Cell Signaling & Molecular Targets in Cancer

Malay Chatterjee • Khosrow Kashfi Editors

Cell Signaling & Molecular Targets in Cancer

EditorsMalay ChatterjeeDepartment of Pharmaceutical TechnologyJadavpur UniversityKolkata, Indiamcbiochem@yahoo.com

Khosrow Kashfi Department of Physiology and PharmacologyCity University of New York Medical SchoolNew York, USAkashfi @med.cuny.edu

ISBN 978-1-4614-0729-4 e-ISBN 978-1-4614-0730-0DOI 10.1007/978-1-4614-0730-0Springer New York Dordrecht Heidelberg London

Library of Congress Control Number: 2011940810

© Springer Science+Business Media, LLC 2012All rights reserved. This work may not be translated or copied in whole or in part without the written permission of the publisher (Springer Science+Business Media, LLC, 233 Spring Street, New York, NY 10013, USA), except for brief excerpts in connection with reviews or scholarly analysis. Use in connection with any form of information storage and retrieval, electronic adaptation, computer software, or by similar or dissimilar methodology now known or hereafter developed is forbidden.The use in this publication of trade names, trademarks, service marks, and similar terms, even if they are not identifi ed as such, is not to be taken as an expression of opinion as to whether or not they are subject to proprietary rights.

Printed on acid-free paper

Springer is part of Springer Science+Business Media (www.springer.com)

v

Acknowledgement

I sincerely thank all my students, researchers and colleagues who initially put forth the idea of writing this book. The book is the result of their initiative and constant motivation.

I wish to express special gratitude to Prof. Kho Kashfi , City University of New York, who collaborated with me as a co-editor in editing this book and sincerely acknowledge his valuable suggestions, comments and guidance in completing this book.

I also like to thank our reviewers for their painstaking work. I would like to thank Mr. Subhadeep Das, research associate of the department who played a major role in assuring the consistency of the book.

Many new approaches and topics in cancer research are included in this book and we have incorporated the skills, experience and perspective of a truly international complement of highly distinguished authors. The publication of this book could not have been possible but for ungrudging effort put in by all our authors. I would like to thank all of them for their valuable contribution.

I especially thank our publisher Springer, USA, for their continuous support, enthusiasm and help in improving the usability of the text. Many individuals associated with our publishers need our special thanks. Outstanding among them are Florencia Schapiro, Cancer Research Editor at Springer Biomedicine, and her assistant Greg Baer who supervised the production of this book.

I thank my family for their patience, love and support of this venture. Special thanks are to my wife Shipra. She has been the inspiration that has driven me onwards.

Last but not the least I hope this book will provide useful and important informa-tion to researchers, clinicians, academics and pharmaceutical scientists engaged in the areas of cancer research.

Malay Chatterjee

vii

Contents

1 GRB2 Signaling as a Molecular Target for Cancer ........................... 1Alessio Giubellino

2 Human Arylamine N-acetyltransferase 1: From Drug Metabolism to Drug Target ................................................................... 23Fernando Rodrigues-Lima, Julien Dairou, Florent Busi, and Jean-Marie Dupret

3 Targeting Argininosuccinate Synthetase in Cancer Therapy ............ 37Niramol Savaraj, Min You, Chunjing Wu, Macus Tien Kuo, Vy Dinh, Medhi Wangpaichitr, and Lynn Feun

4 Parathyroid Hormone–Related Peptide Signaling in Cancer ............ 53Franco Oreste Ranelletti and Giovanni Monego

5 Signalling Molecules as Selective Targets for Therapeutic Strategies in Multiple Myeloma ............................................................ 87Francesco Piazza and Gianpietro Semenzato

6 Role of Bile Acids in Carcinogenesis of Gastrointestinal Tract ......... 109Hiroshi Yasuda and Fumio Itoh

7 AIB1: A Transcriptional Coactivator Which Integrates Signaling Cross Talk in Cancer Cells ................................................... 129Macarena Ferrero and Jaime Font de Mora

8 Rational Design of DNA Anticancer Agent That Targets Signal Transducer and Activator of Transcription 3 (Stat3) for Cancer Therapy ............................................................................... 167Naijie Jing

9 Estrogen Receptor Signaling in Lung Cancer ..................................... 191P.A. Hershberger and J.M. Siegfried

viii Contents

10 Microparticle Dissemination of Biological Activities: Implications for Cancer Biology ........................................................... 211Pauline P. Goh

11 Protein Kinase D Signaling in Cancer ................................................. 245Peter Storz

12 Cell Signaling and Cancer: Integrated, Fundamental Approach Involving Electron Transfer, Reactive Oxygen Species, and Antioxidants ...................................................................... 273Peter Kovacic and Ratnasamy Somanathan

13 Targeting Signal Transducer and Activator of Transcription (STAT) for Anticancer Therapy ............................................................ 299Fabio P.S. Santos, Inbal Hazan-Halevy, and Zeev Estrov

Index ................................................................................................................ 323

ix

Contributors

Florent Busi UFR des Sciences du Vivant, Unité de Biologie Fonctionnelle et Adaptative , Univ Paris Diderot-Paris 7 , CNRS EAC 4413, 75013 Paris , France

Julien Dairou UFR des Sciences du Vivant, Unité de Biologie Fonctionnelle et Adaptative , Univ Paris Diderot-Paris 7 , CNRS EAC 4413, 75013 Paris , France

Vy Dinh Miami V.A. Healthcare System , Miami , FL 33125 , USA

Jean-Marie Dupret UFR des Sciences du Vivant, Unité de Biologie Fonctionnelle et Adaptative , Univ Paris Diderot-Paris 7 , CNRS EAC 4413, 75013 Paris , France

Zeev Estrov Department of Leukemia, The University of Texas, Anderson Cancer Center , 1515 Holcombe Boulevard, Unit 0428 , Houston , TX 77030 , USA, zestrov@mdanderson.org

Macarena Ferrero Laboratory of Cellular and Molecular Biology , Centro de Investigación Príncipe Felipe , Avenida Autopista del Saler 16, 46012 Valencia , Spain

Lynn Feun Sylvester Cancer Center , University of Miami School of Medicine , Miami , FL 33125 , USA, lfeun@med.miami.edu

Alessio Giubellino , MD Urologic Oncology Branch , National Cancer Institute, National Institutes of Health , Bethesda , MD 20892 , USA, giubella@mail.nih.gov

Pauline P. Goh Vascular Immunology Unit, Department of Pathology , Sydney Medical School, University of Sydney , Sydney , NSW 2006 , Australia paulineg@med.usyd.edu.au

Inbal Hazan-Halevy Department of Hematology and Bone Marrow Transplantation , Tel Aviv Sourasky Medical Center , Haifa , Israel

x Contributors

P.A. Hershberger Department of Pharmacology , University of Pittsburgh , Pittsburgh , USA

Fumio Itoh Division of Gastroenterology and Hepatology , St. Marianna University School of Medicine , 2-16-1 Sugao , 216-8511 Kawasaki , Japan

Naijie Jing , Ph.D. Department of Medicine , Baylor College of Medicine , Houston , TX 77030 , USA, njing@bcm.tmc.edu

Peter Kovacic Department of Chemistry , San Diego State University , San Diego , CA 92182-1030 , USA, pkovacic@sundown.sdsu.edu

Macus Tien Kuo , M.D. Anderson Cancer Center , University of Texas , Houston , TX 77054 , USA

Giovanni Monego Institutes of Human Anatomy and Cell Biology , Universtà Cattolica del S. Cuore , Largo F. Vito 1, 00168 Rome , Italy

Jaime Font de Mora Laboratory of Cellular and Molecular Biology , Centro de Investigación Príncipe Felipe , Avenida Autopista del Saler 16, 46012 Valencia , Spain, jfont@cipf.es

Francesco Piazza Department of Clinical and Experimental Medicine, Haematology-Immunology Section and Venetian Institute of Molecular Medicine, Haematological Malignancies Unit , Padua University School of Medicine , Padua, Italy, Via Giustiniani 2 , 35128 Padova , Italy

Franco Oreste Ranelletti Institutes of Histology and Embryology , Universtà Cattolica del S. Cuore , Rome 00168 , Italy, ranelletti@rm.unicatt.it

Fernando Rodrigues-Lima Univ Paris Diderot-Paris 7 , Unité de Biologie Fonctionnelle et Adaptative, 75013 Paris , France, fernando.rodrigues-lima@univ-paris-diderot.fr

Fabio P. S. Santos Department of Leukemia , The University of Texas, M.D. Anderson Cancer Center , Houston , TX , USA

Niramol Savaraj Miami V.A. Healthcare System , Miami , FL 33125 , USA

Gianpietro Semenzato Department of Clinical and Experimental Medicine, Haematology-Immunology Section and Venetian Institute of Molecular Medicine, Haematological Malignancies Unit , Padua University School of Medicine , Padua, 35128 Padova , Italy, g.semenzato@unipd.it

xiContributors

J.M. Siegfried Co-Director, Thoracic Malignancies Program, Department of Pharmacology , University of Pittsburgh Cancer Institute , Pittsburgh , PA 15213, USA, siegfriedjm@upmc.edu

Ratnasamy Somanathan Department of Chemistry , San Diego State University , San Diego , CA , 92182-1030 , USA

Centro de Graduados e Investigación del Instituto Tecnológico de Tijuana , Apdo postal 1166, Tijuana , BC , Mexico

Peter Storz , Ph.D. Department for Cancer Biology , Mayo Clinic , Jacksonville , FL 32224 , USA, storz.peter@mayo.edu

Medhi Wangpaichitr Miami V.A. Healthcare System , Miami , FL 33125 , USA

Chun jing Wu Miami V.A. Healthcare System , Miami , FL 33125 , USA

Hiroshi Yasuda Division of Gastroenterology and Hepatology , St. Marianna University School of Medicine , 2-16-1 Sugao 216-8511 Kawasaki , Japan, hyasuda@marianna-u.ac.jp

Min You Sylvester Cancer Center , University of Miami School of Medicine , Miami , FL 33136 , USA

1M. Chatterjee and K. Kashfi (eds.), Cell Signaling & Molecular Targets in Cancer, DOI 10.1007/978-1-4614-0730-0_1, © Springer Science+Business Media, LLC 2012

Introduction

Adaptor Proteins in Cell Signaling

Eukaryotic cells have developed complex signaling processing circuits that operate inside the cellular cytoplasm and govern several cellular functions [ 1 ] . In an oversim-plifi ed model, upon stimulation by extracellular ligands (e.g., growth factors), cell surface receptors become activated. The activation is responsible for the transient posttranslational modifi cation (e.g., phosphorylation) of specifi c residues inside a defi ned amino acid sequence, creating specifi c docking sites for intracellular signaling effectors [ 2, 3 ] . The specifi city of such interactions is dictated by the presence inside the protein effector of “domains,” evolutionary conserved sequences with characteris-tic structures and functions [ 4, 5 ] .

Structural analysis of the protein kinase Src uncovered the presence, besides the catalytic domain (named SH1 domain), of other sequences with peculiar and distinct structures [ 6 ] ; those sequences where named consecutively Src-homology 2 (SH2) and Src-homology 3 (SH3) domains because of the proximity to the catalytic domain.

Computational analysis has allowed the identifi cation of similar domains in other proteins. In addition, several other protein-binding modules were discovered, each recognizing specifi c binding motifs on partner proteins [ 7 ] . Comprehensively these proteins go under the name of adaptor (or adapter) proteins. A more strict defi nition of this class of proteins includes only proteins containing two or more protein binding modules, and devoid of any catalytic activity [ 8 ] .

A. Giubellino (*) Urologic Oncology Branch , National Cancer Institute, National Institutes of Health , Bethesda , MD 20892, USA e-mail: giubella@mail.nih.gov

Chapter 1 GRB2 Signaling as a Molecular Target for Cancer

Alessio Giubellino

2 A. Giubellino

Cell signaling has evolved as an intricate network of proteins organized into cascades where the function of one component is dependent upon interaction and activation by other proteins. In this context, adaptor proteins serve the role to connect and assemble the complex array of intercommunicating components. Increasing evidence, though, shows that they are not only simple connectors, but refi ned modulators of cell signaling; indeed posttranslational modifi cations (such as phos-phorylation) of some of these proteins can fi nely tune the process, adding a further layer of complexity to the system.

Protein–protein interactions are of paramount importance for virtually every process inside a cell, and defi ne specifi city in signal transduction. The presence of modular domains that specifi cally interact with a consensus sequence inside the structure of partner proteins (frequently recognizing specifi c posttranslational modifi cations) is at the base of the temporal and spatial specifi city of signaling transduction networks. The versatility and the modular organization can target signaling proteins to the appropriate location within the cells, providing the correct wiring to control and integrate the fl ow of information. The family of adaptor pro-teins encompasses several members with a variety of modules and interaction speci-fi city. For example, the phosphotyrosine-binding (PTB) domain, similarly to the SH2 domain, binds to phosphotyrosine-containing sequences [ 9 ] . Other domains can interact with other modifi ed peptides (such as the 14-3-3 and WW domains with phosphoserine-containing sequences, or the Bromo domain with acetyl-lysine), with unmodifi ed peptides (such as the EVH1 and SH3 domains with proline-rich sequences, or the VHS domain that bind to acidic di-leucine motifs in cytoplasmic domains of sorting receptors), with phospholipids (such as the PH or the FERM domain that bind to the phosphates in the headgroup of phosphoinositides) and even with nucleic acids (such as the PUM domain binding with RNA or the Tubby domain binding to DNA sequences). Several other modules recognize the identical module in other proteins (domain/domain interactions and formation of homotypic oligom-ers); examples of this category include the PDZ, SAM, and DD domains.

It is remarkable that a limited number of modules can control the complex actions of many different cell types; since it is improbable that there are proteins for a single biological role, it is reasonable to consider that signaling proteins rather act in a combinatorial fashion. On this regard , a system biology approach will most likely give us a better opportunity to understand which combination of proteins is suffi cient and necessary for a distinct biological function.

The Grb Family

The discovery of the SH2 domain in the sequence of Fps and Src tyrosine kinases [ 10, 11 ] have sparked the detection of similar domains in other signaling molecules and the discovery of other regions of similarity in the sequence of other proteins. By screening bacterial expression libraries with the phosphorylated C-terminal tail of the EGF receptor, several other SH2 domain containing proteins were characterized [ 12 ] .

31 GRB2 and Target Therapy

In particular, using the CORT (Cloning Of Receptor Targets) method, the fi rst clone to be isolated was the p85 subunit of the previously identifi ed PI-3 kinase; being the fi rst protein to be discovered with this technique, it was named growth factor recep-tor-bound protein 1 (or Grb1) [ 13 ] . It was found that this 85-kDa protein had no intrinsic PI-3 kinase activity, but its structure was composed of two SH2 domains and one SH3 domain. The N-terminus of the p110 subunit (with catalytic activity) of PI3K is tightly associated with a region located between the two SH2 domains of p85. The PI3K family is then organized in three classes, each one with a unique preference for phosphoinositide substrates, producing specifi c lipid second messengers.

The second clone, Grb2, was isolated from the same library used for Grb1/p85 and independently cloned by PCR [ 14, 15 ] . Grb2 is one of those proteins made exclusively of SH2 and SH3 domains (such as Crk and Nck). Developmental studies of the homologues in Caenorhabditis elegans (Sem-5) and in Drosophila melanogaster (Drk, then classifi ed as Grb8) have elucidated the role of Grb2 in cell signaling as discussed below. Several other Grb clones that were isolated turned out to be pro-teins already discovered through other methods [ 16 ] . Grb3 was identifi ed as the protein Crk and Grb4 turned out to be the protein Nck; both these proteins have a structural similarity to Grb2, in the fact they are exclusively composed of SH2 and SH3 domains. Grb5 was recognized as the tyrosine kinase Fyn, Grb6 as the phospho-lipase C-gamma (PLC- g ) and Grb9 as the protein tyrosine phosphatase Syp.

Grb7 and Grb10 were discovered as a novel family of SH3 domain proteins with a distinct structure [ 16 ] . Indeed the molecular architecture of Grb2 (the prototype of the superfamily of adaptor proteins including Grb10 and Grb14) includes an N-terminal proline-rich region, a C-terminal SH2 domain, and a central segment named GM region (for Grb and Mig) which includes a PH domain with sequence homology to the Caenorhabditis elegans protein Mig-10 [ 17, 18 ] . Despite the highly conserved structure homology, the members of the Grb7/10/14 superfamily exhibit a distinctive expression pattern among different tissue types. Interestingly, overex-pression of these proteins has been observed in several cancers and correlate with tumor progression [ 19, 20 ] . A further level of complexity of this family of proteins (not completely understood and under investigation) is represented by potential dif-ferent mechanisms of regulation, including phosphorylation and the occurrence of homo- and hetero-oligomerization (Table 1.1 ).

The Adaptor Protein GRB2

Grb2 in Cell Signaling

The growth factor receptor-bound protein 2 (Grb2) is a prototype adaptor protein that has been extremely useful in understanding the function of other adaptor pro-teins in cell signaling. Grb2 is widely expressed and is essential for a variety of

4 A. Giubellino

basic cellular functions, acting as a critical downstream intermediary in several oncogenic signaling pathways. The mature form has a mass of 25 kDa and a modu-lar structure with one Src homology 2 (SH2) domain fl anked by two SH3 domains [ 21 ] . Grb2 is also known under several names, but one name in particular (EGFR-binding protein) refl ects the way it was originally isolated through screening for epidermal growth factor receptor (EGFR)–interacting proteins. Subsequent experi-ments have demonstrated that Grb2 interacts with several other proteins, becoming one of the adaptor proteins with the highest number of reported cellular interac-tions. In particular through its SH2 domain, which is a conserved sequence of 100 amino acids, Grb2 can interact directly with receptor tyrosine kinases (c-Met, PDGFR) and non-receptor tyrosine kinases, such as focal adhesion kinase (FAK) and Bcr/Abl [ 22 ] , as well as substrates of tyrosine kinases, via preferential binding to the phosphopeptide motif pYXNX (where N is asparagine and X any residue). The two carbonyl and amino-terminal Src homology 3 (SH3) domains, which have a conserved sequence of around 50 amino acids, bind proline-rich regions within interacting proteins.

The classical model of how Grb2 carries out its functions relies on the widely confi rmed observation that Grb2 is constitutively associated with son of sevenless (Sos), a guanine-nucleotide exchange factor that promotes GDP–GTP exchange on Ras, with consequent activation of Ras and the mitogen-activating protein kinase (MAPK) cascade [ 23 ] . This important function is executed upon recruitment of Grb2 (after growth factor receptor activation) near the cell membrane, bringing Sos close to Ras.

The Grb2 gene (in humans and located on chromosome 17) is highly conserved among species and Grb2 expression is critical for normal development [ 24 ] . Mouse embryos homozygous for a Grb2 null allele die at a very early embryological stage, precluding investigation of this gene later in development. However, using mutations originally identifi ed in C. elegans , it has been possible to generate a hypomorphic allele of the mouse Grb2 gene and derive Grb2 -/hypomorph mice that manifest morpho-genic defects in neural crest cell migration into brachial arches and defects in

Table 1.1 The growth factor receptor-bound protein family

Common name Domains

Grb1 p85 subunit (PI-3 Kinase) SH2, SH3, Bcr Grb2 Grb2 SH2, SH3 Grb3 Crk SH2, SH3 Grb4 Nck SH2, SH3 Grb5 Fyn SH2, SH3, TK Grb6 Phospholipase C- g (PLC- g ) SH2, SH3, PLC Grb7 Grb7 SH2, GM/PH Grb8 Drk (Grb2 homolog in Drosophila) SH2, SH3 Grb9 Syp (protein tyrosine phosphatase-2C) SH2, TK Grb10 Grb10 SH2, GM/PH Grb14 Grb14 SH2, GM/PH

51 GRB2 and Target Therapy

cardiovascular development [ 25 ] . These fi ndings reinforce the idea that Grb2 is critical for epithelial morphogenesis and for processes such as cell motility and vasculogenesis.

A natural isoform known as Grb3-3, with a deletion within the SH2 domain, has been discovered [ 26 ] . Grb3-3 is unable to bind to the epidermal growth factor recep-tor, and inhibits EGF-initiated transactivation of a Ras-responsive element. This Grb3-3 acts as a dominant negative protein over Grb2 and experimental evidence points out a role of Grb3-3 in suppressing proliferative signals and activating apop-tosis [ 27 ] . Together with Grb2, Grb3-3 has been reported to localize in the nucleus and bind to the heterogeneous nuclear ribonucleoprotein C (hnRNP C) [ 28 ] ; the physiological implication of these interactions require further investigation, but it has been suggested to be part of a general mechanism involving Grb2 and Grb3-3 in the apoptotic process.

The domain organization of Grb2 is similar to at least two other protein adaptors: Gads (Grb2-related adaptor protein 2) and Grap (Grb2-related adaptor protein). Gad is mainly involved in leukocyte-specifi c tyrosine kinase signaling, and interacts with several proteins, including Grb2-associated binding protein 1 (Gab1) and the SLP-76 leukocyte protein (LCP2) [ 29, 30 ] . Grap interacts with the stem cell factor receptor and the receptor for erythropoietin, and stabilizes the formation of a complex with the oncoprotein Bcr/Abl [ 31 ] .

