced novel spinalsignaling cascade, including the chemo-kine fractalkine released from 5-HT3

receptor-containing neurons, cytokineIL-18 released from microglia, IL-1� re-leased mainly from astrocytes, enhancedphosphorylation of spinal NMDA recep-tors, and ultimately behavioral hyperalge-sia. Moreover, the mechanisms by whichthese events are sequentially activatedthrough multiple signaling cascades tolink neuron-microglia-astrocyte-neuronalinteractions (Fig. 9C) is unexpected andnovel and highlights how cellular circuitryand molecular signaling interact in thespinal dorsal horn response to 5-HT3 re-ceptor activation. The findings indicatethat spinal hyperexcitability or centralsensitization underlying the developmentof hyperalgesia not only depends on theinitiation of nociceptive input from pri-mary afferents after tissue and nerve in-jury (Guo et al., 2007; Wang et al., 2010),but also requires the maintenance ofdescending facilitation from the raphe5-HT-spinal 5-HT3 receptor systems. Ourstudy supports the growing evidence thatspinal 5-HT3 receptors play a crucial rolein cellular and molecular mechanisms inthe development and maintenance of per-sistent pain states.

Our results demonstrate that there areat least three active signaling cascades ob-served, including fractalkine and its re-ceptor CX3CR1 for mediating spinalneuron-to-microglia signaling, IL-18 andits receptor for microglia-to astrocyte sig-naling, and IL-1� and its receptor forastrocyte-to-neuron signaling, as impor-tant components involved in the func-tional intercellular transduction in thedorsal horn after 5-HT3 receptor activa-tion. These findings do not rule out therole of other chemical mediators releasedfrom the same neurons or of differentsubpopulations of neurons (excitatory orinhibitory neurons) or glial cells in theregulation of spinal nociceptive processes.

It has been reported that some central terminals of primary afferentsexpress 5-HT3 receptors (Kia et al., 1995; Conte et al., 2005). Intra-thecal injection of 5-HT3 receptor agonists may excite these centralterminals to release fractalkine, glutamate, and ATP, directly activateglial cells, and even directly enhance NMDA receptor function indorsal horn neurons. Although these findings suggest other signal-ing cascades, the accumulating data in the present study suggest thatspinal neuron-glia-neuronal interaction may be particularly impor-tant in the 5-HT3 receptor-mediated central sensitization associatedwith intra-RVM 5-HT-dependent descending pain facilitation.Structural and functional plasticity of 5-HT3 receptors in spinal dor-sal horn interneurons could occur after tissue and nerve injury. Infact, we recently found an increase of 5-HT3 receptor protein levels

Figure 9. Intra-RVM BDNF-induced in vivo increase of spinal CD11b and GFAP expressions (A) and an attenuation of hindpawCFA-evoked spinal glial hyperactivity by molecular depletion of descending 5-HT in the RVM (B). A, Exogenous BDNF (100 fmol;n�3 for each group) in the RVM induced significant enhancement of CD11b expression at 6 h (gray bars) and 24 h (black bars) aftermicroinjection and a robust expression of GFAP at 24 h in the spinal dorsal horn when compared with vehicle group (*p � 0.05;n � 3). Pretreatment of Y25130 (30 fmol, i.t.) completely prevented the effects of BDNF on spinal CD11b and GFAP expression,suggesting that spinal 5-HT3R activation mediates spinal glial hyperactivity induced by intra-RVM BDNF-evoked descendingfacilitation. B, Peripheral inflammation resulted in significant increases of CD11b and GFAP in the spinal dorsal horn after unilateralhindpaw injection of CFA in rats treated with control or Tph-2 shRNA in the RVM (*p � 0.05 or **p � 0.01, vs saline group);however, intra-RVM Tph-2 shRNA reduced CFA-produced increases of spinal CD11b and GFAP expression in comparison withcontrol Tph-2 shRNA ( #p � 0.05) (n � 3 for each group). Treatment with Tph-2 shRNA alone in the RVM did not affect basalexpression of spinal CD11b and GFAP when compared to control shRNA. C, Proposed signal pathways involved in pain hypersen-sitivity after 5-HT3 receptor activation in the spinal cord. Some excitatory spinal neurons and primary afferent terminals expressing5-HT3 receptors are activated by the 5-HT3R agonist SR57227. Fractalkine is released from the 5-HT3R-containing neurons orsensory afferents, and then acts on its receptor CX3CR1, which is mainly expressed in microglia. Hyperactivity of microglia conse-quently evokes astrocytes nearby through an IL-18/IL-18R signal cascade and results in astrocytic release of IL-1�. The releasedIL-1� contributes to neuronal hyperexcitability and behavioral pain hypersensitivity via IL-1� receptors (IL-1RI) and enhance-ment of pGluN1R on spinal dorsal horn neurons.


RETRACTED

in the dorsal horn from 1 to 28 d after SNL (our unpublished obser-vations). Although we did not verify whether primary afferent ter-minals contributed to these receptor changes, recent evidenceindicates that there are no changes of 5-HT3 receptor mRNA expres-sion in the rat dorsal root ganglia after osteoarthritis (Rahman et al.,2009). Thus, upregulation of 5-HT3 receptor expression in dorsalhorn neurons following enhanced descending 5-HT drive afternerve injury may play an important role in glial hyperactivity in-volved in the maintenance of persistent pain.

Although spinal glial hyperactivity has been reported in acuteand persistent pain models (Colburn et al., 1997; Watkins et al.,2001; Scholz and Woolf, 2007; Ren and Dubner, 2008, 2010), fewstudies have investigated the involvement of spinal 5-HT3 recep-tors in spinal glial hyperactivity. In the present study, intrathecalinjection of the selective activation of spinal 5-HT3 receptors byintrathecal injection of the receptor agonist or enhanced de-scending pain facilitation by intra-RVM BDNF administrationinduced significant upregulation of GFAP and CD11b. Moleculardepletion of the descending 5-HT system significantly attenuatedperipheral inflammation-produced glial hyperactivity in the spi-nal dorsal horn. These data provide the first evidence that eitherexogenous or endogenous activation of the 5-HT3 receptor re-sults in spinal glial hyperactivity. Moreover, we were interested inthe mechanisms by which quiescent spinal glia alter their func-tion in response to 5-HT3 receptor activation. Recent studieshave demonstrated special expression patterns for chemokines,cytokines, and their receptors in spinal cord cells. For example,fractalkine exists in spinal neurons (Imai et al., 1997; Verge et al.,2004), and its receptor CX3CR1 is selectively expressed in micro-glia (Verge et al., 2004; Lindia et al., 2005). IL-18 and its receptorare present in spinal microglia and astrocytes, respectively (Mi-yoshi et al., 2008). Consistent with our previous study on theRVM (Guo et al., 2007; Wei et al., 2008), we found that IL-1� ismainly expressed in astrocytes but not in microglia in the spinaldorsal horn. Its receptor IL-1RI is present in dorsal horn neuronsexpressing GluNRs. These proteins have been demonstrated toplay a role in spinal nociceptive modulation and the developmentof persistent pain after injury (Scholz and Woolf, 2007; Ren andDubner, 2008, 2010; Milligan and Watkins, 2009). However, pre-vious studies have not shown a relationship between these pro-teins and 5-HT3 receptor activation in the spinal cord. Inaddition, extending our recent findings (Guo et al., 2007; Wei etal., 2008, 2010), we showed the colocalization of IL-1RI with theGluNR subunit GluN1R in dorsal horn neurons and with IL-1RI-mediated facilitation of GluN1R phosphorylation after 5-HT3

receptor activation. Thus, the IL-1�-mediated amplified signal-ing from spinal astrocytes further enhances neuronal excitabilitythrough signaling coupling with GluNRs in the spinal cord,which plays an important role in neuronal hypersensitivity. Ourfindings also suggest that activation of the spinal 5-HT3 receptoris sufficient to induce glial hyperactivity and cytokine release,which are necessary for neuronal and behavioral hypersensitivityafter 5-HT3 receptor activation. The activated glia-mediated pos-itive signaling amplification then sensitizes spinal nociceptiveneurons, leading to further neuronal activation and behavioralhyperalgesia. These findings offer new insights into the cellularand molecular mechanisms in the spinal level responsible fordescending pain facilitation during the development of persistentpain after tissue and nerve injury.