In analogy to other Grb2 family members, also Grb2 can be tyrosine phosphory-lated; this posttranslational modifi cation is orchestrated by the Bcr/Abl oncoprotein and the epidermal growth factor receptor [ 32 ] . The observation that Grb2 phospho-rylation at tyrosine 209 disrupts its binding to Sos suggests a potential negative regulation by phosphorylation; further and more detailed investigation is required to better understand how this and other posttranslational modifi cations impact Grb2’s cellular functions.

Grb2 and Cancer

Besides its role as a critical downstream intermediary in several oncogenic signal-ing pathways, Grb2 signaling has also been implicated directly in the pathogene-sis of several specifi c human malignancies. The Grb2 gene is located in the chromosome region 17q22, which is known to be duplicated in solid tumors and in leukemias [ 33 ] . Interestingly, Grb2 and Her2 are both located on chromosome 17q, and amplifi cations in this region occur frequently in solid tumors such as neuroblastoma and ovarian and gastric cancers. In chronic myelogenous leukemia (CML), the chimeric Bcr/Abl tyrosine kinase oncoprotein is able to bind the Grb2 SH2 domain through Y177 in the BCR region, linking the fusion protein to the Ras pathway [ 34 ] . Inhibition of the ATP binding site of the Abl tyrosine kinase with small molecules such as Imatinib (STI-571) is currently the main therapy, but inhibition of Grb2 could become a valid adjuvant therapy or an alternative in patients resistant to other treatments.

6 A. Giubellino

Grb2 may also be overexpressed in solid tumors, like those found in breast cancer. Indeed, in addition to its role as a proximal mediator of ErbB2/Neu signal-ing, Grb2 itself was found to be overexpressed in several breast cancer cell lines and breast cancer tissue samples [ 35, 36 ] , enhancing signaling through the MAPK pathway. Grb2 is also important in polyomavirus-induced mammary carcinoma, and Grb2 gene dosage is rate limiting for the onset and development of mammary carcinomas [ 25 ] , highlighting its critical role in the transformation process. Grb2 is involved in keratinocyte growth factor (KGF)–induced motility in MCF-7 breast cancer cells [ 37 ] further suggesting that Grb2 can be a valid therapeutic target for pathological processes such as the spread of solid tumors through local invasion and metastasis. In bladder cancer cells where no EGFR overexpression or H-Ras mutations have been observed, Grb2 has been found overexpressed together with Sos1, as the only observed mechanism of oncogenesis [ 38 ] . In the highly metastatic cancer cell line 1-LN, Grb2 was one of the effector proteins signifi cantly induced, together with Sos1, Shc, and Raf1, through activation of the [alpha]

2 -macroglobulin receptor [ 39 ] .

Another group, using immunohistochemical analysis of tissue microarray from more than 1,000 specimens, has reported the overexpression of Grb2, together with overexpression of Her2, in gastric carcinoma, specifi cally with an increase of Grb2 expression in primary cancer and nodal metastasis when compared with normal gastric mucosa [ 40 ] ; moreover, Grb2 overexpression was associated with poor sur-vival rates, supporting a role for Grb2 in tumor cell aggressiveness. The same group has previously investigated Grb2 expression in colorectal cancers and found a signifi cant increase in specimens derived from metastatic lesions [ 41 ] .

Consistent with a role in tumor dissemination, several groups have reported specifi c direct and indirect interactions of Grb2 with molecules involved in cytoskel-eton remodeling, motility, and other cellular processes recapitulated in the multistep cascade of cancer metastasis. Inhibitors of Grb2 have been demonstrated to reduce motility in vitro and decrease cancer metastasis in animal models [ 42– 44 ] . Several studies, summarized below, elucidate the molecular mechanisms by which Grb2 contributes to cell motility and other processes characteristic of cancer metastasis.

Involvement of Grb2 in Invasion and Metastasis

It is well known that the primary cause of mortality in cancer is due to the deleteri-ous consequences of tumor dissemination and metastasis. Despite progressive advancement in our understanding and treatment of cancer over the last decade, the metastatic process remains the least understood at the molecular level [ 45 ] . To develop more effective therapies we need to better understand the molecular mecha-nisms underlying this multistep process and identify novel molecular targets [ 46 ] . Many current cancer treatments focus primarily on blocking the proliferation of tumor cells using cytostatic agents and targeted therapies, but these regimens offer limited success, with frequent relapse. Thus, to improve survival rates for most cancers, more effective ways of treating micrometastatic disease are required.

71 GRB2 and Target Therapy

Metastasis is a multistep process [ 47, 48 ] in which cells from the primary tumor migrate through the extracellular matrix, enter the circulation through newly formed blood vessels (tumor angiogenesis) and disseminate to distant sites (extravasation), where proliferation begins again. Blocking any stage of this process can potentially be an effective strategy to block the entire process of metastatic disease.

The contribution of a protein such as Grb2 in oncogenesis goes beyond its origi-nal characterization in cell proliferation [ 49 ] ; emerging evidence shows that Grb2 contributes to tumorigenesis in several other ways and to other stages of cancer development. Direct and indirect interactions between Grb2 and several intracel-lular proteins involved in the metastatic cascade have been the subject of numerous original studies that I will summarize in the following pages.

Grb2 Involvement in the Early Phases of the Metastatic Cascade

Inside the primary tumor, several experimental evidences have demonstrated that changes occur in the adhesion properties of potentially metastatic cells, as an early event in the metastatic cascade [ 50 ] . Also the results of a number of clinical studies corroborate this notion, and the expression of several adhesion molecules is altered in different tumors and correlate with prognosis and biological behavior in primary tumor and metastasis [ 51 ] . Tumor cells lose their junctions to other cells and to the extracellular matrix (ECM), and display increased motility. In motile cells, new adhesion sites (focal complexes) located within cell edge protru-sions (lamellipodia and fi lopodia) are transient and small compared to the more stable focal adhesions underlying the cell body and localized at the extremities of actin stress fi bers [ 52 ] . The interaction of ECM components with the cell surface is mediated mainly by members of the integrin family of transmembrane recep-tors. Integrins do not have intrinsic catalytic activity but rely on the kinase activity of other nearby intracellular proteins. For example, focal adhesion kinase (FAK) co-localizes with integrin receptors upon engagement of the cell with the ECM and constitutes a nodal point in integrin signaling, and an important regulator of cell migration [ 53 ] . The overexpression of focal adhesion kinase in several types of tumors is associated with increased angiogenesis, metastasis, and poor progno-sis [ 54 ] . FAK function is regulated through tyrosine phosphorylation at specifi c residues in its amino acid sequence. Several stimuli, such as those mediated by integrins, can induce FAK autophosphorylation, creating docking sites for proteins containing SH2 domains, including Src. Src can also activate FAK and promote phosphorylation on other tyrosine residues; one of these residues, Y925, occurs within a consensus sequence (pYXNX) for high-affi nity binding to the SH2 domain of Grb2 [ 55 ] . Interestingly, elevated Src activity, as observed during colon cancer progression, specifi cally promotes phosphorylation on tyrosine Y925, inducing changes in integrin adhesion and deregulation of E-cadherin [ 56 ] , lead-ing to an E-cadherin/N-cadherin switch [ 57 ] . This event is part of an important hallmark of cell transformation and metastasis, namely epithelial-mesenchymal transition (EMT).

8 A. Giubellino

The interaction of Grb2 with FAK, Shc, and other proteins also leads to activation of the Ras and ERK2 pathways; integrin engagement of these pathways induces cell spreading through actin cytoskeleton rearrangement. Indeed, one of the differences between ERK2 pathway activation by growth factor receptors versus by integrin receptor is that the latter requires a functional actin cytoskeleton to signal, while growth factor receptors can signal even when the actin microfi laments are disrupted by cytochalasin D, a potent inhibitor of actin polymerization [ 58, 59 ] .

The discovery of Grb2-mediated adhesion signaling raises questions as to its precise role in this context. In particular it is important to understand the signaling that permits migrating tumor cells to go through a series of continuous attachments and detachments, and how signaling proteins such as Grb2 direct these transitions and promote cell movement.

After detaching from neighbor cells and from the ECM, tumor cells have to migrate through the surrounding tissue and reach blood vessels for dissemination. This event is made possible by several proteinases [ 60 ] , such as the matrix metallo-proteinases (MMPs), a family of secreted and transmembrane proteins capable of degrading virtually every component of the extracellular matrix. They function in physiologic processes such as tissue growth, morphogenesis, tissue repair, and angiogenesis, as well as in pathological conditions such as tumor invasion and metastasis [ 61 ] . The MMP family includes a class of membrane-anchored metallo-proteinases, ADAMs (A Disintegrin And Metalloprotease), involved in proteolytical cleavage and release of membrane-bound growth factors, cytokines and receptors [ 62 ] . ADAMs overexpression and dysregulation have been implicated in angiogen-esis and metastasis, especially in ErbB ligand cleavage and activation as well as in the processing of other proteins involved in oncogenesis [ 63 ] . Selective ADAMs inhibitors have been developed in recent years and are currently entering clinical trials as a therapeutic strategy in many cancers, reinvigorating the hopes placed earlier on MMP inhibitors [ 64, 65 ] .

Grb2 is also involved in ECM remodeling; in fact the transmembrane metallo-proteinase ADAM12 (Meltrin alpha), upregulated in several cancers, interacts directly with the SH3 domains of Grb2 through prolin-rich sequences in its cytoplasmic tail [ 66 ] . Moreover, Grb2 and ADAM12 co-localize at membrane ruffl es, structures visible specifi cally during epithelial cell migration. Another protein in this family, ADAM15 (metargidin) also interacts with Src and Grb2 in vitro through proline-rich sequences in the cytoplasmic domain [ 67 ] .

In addition to weakening the structural integrity of the ECM, these proteolytic activities can liberate matrix-bond chemokines and growth factors that further enhance the motility of cancer cells. Growth factors, upon binding to membrane receptors, initiate signaling leading to survival, increase specifi c metabolic cascades, and other complex activities such as motility and invasion. Thus, it is the complex downstream signaling triggered by growth factors that lead to these diverse effects. Most, if not all growth factors have motogenic effects. One of the best characterized growth factors involved in cell motility and invasion is the hepatocyte growth factor (HGF), also known as the Scatter Factor (SF), the ligand for the tyrosine kinase receptor Met [ 68 ] . Scattering is a spatially and temporally complex process in which

91 GRB2 and Target Therapy

a cluster of grouped cells lose apical/basal polarity and initiate membrane ruffl ing (centrifugal spreading phase, after 1–3 h), then dissociate from the ECM and neigh-boring cells through disruption of E-cadherin-mediated cell–cell adhesion (dissocia-tion phase, after 3–6 h), and subsequently migrate (migration phase, after 6 h) [ 69 ] . All of these events are triggered upon HGF binding to the extracellular domain of c-Met; intracellularly, the c-Met kinase domain is activated and through a series of auto- and transphosphorylations on specifi c tyrosine residues, docking sites for effec-tor proteins are created. Grb2 interacts directly with pY1356 in the multifunctional docking site of c-Met, or indirectly through the adaptor protein Gab1 (Grb2 Associated Binder 1). Several downstream pathways have been implicated in this process, such as activation of the GTPase Rac (Rho family) and the small GTPase Ras [ 70, 71 ] . Activation of the Ras–Rac1/Cdc42–PAK and Gab1–Crk–C3G—Rap1 effector cas-cade also regulates cytoskeletal and cell adhesion proteins such as cadherins, Arp2/3, N-Wiskott–Aldrich Syndrome protein (N-WASp ), paxillin, integrins and FAK.

Grb2 interacts directly with the actin fi lament machinery. The interaction with WASp [ 72 ] , a regulator of actin cytoskeletal rearrangement, is a well documented example. Patients affected by a mutation in the gene encoding of this protein show functional defects in platelets, in T- and B-cell polarization, and in the ability of these cells to migrate to external stimuli, resulting in thrombocytopenia, immunodefi ciency, and propensity to develop malignancies (mainly leukemia and lymphoma) [ 73 ] . The WASp contains proline-rich sequences that mediate interaction with the Grb2-SH3 domains. Binding to Grb2 translocates WASp from the cytosol to the plasma mem-brane, where it can interact with membrane-bound proteins such as Rac and Cdc42 [ 74 ] . Furthermore, Grb2 links the EGF receptor to WASp constitutively and this inter-action is enhanced upon EGF stimulation. WASp at the membrane also interacts with Nck [ 75 ] , and together with Grb2, cooperatively stabilizes the actin-nucleating complex. So Grb2 and Nck, both SH2 and SH3 domain–containing proteins, can link membrane receptors and membrane-bound proteins to intracellular cytoskeletal regulators, increasing their local concentrations at the membrane and facilitating enzymatic reactions and activation.

Model organisms, such as Listeria monocytogenes and vaccinia virus, have been used to refi ne our understanding of the role of Grb2 in actin-based motility. These pathogens hijack the actin cytoskeletal machinery to navigate through the host cytoplasm [ 75, 76 ] . N-WASp is necessary for the actin-based motility of vaccinia virus, and in mammalian cells regulate actin polymerization through the Arp2/3 complex (the nucleation factor of newly formed actin fi laments) and interaction with Cdc42 [ 77 ] . When N-WASp is not present, Grb2 triggers a weak activation of Arp2/3 with defective actin polymerization [ 78 ] .

Several migratory signaling pathways from the cell surface converge on the p21-activating kinases (PAKs), which consequently translocate to the leading edge of the cell and contributes to motility and invasion. Activation of PAKs and translocation to the plasma membrane are processes that involve the interaction with adaptor proteins such as Nck and Grb2. PAKs are serine/threonine kinases that regulate cancer sig-naling networks and are considered platforms that amplify and propagate oncogenic signals elicited by extracellular stimuli [ 79 ] . PAKs are important regulators of actin

10 A. Giubellino

cytoskeletal dynamics and the role of PAKs in cancer has been widely reported in literature. Specifi cally, PAK1, the best characterized member of the PAK family, was discovered in 1994 by Manser et al. [ 80 ] as a target for the Rho-GTPase related proteins CDC42 and Rac1, well-known regulators of the actin cytoskeleton and implicated in the formation of fi ngerlike protrusions (fi lopodia; CDC42) and sheet-like structures at the cell periphery (lamellipodia; Rac1). Interestingly, PAK can directly and specifi cally interact with Grb2 through a prolin-rich motif in the PAK sequence [ 81 ] . This interaction is independent of EGF stimulation, but it is increased after stimulation of the EGF receptor and EGFR-Grb2-PAK1 interaction is required for EGF induced lamellipodia formation. However, partially in contrast with this interaction, Yamaguchi et al. [ 82 ] have reported that Grb2 partial silencing using siRNA technology does not block invadopodia formation, at least in the rat mam-mary adenocarcinoma used by the authors.

The complexity of Grb2 involvement in actin-based cell motility is highlighted by the growing list of interacting cytoskeletal proteins; we can schematically classify those connections based on the module of Grb2 mediating the interaction (Table 1.2 ).

In a screening for Merlin-binding proteins, Wiederhold et al. [ 83 ] discovered a novel protein, Magicin (Merlin and Grb2 interacting cytoskeletal protein), with a consensus

Table 1.2 List of the main proteins interacting with the SH2 or the SH3 domain of Grb2

SH2 domain interacting proteins SH3 domain interacting proteins

EGFR SOS1 PDGFR WASP VEGFR PAK1 MET GAB1 RON p85/PI3K ERB-B2/B3 JAK1/2 KIT ELK1 LAT ADHALIN FGFR DYNAMIN NGFR SPROUTY1/2 RET ADAM12 EPH B2/B6/A2 MTA1/3 CSF1R SELECTIN-L SHP-1/2 VAV SRC DYSTROGLYCAN FAK FAS ligand CBL HUNTINGTIN CD72 MAP2 ZAP70 CRK CALDESMON CORTACTIN SHC MAGICIN IRS-1 DELTEX1 BCR/ABL DYNACTIN1 MUC1

111 GRB2 and Target Therapy

sequence (pYVNG) for the SH2 domain of Grb2. Magicin creates a multiprotein complex with Merlin, although the main interaction seems to be through the SH3 domain of Grb2. Merlin is the product of the Neurofi bromatosis 2 (NF2) gene; NF2 mutations give rise to an autosomal dominant syndrome characterized by vestibular schwannomas and meningiomas. The sequence of Merlin shows similarities with ERM proteins (Ezrin, Radixin, and Moesin), that linker membrane proteins to the actin cytoskeleton; Merlin has the FERM domain for interaction with F-actin. Merlin local-izes to the leading edge of cells (membrane ruffl es), where it colocalizes with actin and contributes to actin assembly and interaction with the cortical cytoskeleton.

In A431 human epidermoid carcinoma cells, HGF stimulates the phosphorylation of cortactin, a fi lamentous actin–binding protein, that translocates from the cyto-plasm, where it’s located when inactive, to the cell periphery where it assists the Arp2/3 complex in nucleating actin [ 84 ] , promoting the formation of lamellipodia; Grb2 can associate directly to cortactin, linking c-met to this molecule. When phos-phorylated on serine or threonine by the extracellular-signal-regulated kinase (ERK), cortactin assumes a conformation that allows N-WASp and other nucle-ation-promoting factors to bind to the cortactin–Arp2/3–actin complex [ 85 ] . Cortactin is also overexpressed in certain cancers and is associated with an invasive phenotype, formation of invadopodia, and secretion of MMPs, favoring the spread of cancer cells through tissue [ 86, 87 ] . Interestingly, cortactin can bind to the actin and calmodulin-binding protein Caldesmon. Caldesmon, when tyrosine phosphory-lated, can interact with the Shc–Grb2–Sos complex, enhancing the interaction between myosin and actin and driving transformation during sarcomagenesis [ 88 ] .

Grb2 interacts also with POB1 ( p artner o f Ral B P 1 ), a protein that shares a homol-ogy with Eps15, an epidermal growth factor (EGF) receptor substrate, and has two proline-rich motifs. POB1 interacts with RalBP1 that exhibits GAP activity for Rac and CDC42, controlling the cytoskeleton [ 89 ] .

The importance of Grb2 in actin polymerization is further underscored in the formation of podosomes. Originally identifi ed in cells of mesenchymal origin, podosomes have also emerged as adhesive structures in epithelial cells. These clus-ters of actin organized in rosette-like structures have components also found in focal contacts as well as dynamin, cortactin, Arp 2/3, N-WASp, and VASP [ 90 ] . Grb2, but not Nck, participates in podosome formation and overexpression of Grb2 interferes with the organization of these structures [ 91 ] . Characteristically, these structures disappear when cells become motile and re-form when cells are no longer moving.

Not only the actin cytoskeleton seems to be affected by Grb2 mediated signaling, but also the function of another component of the cytoskeleton, the microtubule network. For example, in osteoclasts Grb2 is one of the major binding proteins for dynactin [ 92 ] , a multisubunit activator of the microtubule motor protein dynein that contributes to cell polarization during migration.

Hungtingtin, whose malfunction is associated with Huntington’s Disease, has several prolix-rich motifs and interacts specifi cally with the Grb2 SH3 domains, when Grb2 is dissociated from Sos (hungtingtin and Sos do not coexist in the same complex), linking hungtingtin to the EGF receptor [ 93 ] . Hungtingtin is mainly associated with microtubules and appears to function in cytoskeletal anchoring.

12 A. Giubellino

Another microtubule-associated protein, MAP2 (Microtubule associated protein2), a major cytoskeletal protein in neurons [ 94 ] that participates in neuronal morpho-genesis, also binds Grb2, linking the microtubule network to multimeric signaling complexes in the cytosol. The number of Grb2 interacting proteins involved in the actin and tubulin cytoskeleton is continuously increasing, reinforcing the idea that Grb2 is playing a fundamental role in this context.

Role of Grb2 in Angiogenesis and Dissemination

Detailed evaluation through experimental models and clinical observations has revealed that the metastatic process is extremely ineffi cient [ 95 ] ; indeed, of the large number of cancer cells that can be shed into the circulation only few will effectively colonize a secondary site. In the fi rst place, the primary tumors have to establish an effective blood supply in order to maintain its mass and grow. For this reason, tumor cells secrete several growth factors that induce the formation of new blood vessels (angiogenesis) [ 96 ] . Angiogenesis is an important step in the transition of the primary tumor to malignancy. In addition to nourishing the tumor, newly formed vessels provide a means to disseminate metastatic cells. Recent fi ndings describe angiogenesis at the primary tumor as a mosaic of tumor cells and endothelial cells, and this structure facilitates the shedding of cancer cells into the systemic circulation.