In the present study, we directly activated the spinal 5-HT3

receptor to mimic 5-HT release through descending pain facili-tation pathways (Wei et al., 2010). We found that intrathecalinjection of 10 pmol of the 5-HT3 receptor agonist SR57227 pro-

duced thermal hypersensitivity that lasted for 4 h. This observa-tion provides direct evidence that the spinal 5-HT3 receptor playsa role in pain facilitation. Activation of 5-HT3 receptors in thespinal cord by 5-HT is mediated by the descending excitatorydrive from the RVM to the spinal cord (Suzuki et al., 2002; La-graize et al., 2010). Consistent with studies with another 5-HT3

receptor agonist, 2-Me-5H (Alhaider et al., 1991; Jeong et al.,2004), we found that intrathecal injection of higher doses ofSR57227 (10 nmol) induced transient analgesia. The differentdoses used in our experiments may reflect different mechanismsthat depend on specific cellular circuits or the particular proteinsinvolved. It has been shown that 5-HT3 receptors are predomi-nantly localized in terminals of excitatory axons in the rat super-ficial dorsal horn, and some of these originate from dorsal hornneurons (Kia et al., 1995; Morales et al., 1998; Zeitz et al., 2002;Conte et al., 2005), Although cell bodies expressing these recep-tors in the dorsal horn are further identified as excitatory neurons(Tecott et al., 1993; Morales et al., 1998), some 5-HT3 receptor-labeled neurons in rat dorsal horn express glutamate decarboxyl-ase (GAD), a marker for GABAergic neurons (Conte et al., 2005).Recent studies have demonstrated in the mouse that some dorsalhorn neurons sensitive to 5-HT3 receptor agonists were GADpositive (Fukushima et al., 2009) and that some 5-HT3 receptormRNA-containing dorsal horn neurons were GAD positive(Huang et al., 2008). Thus, 5-HT3 receptors appear to be ex-pressed in both excitatory and inhibitory intrinsic neurons andterminals in the spinal dorsal horn. Synaptic plasticity of 5-HT3

receptor expression and function in the spinal dorsal horn neu-rons and the terminals of primary afferent fibers during the de-velopment of persistent pain after injury needs to be furtherinvestigated.

ReferencesAira Z, Buesa I, Salgueiro M, Bilbao J, Aguilera L, Zimmermann M, Azkue JJ

(2010) Subtype-specific changes in 5-HT receptor-mediated modulationof C fibre-evoked spinal field potentials are triggered by peripheral nerveinjury. Neuroscience 168:831– 841.

Alhaider AA, Lei SZ, Wilcox GL (1991) Spinal 5-HT3 receptor-mediatedantinociception: possible release of GABA. J Neurosci 11:1881–1888.

Bazan JF, Bacon KB, Hardiman G, Wang W, Soo K, Rossi D, Greaves DR,Zlotnik A, Schall TJ (1997) A new class of membrane-bound chemokinewith a CX3C motif. Nature 385:640 – 644.

Burgess SE, Gardell LR, Ossipov MH, Malan TP Jr, Vanderah TW, Lai J,Porreca F (2002) Time-dependent descending facilitation from the ros-tral ventromedial medulla maintains, but does not initiate, neuropathicpain. J Neurosci 22:5129 –5136.

Clark AK, Yip PK, Malcangio M (2009) The liberation of fractalkine in thedorsal horn requires microglial cathepsin S. J Neurosci 29:6945– 6954.

Colburn RW, DeLeo JA, Rickman AJ, Yeager MP, Kwon P, Hickey WF(1997) Dissociation of microglial activation and neuropathic pain be-haviors following peripheral nerve injury in the rat. J Neuroimmunol79:163–175.

Conte D, Legg ED, McCourt AC, Silajdzic E, Nagy GG, Maxwell DJ (2005)Transmitter content, origins and connections of axons in the spinal cordthat possess the serotonin (5-hydroxytryptamine) 3 receptor. Neurosci-ence 134:165–173.

DeLeo JA, Yezierski RP (2001) The role of neuroinflammation and neuro-immune activation in persistent pain. Pain 90:1– 6.

Dogrul A, Ossipov MH, Porreca F (2009) Differential mediation of de-scending pain facilitation and inhibition by spinal 5HT-3 and 5HT-7receptors. Brain Res 1280:52–59.

Fields HL, Heinricher MM, Mason P (1991) Neurotransmitters in nocicep-tive modulatory circuits. Annu Rev Neurosci 14:219 –245.

Fukushima T, Ohtsubo T, Tsuda M, Yanagawa Y, Hori Y (2009) Facilitatoryactions of serotonin type 3 receptors on GABAergic inhibitory synaptictransmission in the spinal superficial dorsal horn. J Neurophysiol102:1459 –1471.