Many of the pathways in which Grb2 is involved are important in the forma-tion of a novel vessel through angiogenesis and lymphangiogenesis. Several growth factors, such as VEGF, angiopoietin-1, FGF2, and HGF, contribute to the development of new blood vessels in physiologic and in pathological conditions, such as tumor angiogenesis. The vascular endothelial growth factor (VEGF) receptor 2 (VEGFR2/KDR) is phosphorylated in response to its ligand, VEGF-A which is secreted by many tumor cells, and this activation lead to the direct recruitment of Grb2, Shc, and Nck [ 97 ] . This occurs also for the VEGF receptor 3 (FLT4L). Besides the direct interaction, Grb2 can also bind indirectly through the intercession of Shc [ 98 ] . Consequently, Grb2 can lead to cell cycle progres-sion via the Sos/Ras pathway and to cell motility through activation of the Rac1/Rho pathway. The latter response appears to be sensitive to specifi c binding antagonists of the SH2 domain of Grb2 [ 99 ] , with reduction of cell invasion and inhibition of more complex processes, such as endothelial cell tubulogenesis and formation of vessels in the chick chorioallantoic membrane (CAM). Other sig-naling pathways such as those driven by angiopoietin-1 and fi broblast growth factor-2 (FGF-2) also stimulate angiogenesis through direct and indirect interac-tion with Grb2, via intermediate proteins such as the FGF receptor substrate 2, Gab1, and Shc [ 100, 101 ] .

Another mediator of angiogenic signaling is HGF, primarily through a direct effect on vascular endothelial cells. In particular, the activation of Met by HGF has been shown to enhance tumor angiogenesis and the interaction between tumor and endothelial cells, mostly increasing endothelial expression of CD44

131 GRB2 and Target Therapy

[ 102 ] or integrin expression in cancer cells [ 103 ] . These events require the activation of multiple signaling for which Grb2 has been demonstrated to be a key intermediate [ 104, 105 ] . Interestingly, NK4, a competitive antagonist of HGF-c-Met association, has been shown to be an angiogenesis inhibitor [ 106 ] . Several other angiogenic signaling pathways, including the ones driven by plate-let-derived growth factor (PDGF), ALK, and Eph, require Grb2 as a critical downstream effector.

Besides its role as a critical effector protein in focal adhesion platforms, FAK through Y925 and Grb2 binding is involved in tumor neo-vascularization. Indeed FAK activation and consequent binding to Grb2 within tumor cells induce the expression of VEGF; elevated VEGF production in tumor cells stimulate endothe-lial cell, facilitating cell motility and survival, without affecting cell proliferation [ 107 ] . Moreover, previous studies have demonstrated that hypoxia conditions, like those experienced inside tumors, is able to increase phosphorylation of FAK with consequent Grb2 binding [ 108 ] .

Selective antagonists of the Grb2 SH2 domain have already shown promising effects on tumor angiogenesis [ 99 ] and may represent important tools to better understand how adaptor proteins are involved in the morphogenetic response of endothelial cells to angiogenic cues and in the formation of blood vessels.

The fi nal step in the metastatic cascade consists in the extravasation of circulat-ing tumor cells and the colonization of the secondary site. One of the best character-ized models of extravasation is represented by the movement of leukocytes from the circulation to the site of tissue damage or infection, in response to cytokines released by macrophages in the affected tissue. These cytokines induce the expression of a particular class of adhesion molecules, selectins, while specifi c chemokines act as chemoattractants on circulating leukocytes [ 109 ] .

Selectins mediate the adhesion of lymphocytes on the endothelial cell luminal surface with a series of low-affi nity binding sites, slowing down their speed to com-plete arrest. Studies on the intracellular signaling events upon L-selectin activation have identifi ed Grb2 as an important adaptor: Grb2 binds directly to L-selectin and trigger activation of Rac2 [ 110 ] . L-selectin can enhance the formation of metastasis to lymph nodes in vivo [ 111 ] . Endothelial cells in different tissues are not alike and can express different patterns of adhesion molecules; this may explain in part why tumor cells prefer specifi c organs, skipping organs that are the most logical target based on vascular drainage from the primary tumor.

Integrins are also important mediators of cancer cells rolling adhesion by circu-lating and subsequent extravasation [ 109 ] . Integrins expressed on the surface of circulating tumor cells engage the surface of endothelial cells and this binding trig-gers association of the integrin cytoplasmic tail to the intracellular cytoskeleton; consequently, cells can change their shape and form pseudopodia for facilitating passage between endothelial cells.

After successful extravasation, tumor cells must again activate ECM degrada-tion, migrate to the metastatic site and proliferate again. Thus, metastatic cells must switch from a migratory to a proliferative state, again modulating pathways in which Grb2 is a well-known mediator.

14 A. Giubellino

Development of Grb2 Inhibitors as Anticancer Drugs

The recognition that Grb2 is important in several oncogenic signaling pathways is the origin of several efforts to selectively disrupt its intracellular network. Specifi cally, the peculiar structure of the SH2 domain of Grb2 has been the focus of intense study in an effort to synthesize selective antagonists.

What is different about the SH2 domain of Grb2 (compared with other SH2 domains) is that it invariably prefers an asparagine at the second position down-stream of the phosphotyrosine (pY + 2) and requires the ligand peptide to adopt a b -bend confi guration [ 112 ] . The basis of these requirements became clear when the structure of Src and Grb2 proteins became available for comparison. For the Src kinase, the peptide that binds the SH2 domain has a linear confi guration because it allocates in a broad pocket that is open and elongated, while the peptide sequence that binds to the Grb2 SH2 domain is forced into a much deeper pocket and this explains the sequence requirement at pY + 2 and the b -bend confi guration.

Medicinal chemists took advantage of this information and started the rational design and synthesis of sophisticated compounds. Several potent binding antagonists of the SH2 domain of Grb2 have been developed in the last decade. Short phospho-tyrosine-containing peptides mimicking the motif within Grb2 target proteins were used as the starting point for the synthesis of this class of binding antagonists. A major challenge in designing SH2 domain antagonists is the presence of nega-tive charges from phosphate and acidic side chains, which may present an obstacle to penetrating the cell membrane. Conferring phosphatase resistance through mod-ifi cation of the phosphotyrosine is also a big challenge because this can adversely affect SH2 domain–binding affi nity. In addition, selectivity is essential to avoid random antagonism of SH2 domain interactions. Thus it is not surprising that the development of high affi nity, stable, and cell-permeable SH2 inhibitors has been a diffi cult challenge; nonetheless, several advancements have been made. To confer phosphatase resistance the phosphotyrosyl residue has been substituted by phospho-nomethyl phenylalanine (Pmp) residue, or similar structures [ 113 ] ; another approach was to use non-phosphate containing ligands [ 114 ] . More recently, Song et al. [ 115 ] reported the synthesis of potent inhibitor free of phosphotyrosine or any phosphotyrosyl mimetic, demonstrating that complete replacement of the phos-photyrosyl residue can be accomplished without signifi cant loss of binding affi nity.

High-affi nity compounds, able to block EGFR-Grb2 interactions in intact cells [ 116 ] were derived through systematic and stepwise substitution of the backbone motif pYxN and mimicking the b -turn conformation. Starting from this platform, potent peptidomimetic inhibitors of SH2 domain interactions have been developed [ 117, 118 ] . Macrocyclization has been adopted to stabilize the b -turn conformation, obtaining potent peptidomimetic inhibitors. Other modifi cations have been identi-fi ed that increase inhibitor affi nity and the potential for cell membrane penetration, and it has been demonstrated that it is possible to design Grb2 Sh2 domain antagonists devoid of any peptidic character [ 119 ] .

151 GRB2 and Target Therapy

Using synthetic binding antagonists of the Grb2 SH2 domain, Atabey et al. [ 120 ] demonstrated their potent blockade of HGF-stimulated cell motility, matrix inva-sion, and branching morphogenesis in epithelial and hematopoietic target cell models. The same compounds did not affect HGF-stimulated mitogenesis. Unpublished evidence suggests that these compounds can block mitogenesis in specifi c cell types, implying that dependence on Grb2 for mitogenic signaling may be cell-type specifi c. Interestingly, no evidence of toxicity, or loss of contractility required for cellular functions other than locomotion were observed. The same compounds were also tested for inhibition of the basic morphogenic events required for angiogenesis, such as the HGF, VEGF, and bFGF- driven endothelial cell migra-tion and invasion [ 99 ] , and inhibition of vasculogenesis in vivo in a chick chorioal-lantoic assay. Testing of a prototypical antagonist in two aggressive tumor models revealed inhibition of tumor metastasis without affecting primary tumor growth, thus highlighting the critical role of the Grb2 adapter function in motility, invasion, and the spreading of solid tumors [ 121 ] .

Targeting the SH3 domain of Grb2 has been another important therapeutic strat-egy. The structure of these modules is known in great detail. The ligand binding surface of SH3 domains is relatively fl at and hydrophobic and consists of three pockets characterized by conserved aromatic residues. The ligand typically occu-pies two of these pockets with two hydrophobic prolines, while the third pocket frequently interacts with basic residues, in a so called polyproline-2 (PPII) confor-mation [ 122 ] . The same conformation is recognized by other proline-recognizing modules such as WW and profi lin domains [ 122 ] , and this similarity has been the subject of several studies to better understand the selectivity of SH3 domains for target proteins. The importance of conformation over sequence for SH3 domain ligand recognition is also gaining acceptance. Although SH3 domains have long been thought to bind preferentially to proline rich sequences of the form PXXP in target proteins, several exceptions to this rule have been found [ 123 ] . The SH3 domains of Grb2 have been found to bind a RXXK core consensus motif [ 124 ] .

The relatively low binding affi nities reported for SH3/target protein interactions, together with the ability of SH3 domains from different proteins to recognize the same target, have raised questions regarding the basis for SH3 domain selectivities observed in intact cells as well as the feasibility of screening peptide libraries using SH3 domains to discover binding antagonists [ 125 ] . Nonetheless, progress has been made on both fronts [ 126 ] . For Grb2 in particular, SH3 domain target selectivity may be increased through two mechanisms, one intrinsic to the SH3 domains them-selves and the other through their context in an SH2 domain containing protein. For example, both Grb2 SH3 domains may interact simultaneously with different sites on a single target molecule, e.g., SOS1, thereby increasing both the apparent affi nity and selectivity of Grb2-target interaction [ 123 ] . Because the Grb2 SH2 domain restricts Grb2 subcellular localization, the pool of potential SH3 domain binding partners is also likely to be limited, further increasing their apparent selectivity.

The SH3 domains from several proteins have been used to screen short peptide libraries in search of binding antagonists. Peptides binding the SH3 domain containing adaptor protein Mona/Gads with high affi nity have been identifi ed, and subsequent

16 A. Giubellino

structural studies using one of these peptides revealed a novel type of peptide-SH3 domain interaction [ 127 ] . Similarly, screening for peptides binding the SH3 domains of the C. elegans Grb2 homolog Sem-5 yielded a bivalent peptide ligand with nanomo-lar affi nity [ 128 ] . Pak1-derived peptides encompassing proline-rich sequences in that protein were found to specifi cally disrupt Grb2 SH3 domain-Pak1 interactions with relevant impact on growth factor mediated migration and lamellipodia formation [ 81 ] . Non-natural amino acids analogs have been substituted at the proline-requiring site of Grb2 SH3 domain ligands [ 129 ] . These have provided peptides with nanomolar affi n-ity and reinforced the concept that proline residues may be dispensable in the design of SH3 domain–binding antagonists.

An adaptation of the target peptide screening approach in developing SH3 domain–binding antagonists has been to systematically introduce point mutations in target peptide sequences. High-affi nity peptides capable of blocking the prolifera-tion of primary blast cell cultures derived from patients with chronic myelogenous leukemia (CML) and Bcr/Abl positive cell lines have been developed using this strategy [ 130 ] . Subsequent modifi cations of these peptides to improve their ability to permeate cells yielded agents that more potently disrupted Grb2 signaling com-plexes in CML-derived cells [ 131 ] . These preclinical studies support the concept that Grb2 SH3 domain binding antagonists could provide a therapeutic alternative for CML patients developing resistance to standard treatments [ 132 ] .

Enhancing the affi nity and selectivity of artifi cial SH3 domain–binding antago-nists by exploiting the existence of two SH3 domains in Grb2, dimeric peptides with high affi nity binding to both SH3 domains of Grb2 have been designed with the goal of disrupting Grb2-SOS1 interactions [ 133 ] . These “peptidimers” inhibited cell growth in vitro and displayed anti-tumor effects in xenograft models, and thus rep-resent the fi rst examples of in vivo activity for this class of compounds [ 134 ] . Introducing N-alkylated residues into both monomers of the peptidimer and opti-mizing the linker improved the affi nity for Grb2 to the subnanomolar range [ 135 ] . Finally, non-peptidic small molecule inhibitors have also been explored. The fi rst example is the Src signal transduction inhibitor UCS15A that disrupts several SH3 domain mediated interactions, including those of Grb2 [ 136 ] . Although target selec-tivity remains to be improved, this and similar chemical structures may provide a platform for the development of small synthetic drugs that potently antagonize specifi c SH3 domain–binding interactions.

As a fi nal point, it is noteworthy to remember that other potential therapeutic approaches have been explored. Gene silencing using RNA interference (RNAi) has been used to explore the role of Grb2 in signal transduction [ 137 ] and in receptor downregulation [ 138 ] . Studies on leukemia and breast cancer using antisense oligo-nucleotide showed inhibition of proliferation, but more studies using RNAi technol-ogy to exploit its therapeutic potential in the inhibition of Grb2 are needed to understand if this is an effective strategy. Lentiviral-mediated silencing of Grb2 through RNAi can be envisioned as a potential approach that has been proved already to be effective for other therapeutic targets and in other diseases [ 139 ] .

Further studies are necessary to refi ne our understanding of the complexity of Grb2 signaling and to better understand how Grb2 is linked to tumor metastasis in

171 GRB2 and Target Therapy

different tumor types. A promising and powerful strategy to explore target protein selectivity and mechanism of action of these compounds is the synthesis of tool compounds (e.g., modifi ed with chemical tags, such as biotin) [ 140 ] . This and other strategies, such as the use of microarrays for the global analysis of gene expression profi les, will be extensively used to develop pharmacodynamic markers of drug action, a high priority in any modern drug development effort.

Conclusions and Prospectives

The fundamental contribution of adaptor proteins to complex cell signaling cascades and the consequent appropriate cellular responses is outlined by many experimental observations. Several adaptor proteins have been involved directly or indirectly in the pathogenesis of numerous diseases, including cancer. To cite a few examples, the adaptor protein Shc is broadly involved in oncogenesis and in tumor progression [ 141 ] ; Nedd9, an adaptor protein related to p130CAS, has been considered a mela-noma metastasis gene, contributing to invasion and the spread of transformed cells [ 142 ] ; the adaptors Nck and Crk, promoting the local state of actin polymerization, contribute to tumor progression and immune disorders [ 143 ] . Moreover, it has been observed that the role of adaptors may go beyond their function as mere effectors of kinase-initiated signaling. For example, the integrity of the SH2 and SH3 domains of tyrosine kinase c-Src are required for facilitating cell spreading, while its catalytic activity is dispensable [ 144 ] .

The adaptor protein Grb2 has been the focus of extensive research and signifi cant advances have been made in the understanding of its biology and the role it plays in specifi c signaling systems. Nonetheless, much more remains to be uncovered. A number of proteins that bind to Grb2 have been identifi ed and their interaction characterized. The role of Grb2 as a signal-associated transducer of several cancer-relevant receptors and the broad involvement of Grb2 in several steps of tumorigen-esis and tumor progression make it an excellent candidate for anti-tumor therapeutic strategies. Using Grb2 SH2 domain antagonists we have already learned important information about Grb2 and growth factor-induced signaling.

Originally designed to block cell proliferation, we have discovered that com-pounds that selectively antagonize Grb2 potently inhibit cell migration, invasion, and angiogenesis; and promising evidence points to a potential use of these com-pounds as anti-metastatic therapeutics [ 145 ] .

In vivo evidence of Grb2 dimers, and crystal structures of these dimers [ 146 ] , may become the basis for development of dimeric small molecules as a possible strategy, such as has been explored for other therapeutic targets. However, more experimental evidence to prove that such dimeric form exists in solution, and in cells, plus modeling evidence that could fi nely estimate the distance between the two Grb2 SH2 domains in solution is needed to rationally undertake/attempt the synthesis of dimeric Grb2 inhibitors. Moreover, other experimental evidence is required to demonstrate the biological role of such dimerization.

18 A. Giubellino

Considering the fundamental role of adapter proteins such as Grb2, and other adaptors in cell signaling and in the development of human cancer, in the coming years we anticipate more work on developing specifi c drugs that selectively target these proteins, both to treat human disease and as a tool to deepen our knowledge of the role of adapter proteins in normal as well as diseased cell signaling.

An interesting option is the use of these molecules in combination with conventional chemotherapeutics or with targeted therapies. Further studies are needed to determine the tumor-specifi c biology of Grb2 and other adaptor proteins in diverse human cancers in order to determine where and when these inhibitors may provide the best benefi t. Considering the wide-spread presence of Grb2 in various tissues, it will be important to also address issues related to potential systemic toxicity of selective antagonists.

Rationally designed drugs targeting specifi c molecules involved in oncogenesis and metastasis is still in its infancy. It will be important to defi ne targets that are most likely to be uniquely involved in these processes. To address the problem of low effi cacy for some single agent therapies, and to target a complex process such as metastasis, combinations of drugs acting at different signaling nodes will proba-bly be needed. Drugs targeting protein–protein interactions hold the promise of fewer side effects and when used in combinations, may realize a better therapeutic effi cacy than conventional medications.

Disease-relevant intracellular protein–protein interactions are promising drug targets, especially where cancer cells are dependent on the activity of a specifi c oncogene. Indeed, oncogenic-relevant proteins (such as Bcr/Abl, Src, and Ras) are not acting alone as single proteins, but we need to consider them as complex protein networks that are perturbed and remodeled upon drug action [ 147 ] . The future will reserve a predominant importance of systems biology to the study of intracellular signaling complexes; a better understanding of the complexity of the interactome will allow for interpretation and understanding of pathological processes and help to determine therapeutic strategy to target this complexity. It is becoming progres-sively clear that the era of the “magic bullet,” as theorized by Paul Ehrlich [ 148 ] , is leaving room for a new era where disciplines such as network medicine [ 149 ] , network pharmacology [ 150 ] and system biology of cell signaling [ 151 ] bring the promise of a better understanding of how we will select targets and use drug com-binations. A systems biology approach will most likely determine which molecular targets will be more useful to target in combination to reduce single drug dosages and achieve higher effi cacy, reducing the potential of toxicity resulting from using higher doses of a single agent. In line with this view, adaptor proteins will be an important target for combination therapies.

References

1. T. Pawson, P. Nash, Science 300 , 445 (2003). 2. T. Hunter, Cell 100 , 113 (2000). 3. T. Hunter, Current Opinion in Cell Biology 21 , 140 (2009).

191 GRB2 and Target Therapy

4. T. Pawson, P. Nash, Genes Dev. 14 , 1027 (2000). 5. T. Pawson, Cell 116 , 191 (2004). 6. J. Roskoski, Biochemical and Biophysical Research Communications 324 , 1155 (2004). 7. T. Pawson, Current Opinion in Cell Biology 19 , 112 (2007). 8. D. C. Flynn, Oncogene 20 , 6270 (2001). 9. M. T. Uhlik et al. , Journal of Molecular Biology 345 , 1 (2005). 10. I. Sadowski, J. C. Stone, T. Pawson, Mol. Cell. Biol. 6 , 4396 (1986). 11. T. Pawson, Oncogene 3 , 491 (1988). 12. L. E. M. Marengere, T. Pawson, Journal of Cell Science 107 , 97 (1994). 13. E. Y. Skolnik et al. , Cell 65 , 83 (1991). 14. E. J. Lowenstein, Cell 70 , 431 (1992). 15. K. Matuoka, M. Shibata, A. Yamakawa, T. Takenawa, Proceedings of the National Academy

of Sciences of the United States of America 89 , 9015 (1992). 16. B. Margolis et al. , Proceedings of the National Academy of Sciences of the United States of

America 89 , 8894 (1992). 17. D. Stein et al. , EMBO Journal 13 , 1331 (1994). 18. J. Manser, W. B. Wood, Developmental Genetics 11 , 49 (1990). 19. T. L. Shen, J. L. Guan, Frontiers in Bioscience 9 , 192 (2004). 20. M. A. Lim, H. Riedel, F. Liu, Frontiers in Bioscience 9 , 387 (2004). 21. E. J. Lowenstein et al. , Cell 70 , 431 (1992). 22. P. G. Dharmawardana, B. Peruzzi, A. Giubellino, J. Burke, D. P. Bottaro, Anti-Cancer Drugs

17 , 13 (2006). 23. A. M. Tari, G. Lopez-Berestein, Seminars in Oncology 28 , 142 (2001). 24. A. M. Cheng et al. , Cell 95 , 793 (1998). 25. T. M. Saxton et al. , Current Biology 11 , 662 (2001). 26. I. Fath et al. , Science 264 , 971 (1994). 27. I. Rey et al. , Cell Death and Differentiation 2 , 105 (1995). 28. F. Romero, The Journal of biological chemistry 273 , 7776 (1998). 29. S. K. Liu, C. J. McGlade, Oncogene 17 , 3073 (1998). 30. N. Dimasi, International Journal of Biochemistry and Cell Biology 39 , 109 (2007). 31. G. S. Feng et al. , J. Biol. Chem. 271 , 12129 (1996). 32. S. Li, A. D. Couvillon, B. B. Brasher, R. A. Van Etten, EMBO Journal 20 , 6793 (2001). 33. K. Huebner et al. , Genomics 22 , 281 (1994). 34. A. M. Pendergast et al. , Cell 75 , 175 (1993). 35. R. J. Daly, M. D. Binder, R. L. Sutherland, Oncogene 9 , 2723 (1994). 36. B. S. Verbeek, S. S. driaansen-Slot, G. Rijksen, T. M. Vroom, Journal of Pathology 183 , 195

(1997). 37. X. P. Zang, D. R. Siwak, T. X. Nguyen, A. M. Tari, J. T. Pento, Clinical and Experimental

Metastasis 21 , 437 (2004). 38. T. Watanabe et al. , IUBMB Life 49 , 317 (2000). 39. U. K. Misra, S. V. Pizzo, Cellular Signalling 16 , 487 (2004). 40. G. Z. Yu, Y. Chen, J. J. Wang, Journal of Cancer Research and Clinical Oncology , in press. 41. G. Z. Yu et al. , Oncology Reports 19 , 1191 (2008). 42. B. Gay et al. , J. Biol. Chem. 274 , 23311 (1999). 43. N. Atabey et al. , J. Biol. Chem. 276 , 14308 (2001). 44. A. Giubellino et al. , Cancer Res 67 , 6012 (2007). 45. G. Christofori, Nature 441 , 444 (2006). 46. P. S. Steeg, D. Theodorescu, Nature Clinical Practice Oncology 5 , 206 (2008). 47. I. J. Fidler, Nat Rev Cancer 3 , 453 (2003). 48. P. S. Steeg, Nat Med 12 , 895 (2006). 49. J. Downward, FEBS Letters 338 , 113 (1994). 50. U. Cavallaro, G. Christofori, Nat Rev Cancer 4 , 118 (2004). 51. K. A. Paschos, D. Canovas, N. C. Bird, Cellular Signalling 21 , 665 (2009). 52. S. K. Mitra, D. A. Hanson, D. D. Schlaepfer, Nat Rev Mol Cell Biol 6 , 56 (2005).