RETRACTED

Gao YJ, Ji RR (2010) Targeting astrocyte signaling for chronic pain. Neuro-therapeutics 7:482– 493.

Gebhart GF (2004) Descending modulation of pain. Neurosci Biobehav Rev27:729 –737.

Geranton SM, Fratto V, Tochiki KK, Hunt SP (2008) Descending seroto-nergic controls regulate inflammation-induced mechanical sensitivityand methyl-CpG-binding protein 2 phosphorylation in the rat superficialdorsal horn. Mol Pain 4:35.

Guo W, Zou S, Guan Y, Ikeda T, Tal M, Dubner R, Ren K (2002) Tyrosinephosphorylation of the NR2B subunit of the NMDA receptor in the spinalcord during the development and maintenance of inflammatory hyper-algesia. J Neurosci 22:6208 – 6217.

Guo W, Robbins MT, Wei F, Zou S, Dubner R, Ren K (2006) Supraspinalbrain-derived neurotrophic factor signaling: a novel mechanism for painfacilitation. J Neurosci 26:126 –137.

Guo W, Wang H, Watanabe M, Shimizu K, Zou S, LaGraize SC, Wei F,Dubner R, Ren K (2007) Glial-cytokine-neuronal interactions underly-ing the mechanisms of persistent pain. J Neurosci 27:6006 – 6018.

Hammond DL, Yaksh TL (1984) Antagonism of stimulation-produced an-tinociception by intrathecal administration of methysergide or phentol-amine. Brain Res 298:329 –337.

Hammond DL, Tyce GM, Yaksh TL (1985) Efflux of 5-hydroxytryptamineand noradrenaline into spinal cord superfusates during stimulation of therat medulla. J Physiol 359:151–162.

Hamon M, Bourgoin S (1999) Serotonin and its receptors in pain control.In: Novel aspects of pain management: opioids and beyond (Sawynok J,Cowan A, eds), pp 203–228. New York: Wiley.

Hansson E, Ronnback L (2004) Altered neuronal-glial signaling in glutama-tergic transmission as a unifying mechanism in chronic pain and mentalfatigue. Neurochem Res 29:989 –996.

Huang J, Wang YY, Wang W, Li YQ, Tamamaki N, Wu SX (2008)5-HT(3A) receptor subunit is expressed in a subpopulation of GABAergicand enkephalinergic neurons in the mouse dorsal spinal cord. NeurosciLett 441:1– 6.

Hylden JL, Wilcox GL (1980) Intrathecal morphine in mice: a new tech-nique. Eur J Pharmacol 67:313–316.

Imai T, Hieshima K, Haskell C, Baba M, Nagira M, Nishimura M, Kakizaki M,Takagi S, Nomiyama H, Schall TJ, Yoshie O (1997) Identification andmolecular characterization of fractalkine receptor CX3CR1, which medi-ates both leukocyte migration and adhesion. Cell 91:521–530.

Jeong CY, Choi JI, Yoon MH (2004) Roles of serotonin receptor subtypesfor the antinociception of 5-HT in the spinal cord of rats. Eur J Pharmacol502:205–211.

Kawasaki Y, Zhang L, Cheng JK, Ji RR (2008) Cytokine mechanisms of cen-tral sensitization: distinct and overlapping role of interleukin-1beta,interleukin-6, and tumor necrosis factor-alpha in regulating synaptic andneuronal activity in the superficial spinal cord. J Neurosci 28:5189 –5194.

Kia HK, Miquel MC, McKernan RM, Laporte AM, Lombard MC, Bourgoin S,Hamon M, Verge D (1995) Localization of 5-HT3 receptors in the ratspinal cord: immunohistochemistry and in situ hybridization. Neurore-port 6:257–261.

Lagraize SC, Guo W, Yang K, Wei F, Ren K, Dubner R (2010) Spinal cordmechanisms mediating behavioral hyperalgesia induced by neurokinin-1tachykinin receptor activation in the rostral ventromedial medulla. Neu-roscience 171:1341–1356.

Lindia JA, McGowan E, Jochnowitz N, Abbadie C (2005) Induction ofCX3CL1 expression in astrocytes and CX3CR1 in microglia in the spinalcord of a rat model of neuropathic pain. J Pain 6:434 – 438.