20 A. Giubellino

53. B. D. Cox, M. Natarajan, M. R. Stettner, C. L. Gladson, Journal of Cellular Biochemistry 99 , 36 (2006).

54. G. W. McLean et al. , Nat Rev Cancer 5 , 505 (2005). 55. D. D. Schlaepfer, S. K. Hanks, T. Hunter, P. Van der Geer, Nature 372 , 786 (1994). 56. E. Avizienyte et al. , Nat Cell Biol 4 , 632 (2002). 57. R. B. Hazan, R. Qiao, R. Keren, I. Badano, K. Suyama, Annals of the New York Academy

of Sciences 1014 , 155 (2004). 58. S. Miyamoto et al. , Journal of Cell Biology 131 , 791 (1995). 59. D. D. Schlaepfer, K. C. Jones, T. Hunter, Mol. Cell. Biol. 18 , 2571 (1998). 60. C. J. Malemud, Frontiers in Bioscience 11 , 1696 (2006). 61. M. D. Martin, L. M. Matrisian, Cancer and Metastasis Reviews 26 , 717 (2007). 62. M. L. Moss, M. H. Lambert, Essays in Biochemistry 38 , 141 (2002). 63. C. P. Blobel, Nat Rev Mol Cell Biol 6 , 32 (2005). 64. B. B. Zhou et al. , Expert Opinion on Investigational Drugs 14 , 591 (2005). 65. J. S. Fridman et al. , Clin Cancer Res 13 , 1892 (2007). 66. A. Suzuki et al. , Oncogene 19 , 5842 (2000). 67. Z. Poghosyan et al. , J. Biol. Chem. 277 , 4999 (2002). 68. C. Birchmeier, W. Birchmeier, E. Gherardi, G. F. Vande Woude, Nat Rev Mol Cell Biol 4 ,

915 (2003). 69. J. F. Lai et al. , J. Biol. Chem. 275 , 7474 (2000). 70. A. J. Ridley, P. M. Comoglio, A. Hall, Mol. Cell. Biol. 15 , 1110 (1995). 71. G. Hartmann, K. M. Weidner, H. Schwarz, W. Birchmeier, J. Biol. Chem. 269 , 21936

(1994). 72. H. She et al. , Mol. Biol. Cell 8 , 1709 (1997). 73. H. D. Ochs, A. J. Thrasher, Journal of Allergy and Clinical Immunology 117 , 725 (2006). 74. P. Aspenstrom, U. Lindberg, A. Hall, Current Biology 6 , 70 (1996). 75. N. Scaplehorn et al. , Current Biology 12 , 740 (2002). 76. M. F. Carlier, C. Le Clainche, S. Wiesner, D. Pantaloni, Bioessays 25 , 336 (2003). 77. H. N. Higgs, T. D. Pollard, Annual Review of Biochemistry 70 , 649 (2001). 78. M. F. Carlier et al. , J. Biol. Chem. 275 , 21946 (2000). 79. R. Kumar, A. E. Gururaj, C. J. Barnes, Nat Rev Cancer 6 , 459 (2006). 80. E. Manser, T. Leung, H. Salihuddin, Z. S. Zhao, L. Lim, Nature 367 , 40 (1994). 81. L. A. Puto, K. Pestonjamasp, C. C. King, G. M. Bokoch, J. Biol. Chem. 278 , 9388 (2003). 82. H. Yamaguchi et al. , J. Cell Biol. 168 , 441 (2005). 83. T. Wiederhold et al. , Oncogene 23 , 8815 (2004). 84. L. Crostella, S. Lidder, R. Williams, G. G. Skouteris, Oncogene 20 , 3735 (2001). 85. N. Martinez-Quiles, H. Y. H. Ho, M. W. Kirschner, N. Ramesh, R. S. Geha, Mol. Cell. Biol.

24 , 5269 (2004). 86. A. M. Weaver, Clinical and Experimental Metastasis 23 , 97 (2006). 87. E. S. Clark, A. S. Whigham, W. G. Yarbrough, A. M. Weaver, Cancer Res 67 , 4227 (2007). 88. J. L. Boerner et al. , Oncogene 22 , 6679 (0AD). 89. A. Hall, Annual Review of Cell Biology 10 , 31 (1994). 90. L. Spinardi, P. C. Marchisio, European Journal of Cell Biology 85 , 191 (2006). 91. L. Spinardi et al. , Experimental Cell Research 295 , 360 (2004). 92. M. Sahni et al. , J. Biol. Chem. 271 , 33141 (1996). 93. Y. F. Liu, R. C. Deth, D. Devys, J. Biol. Chem. 272 , 8121 (1997). 94. R. W. L. Lim, S. Halpain, J. Biol. Chem. 275 , 20578 (2000). 95. K. J. Luzzi et al. , Am J Pathol 153 , 865 (1998). 96. J. Folkman, Seminars in Oncology 29 , 15 (2002). 97. J. Kroll, J. Waltenberger, J. Biol. Chem. 272 , 32521 (1997). 98. E. Fournier et al. , Oncogene 18 , 507 (1999). 99. J. V. Soriano et al. , Molecular Cancer Therapeutics 3 , 1289 (2004). 100. T. Shono, H. Kanetake, S. Kanda, Experimental Cell Research 264 , 275 (2001).

211 GRB2 and Target Therapy

101. K. V. Stoletov, K. E. Ratcliffe, B. I. Terman, The FASEB journal : offi cial publication of the Federation of American Societies for Experimental Biology 16 , 1283 (2002).

102. S. Hiscox, W. G. Jiang, Biochemical and Biophysical Research Communications 233 , 1 (1997). 103. N. Kawakami-Kimura et al. , British Journal of Cancer 75 , 47 (1997). 104. E. M. Rosen et al. , CIBA Foundation Symposia 215 (1997). 105. M. Rosario, W. Birchmeier, Trends in Cell Biology 13 , 328 (2003). 106. K. Matsumoto, T. Nakamura, Cancer Science 94 , 321 (2003). 107. S. K. Mitra et al. , Oncogene 25 , 5969 (2006). 108. Y. Seko et al. , Biochemical and Biophysical Research Communications 262 , 290 (1999). 109. A. E. Aplin, A. Howe, S. K. Alahari, R. L. Juliano, Pharmacological Reviews 50 , 197 (1998). 110. B. Brenner et al. , Proceedings of the National Academy of Sciences 93 , 15376 (1996). 111. F. Qian, D. Hanahan, I. L. Weissman, Proceedings of the National Academy of Sciences of

the United States of America 98 , 3976 (2001). 112. H. W. H. G. Kessels, A. C. Ward, T. N. M. Schumacher, Proceedings of the National

Academy of Sciences of the United States of America 99 , 8524 (2002). 113. J. Burke et al. , Biochemistry« 6490 (1994). 114. Z. J. Yao et al. , Journal of Medicinal Chemistry 42 , 25 (1999). 115. Y. L. Song et al. , Journal of Medicinal Chemistry 49 , 1585 (2006). 116. B. Gay et al. , International Journal of Cancer 83 , 235 (1999). 117. K. Machida, B. J. Mayer, Biochimica et Biophysica Acta (BBA) - Proteins & Proteomics

1747 , 1 (2005). 118. J. Burke, International Journal of Peptide Research and Therapeutics 12 , 33 (2006). 119. G. Caravatti, J. Rahuel, G. Brigitte, P. Furet, Bioorganic and Medicinal Chemistry Letters 9 ,

1973 (1999). 120. N. Atabey et al. , Journal of Biological Chemistry 276 , 14308 (2001). 121. A. Giubellino et al. , Cancer Research 67 , 6012 (2007). 122. B. K. Kay, M. P. Williamson, M. Sudol, FASEB Journal 14 , 231 (2000). 123. B. J. Mayer, Journal of Cell Science 114 , 1253 (2001). 124. D. M. Berry, P. Nash, S. K. W. Liu, T. Pawson, C. J. McGlade, Current Biology 12 , 1336 (2002). 125. A. R. Viguera, J. L. R. Arrondo, A. Musacchio, M. Saraste, L. Serrano, Biochemistry 33 ,

10925 (1994). 126. S. M. Feller, M. Lewitzky, Current Pharmaceutical Design 12 , 529 (2006). 127. M. Harkiolaki et al. , EMBO Journal 22 , 2571 (2003). 128. M. R. Ferguson et al. , Protein Sci 13 , 626 (2004). 129. J. T. Nguyen, C. W. Turck, F. E. Cohen, R. N. Zuckermann, W. A. Lim, Science 282 , 2088

(1998). 130. C. Kardinal et al. , FASEB Journal 14 , 1529 (2000). 131. C. Kardinal et al. , Blood 98 , 1773 (2001). 132. S. M. Feller, G. Tuchscherer, J. Voss, Leukemia and Lymphoma 44 , 411 (2003). 133. D. Cussac et al. , FASEB Journal 13 , 31 (1999). 134. B. Gril et al. , International Journal of Cancer 121 , 407 (2007). 135. M. Vidal et al. , Biochemistry 43 , 7336 (2004). 136. C. Oneyama, H. Nakano, S. V. Sharma, Oncogene 21 , 2037 (2002). 137. M. Di Fulvio, K. M. Henkels, J. Gomez-Cambronero, Biochemical and Biophysical Research

Communications 357 , 737 (2007). 138. F. Huang, A. Sorkin, Mol. Biol. Cell 16 , 1268 (2005). 139. K. V. Morris, J. J. Rossi, Gene Therapy 13 , 553 (2006). 140. A. Giubellino et al. , Journal of Medicinal Chemistry 51 , 7459 (2008). 141. J. Ursini-Siegel, W. J. Muller, Cell Cycle 7 , 1936 (2008). 142. M. Kim et al. , Cell 125 , 1269 (2006). 143. S. Antoku, K. Saksela, G. M. Rivera, B. J. Mayer, Journal of Cell Science 121 , 3071 (2008). 144. K. B. Kaplan, J. R. Swedlow, D. O. Morgan, H. E. Varmus, Genes Dev. 9 , 1505 (1995). 145. A. Giubellino, J. Burke, D. P. Bottaro, Expert Opinion on Therapeutic Targets 12 , 1021 (2008).

22 A. Giubellino

146. N. Schiering, E. Casale, P. Caccia, P. Giordano, C. Battistini, Biochemistry 39 , 13376 (2000). 147. M. Brehme et al. , Proceedings of the National Academy of Sciences of the United States of

America 106 , 7414 (2009). 148. K. Strebhardt, A. Ullrich, Nature Reviews Cancer 8 , 473 (2008). 149. T. Pawson, R. Linding, FEBS Letters 582 , 1266 (2008). 150. A. L. Hopkins, Nature Chemical Biology 4 , 682 (2008). 151. L. Kuepfer, M. Peter, U. Sauer, J. Stelling, Nature Biotechnology 25 , 1001 (2007).

23M. Chatterjee and K. Kashfi (eds.), Cell Signaling & Molecular Targets in Cancer, DOI 10.1007/978-1-4614-0730-0_2, © Springer Science+Business Media, LLC 2012

Introduction

Arylamine N -acetyltransferases (NAT) are xenobiotic-metabolizing enzymes (XME) that participate in the metabolism of numerous aromatic and heterocyclic amine compounds including drugs and carcinogens [ 1 ] . NAT enzymes catalyze the transfer of an acetyl moiety from acetyl-CoA (AcCoA) to the nitrogen or oxygen atom of aromatic amines and their N-hydroxylated metabolites (Fig. 2.1 ). These phase II XME play, thus, an important role in the detoxifi cation and/or bioactivation of several therapeutic drugs and carcinogens [ 1 ] . NAT enzymes have been identifi ed in several species including bacteria [ 2 ] and lower eukaryotes [ 3, 4 ] . In humans, there are two polymorphic NAT loci producing two functional enzymes, NAT1 and NAT2. These two isoenzymes are encoded adjacent to each other on chromosome 8. A third locus encodes a pseudogene [ 5, 6 ] .

NAT1 and NAT2 are cytosolic enzymes (~31 kDa) that have very similar sequences (81% identity at the amino acid level). They have distinct but overlapping substrate preferences [ 7 ] . The two human isoenzymes have different tissue distribu-tions and are differently expressed during development [ 8 ] . NAT2 is principally expressed in the liver and in colon epithelium, which is in agreement with its xenobiotic-metabolizing function. Conversely, NAT1 is distributed widely in adult tissues [ 8 ] . Identifi cation of promoter regions suggests that NAT1 and NAT2 gene expression is independent and involves different transcription elements and factors [ 9, 10 ] . Polymorphisms affecting enzyme activity have been described for both genes and can lead to “slow” or “rapid” acetylator phenotypes. These interindivid-ual variations have been associated with adverse drug reactions and several diseases such as cancer [ 11, 12 ] . In addition to the genetic processes which control their

F. Rodrigues-Lima (*) Univ Paris Diderot-Paris 7, Unité de Biologie Fonctionnelle et Adaptative , 75013 Paris , France e-mail: fernando.rodrigues-lima@univ-paris-diderot.fr

Chapter 2 Human Arylamine N -acetyltransferase 1: From Drug Metabolism to Drug Target

Fernando Rodrigues-Lima , Julien Dairou , Florent Busi , and Jean-Marie Dupret

24 F. Rodrigues-Lima et al.

expression, the activity of human NAT enzymes, particularly NAT1, can also be modulated by “nongenetic factors” such as substrate-dependent downregulation, drug inhibition, or biological oxidants [ 13– 15 ] .

The genetic polymorphism in NAT activity was fi rst identifi ed in patients treated with isoniazid for tuberculosis [ 16 ] . This drug is primarily excreted following acety-lation by human NAT2. Since then, many therapeutic drugs such as hydralazine or sulfamethazine have been shown to be polymorphically acetylated in humans. It is now known that human NAT1 and NAT2 loci are highly polymorphic, with more than 26 and 53 alleles identifi ed at the NAT1 and NAT2 locus, respectively. Several of these NAT1 and NAT2 alleles can lead to slow acetylator phenotypes due to altered enzyme activity [ 1 ] . Common consequences of the polymorphic acetylation of therapeutic drugs are drug-associated adverse effects either due to rapid or slow acetylation [ 17 ] .

NAT-dependent acetylation plays an important role in the metabolic activation and detoxifi cation of environmental carcinogens such as 4-aminobiphenyl (4-ABP) or benzidine and changes in the N - and/or O -acetylation of these aromatic chemicals have been linked to carcinogenesis [ 18 ] .

In addition to its role in aromatic amine xenobiotic metabolism, there is strong evidence for an endogenous role of human NAT1 in folate catabolism through the NAT1-dependent N -acetylation of p -aminobenzoylglutamate ( p -ABAGlu) (Fig. 2.2 ) [ 19 ] .

More recently, several data have been published suggesting that NAT1 plays a biological role in breast cancer progression [ 20– 22 ] and that this XME could be targeted in treatment [ 2, 23 ] . Proteomic and microarray studies have shown that in breast cancer there is overexpression of the human NAT1 gene in estrogen receptor-positive tumors [ 20, 22 ] . In addition, it has been reported that overexpression of human NAT1 in luminal epithelial cells leads to enhanced growth and drug resis-tance [ 20 ] . These recent data suggest that human NAT1 could be targeted in breast cancer treatment [ 2 ] . Very recently, the fi rst human NAT1-specifi c inhibitors have been synthesized and tested in human breast cancer cell lines [ 23 ] .

NH2R NHCOCH3R

Arylamine Arylamide

CoAS COCH3 CoA SH

NHOHR NHOCOCH3R

Hydroxyarylamine Hydroxyarylamide

CoAS COCH3 CoA SH

Fig. 2.1 Main reactions catalyzed by NAT enzymes. N -acetylation of arylamine from acetyl-CoA (CoASCOCH3) ( upper part ) and N -acetylation of hydroxyarylamines from acetyl-CoA ( lower part )

252 Human Arylamine N -acetyltransferase 1: From Drug Metabolism to Drug Target

Human NAT1 Gene Structure and Polymorphism

Human NAT1 gene is located on chromosome 8 at 8p22, a chromosomal region commonly deleted in certain human cancers [ 6 ] . NAT1 gene consists of at least nine exons spanning 52 kb [ 9 ] . The full coding sequence (870 bp) is contained within exon 9. Several NAT1 transcripts have been described which contain vari-ous combinations of the exons in the 5’ UTR [ 9, 24 ] . These mRNA originate mainly from two different promoters (Fig. 2.3 ) named NATa and NATb [ 25 ] which are, respectively, located 51.5 and 11.8 kb upstream of the single translated exon.

N

N N

N

OH

NH2

NH

NH

O

OH

O

O OH

Folic Acid

O

OOH

N

N N

N

OH

NH2

6 Methyl-pteridine

H2N

NH

NH

NH

OH

O

PABA-Glu

O

OH

O

OOH

O

H3C

N-acetylPABA-Glu

NAT1

Fig. 2.2 Potential role of NAT1 in folate catabolism through N -acetylation of p-ABAGlu

26 F. Rodrigues-Lima et al.

A proximal promoter at −245 bp has also been described [ 26 ] but is unlikely to be of biological importance [ 25 ] . Transcription of NAT1 gene occurs in a wide variety of tissues and cell lines, and most mRNAs are initiated at the NATb promoter which is upstream of exon 4. This promoter gives rise to at least fi ve different tran-scripts which have different translational effi ciencies, although the biological sig-nifi cance of this is unknown [ 9, 24 ] . The most common transcript is the shortest and comprises exons 4, 8, and 9 only (Fig. 2.4 ). RT-PCR studies [ 27 ] showed that the alternative promoter, NATa, is most highly expressed in a few tissues, including lung, trachea, kidney, and liver suggesting that the activity of this promoter is tis-sue specifi c. Two major and four major transcripts arising from the NATa promoter and beginning with exon 1 have been reported [ 9 ] . So far, the biological signifi -cance of these different transcripts remains unknown [ 25 ] .

The pattern of placental NAT1 expression during human development and the spatial and temporal expression of the murine ortholog of human NAT1 ( Nat2 ) are likely due to transcriptional regulation [ 28 ] . Recently, androgens have been

open reading frame

exon

promoter

1 2 3 4 5 6 7 8 9

4 8 9major mRNA:

gene structure:NATa NATb

Fig. 2.3 Structure of the human NAT1 gene

Fig. 2.4 Structure of human NAT1 showing the positions of polymorphic variants. Backbone is shown as ribbons; wild-type residues are shown in ball-and-stick and correspond to the enzyme coded by NAT1*4 allele

272 Human Arylamine N -acetyltransferase 1: From Drug Metabolism to Drug Target

shown to increase NAT1 mRNA transcription from the NATb promoter in two prostate cancer cell lines [ 29 ] . In addition, high levels of NAT1 gene expression have been described in the estrogen receptor-positive human breast cancer ZR-75-I cell line correlated with high transcription level from the NATa pro-moter [ 22 ] .

Expression of human NAT1 and NAT2 genes differs during development. Contrary to NAT2 , NAT1 gene is expressed in placenta in the fi rst trimester and at the blasto-cyst stage [ 8 ] . In addition to its expression in tissues possessing xenobiotic metabo-lism functions, NAT1 is also known to be expressed in tissues not normally associated with xenobiotic metabolism such as lymphocytes and red blood cells [ 8 ] . The large tissular expression of human NAT1 compared to NAT2 further supports the hypoth-esis that NAT1 could be involved in endogenous functions.

The existence of polymorphic variants of the human NAT enzymes was fi rst identifi ed through population genetic studies of phenotypic variation [ 16 ] . NAT1 has long been thought to be genetically invariant. However, in 1993 several allelic variants at the NAT1 locus were fi rst described [ 30 ] . To date, 26 different NAT1 alleles have been detected in human populations [ 31, 32 ] . Phenotypic differences are mainly due to single nucleotide polymorphisms (SNP) which are inherited effectively as haplotypes with up to six SNP per allele [ 33 ] . These SNPs and the NAT1 alleles are described in detail on the website http://louisville.edu/medschool/pharmacology/NAT.html . Most SNPs (19 out of 21) occur in the coding region (exon 9). Certain SNPs have also been described in the 5 ¢ and 3 ¢ UTR regions of NAT1; however, their functional effects are poorly understood [ 31 ] . In addition to SNPs, deletions and insertions within the 3’UTR region have also been reported. Several SNPs in the coding region lead to amino acid substitutions leading to enzyme variants with reduced or no activity [ 34 ] . Certain SNPs can also lead to truncated NAT1 enzyme [ 2 ] . As indicated above, NAT1 polymorphism can result in NAT1 protein variants with altered enzymatic activity or decreased abundance in human cells [ 2 ] . These genetic mechanisms are the basis for the existence of “slow” versus “rapid” NAT1 acetylator groups. Loss of function alleles that results in a slow acetylator phenotype include NAT1*14 , NAT1*15 , NAT1*17 , NAT1*19, and NAT1*22 [ 31 ] . The effect of the human NAT1*10 allele, which in certain cases appears to increase activity and in other cases appears to have no effect [ 2 ] , may be an example of the complex effects of polymorphisms in the noncoding region on transcription and the extent of translation of this transcript [ 32 ] .

Contrary to NAT2, human NAT1 gene shows less variation in allelic frequencies among populations which may refl ect a selective advantage in minimizing the per-sistence of various NAT1 alleles [ 35 ] . The reference NAT1*4 allele (~70% in popu-lations of European descent) and NAT1*10 which contains two SNPs outside the coding region (~20% in populations of European descent) are common in most ethnic groups studied so far. Slow acetylator alleles account for less than 3% of the NAT1 alleles found in persons of European descent [ 11 ] but up to 25% in certain populations [ 36 ] .

Decreased cellular activity of most NAT1 variants correlates well with reduced proteins levels. Most of these variants did not exhibit transcription defi ciency [ 2 ]

28 F. Rodrigues-Lima et al.

indicating that the reduced cellular levels of these NAT1 alloenzymes are caused by mechanisms that act on NAT1 protein. Work from Hein’s group suggested that low intrinsic stability leading to intracellular degradation could account for the weak cellular activity of certain NAT1 variant [ 34 ] . Minchin and collaborators proposed a model for the rapid degradation of certain NAT1 variants by the proteasome. They hypothesized that NAT1 exists in the cell in either a stable acetylated state or an unstable non-acetylated state [ 14 ] . The variant alloenzymes may contain structural features that prevent catalytic formation of an acetylthioester and hence favor the formation of non-acetylated enzymes. These forms are more readily ubiquitinated and degraded by the protease, resulting in low amounts of NAT1 [ 14 ] . Recent work from Walters’s group also support the notion that low cellular NAT1 activity of certain variants is due to cellular degradation likely due to incorrect folding. Using green fl uorescent protein-tagged NAT1 variants, they showed that contrary to the “wild-type,” active NAT1 enzyme which is distributed in the cytosol, certain vari-ants are found clustered in aggresomes that are rapidly ubiquitinated and degraded [ 37 ] . It appears from all these studies that NAT1 slow acetylator phenotypes are associated with SNPs in the coding region that alter the NAT1 protein structure leading to its degradation in cells.

Human NAT1 Protein Structure

The understanding of the structural characteristic of the NAT1 enzyme began with the identifi cation of sulfhydryl-containing residues as being essential for acetyla-tion of the substrates [ 38 ] . Site-directed mutagenesis confi rmed this point by show-ing that a cysteine residue conserved in all NAT enzymes is crucial for catalytic activity [ 39 ] . In 2000, the crystal structure of the bacterial NAT from Salmonella typhimurium gave a clear understanding of the active site of NAT enzymes [ 40 ] . Unexpectedly, the structure showed a cysteine protease-like catalytic triad (Cys-His-Asp) that appears to be conserved in all NAT enzymes [ 40 ] . Since then, the structure of several bacterial NAT enzymes have been reported [ 2, 41 ] . In 2007, the structures of the human NAT1 and NAT2 isoforms were published [ 42 ] . Overall, these structural studies indicate that all NAT enzymes share a conserved “NAT” fold that is related, at least in part (active site core), to cysteine protease enzymes [ 43 ] . The NAT fold consists of a three-domain structure of approximately equal length (~100 amino acids). The fi rst domain is predominantly alpha helical, the second domain is predominantly beta sheets and the third domain is alpha–beta lid [ 2 ] . The residues of the active site are in domains one and two which are the most highly conserved. The C-terminus is less conserved and has a major role in sub-strate specifi city. Indeed, the positioning of the C-terminal regions of human NAT1 and NAT2 proximal to the catalytic cavity allows for additional interactions between NAT amino acids and the substrates [ 2 ] . In addition, its length controls enzymatic activity [ 44 ] . Comparison of human and bacterial NAT structures identi-fi ed the existence of a loop (between domains two and three) which is found only

292 Human Arylamine N -acetyltransferase 1: From Drug Metabolism to Drug Target

in eukaryotic NAT enzymes [ 2 ] . This “eukaryotic-specifi c” loop appears to be important for the differences between the CoA binding sites in eukaryotic and prokaryotic NAT enzymes [ 45 ] .

The recent determination of the structures of the human NAT1 and NAT2 enzymes has rationalized previous comparative studies on the enzyme substrate specifi city showing how variations at one position may contribute to selective bind-ing of certain drugs or carcinogens to NAT1 or NAT2 [ 42, 46 ] . The crystal struc-tures of NAT1 and NAT2 have contributed to understand the impact of polymorphisms on the enzyme structure and activity [ 2 ] and have also allowed the identifi cation of the key bonds required to maintain both the active site and the NAT fold (Fig. 2.4 ). Comparison of the human and prokaryotic structures is likely to be of prime impor-tance for the rational design of specifi c inhibitors of human and/or bacterial NAT isoforms [ 2 ] .

Animal Models to Understand NAT1 Functions

NAT enzymes have been identifi ed in different eukaryotic species, in particular in rodents. Animal models have played an important role in understanding the phar-macogenetics variations and the molecular effects of the NAT polymorphisms [ 31 ] . Indeed, earlier studies reported variability in NAT activity among different mouse, Syrian hamster, and rat [ 2 ] . These animals were later found to possess three func-tional NAT genes, although one of these genes ( Nat3 ) generates a relatively inactive enzyme. Nat3 is likely to be evolving to become a pseudogene, like the third locus ( NATP1 ) in humans [ 33 ] .

Mouse models have recently been very useful to understand the role of NAT enzymes and, in particular, of human NAT1. Indeed, mouse Nat2 and human NAT1 share close sequence identity and substrate specifi city and have similar tissue distribution [ 47 ] . Nat2 is thus considered as the murine ortholog of NAT1 , and several studies aimed at understanding the role of human NAT1 have used Nat2 as a model [ 8 ] . Knockout mouse strains for Nat2 gene showed that, in small population studies, the mice were devoid of any obvious developmental defects [ 48 ] . Inactivation of both Nat1 and Nat2 genes in a double-knockout strain was apparently aphenotypic. However, these mice were found to have compromised metabolic activities toward aromatic amine substrates [ 49 ] in agreement with their role in xenobiotic metabolism. In large population studies, strains devoid of Nat2 showed a bias in the sex ratio of live-born offsprings [ 50 ] . In addition, the frequency of neural tube defect was increased tenfold in heterozygous Nat2 null/wt offsprings [ 51 ] . Interestingly, Nat2 has been reported to be involved in the susceptibility to teratogen-induced orofacial clefting [ 2 ] . It has been suggested that human NAT1 and Nat2 could play a role in the catabolism of folate. Indeed, both enzymes have been found to acetylate the folate catabolite, p -aminobenzo-ylglutamate (p-ABAGlu) [ 19, 47 ] (Fig. 2.2 ). Recent studies showed that acety-lated p-ABAGlu was present in the urine of WT mice fed with a folate supplement,

30 F. Rodrigues-Lima et al.

but not in the urine of Nat2 null/null knockouts [ 52 ] . These data further support a putative endogenous role of NAT1/Nat2 in the metabolism of folate.

Contrary to the Nat2 gene invalidation, overexpression of its human ortholog NAT1 in transgenic mice appears to have deleterious effects with many lethal malformations, including tail kinks resembling neural tube defects which could be associated with folate defi ciency [ 53 ] . This is in agreement with a putative role of NAT1 in folate metabolism with excess NAT1 activity promoting folate defi ciency [ 2 ] .

As stated above, although the transgenic mice initially appeared to have no particular phenotype (except compromised aromatic amine metabolism), several studies suggest that deletion of Nat2 is associated with congenital abnormalities and imbalance in the sex ratios of offsprings. Most of these defects could be due to epigenetic effects through changes in DNA methylation [ 22 ] . Important stud-ies are in progress to analyze the effects of carcinogen exposures on mice lacking Nat2.

Possible Relevance of NAT1 in Cancer

Changes in the NAT-dependent N - and or O -acetylation of aromatic amine com-pounds have been linked to carcinogenesis [ 1, 54 ] . However, several studies strongly suggest that in addition to xenobiotic metabolism, NAT1 may have other functions [ 2, 32 ] . Recent data point to a role of NAT1 in cancer mechanisms and in particular in breast tumor biology [ 2 ] . In a comparative 2D proteomic study by Adams et al., NAT1 was found to be among the most consistently upregulated proteins in invasive ductal carcinoma and invasive lobular carcinoma when compared to normal human breast tissue [ 20 ] . Overexpression of NAT1 in normal breast luminal epithelial cells induced two of the hallmark traits of cancer, i.e., enhanced growth and resistance to etoposide, a therapeutic cytotoxic drug used in cancer treatment [ 20 ] . The proteomic data reported by Adams et al. were further supported by detailed analysis of a series of microarray-based studies that compared the expression profi les of thousands of human genes between malignant and normal breast tissue, or between estrogen receptor-positive (ER+) and ER-negative (ER−) breast tumors. The results of these microarray-based studies have been recently reviewed by Wakefi eld et al. [ 22 ] and are available through the oncomine website ( http://www.oncomine.org/ ). NAT1 gene appears among the fi ve most highly overexpressed genes in ER+ and in pro-gesterone receptor-positive tumors. In addition, NAT1 was found to be among the genes that are downregulated in the late-stage breast tumors [ 22 ] . The molecular basis for the upregulation of NAT1 gene is not known. In their recent study, Wakefi eld et al. [ 22 ] showed that the levels of NAT1 in different ER+ breast cancer cell lines differ signifi cantly (up to 40 times higher activity for the human ZR-75-1 cell line compared to the others). Elevated levels of NAT1 were not due to alteration in gene copy number in this cell line. Further analysis indicated that only the cell line with highest NAT1 activity (ZR-75-1) had NAT1 transcripts originating from the distal promoter NATa. The other cell lines tested had much less NAT1 activity, and NAT1

312 Human Arylamine N -acetyltransferase 1: From Drug Metabolism to Drug Target

transcripts were derived from the NATb promoter (Fig. 2.3 ). Interestingly, previous analysis of promoter use in normal human tissue indicates that the NATa promoter is tissue specifi c and active in liver, kidney, lung, and trachea [ 27 ] . In addition to the difference in the use of the promoters, there is variability in the 3 ¢ end of the human NAT1 gene transcript that may be associated with different levels of expression in breast cancer cell lines [ 22 ] . Moreover, both human NAT genes are encoded within a 200-kb region along with the human NAT pseudogene, and this region of the genome (8p22) [ 5 ] is unstable in several tumors, showing loss of heterozygosity or gene duplication [ 54 ] .

So far, there is no clear evidence linking NAT1 expression and estrogens. Several other results add complexity to the involvement of NAT1 in breast cancer. For instance, Kim et al. [ 55 ] have reported differential methylation of the NAT1 gene in breast cancers compared to benign or normal tissue [ 55 ] suggesting that genetic and epigenetic mechanisms act on NAT1 expression. Clinical studies reported that high levels of NAT1 expression are associated with longer relapse-free survival of patients with ER+ breast cancer undergoing treatment with tamoxifen [ 21 ] . Interestingly, it has been shown that the activity of human NAT1 and its murine counterpart Nat2 could be inhibited by tamoxifen [ 47, 56 ] . This suggests that NAT1 may be infl u-enced directly by estrogen agonists or antagonists.

Recent data also suggest altered regulation of NAT1 in prostate cancer. Indeed, Butcher et al. [ 29 ] have shown the androgen induction of NAT1 in prostate cancer cells which is in agreement with the presence of androgen response elements upstream of the human NAT1 and murine Nat2 coding exons [ 29 ] . Androgens are known to be important for the prostate cancer development and progression [ 57 ] . In addition, a recent microarray study identifi ed three separate tumor subtypes express-ing different levels of NAT1 [ 58 ] .

NAT1 as a Drug Target in Cancer

The increasing evidence for an association of NAT1 with carcinogenesis, in particular with breast cancer, suggests that this XME could be targeted for breast cancer therapy [2]. Interestingly, recent studies have reported that certain well-known anticancer drugs are able to inhibit NAT1 enzyme in vitro and in vivo (Fig. 2.5 ). Tamoxifen, an antagonist of the estrogen receptor that is currently used to treat hormone- positive breast cancers, has been shown to inhibit NAT1 and its murine ortholog Nat2 [ 47, 56 ] . Recently, cisplatin, one of the most important chemotherapeutic compounds used in the treatment of various human cancers [ 59 ] , has been found to irreversibly inhibit NAT1 [ 60 ] . Indeed, studies using recombinant NAT1 protein in human breast cancer cell lines and mice showed that cisplatin, at pharmacologically relevant concentra-tions, was able to impair the endogenous catalytic functions of NAT1. Mechanistic analysis of this inhibition indicated that NAT1 inactivation was rapid. The second-order rate constant for the inhibition of NAT1 by cisplatin was found to be the highest reported for a reaction between cisplatin and a biological target [ 60 ] . Although these

32 F. Rodrigues-Lima et al.

data do not demonstrate that alteration of NAT1 functions in breast cancer cells contributes to the therapeutic effect of cisplatin, these results emphasize the putative link between NAT1 and breast cancer. Another recent study also reports that disulfi ram also impairs NAT1 functions in human cancer cells [ 61 ] . Disulfi ram has been used for decades to treat alcoholism [ 62 ] . However, several studies indicate that this drug could be used in cancer treatment [ 62 ] . Interestingly, disulfi ram was found to inhibit enzymes that have been associated with cancer progression such as DNA topoisomerases, matrix metalloproteinases, and proteasome [ 61, 62 ] .

Specifi c inhibitors for prokaryotic NAT enzymes have been identifi ed/synthe-sized over the last years [ 63 ] . These studies have shown that inhibition of NAT activity in Mycobacterium bovis has effects similar to deleting the NAT gene [ 64 ] . More recently, Edith Sim’s team in Oxford has reported the identifi cation, synthesis, and evaluation of a series of selective inhibitors (rhodanine and thiazolidin-2,4-di-one derivatives) for human NAT1 and murine Nat2 [ 23 ] . The most potent inhibitor was found to act at submicromolar concentrations and to inhibit both the recombi-nant enzymes and human NAT1 in ZR-75 breast cancer cells in a competitive man-ner [ 23 ] . It is expected that rational drug design based both on the recently identifi ed inhibitors and on the structure of human NAT1 will enable the synthesis of highly potent molecules. These compounds are expected to improve our understanding of the contribution of NAT1 to breast cancer mechanisms and putatively will be of therapeutic interest. Recent data from R. Minchin’s laboratory further support the

COOH

NHOH

NO

N

CH3

CH3

CH3

Hydroxylamine para -aminobenzoic acid 2-nitrosofluorene

O

N

O

O−

peroxynitrite

OO

O

O

OH

HO

Pt

Cl

Cl NH2

NH2

cisplatin 11a-hydroxycinnamosmolidetamoxifen

Fig. 2.5 Chemical structure of compounds known to inhibit NAT1 enzyme

332 Human Arylamine N -acetyltransferase 1: From Drug Metabolism to Drug Target

contribution of NAT1 to cancer mechanisms and emphasize its potential role as a drug target. Using a specifi cic inhibitors or RNAi-mediated knock-down approaches, these authors show that inhibition of NAT1 in colon adenocarcinoma or breast cancer cells leads to growth inhibition [ 66 , 67 ] .

References

1. Hein, D. 2002, Mutat Res, 65, 65 2. Sim, E.., Walters, K. and Boukouvala, S. 2008, Drug Metab Rev, 40, 479 3. Rodrigues-Lima, F. and Dupret, J. M. 2002, Biochem Biophys Res Commun, 293, 783 4. Martins, M.., Rodrigues-Lima, F.., Dairou, J.., Lamouri, A.., Malagnac, F.., Silar, P. and

Dupret, J. M. 2009, J Biol Chem, 284, 18726 5. Matas, N.., Thygesen, P.., Stacey, M.., Risch, A. and Sim, E. 1997, Cytogenet Cell Genet, 77, 290 6. Butcher, N.., Boukouvala, S.., Sim, E. and Minchin, R. F. 2002, Pharmacogenomics J, 2, 30 7. Grant, D. M.., Blum, M.., Beer, M. and Meyer, U. A. 1991, Mol Pharmacol, 39, 184 8. Sim, E.., Westwood, I. and Fullam, E. 2007, Expert Opin Drug Metab Toxicol, 3, 169 9. Butcher, N. J.., Arulpragasam, A.., Goh, H. L.., Davey, T. and Minchin, R. F. 2005, Biochem

J, 387, 119 10. Husain, A.., Zhang, X.., Doll, M. A.., States, J. C.., Barker, D. F. and Hein, D. W. 2007, Drug

Metab Dispos, 35, 721 11. Hein, D. W.., Doll, M. A.., Fretland, A. J.., Leff, M. A.., Webb, S. J.., Xiao, G. H.., Devanaboyina,

U. S.., Nangju, N. A. and Feng, Y. 2000, Cancer Epidemiol Biomarkers Prev, 9, 29 12. Sim, E.., Lack, N.., Wang, C. J.., Long, H.., Westwood, I.., Fullam, E. and Kawamura, A. 2008,

Toxicology, 254, 170 13. Atmane, N.., Dairou, J.., Paul, A.., Dupret, J. M. and Rodrigues-Lima, F. 2003, J Biol Chem,

278, 35086 14. Butcher, N. J.., Arulpragasam, A. and Minchin, R. F. 2004, J Biol Chem, 279, 22131 15. Rodrigues-Lima, F.., Dairou, J. and Dupret, J. M. 2008, Curr Drug Metab, 9, 505 16. Evans, D. A. P. and White, T. A. 1964, J. Lab. Clin. Med., 63, 394 17. Meisel, P. 2002, Pharmacogenomics, 3, 349 18. Hein, D. W. 2000, Toxicol Lett, 112-113, 349 19. Minchin, R. F. 1995, Biochem J, 307, 1 20. Adam, P. J.., Berry, J.., Loader, J. A.., Tyson, K. L.., Craggs, G.., Smith, P.., De Belin, J..,

Steers, G.., Pezzella, F.., Sachsenmeir, K. F.., Stamps, A. C.., Herath, A.., Sim, E.., O’Hare, M. J.., Harris, A. L. and Terrett, J. A. 2003, Mol Cancer Res, 1, 826

21. Bieche, I.., Girault, I.., Urbain, E.., Tozlu, S. and Lidereau, R. 2004, Breast Cancer Res, 6, R252 22. Wakefi eld, L.., Robinson, J.., Long, H.., Ibbitt, J. C.., Cooke, S.., Hurst, H. C. and Sim, E.