Lopez-Garcia JA (2006) Serotonergic modulation of spinal sensory circuits.Curr Top Med Chem 6:1987–1996.

Michael GJ, Averill S, Nitkunan A, Rattray M, Bennett DL, Yan Q, Priestley JV(1997) Nerve growth factor treatment increases brain-derived neu-rotrophic factor selectively in TrkA-expressing dorsal root ganglion cellsand in their central terminations within the spinal cord. J Neurosci17:8476 – 8490.

Millan MJ (2002) Descending control of pain. Prog Neurobiol 66:355– 474.Milligan ED, Watkins LR (2009) Pathological and protective roles of glia in

chronic pain. Nat Rev Neurosci 10:23–36.Milligan ED, Zapata V, Chacur M, Schoeniger D, Biedenkapp J, O’Connor

KA, Verge GM, Chapman G, Green P, Foster AC, Naeve GS, Maier SF,Watkins LR (2004) Evidence that exogenous and endogenous frac-

talkine can induce spinal nociceptive facilitation in rats. Eur J Neurosci20:2294 –2302.

Milligan ED, Sloane EM, Watkins LR (2008) Glia in pathological pain: a rolefor fractalkine. J Neuroimmunol 198:113–120.

Miyoshi K, Obata K, Kondo T, Okamura H, Noguchi K (2008) Interleukin-18-mediated microglia/astrocyte interaction in the spinal cord enhancesneuropathic pain processing after nerve injury. J Neurosci 28:12775–12787.

Morales M, Battenberg E, Bloom FE (1998) Distribution of neurons ex-pressing immunoreactivity for the 5HT3 receptor subtype in the rat brainand spinal cord. J Comp Neurol 402:385– 401.

Okazaki R, Namba H, Yoshida H, Okai H, Miura T, Kawamura M (2008)The antiallodynic effect of Neurotropin is mediated via activation of de-scending pain inhibitory systems in rats with spinal nerve ligation. AnesthAnalg 107:1064 –1069.

Paxinos G, Watson C (2005) The rat brain in stereotaxic coordinates. Am-sterdam: Elsevier.

Pertovaara A (2000) Plasticity in descending pain modulatory systems. ProgBrain Res 129:231–242.

Pertovaara A, Wei H, Hamalainen MM (1996) Lidocaine in the rostroven-tromedial medulla and the periaqueductal gray attenuates allodynia inneuropathic rats. Neurosci Lett 218:127–130.

Peters CM, Hayashida K, Ewan EE, Nakajima K, Obata H, Xu Q, Yaksh TL,Eisenach JC (2010) Lack of analgesic efficacy of spinal ondansetron onthermal and mechanical hypersensitivity following spinal nerve ligationin the rat. Brain Res 1352:83–93.

Porreca F, Ossipov MH, Gebhart GF (2002) Chronic pain and medullarydescending facilitation. Trends Neurosci 25:319 –325.

Raghavendra V, Tanga F, Rutkowski MD, DeLeo JA (2003) Anti-hyperalgesicand morphine-sparing actions of propentofylline following peripheral nerveinjury in rats: mechanistic implications of spinal glia and proinflammatorycytokines. Pain 104:655–664.

Rahman W, Suzuki R, Webber M, Hunt SP, Dickenson AH (2006) Deple-tion of endogenous spinal 5-HT attenuates the behavioural hypersensi-tivity to mechanical and cooling stimuli induced by spinal nerve ligation.Pain 123:264 –274.

Rahman W, Bauer CS, Bannister K, Vonsy JL, Dolphin AC, Dickenson AH(2009) Descending serotonergic facilitation and the antinociceptive ef-fects of pregabalin in a rat model of osteoarthritic pain. Mol Pain 5:45.

Reeve AJ, Patel S, Fox A, Walker K, Urban L (2000) Intrathecally adminis-tered endotoxin or cytokines produce allodynia, hyperalgesia and changesin spinal cord neuronal responses to nociceptive stimuli in the rat. Eur JPain 4:247–257.

Ren K, Dubner R (2007) Pain facilitation and activity-dependent plasticityin pain modulatory circuitry: role of BDNF-TrkB signaling and NMDAreceptors. Mol Neurobiol 35:224 –235.

Ren K, Dubner R (2008) Neuron-glia crosstalk gets serious: role in painhypersensitivity. Curr Opin Anaesthesiol 21:570 –579.

Ren K, Dubner R (2010) Interactions between the immune and nervoussystems in pain. Nat Med 16:1267–1276.