2008, Genes Chromosomes Cancer, 47, 118 23. Russell, A. J.., Westwood, I. M.., Crawford, M. H.., Robinson, J.., Kawamura, A.., Redfi eld,

C.., Laurieri, N.., Lowe, E. D.., Davies, S. G. and Sim, E. 2009, Bioorg Med Chem, 17, 905 24. Husain, A.., Barker, D. F.., States, J. C.., Doll, M. A. and Hein, D. W. 2004, Pharmacogenetics,

14, 397 25. Butcher, N. J.., Tiang, J. and Minchin, R. F. 2008, Curr Drug Metab, 9, 498 26. Butcher, N. J.., Arulpragasam, A.., Pope, C. and Minchin, R. F. 2003, Biochem J, 376, 441 27. Barker, D. F.., Husain, A.., Neale, J. R.., Martini, B. D.., Zhang, X.., Doll, M. A.., States, J. C.

and Hein, D. W. 2006, Pharmacogenet Genomics, 16, 515 28. Wakefi eld, L.., Cornish, V.., Broackes-Carter, F. and Sim, E. 2005, J Histochem Cytochem,

53, 583 29. Butcher, N. J.., Tetlow, N. L.., Cheung, C.., Broadhurst, G. M. and Minchin, R. F. 2007, Cancer

Res, 67, 85

34 F. Rodrigues-Lima et al.

30. Vatsis, K. P. and Weber, W. W. 1993, Arch Biochem Biophys, 301, 71 31. Boukouvala, S. and Fakis, G. 2005, Drug Metab Rev, 37, 511 32. Minchin, R. F.., Hanna, P. E.., Dupret, J. M.., Wagner, C. R.., Rodrigues-Lima, F. and Butcher,

N. J. 2007, Int J Biochem Cell Biol, 39, 1999 33. Blum, M.., Grant, D. M.., McBride, W.., Heim, M. and Meyer, U. A. 1990, DNA Cell Biol, 9, 193 34. Fretland, A. J.., Doll, M. A.., Leff, M. A. and Hein, D. W. 2001, Pharmacogenetics, 11, 511 35. Upton, A.., Johnson, N.., Sandy, J. and Sim, E. 2001, Trends Pharmacol Sci, 22, 140 36. Dhaini, H. R. and Levy, G. N. 2000, Pharmacogenetics, 10, 79 37. Liu, F.., Zhang, N.., Zhou, X.., Hanna, P. E.., Wagner, C. R.., Koepp, D. M. and Walters, K. J.

2006, J Mol Biol, 361, 482 38. Riddle, B. and Jencks, W. P. 1971, J Biol Chem, 246, 3250 39. Dupret, J. M. and Grant, D. M. 1992, J Biol Chem, 267, 7381 40. Sinclair, J. C.., Sandy, J.., Delgoda, R.., Sim, E. and Noble, M. E. 2000, Nat Struct Biol, 7, 560 41. Martins, M.., Pluvinage, B.., de la Sierra-Gallay, I. L.., Barbault, F.., Dairou, J.., Dupret, J. M.

and Rodrigues-Lima, F. 2008, J Mol Biol, 383, 549 42. Wu, H.., Dombrovsky, L.., Tempel, W.., Martin, F.., Loppnau, P.., Goodfellow, G. H.., Grant,

D. M. and Plotnikov, A. N. 2007, J Biol Chem, 282, 30189 43. Rodrigues-Lima, F.., Deloménie, C.., Goodfellow, G. H.., Grant, D. M. and Dupret, J. M. 2001,

Biochem J, 356, 327 44. Mushtaq, A.., Payton, M. and Sim, E. 2002, J Biol Chem, 17, 12175 45. Fullam, E.., Westwood, I. M.., Anderton, M. C.., Lowe, E. D.., Sim, E. and Noble, M. E. 2008,

J Mol Biol, 375, 178 46. Liu, L.., Von Vett, A.., Zhang, N.., Walters, K. J.., Wagner, C. R. and Hanna, P. E. 2007, Chem

Res Toxicol, 20, 1300 47. Kawamura, A.., Westwood, I.., Wakefi eld, L.., Long, H.., Zhang, N.., Walters, K.., Redfi eld, C.

and Sim, E. 2008, Biochem Pharmacol, 75, 1550 48. Cornish, V.., Pinter, K.., Boukouvala, S.., Johnson, N.., Labrousse, C.., Payton, M.., Priddle,

H.., Smith, A. J. H. and Sim, E. 2003, Pharmacogenomics J, 3, 169 49. Sugamori, K. S.., Wong, S.., Gaedigk, A.., Yu, V.., Abramovici, H.., Rozmahel, R. and Grant,

D. M. 2003, Mol Pharmacol, 64, 170 50. Wakefi eld, L.., Long, H.., Lack, N. and Sim, E. 2007, Mamm Genome, 18, 270 51. Wakefi eld, L.., Cornish, V.., Long, H.., Griffi ths, W. J. and Sim, E. 2007, Biochem Biophys

Res Commun, 364, 556 52. Wakefi eld, L.., Cornish, V.., Long, H.., Griffi ths, W. J. and Sim, E. 2007, Biochem Biophys

Res Commun, 364, 556 53. Cao, W.., Chau, B.., Hunter, R.., Strnatka, D.., McQueen, C. A. and Erickson, R. P. 2005,

Pharmacogenomics J, 5, 255 54. Hein, D. W. 2006, Oncogene, 25, 1649 55. Thygesen, P.., Risch, A.., Stacey, M.., Fakis, G.., Takle, L.., Knowles, M. and Sim, E. 1999,

Pharmacogenetics, 9, 1 56. Kim, S. J.., Kang, H. S.., Chang, H. L.., Jung, Y. C.., Sim, H. B.., Lee, K. S.., Ro, J. and Lee,

E. S. 2008, Oncol Rep, 19, 663 57. Lee, J. H.., Lu, H. F.., Wang, D. Y.., Chen, D. R.., Su, C. C.., Chen, Y. S.., Yang, J. H. and

Chung, J. G. 2004, Res Commun Mol Pathol Pharmacol, 115-116, 217 58. Brooke, G. N.., Parker, M. G. and Bevan, C. L. 2008, Oncogene, 27, 2941 59. Lapointe, J.., Li, C.., Higgins, J. P.., van de Rijn, M.., Bair, E.., Montgomery, K.., Ferrari, M..,

Egevad, L.., Rayford, W.., Bergerheim, U.., Ekman, P.., DeMarzo, A. M.., Tibshirani, R.., Botstein, D.., Brown, P. O.., Brooks, J. D. and Pollack, J. R. 2004, Proc Natl Acad Sci U S A, 101, 811

60. Ott, I. and Gust, R. 2007, Anticancer Agents Med Chem, 7, 95 61. Ragunathan, N.., Dairou, J.., Pluvinage, B.., Martins, M.., Petit, E.., Janel, N.., Dupret, J. M.

and Rodrigues-Lima, F. 2008, Mol Pharmacol, 73, 1761 62. Malka, F.., Dairou, J.., Ragunathan, N.., Dupret, J. M. and Rodrigues-Lima, F. 2009, Febs J,

276, 4900 63. Sauna, Z. E.., Shukla, S. and Ambudkar, S. V. 2005, Mol Biosyst, 1, 127

352 Human Arylamine N -acetyltransferase 1: From Drug Metabolism to Drug Target

64. Brooke, E. W.., Davies, S. G.., Mulvaney, A. W.., Pompeo, F.., Sim, E. and Vickers, R. J. 2003, Bioorganic & Medicinal Chemistry, 11, 1227

65. Madikane, V. E.., Bhakta, S.., Russell, A. J.., Campbell, W. E.., Claridge, T. D.., Elisha, B. G.., Davies, S. G.., Smith, P. and Sim, E. 2007, Bioorg Med Chem, 15, 3579

66. Tiang, J. M.., Butcher, N. J.., Cullinane, C.., Humbert P. O. and Minchin, R. F. 2011, PLoS One 6:e17031

67. Tiang, J. M.., Butcher, N. J. and Minchin, R. F. 2010, Biochem Biophys Res Commun, 39, 95

37M. Chatterjee and K. Kashfi (eds.), Cell Signaling & Molecular Targets in Cancer, DOI 10.1007/978-1-4614-0730-0_3, © Springer Science+Business Media, LLC 2012

Introduction

There has been renewed interest in the use of selective amino acid deprivation as a method to treat various cancers. It has been known for years that certain cancers are auxotrophic for particular nonessential amino acids. By exploiting the differences between normal human cells and cancer cells, one can target these cancers and potentially reduce the potential side effects of the drugs. The best example so far has been the use of asparaginase in the treatment of acute lymphoblastic leukemia (ALL). ALL cells have a requirement for L-asparagine, a nonessential amino acid in humans. By depleting this amino acid, ALL cells can be targeted and drug toxicity reduced.

In this chapter, we will focus on arginine depletion as another amino acid deprivation target for cancers.

Background

Reversible inhibition of mitosis in lymphocytes cultures by Mycoplasma was fi rst noted by Copperman and Morton in 1966 [ 1 ] . The mechanism behind Mycoplasma inhibition of lymphocyte transformation induced by phytohaemagglutinin was described by Barile and Leventhal two years later [ 2 ] . They discovered that the depletion of arginine was the underlying mechanism. Gill and Pan in 1970 found that addition of arginine could reverse the inhibition of cell division in L5178Y cells by arginine-degrading Mycoplasma and the possible role of arginine

L. Feun (*) Sylvester Cancer Center, University of Miami school of Medicine , Miami, FL 33125, USA e-mail: lfeun@med.miami.edu

Chapter 3 Targeting Argininosuccinate Synthetase in Cancer Therapy

Niramol Savaraj , Min You , Chunjing Wu , Macus Tien Kuo , Vy Dinh , Medhi Wangpaichitr , and Lynn Feun

38 N. Savaraj et al.

deiminase [ 3 ] . Subsequently, Fenske and Kenny reported on the role of arginine deiminase in the growth of Mycoplasma [ 4 ] , and Weickmann and Fahrney pro-vided evidence of multiple forms of arginine deiminase from Mycoplasma [ 5 ] . It was not until 1990 that Sugimura identifi ed arginine deiminase as the lymphocyte blastogenesis factor originating from Mycoplasma arginini [ 6– 8 ] . In the same year, Miyazaki et al. reported on the potent growth inhibition of human tumor cells in culture by arginine deiminase purifi ed from culture medium in cell lines infected with Mycoplasma [ 9 ] . Later, Takaku described the in vivo antitumor activity of arginine deiminase [ 10, 11 ] .

Taken together, these reports suggest that arginine deprivation, such as after treat-ment with arginine deiminase isolated from Mycoplasma , represents a novel approach to the therapy of various malignancies which require exogenous arginine.

Why Arginine Deprivation Is Important

The amino acid arginine is involved in several important cellular functions. These include polyamine synthesis, creatine production, and nitric oxide production [ 12– 14 ] . Arginine is the only endogenous source of nitric acid in humans [ 12 ] . Humans derive arginine from several sources. These include the diet, body protein turnover, and de novo synthesis.

In adult humans, arginine is considered a nonessential amino acid since it can be synthesized from citrulline. However, endogenous production of arginine may be insuffi cient under certain circumstances, such as when cells are under stress or need to proliferate during wound healing. As mentioned, certain tumor cells require exogenous arginine in order to grow and proliferate, and diet restriction of arginine may actually inhibit metastatic growth [ 15– 17 ] .

Arginine is synthesized from citrulline via the urea cycle (Fig. 3.1 ). There are two key enzymes involved: (1) argininosuccinate synthetase (ASS) which

converts L-citrulline and aspartic acid to argininosuccinate and (2) argininosuccinate lyase (ASL) which then converts argininosuccinate to L-arginine and fumaric acid. L-arginine can also be degraded by the urea cycle enzyme arginase to L-ornithine. L-ornithine is converted back to L-citrulline by ornithine carbamoyl transferase (OCT) and then is recycled back to arginine. Wheatley has suggested that ASS and ASL are tightly coupled [ 18– 20 ] . The sensitivity of tumor cells to arginine deprivation may depend on their ability to synthesize arginine from alternative intermediates in the urea cycle such as ornithine, citrulline, and argininosuccinate.

There are three enzymes which can catabolize arginine: arginase, arginine decar-boxlyase, and arginine deiminase (ADI). Since 1950, arginase has been tried in experimental animals as an antitumor agent. No major responses were observed. There are several potential problems with arginase as a targeted therapy for cancer. First of all, arginase has a low affi nity for arginine, and larger amounts of the enzyme may be required to produce a response. Secondly, for arginase, the optimal pH is 9.5, which is high. On the other hand, Wheatley has shown that arginase may be effective at lower pH of 7.2–9 [ 15 ] . It is important to note that arginase catabolizes

393 Argininosuccinate Synthetase in Cancer Therapy

arginine to ornithine. The liver and the small bowel are known to be able to convert ornithine to citrulline due to the presence of OCT.

It is not clear whether other normal tissues are able to do this since OCT gene is hypermethylated and not expressed in these tissues. Thus, there is the potential for normal tissue toxicity from the use of arginase. Despite these potential problems, pegylated arginase has been shown to have both in vitro and in vivo activity in hepa-tocellular carcinoma [ 21, 22 ] . Another novel approach involves transhepatic chemoembolization of the liver augmented with high-dose insulin to induce leakage of hepatic arginase from the liver into the circulation [ 23 ] . The high-dose insulin was administered to induce a state of hypoaminoacidemia to augment arginine depletion. Five of seven patients with hepatocellular carcinoma had response to this treatment. The two patients with no response had no signifi cant reduction in plasma arginine levels. Since arginase has a short half-life, pegylation of arginase has been developed in attempt to produce sustained in vivo activity [ 24 ] . Further studies with pegylated arginase appear to be indicated.

One of the important factors which make arginine deprivation an attractive approach to treat cancer is that certain tumors lack ASS expression. These tumors include mela-noma, hepatocellular carcinoma, certain mesotheliomas, renal cell cancer and prostate cancers [ 25– 28 ] . These ASS(−) tumors will require exogenous arginine for their growth. Thus, by depleting arginine, one can inhibit cell growth [ 16, 29– 31 ] . Transfection of ASS also confers resistance to arginine deprivation treatment [ 30, 31 ] .

The question remains which is the best enzyme to deplete arginine. ADI has several advantages for a targeted therapy. It degrades arginine to citrulline and ammonia. Tumor cells which lack ASS expression will not be able to synthesize arginine from citrulline, while normal cells are able to do so. Theoretically, normal tissue toxicity can be avoided by this approach. Secondly, ADI is active at physiologic pH. Thirdly, unlike arginase, ADI has high affi nity for arginine [ 32 ] .

The major drawback for ADI is that it is not a normal human enzyme, but made by Mycoplasma . Therefore, ADI is highly immunogenic and has a short half-life. One method to prolong the half-life of the enzyme and reduce immunogenecity

ARGININOSUCCINATE

ARGININE CITRULLINE + Ammonium

ArgininosuccinateLyase

ADI

ArgininosuccinateSynthetase

(ASS)

ORNITHINE

ArginaseOrnithine

Carbamoyl transferase

Putrescine

Aspartate

Carbamoyl phosphateUrea

Detoxification

Fumarate

(OCT)

Fig . 3.1 Diagram for arginine metabolism in the urea cyle and the action of ADI and arginase

40 N. Savaraj et al.

is by pegylation. A number of pegylated forms of ADI have been tested. One pegylated form of ADI has been developed by Polaris, Inc (formerly Phoenix Pharmacologics) termed ADI-PEG20.

ADI is a recombinant protein of approximately 46,000 daltons which has a cova-lent attachment to polyethylene glycol (PEG) of 20,000 daltons. Each molecule of ADI is attached to approximately 13–16 molecules of PEG. ADI-PEG20 incorpo-rates the succinimidyl–succinate linker . ADI-PEG20 has undergone extensive in vitro and in vivo testing [ 30 ] . Subsequently, ADI-PEG20 has entered clinical trial in patients with malignant melanoma and hepatocellular carcinoma, and trials are planned for mesothelioma and possibly other tumor types [ 33– 37 ] .

Preclinical Antitumor Activity of ADI-PEG20

Takaku demonstrated that the addition of ADI to the culture media resulted in killing a number of tumors including melanoma and hepatocellular carcinoma [ 10 ] . Sugimura also showed that the growth inhibition of melanoma cells induced by arginine depriva-tion could not be reversed by the addition of the amino acid citrulline [ 38 ] . He hypoth-esized that melanoma cells lack argininosuccinate synthetase and hence cannot synthesize arginine from citrulline. Studies by Ensor et al. demonstrated that the human melanoma cell lines SK-mel2 and SK-mel28 were inhibited in a dose-dependent man-ner by adding ADI to the culture media [ 30 ] . These cells were found to express argini-nosuccinate lyase mRNA but not that of argininosuccinate synthetase by northern blot analysis. To confi rm this hypothesis, SK-mel2 and SK-mel28 cells were transfected with a plasmid containing the human argininosuccinate synthetase cDNA using a cyto-megalovirus promoter. The transfected cells were resistant to ADI. In the in vivo study, Takaku has shown that mice implanted with human melanomas and hepatocellular carcinomas and treated with ADI resulted in inhibition of tumor growth and extended life expectancy [ 10, 11 ] . These results were further confi rmed with several other human melanomas including SK-mel2 and SK-mel28 [ 30 ] . Furthermore, when dogs with spontaneous melanoma of the oral cavity were treated with ADI-PEG20, clinical responses were observed. These results confi rm that ADI-PEG20 has antitumor activ-ity in melanoma. Similarly, hepatocellular carcinomas, SK-hep1, SK-hep2, and SΚ-hep3, implanted in mice were also inhibited when treated with ADI-PEG20.

ASS Expression and Arginine Deprivation in Melanoma

As stated earlier, multiple studies have demonstrated that arginine deprivation using ADI showed antitumor activity both in vitro and in vivo. Furthermore, Ensor has tested 16 melanoma cell lines and found no ASS expression in all these mela-noma cell lines. In human tumor samples, the majority of melanomas and hepato-cellular carcinomas do not express ASS, while lung cancer and breast cancer cells

413 Argininosuccinate Synthetase in Cancer Therapy

were usually positive for ASS. In our laboratory, we evaluated the effect of degrad-ing arginine in the culture media using ADI or exposing melanoma cells to argin-ine-free media. Our results demonstrated that ADI treatment results in growth inhibition which eventually leads to cell death [ 31 ] . Four ASS(−) melanoma cell lines (A375, SK-mel2, A2058, and Mel-1220), one normal human fi broblast cell line (BJ-1), and one ASS-positive NSCLC cell line were studied. The ID50 (growth inhibitory effect) for the four melanoma cell lines after 3-day treatment ranged from 0.05 to 0.1 ug/ml, and it was greater than 1 ug/ml in BJ-1 and NSCLC cell lines. It is of interest to note that at 72 h after treatment, the ASS protein can be detected by western blot analysis with A2058 expressing the highest level (2.76-fold increase), while in Mel-1220, it was not detectable, and A375 has negligible increased ASS protein. The cell lines (BJ-1 and NSCLC) which consti-tutively express ASS did not show changes in ASS protein after exposure to argi-nine-free media [ 31 ] . The changes in ASS expression upon arginine deprivation is also detected at the transcriptional levels using real-time RT-PCR.

The ASS mRNA showed about 3-fold increase in A2058 followed by about two- to threefold increase in SK-mel2, while negligible changes occurred in A375 and Mel-1220. However, upon arginine replenishment, ASS mRNA and protein is back to normal [ 31 ] . Thus, it appears that arginine in the media controls ASS expression in certain melanoma cell lines.

In our ongoing phase II trial in melanoma, we have studied ASS expression in tumor samples obtained prior to treatment with ADI-PEG20 and after progression or relapse. Two patients had tumor samples tested for ASS expression prior to ther-apy and were ASS(−). Both patients had a partial response to ADI-PEG20 but later had progression of disease. At the time of tumor progression, tumor samples were obtained again and were ASS positive. One patient’s tumor sample prior to treat-ment with ADI-PEG20 was found to be ASS positive, and this patient did not respond to therapy. Of 11 patients whose tumor samples were ASS(−), seven had evidence of antitumor activity (partial response, mixed response, minor response). While the data is still preliminary, it suggests that there may be a correlation between ASS tumor expression and clinical antitumor activity. This trial is continuing to accrue more patients.

Arginine Deprivation in Hepatocellular Carcinoma

Dillon reported that all 51 hepatoma cell lines studied were ASS negative by immu-nohistochemical staining [ 25 ] . Ensor found that some hepatocellular cell lines which lack ASS expression were sensitive to arginine deprivation with ADI-PEG20 [ 30 ] . On the other hand, Cheng found that fi ve hepatoma cell lines had ASS expres-sion and were not sensitive to ADI [ 21, 22 ] . These cell lines lack OCT and were also sensitive to arginase. PEG-arginase also has been reported to have activity in vivo against hepatoma. Therefore, it is not clear how frequent ASS expression occurs in hepatoma and whether ADI or arginase is the better agent of choice for clinical trial.

42 N. Savaraj et al.

Arginine Deprivation in Other Tumor Cell Types

Dillon has reported that some renal cell cancers and sarcomas as well as some prostate cancers lack ASS expression [ 25 ] . Other investigators also found lack of ASS expres-sion in certain mesothelioma and neuroblastomas [ 26, 39 ] . Renal cell cancers which were negative for ASS expression by immunohistochemical staining were also found to be sensitive to ADI-PEG20 [ 25, 27 ] . This is of interest that the normal renal epithe-lium has high levels of ASS expression. Similarly, mesothelioma cell lines which lack ASS expression are also sensitive to arginine deprivation with ADI [ 26 ] . In contrast, mesothelioma cell lines which express ASS were resistant to ADI. In one study using immunohistochemical staining, 63% of mesothelioma cell lines express low levels of ASS. Thus, arginine deprivation may be a useful agent to treat certain mesotheliomas. A clinical trial using ADI-PEG20 is being planned for mesothelioma (Szlosarek, personal communication). Certain other tumor cell lines which may be sensitive to arginine deprivation include human T and B cell lymphoblastic cell lines [ 40, 41 ] . Interestingly, arginine deprivation with ADI-PEG20 showed better antitumor effect than L-asparaginase which is approved for lymphoblastic leukemia. Neuroblastoma cell lines have also been shown to be sensitive to arginine deprivation with ADI.

How Arginine Deprivation Affects Growth and Apoptotic Signaling

Arginine Deprivation Affects mTOR Signaling

Although arginine is a nonessential amino acid in normal cells which possess ASS, however, in ASS(–) tumor cells, it becomes an essential amino acid. Thus, arginine deprivation inhibits mTOR similar to those reported with nutritional deprivation such as amino acid deprivation. We have found that upon arginine deprivation, ASS(–) cells activate AMPK, which is known to regulate mTOR activity via energy/nutrient sensing [ 42 ] . When cells are deprived of ATP (high AMP/ATP) ratio, AMPK is activated via phosphorylation by LKB or other upstream kinase(s) [ 43, 44 ] . Activated AMPK downregulates energetically demanding processes like trans-lation by inhibiting mTOR [ 45 ] . In this regard, we have studied the effects of ADI-PEG20 treatment on ATP levels and AMPK activation. Our data showed that the ATP decreased by 30%, 55%, 50%, and 60% in Mel-1220 , A2058, SK-mel2, and A375, respectively, at 72 h corresponding to the activation of AMPK. Activation of AMPK also results in mTOR inhibition as evidenced by decreased 4E-BP phospho-rylation, while p70S6K phosphorylation only decreased in two cell lines, which are ASS negative and cannot be induced. We have also studied three additional cell lines derived from patients whose tumors were ASS negative and cannot be induced. These cell lines also showed activation of AMPK upon arginine deprivation and

433 Argininosuccinate Synthetase in Cancer Therapy

inhibition of 4E-BP [ 42 ] . Thus, our data demonstrated that upon arginine deprivation in ASS(−) melanoma cells, activation of AMPK occurs which in turn has a negative impact on mTOR activity [ 42 ] . In this regard, Kim et al. also have shown that argi-nine deprivation results in decreased mTOR phosphorylation in prostate cancer cell lines which do not express ASS [ 28 ] . Thus, one can conclude that arginine depriva-tion in ASS(−) tumor cells results in mTOR inhibition which can ultimately lead to autophagy [ 46 ] .

Arginine Deprivation on RAF/MEK/ERK1/2 Signaling

It is known that approximately 60% of melanoma tumors possess BRAF mutation (V600E). Activation of BRAF has been shown to be one of the major growth signaling for melanoma. In fact, BRAF inhibitor has been developed to treat melanoma, with variable success depending on the specifi city of the compound [ 47, 48 ] . We have found that upon treatment with ADI-PEG20, activated MEK and ERK, as detected by the phosphorylated form, increased, while no signifi cant changes occurred in BRAF. Interestingly, the addition of MEK inhibitor (U0176 or PD98059) increased apoptosis when used in combination with ADI-PEG20 treatment. Thus, it appears activation of MEK and ERK may be an attempt for the cells to survive upon arginine deprivation through autophagy. To support this, recently it has been shown that activation of MEK and ERK are important in noncanonical autophagic process [ 49 ] . Inhibition of this process can result in apoptosis [ 49 ] . In addition, Wang et al. have shown that upon amino acid deprivation, activation of MEK and ERK occurs which results in protective autophagy, while sustained activation of MEK/ERK results in destructive autophagy [ 49 ] . They have also shown that activation of AMPK during nutritional deprivation activates MEK1 and leads to disassembling of mTORC1 complex via binding to and activation of TSC2. These fi ndings confi rm our results that arginine deprivation results in activation of MEK/ERK but has minor or no discernable effect on RAF. Activation of MEK/ERK leads to mTOR inhibition which results in autophagy.

Arginine Deprivation Leads to Autophagy in ASS(−) Cells

Autophagy is a lysosomal degradation pathway which involves vesicular sequestra-tion of proteins or organelles into autophagosomes which then fuse with lysosomes and become degraded [ 50, 51 ] . Low levels of autophagy also occur as a normal physiologic process to remove damaged organelles [ 52 ] . This process can be rapidly activated as an adaptive catabolic process in response to different forms of meta-bolic stress such as nutritional deprivation, hypoxia, or growth factor withdrawal [ 53– 55 ] . The bulk forms of degradation generated are free amino acids and fatty acids which can be recycled to make essential proteins for adaptive survival. The signaling mechanisms of autophagy are complex and involve multiple pathways,

44 N. Savaraj et al.

depending upon the cellular contexts and type of inducers [ 56 – 61 ] . Two evolutionally conserved nutrient sensors play a role in autophagy regulation: (1) mTOR kinase which turns off the energy consuming translational process during autophagy and (2) the eukaryotic kinase initiation factor 2 a kinase (GCN2) which represses trans-lation but upregulates transcriptional activator ATF4 which is required to transcribe stress related genes [ 62, 63 ] . Our initial data do not show alteration of GCN2 upon arginine deprivation. Downstream the TOR kinase, there are 17 genes which are involved in the autophagic process in yeast, termed ATG genes. The ATG gene is involved in the generation and maturation of autophagosome [ 64 ] . In cancer cells, the mechanism of how many ATG genes are involved in the autophagosome forma-tion is not well understood. However, Vps34 (PI3 kinase class III) and Beclin 1(ATG6) have been shown to be involved in the vesicle nucleation process [ 51, 65 ] . On the other hand, autophagy can also lead to cell death (program type II or noncas-pase-dependent cell death) which is characterized by degradation of organelles but preserved cytoskeletal process [ 63, 66 ] . Autophagic cell death is known to occur during the developmental process [ 67, 68 ] and recently with cancer chemotherapy and hormonal therapy [ 69, 70 ] . We have found that, upon arginine deprivation, ASS(−) melanoma cells undergo autophagy, most likely as part of the adaptive mechanisms to avoid cell death. These fi ndings also have been shown by Kim et al. in prostate cancer cell lines which do not express ASS [ 28 ] . In fact, our preliminary data also suggest that knockdown of Beclin 1 increased cell death after ADI-PEG20 treatment by 20–30%. In this regard, Kim et al. also have shown that knockdown of Beclin 1 in ASS(−) prostate cancer cells increases cell death [ 28 ] . Thus, ADI-PEG20 or arginine deprivation treatment induces autophagy in ASS(−) melanoma cell lines, most likely representing a mechanism for survival. Inhibition of this process should be considered to increase the therapeutic effect of this treatment.

One can conclude that arginine deprivation results in activation of AMPK which inhibits mTOR via excessive activation of MEK and ERK and possibly other pathways. This results in induction of autophagy in an attempt for the cell to survive (Fig. 3.2 ). However, prolonged arginine deprivation will ultimately result in cas-pase-dependent or independent apoptosis, depending on the cell type and the apop-totic machinery in the cells [ 28, 31, 41, 71 ] .

How Arginine Deprivation Induces Cell Death in ASS(−) Melanoma Cells

The ASS gene is located in chromosome 9q34.1. There are many pseudogenes (14 reported) located among other chromosomes [ 72 ] . The transcription and translation of ASS is not well understood. Two species of ASS mRNA which differ in their 5 ¢ -UTR have been reported (Genbank Database). Previous published studies indicate that ASS regulation occurs at the pretranslational levels [ 12 ] . Multiple factors have been shown to positively and negatively infl uence ASS transcription, but are most likely tissue specifi c. Several investigators have demonstrated that glucocorticoids, glucagons, and cyclic

453 Argininosuccinate Synthetase in Cancer Therapy

AMP increase ASS expression, whereas fatty acids can repress ASS expression [ 73– 81 ] . Both growth hormone and insulin have negative infl uence on ASS expression in liver tissue but do not affect ASS expression in other body tissues. Various cytokines, IL-Ib, interferon, and TGF-b, can affect ASS expression [ 82, 83 ] . Glutamine can stimulate ASS expression in rat hepatocytes and Caco-2 cells through O-glycosylation of SP-1 sites [ 84 ] . ASS expression can also be regulated by arginine [ 85 ] .

We also have found that arginine in the media can regulate arginine expression in certain melanoma cells which possess very low levels of ASS not detected by western blot analysis but could be detected by real-time RT-PCR [ 31 ] . These cell lines can be induced to express ASS mRNA in the arginine free media. Our data in four different melanoma cells do not suggest any differences in the promoter region of these cell lines. Recently, we have found that ASS in melanoma cells is positively regulated by c-Myc but negatively by HIF1alpha. On the other hand, in other tumor types such as mesothelioma and ovarian cancer, aberrant methylation have been reported which results in epigenetic gene silencing [ 26 ] . Thus, it appears that ASS gene regulation in cancer cells is also tumor cell-type specifi c.

From our data and the data available from other laboratories, ASS gene silencing occurs in certain tumor types such as melanoma, mesothelioma, and hepatoma. However, whether it is epigenetic or transcriptional factor-regulated or both are cell-type specifi c requires further investigation.

ASS Expression and Cisplatin Resistance

Downregulation of ASS has been found in cisplatin-resistant ovarian cancer cell lines [ 86, 87 ] . The exact mechanism(s) is not known. Recently, ASS methylation/gene silencing at diagnosis was found to be associated with signifi cantly reduced overall survival and relapse-free survival in ovarian cancer. Furthermore, in ovarian

?

AUTOPHAGY

pAMPK

Arginine deprivation

pMEK

pERK

TSC1/2

mTOR

x

Fig. 3.2 Possible pathways which can lead to autophagy upon arginine deprivation

46 N. Savaraj et al.

cancer cell lines, methylation of ASS promoter correlated with transcriptional silencing and selective resistance to platinum-based drug. The underlying mecha-nisms are not well understood. The author suggests that alteration of nitric oxide which affects apoptosis may be involved [ 86 ] .

Other Effects of Arginine Deprivation

Arginine deprivation can also have indirect effects on tumor growth and proliferation. For example, arginine deprivation may have anti-angiogenesis effects. Beloussow showed that arginine deprivation using recombinant ADI had anti-angiogenesis action in cultured human umbilical vein endothelial cells [ 88 ] . Park et al. used the same cell line to demonstrate that arginine deprivation with recombinant ADI inhib-ited angiogenesis in a dose-dependent manner [ 89 ] . The inhibition of angiogenesis was reversed by adding arginine back to the media. In addition, they showed that arginine deprivation with ADI produced inhibition of angiogenesis with chick embryo and mice. Thus, their in vivo studies confi rmed the anti-angiogenesis results seen with their in vitro study demonstrating that ADI could inhibit tumor cell growth with CHO and HeLa cells. Therefore, ADI may affect tumor growth by its anti-angiogenetic properties. Other investigators also have shown that ADI was effective in the inhibition of unfavorable neuroblastoma [ 39 ] .

Thus, it appears that ADI could also exert its antitumor activity via inhibition of angiogenesis.

ADI also has been used in combination with radiation therapy. The antitumor effect produced by radiation therapy was potentiated, suggesting a possible role for arginine deprivation with radiation therapy for certain tumors.

Another effect of arginine deprivation may be on the immune system. It is well known that arginine is the only endogenous source for nitric oxide production. Arginine is the only substrate for nitric oxide synthetase [ 90 ] , so arginine depriva-tion can inhibit nitric oxide production in macrophages challenged with interferon. Shen et al. showed that recombinant ADI could be a differential modulator of induc-ible and endothelial nitric oxide synthetase activity in cultured endothelial cells [ 91 ] . Furthermore, this effect was observed after mice were treated with TNF and endotoxin. They found that ADI-PEG20 did not inhibit nitric oxide production by eNOS, so ADI-PEG20 may be useful as a selective modulator for nitric oxide pro-duced by iNOS. In addition, nitric oxide may affect ASS as Hao et al. found that ASS is reversibly inactivated by S-nitrosylation both in vitro and in vivo [ 92 ] . Further research into the complex interrelationships between these different param-eters needs to be done to elucidate the role of arginine deprivation, nitric oxide production, and tumor cell survival. It is of interest that nitric oxide may promote tumor growth and metastasis by its stimulation of tumor cell migration, growth, and invasiveness. In this regard, Jadeski showed that nitric oxide promotes murine mammary cell tumor [ 93 ] . Some metastatic melanoma cells may also escape immunosurveillance through the novel mechanism of releasing nitric oxide which induces immunocyte dysfunction [ 94 ] . Other inhibitors of nitric oxide such

473 Argininosuccinate Synthetase in Cancer Therapy

as NG-methyl-L-arginine and NG-monomethyl-L-arginine have been shown to reverse or reduce the hypotensive effects in interleukin-2 therapy, enabling more drug to be delivered with less toxicity [ 95, 96 ] . Thus, arginine deprivation by ADI or arginase may be useful to reduce nitric oxide production and to enhance immu-nogenecity of tumors and lessen the side effect during interleukin-2 therapy [ 32 ] .

Clinical Trials with ADI-PEG20

We have reported on a phase I/II trial of ADI-PEG20 in patients with advanced or metastatic melanoma [ 34 ] . This trial consisted of a phase I trial in the U.S. and a phase I/II trial in Italy. The phase I trial in the U.S. had 15 patients enrolled in four cohorts using different weekly doses of the drug. In Italy, there were 24 patients enrolled in the phase I trial, also using varying dose levels of ADI-PEG20. The dose of 160 IU/m² given weekly intramuscularly was felt to be the optimum biological dose (OBD). The most common side effect in both the U.S. and Italian part of the study was discomfort at the injection site. Other side effects were less common and included fatigue and mild elevation of the serum uric acid. In terms of response, none of the 15 patients enrolled in the phase I trial in the U.S. had a response. In Italy, 6 of 24 patients enrolled in the phase I/II had a response to treatment. This included one complete response and fi ve partial responses, for a total response rate of 25%. In addition, 14 patients had stable disease for ³ 1 cycle of therapy, and six patients had stable disease for 3 months of the trial. All the patients with response or stable disease had received the OBD or higher dose of ADI-PEG20.

We are currently conducting a phase II trial of ADI-PEG20 in patients with advanced or metastatic melanoma, and preliminary results have been published [ 34 ] . We have observed responses in at least four patients and stable disease in other patients. Toxicity has generally been mild, with discomfort at the injection site being the most common side effect. This trial is still ongoing. A phase I/II trial of ADI-PEG20 in melanoma is being conducted at New York University and Memorial Sloan-Kettering Cancer Center. This trial allowed heavily pretreated patients to be entered. While no major responses were observed, stable disease was seen in several patients.

Arginine depletion with ADI-PEG20 has also been investigated in patients with hepatocellular carcinoma. A patient with unresectable hepatocellular carcinoma was treated with escalating doses of ADI-PEG20 in a single patient exemption trial. No drug toxicity was noted. The patient had a reduction in tumor size and a decrease in the serum alpha fetoprotein. The encouraging response in this single patient led to a series of phase I/II trials in hepatocellular carcinoma. In a study conducted at the Pascale Cancer Institute in Naples, Italy, patients were treated with various doses of ADI-PEG20. Nineteen patients were entered into the trial using one of four drug cohorts. The dose of 160 IU/m² given weekly intramuscularly was considered the OBD and lowered the serum arginine level to non-detectable levels (0.5 uM). In terms of toxicity, the side effects included discomfort at the injection site, elevation of the serum uric acid and fi brinogen, and occasional elevation of the serum lipase

48 N. Savaraj et al.

and amylase levels. No clinical evidence of pancreatitis was detected. No evidence of neutralizing antibody was found.

In terms of response, two patients had complete response, and seven patients had partial response for a response rate of 47%. Duration of response was defi ned as the time from start of therapy to tumor progression. The median duration of response was >400 days (range 37– >680 days).

Another phase I/II trial of weekly ADI-PEG20 was conducted at the M.D. Anderson Cancer Center in Houston, Texas. In this trial, 35 patients were enrolled.In terms of toxicity, 12 patients had grade 3 toxicity which consisted mainly of liver function or serum electrolyte abnormalities. In addition, three patients had grade 4 toxicity which consisted of liver function abnormalities or elevation of serum lipase. In terms of response, one patient had a partial response, and the patient’s disease became resectable after treatment. Furthermore, 16 patients had stable disease. Four patients did not complete the trial due to either allergic reaction or intercurrent disease. Twenty-eight patients had disease progression, with the mean time for progression of 3.4 months (range 1–13 months).

We have treated nine patients with hepatocellular carcinoma with ADI-PEG20 as part of the phase 2B testing. Of the nine patients treated at the University of Miami, two patients had stable disease for at least 12 months. One of the two patients had stable disease for >2 years until he developed an allergic reaction, and the therapy was discon-tinued. Recently, a large phase II study in hepatoma treated with ADI-PEG20 showed a disease control rate of 31% and 7.3 months for overall survival. The patients with no detectable arginine appears to do better with an overall survival of 10 months [ 97 ] .

Concluding Remarks and Future Direction

The data from our laboratory and the data from other laboratories support the notion that arginine deprivation represents a novel targeted approach for antitumor therapy in humans. Tumors which cannot synthesize arginine from the urea cycle and thus are auxotrophic for arginine can be treated with drugs such as ADI-PEG20 or argi-nase. Furthermore, our in vitro laboratory data suggest that arginine deprivation combined with DNA-damaging agents such as temozolomide or cisplatin may be synergistic in certain tumor cell lines. Tumor cells which lack ASS expression may be unable to repair DNA damage without the presence of arginine. We are currently investigating the mechanism behind this. In addition, clinical trials combining ADI-PEG20 to deplete arginine with DNA damaging agents should be explored for their synergistic activity. Melanoma and hepatocellular carcinoma are the most common tumor types that have been studied so far in clinical trials with arginine deprivation using ADI-PEG20. Arginine deprivation should also be investigated in certain mesotheliomas, renal cell cancers, and prostate cancers which lack ASS expression. Recently, a patient with pancreatic neuroendocrine tumor was treated with ADI-PEG20 and reportedly had a major response to therapy (Bomalaski, Polaris, Inc. unpublished data). Thus, ASS expression and arginine deprivation should be studied further in other tumor types.

493 Argininosuccinate Synthetase in Cancer Therapy

The development of drug resistance due to the induction of ASS gene expression represents a major problem. In our clinical trial with melanoma patients, biopsies of tumor after initial response to ADI showed that ASS expression was induced and correlated with drug resistance and relapse or tumor progression.

Understanding the transcription/translational control of the ASS gene may aid in the development of ways to overcome the development of drug resistance. Pharmacological methods to control ASS expression and so prevent drug resistance to arginine depletion are currently being investigated in our laboratory.

References

1. Copperman, R., and Morton, H. E. 1966, Proc Soc Exp Biol Med, 123, 790–795 2. Barile, M. F., and Leventhal, B. G. 1968, Nature, 219, 750–752 3. Gill, P., and Pan, J. 1970, Can J Microbiol, 16, 415–419 4. Fenske, J. D., and Kenny, G. E. 1976, J Bacteriol, 126, 501–510 5. Weickmann, J. L., and Fahrney, D. E. 1977, J Biol Chem, 252, 2615–2620 6. Sugimura, K., Fukuda, S., Wada, Y., Taniai, M., Suzuki, M., Kimura, T., Ohno, T., Yamamoto,

K., and Azuma, I. 1990, Infect Immun, 58, 2510–2515 7. Sugimura, K., Kimura, T., Arakawa, H., Ohno, T., Wada, Y., Kimura, Y., Saheki, T., and

Azuma, I. 1990, Leuk Res, 14, 931–934 8. Sugimura, K., Ohno, T., Fukuda, S., Wada, Y., Kimura, T., and Azuma, I. 1990, Cancer Res,

50, 345–349 9. Miyazaki, K., Takaku, H., Umeda, M., Fujita, T., Huang, W. D., Kimura, T., Yamashita, J., and

Horio, T. 1990, Cancer Res, 50, 4522–4527 10. Takaku, H., Takase, M., Abe, S., Hayashi, H., and Miyazaki, K. 1992, Int J Cancer, 51, 244–249 11. Takaku, H., Matsumoto, M., Misawa, S., and Miyazaki, K. 1995, Jpn J Cancer Res, 86, 840–846 12. Husson, A., Brasse-Lagnel, C., Fairand, A., Renouf, S., and Lavoinne, A. 2003, Eur J Biochem,

270, 1887–1899 13. Lind, D. S. 2004, J Nutr, 134, 2837 S-2841 S; discussion 2853 S 14. Morris, S. M., Jr. 2006, Am J Clin Nutr, 83, 508 S-512 S 15. Wheatley, D. N., Philip, R., and Campbell, E. 2003, Mol Cell Biochem, 244, 177–185 16. Wheatley, D. N., and Campbell, E. 2003, Br J Cancer, 89, 573–576 17. Wheatley, D. N. 2004, Anticancer Drugs, 15, 825–833 18. Wheatley, D. N. 2005, Semin Cancer Biol, 15, 247–253 19. Wheatley, D. N., Campbell e, Lai P. B. S., Cheng, P. N. M. 2005, Gene Therapy and Molecular

Biology, 9, 33–40 20. Wheatley, D. N., and Campbell, E. 2002, Pathol Oncol Res, 8, 18–25 21. Cheng, P., Lo, T., and Leung, T., et al. 2005, Proc Am Soc Clin Oncol, 23 22. Cheng, P. N., Lam, T. L., Lam, W. M., Tsui, S. M., Cheng, A. W., Lo, W. H., and Leung, Y. C.