Roberts MH (1984) 5-Hydroxytryptamine and antinociception. Neuro-pharmacology 23:1529 –1536.

Sawynok J, Reid A (1996) Interactions of descending serotonergic systemswith other neurotransmitters in the modulation of nociception. BehavBrain Res 73:63– 68.

Scholz J, Woolf CJ (2007) The neuropathic pain triad: neurons, immunecells and glia. Nat Neurosci 10:1361–1368.

Staniland AA, Clark AK, Wodarski R, Sasso O, Maione F, D’Acquisto F,Malcangio M (2010) Reduced inflammatory and neuropathic pain anddecreased spinal microglial response in fractalkine receptor (CX3CR1)knockout mice. J Neurochem 114:1143–1157.

Sung CS, Wen ZH, Chang WK, Chan KH, Ho ST, Tsai SK, Chang YC, WongCS (2005) Inhibition of p38 mitogen-activated protein kinase attenu-ates interleukin-1beta-induced thermal hyperalgesia and inducible nitricoxide synthase expression in the spinal cord. J Neurochem 94:742–752.

Suzuki R, Morcuende S, Webber M, Hunt SP, Dickenson AH (2002) Super-ficial NK1-expressing neurons control spinal excitability through activa-tion of descending pathways. Nat Neurosci 5:1319 –1326.

Tecott L.H, Maricq AV, Julius D (1993) Nervous system distribution ofthe serotonin 5-HT3 receptor mRNA. Proc Natl Acad Sci U S A90:1430 –1444.

Urban MO, Zahn PK, Gebhart GF (1999) Descending facilitatory influences


RETRACTED

from the rostral medial medulla mediate secondary, but not primaryhyperalgesia in the rat. Neuroscience 90:349 –352.

Verge GM, Milligan ED, Maier SF, Watkins LR, Naeve GS, Foster AC (2004)Fractalkine (CX3CL1) and fractalkine receptor (CX3CR1) distribution inspinal cord and dorsal root ganglia under basal and neuropathic painconditions. Eur J Neurosci 20:1150 –1160.

Wang H, Guo W, Yang K, Wei F, Dubner R, Ren K (2010) Contribution ofprimary afferent input to trigeminal astroglial hyperactivity, cytokine induc-tion and NMDA receptor phosphorylation. Open Pain J 2010:144–152.

Watkins LR, Milligan ED, Maier SF (2001) Glial activation: a driving forcefor pathological pain. Trends Neurosci 24:450 – 455.

Wei F, Dubner R, Ren K (1999) Nucleus reticularis gigantocellularis andnucleus raphe magnus in the brain stem exert opposite effects on behav-ioral hyperalgesia and spinal Fos protein expression after peripheral in-flammation. Pain 80:127–141.

Wei F, Guo W, Zou S, Ren K, Dubner R (2008) Supraspinal glial-neuronalinteractions contribute to descending pain facilitation. J Neurosci28:10482–10495.

Wei F, Dubner R, Zou S, Ren K, Bai G, Wei D, Guo W (2010) Moleculardepletion of descending serotonin unmasks its novel facilitatory role inthe development of persistent pain. J Neurosci 30:8624 – 8636.

Yaksh TL, Wilson PR (1979) Spinal serotonin terminal system mediates an-tinociception. J Pharmacol Exp Ther 208:446 – 453.

Zeitz KP, Guy N, Malmberg AB, Dirajlal S, Martin WJ, Sun L, BonhausDW, Stucky CL, Julius D, Basbaum AI (2002) The 5-HT3 subtype ofserotonin receptor contributes to nociceptive processing via a novelsubset of myelinated and unmyelinated nociceptors. J Neurosci22:1010 –1019.

Zhang RX, Liu B, Li A, Wang L, Ren K, Qiao JT, Berman BM, Lao L (2008)Interleukin 1beta facilitates bone cancer pain in rats by enhancingNMDA receptor NR-1 subunit phosphorylation. Neuroscience 154:1533–1538.

Zhuo M, Gebhart GF (1991) Spinal serotonin receptors mediate de-scending facilitation of a nociceptive reflex from the nuclei reticularisgigantocellularis and gigantocellularis pars alpha in the rat. Brain Res550:35– 48.


RETRACTED

behavioral/systems/cognitive spinal5-ht3 ... · intrathecal injection and termination of...

Documents