2007, Cancer Res, 67, 309–317 23. Cheng, P. N., Leung, Y. C., Lo, W. H., Tsui, S. M., and Lam, K. C. 2005, Cancer Lett, 224, 67–80 24. Tsui, S. M., Lam, W. M., Lam, T. L., Chong, H. C., So, P. K., Kwok, S. Y., Arnold, S., Cheng,

P. N., Wheatley, D. N., Lo, W. H., and Leung, Y. C. 2009, Cancer Cell Int, 9, 9 25. Dillon, B. J., Prieto, V. G., Curley, S. A., Ensor, C. M., Holtsberg, F. W., Bomalaski, J. S., and

Clark, M. A. 2004, Cancer, 100, 826–833 26. Szlosarek, P. W., Klabatsa, A., Pallaska, A., Sheaff, M., Smith, P., Crook, T., Grimshaw, M. J., Steele,

J. P., Rudd, R. M., Balkwill, F. R., and Fennell, D. A. 2006, Clin Cancer Res, 12, 7126–7131 27. Yoon, C. Y., Shim, Y. J., Kim, E. H., Lee, J. H., Won, N. H., Kim, J. H., Park, I. S., Yoon, D.

K., and Min, B. H. 2007, Int J Cancer, 120, 897–905 28. Kim, R. H., Coates, J. M., Bowles, T. L., McNerney, G. P., Sutcliffe, J., Jung, J. U., Gandour-

Edwards, R., Chuang, F. Y., Bold, R. J., and Kung, H. J. 2009, Cancer Res, 69, 700–708

50 N. Savaraj et al.

29. Shen, L. J., Beloussow, K., and Shen, W. C. 2006, Cancer Lett, 231, 30–35 30. Ensor, C. M., Holtsberg, F. W., Bomalaski, J. S., and Clark, M. A. 2002, Cancer Res, 62, 5443–5450 31. Savaraj, N., Wu, C., Kuo, M., You, M., Wangpaichitr, M., Robles, C., Spector, S., and Feun, L.

2007, Drug Target Insights, 2, 119–128 32. Dillon, B. J., Holtsberg, F. W., Ensor, C. M., Bomalaski, J. S., and Clark, M. A. 2002, Med Sci

Monit, 8, BR248–253 33. Izzo, F., Marra, P., Beneduce, G., Castello, G., Vallone, P., De Rosa, V., Cremona, F., Ensor, C.

M., Holtsberg, F. W., Bomalaski, J. S., Clark, M. A., Ng, C., and Curley, S. A. 2004, J Clin Oncol, 22, 1815–1822

34. Feun, L., Savaraj, N., Marini, A., and al, e. 2005, Proc Am Soc Clin Oncol, 23, 236s 35. Feun, L., and Savaraj, N. 2006, Expert Opin Investig Drugs, 15, 815–822 36. Curley, S. A., Bomalaski, J. S., Ensor, C. M., Holtsberg, F. W., and Clark, M. A. 2003,

Hepatogastroenterology, 50, 1214–1216 37. Ascierto, P. A., Scala, S., Castello, G., Daponte, A., Simeone, E., Ottaiano, A., Beneduce, G.,

De Rosa, V., Izzo, F., Melucci, M. T., Ensor, C. M., Prestayko, A. W., Holtsberg, F. W., Bomalaski, J. S., Clark, M. A., Savaraj, N., Feun, L. G., and Logan, T. F. 2005, J Clin Oncol, 23, 7660–7668

38. Sugimura, K., Ohno, T., Kusuyama, T., and Azuma, I. 1992, Melanoma Res, 2, 191–196 39. Gong, H., Pottgen, C., Stuben, G., Havers, W., Stuschke, M., and Schweigerer, L. 2003, Int

J Cancer, 106, 723–728 40. Gong, H., Zolzer, F., von Recklinghausen, G., Havers, W., and Schweigerer, L. 2000, Leukemia,

14, 826–829 41. Gong, H., Zolzer, F., von Recklinghausen, G., Rossler, J., Breit, S., Havers, W., Fotsis, T., and

Schweigerer, L. 1999, Biochem Biophys Res Commun, 261, 10–14 42. Feun, L., Wu, C., Kuo, M., Wangpaichitr, M., Spector, S., and Savaraj, N. 2007, Current Phama

Design 43. Hoyer-Hansen, M., and Jaattela, M. 2007, Autophagy, 3, 381–383 44. Hurley, R. L., Anderson, K. A., Franzone, J. M., Kemp, B. E., Means, A. R., and Witters, L. A.

2005, J Biol Chem, 280, 29060–29066 45. Sarbassov, D. D., Ali, S. M., and Sabatini, D. M. 2005, Curr Opin Cell Biol, 17, 596-603 46. Kim, R. H., Bold, R. J., and Kung, H. J. 2009, Autophagy, 5, 567–568 47. Smalley, K. S., and Herlyn, M. 2005, Ann N Y Acad Sci, 1059, 16–25 48. Fecher, L. A., Amaravadi, R. K., and Flaherty, K. T. 2008, Curr Opin Oncol, 20, 183–189 49. Wang, J., Whiteman, M. W., Lian, H., Wang, G., Singh, A., Huang, D., and Denmark, T. 2009,

J Biol Chem 50. Maiuri, M. C., Zalckvar, E., Kimchi, A., and Kroemer, G. 2007, Nat Rev Mol Cell Biol, 8, 741–752 51. Cao, Y., and Klionsky, D. J. 2007, Cell Res, 17, 839–849 52. Levine, B., and Kroemer, G. 2008, Cell, 132, 27–42 53. Jin, S., and White, E. 2007, Autophagy, 3, 28–31 54. Pattingre, S., Espert, L., Biard-Piechaczyk, M., and Codogno, P. 2008, Biochimie, 90, 313–323 55. Zhang, H., Bosch-Marce, M., Shimoda, L. A., Tan, Y. S., Baek, J. H., Wesley, J. B., Gonzalez,

F. J., and Semenza, G. L. 2008, J Biol Chem, 283, 10892–10903 56. Wang, Y., Singh, R., Massey, A. C., Kane, S. S., Kaushik, S., Grant, T., Xiang, Y., Cuervo, A.

M., and Czaja, M. J. 2008, J Biol Chem, 283, 4766–4777 57. Shimizu, S., Kanaseki, T., Mizushima, N., Mizuta, T., Arakawa-Kobayashi, S., Thompson, C.

B., and Tsujimoto, Y. 2004, Nat Cell Biol, 6, 1221–1228 58. Codogno, P., and Meijer, A. J. 2005, Cell Death Differ, 12 Suppl 2, 1509–1518 59. Kondo, Y., Kanzawa, T., Sawaya, R., and Kondo, S. 2005, Nat Rev Cancer, 5, 726–734 60. Amaravadi, R. K., Yu, D., Lum, J. J., Bui, T., Christophorou, M. A., Evan, G. I., Thomas-

Tikhonenko, A., and Thompson, C. B. 2007, J Clin Invest, 117, 326–336 61. Lum, J. J., Bauer, D. E., Kong, M., Harris, M. H., Li, C., Lindsten, T., and Thompson, C. B.

2005, Cell, 120, 237–248 62. Kilberg, M. S., Pan, Y. X., Chen, H., and Leung-Pineda, V. 2005, Annu Rev Nutr, 25, 59–85 63. Levine, B., and Yuan, J. 2005, J Clin Invest, 115, 2679–2688

513 Argininosuccinate Synthetase in Cancer Therapy

64. Xie, Z., and Klionsky, D. J. 2007, Nat Cell Biol, 9, 1102–1109 65. Obara, K., Noda, T., Niimi, K., and Ohsumi, Y. 2008, Genes Cells, 13, 537–547 66. Scarlatti, F., Granata, R., Meijer, A. J., and Codogno, P. 2008, Cell Death Differ 67. Bursch, W., Hochegger, K., Torok, L., Marian, B., Ellinger, A., and Hermann, R. S. 2000,

J Cell Sci, 113 (Pt 7), 1189–1198 68. Mills, K. R., Reginato, M., Debnath, J., Queenan, B., and Brugge, J. S. 2004, Proc Natl Acad

Sci U S A, 101, 3438–3443 69. Kanzawa, T., Germano, I. M., Komata, T., Ito, H., Kondo, Y., and Kondo, S. 2004, Cell Death

Differ, 11, 448–457 70. Bilir, A., Altinoz, M. A., Erkan, M., Ozmen, V., and Aydiner, A. 2001, Pathobiology, 69, 120–126 71. Szlosarek, P., Klabatsa, A., Pallaska, A., Sheaf, f. M., Balkwell, F., and Fennell, D. 2006, Proc.

Am Assoc Can Res, Washington D. C, USA 72. Carritt, B., and Povey, S. 1979, Cytogenet Cell Genet, 23, 171–181 73. Haggerty, D. F., Spector, E. B., Lynch, M., Kern, R., Frank, L. B., and Cederbaum, S. D. 1982,

J Biol Chem, 257, 2246–2253 74. Gebhardt, R., and Mecke, D. 1979, Eur J Biochem, 97, 29–35 75. Lin, R. C., Snodgrass, P. J., and Rabier, D. 1982, J Biol Chem, 257, 5061–5067 76. Morris, S. M., Jr. 1987, Arch Biochem Biophys, 259, 144–148 77. Nebes, V. L., and Morris, S. M., Jr. 1988, Mol Endocrinol, 2, 444–451 78. Husson, A., Bouazza, M., Buquet, C., and Vaillant, R. 1983, Biochem J, 216, 281–285 79. Tomomura, M., Tomomura, A., Dewan, M. A., and Saheki, T. 1996, FEBS Lett, 399, 310–312 80. Grofte, T., Wolthers, T., Jensen, S. A., Moller, N., Jorgensen, J. O., Tygstrup, N., Orskov, H.,

and Vilstrup, H. 1997, Hepatology, 25, 964–969 81. Grofte, T., Jensen, D. S., Gronbaek, H., Wolthers, T., Jensen, S. A., Tygstrup, N., and Vilstrup,

H. 1998, Am J Physiol, 275, E79–86 82. Hattori, Y., Shimoda, S., and Gross, S. S. 1995, Biochem Biophys Res Commun, 215, 148–153 83. Zhang, W. Y., Gotoh, T., Oyadomari, S., and Mori, M. 2000, Brain Res Mol Brain Res, 83, 1–8 84. Brasse-Lagnel, C., Fairand, A., Lavoinne, A., and Husson, A. 2003, J Biol Chem, 278,

52504–52510 85. Jackson, M. J., Allen, S. J., Beaudet, A. L., and O’Brien, W. E. 1988, J Biol Chem, 263

16388–16394 86. Nicholson, L. J., Smith, P. R., Hiller, L., Szlosarek, P. W., Kimberley, C., Sehouli, J., Koensgen,

D., Mustea, A., Schmid, P., and Crook, T. 2009, Int J Cancer 87. Helleman, J., Jansen, M. P., Span, P. N., van Staveren, I. L., Massuger, L. F., Meijer–van

Gelder, M. E., Sweep, F. C., Ewing, P. C., van der Burg, M. E., Stoter, G., Nooter, K., and Berns, E. M. 2006, Int J Cancer, 118, 1963–1971

88. Beloussow, K., Wang, L., Wu, J., Ann, D., and Shen, W. C. 2002, Cancer Lett, 183, 155–162 89. Park, I. S., Kang, S. W., Shin, Y. J., Chae, K. Y., Park, M. O., Kim, M. Y., Wheatley, D. N., and

Min, B. H. 2003, Br J Cancer, 89, 907–914 90. Wu, G., and Morris, S. M., Jr. 1998, Biochem J, 336 (Pt 1), 1–17 91. Shen, L. J., Lin, W. C., Beloussow, K., Hosoya, K., Terasaki, T., Ann, D. K., and Shen, W. C.

2003, Biochem Pharmacol, 66, 1945–1952 92. Hao, G., Xie, L., and Gross, S. S. 2004, J Biol Chem, 279, 36192–36200 93. Jadeski, L. C., Hum, K. O., Chakraborty, C., and Lala, P. K. 2000, Int J Cancer, 86, 30–39 94. Zhang, X. M., and Xu, Q. 2001, Melanoma Res, 11, 559–567 95. Kilbourn, R. G., Fonseca, G. A., Griffi th, O. W., Ewer, M., Price, K., Striegel, A., Jones, E.,

and Logothetis, C. J. 1995, Crit Care Med, 23, 1018–1024 96. Kilbourn, R. G., Fonseca, G. A., Trissel, L. A., and Griffi th, O. W. 2000, Cancer J Sci Am, 6

Suppl 1, S21–30 97. Yang, T. -S., Lu, S. -N., Chao, Y., Sheen, I. -S., Lin, C. -C., Wang, T. -E., Chen, S. -C., Wang,

J. -H., Liao, L. -Y., Thomson, J. A., Wang-Peng, J., Chen, P. -J., and Chen, L. -T. 2010, Br J Cancer, 103, 954–960

53M. Chatterjee and K. Kashfi (eds.), Cell Signaling & Molecular Targets in Cancer, DOI 10.1007/978-1-4614-0730-0_4, © Springer Science+Business Media, LLC 2012

Introduction

Parathyroid hormone–related protein (PTHrP) was discovered in 1987 as a systemic humoral factor because of its association with the paraneoplastic syndrome of humoral hypercalcemia of malignancy (HHM) [ 1 ] . The hypercalcemic activity of PTHrP is based on its partial homology to parathyroid hormone (PTH) and on its ability to bind to the type 1 parathyroid (PTH)/PTH-related peptide receptor (PTH1R), with equal affi nity as PTH, mimicking the stimulatory action of PTH on cAMP production in bone and kidney. This results in bone resorption and renal calcium retention, eventu-ally leading to HHM. While PTHrP was discovered for its endocrine effects, malig-nant tumor, the secretory gland, and the bone tissue and kidneys being the target organs, it became clear that PTHrP is also expressed by nontransformed cells in almost all tissues where it functions locally in paracrine and/or autocrine manner. The most important regulatory roles of PTHrP relate to cell growth and differentiation, smooth muscle relaxation, and transepithelial calcium transport but not to serum calcium homeostasis [ 2 ] . Moreover, PTHrP behaves like an oncofetal protein, its expression being restricted to the period of fetal development or to malignancy.

Although many cancers produce PTHrP, only a limited subset of them led to the development of HHM. About 50% of cases of HHM develop in the presence of squamous cell carcinomas, while the remaining cases are associated with kidney carcinoma, breast, colorectal, esophageal adenocarcinoma and hematologic neo-plasia. However, despite the successful control of hypercalcemia, the development of HHM is associated with a poor prognosis [ 3 ] , indicating that in addition to its

Chapter 4 Parathyroid Hormone–Related Peptide Signaling in Cancer*

Franco Oreste Ranelletti and Giovanni Monego

F. O. Ranelletti (*) Institute of Histology and Embryology , Università Cattolica del S. Cuore, Rome 00168, Italy e-mail: ranelletti@rm.unicatt.it

*This work was supported in part by grant D1.1-2008 to F.O. Ranelletti from Università Cattolica del S. Cuore.

54 F.O. Ranelletti and G. Monego

PTH-like effects, PTHrP has additional roles in cancer. Potential roles for PTHrP in the regulation of tumor growth and invasion are suggested by its growth factor–like properties together with the multifactorial regulation of its expression by growth and angiogenic factors, such as interleukins, epidermal growth factor (EGF), transforming growth factor- a (TGF- a ), transforming growth factor- b (TGF- b ), platelet-derived growth factor (PDGF), and vascular endothelial growth factor (VEGF) [ 2, 4 ] .

Evidences have been accumulated, suggesting that the most important roles exerted by PTHrP in tumor development include: regulation of cancer cell growth, interference with apoptosis signaling pathways, acquisition of invasive phenotype by cancer cells, and induction and progression of bone metastasis. Moreover, the therapeutic potential of PTHrP-targeting strategies in human cancer has been high-lighted by many studies, particularly in breast, prostate, lung, and kidney cancers [ 5– 8 ] . This review article highlights some recent advances in the understanding of the signaling pathways involved in the PTHrP functions and of the factors that regulate PTHrP expression in cancer cells.

PTHrP Gene Structure and Regulation

PTHrP owes the name to the structural homologies between the aminoterminal portion of the molecule and the corresponding aminoterminal portion of PTH. With regard to the primary structure, 8 of the fi rst 13 amino acids (1–13) of N-terminal PTHrP are identical to PTH. Beyond the amino acidic sequence 1–13, the three-dimensional structure of residues 13–34 of PTHrP presents strict similarities with PTH 13–34.

PTHrP gene is localized on chromosome 12p11 , whereas PTH , on 11p15 , and it is considered that these two different chromosomes are derived from a common ancestor after tetraploidization events [ 9 ] .

The human PTHrP gene presents a structure that spans more than 15 kilobases of genomic DNA and includes nine exons (Fig. 4.1 ).

The 5 ¢ -end of the gene is the region deputed to regulation of transcriptional pro-cesses and contains three distinct promoters named P1, P2, and P3, respectively [ 10– 14 ] . P1 and P3 are promoters containing “TATA box”-like sequences, whereas P2 is a GC-rich promoter [ 14, 15 ] . P1 is located 25 bp 5 ¢ of exon 1, P2 is upstream of exon 3, and P3 is located in an intron 35 bp upstream to exon 4.

The 5 ¢ -untranslated regions in the mature PTHrP mRNA are referable to exons 1, 2, 3, and 4, while exon 5 encodes for the so-called prepro region. Exon 6 contains the major part of the coding region and, together with the product of exon 5, forms the sequence shared by all known PTHrP transcripts [ 16– 18 ] .

Exons 7, 8, and 9 are included in the 3 ¢ -end of the gene and can be alternatively spliced in order to code three mRNA variants corresponding to three mature protein isoforms [ 11, 19 ] . These three PTHrP isoforms differ in length, being composed by 139 (PTHrP 1–139), 141 (PTHrP 1–141), and 173 (PTHrP 1–173) amino acids,

554 PTHrP Signaling in Cancer

respectively [ 1, 10, 11, 20 ] . Moreover, the three isoforms of PTHrP differ at the carboxyl termini, and at mRNA level, there are three different corresponding 3 ¢ transcripts. In fact, in exons 7, 8, and 9 coding sequences that are specifi c for PTHrP isoforms are located, and each of these exons also contains a specifi c 3 ¢ -untranslated region (UTR). In detail, in addition to the common product of exons 5 and 6, PTHrP 1–139 is characterized by the product of exon 7; PTHrP 1–141 by the product of exon 8 and PTHrP 1–173 by the product of exon 9.

The unique UTR contained in exons 7, 8, and 9 have strong infl uences on the stability of PTHrP mRNA splice variants, conditioning the half-life of the messen-gers. In fact, each of these 3 ¢ -UTRs contains AUUUA regions, which are responsi-ble for the rapid turnover of the mRNA with low steady-state levels of the transcripts, in spite of the high rate of PTHrP gene transcription [ 21– 26 ] . These so-called AU-rich instability elements are present in the 3 ¢ -UTR of PTHrP mRNA as well as in the sequences of the early response genes, such as c-fos , GM-CSF, and IL-2, which are also characterized by rapid turnover. The half-life of PTHrP mRNA ranges from 30 min to 4 h and can be increased by growth factors, such as TGF- b and EGF, probably by interfering with the binding of the 3 ¢ -UTR with proteins that can promote rapid messenger degradation [ 27 ] . It has been reported that PTHrP mRNA 1–139 and 1–141 can be bound by proteins with molecular weights ranging from 37–40 kD to 80 kD, which are consistent with the molecular weights of p37 AUF-1 , p40 AUF-1 (AUF-1 family members), and KSRP (K homology–type splicing regulatory protein), respectively [ 28, 29 ] . Moreover, IL-2 seems to play a role in stabilizing the PTHrP mRNA in HTLV-1 infected T cells [ 30 ] .

PTHrP can theoretically start from all the three distinct promoters. Several studies were conducted on the expression of the three promoters of PTHrP , and after all, it is considered that P3 plays the major role in the regulation of the gene transcription in various cancers and tumor-derived cell lines [ 31 ] . As reported by some investigators,

Fig. 4.1 Structure of human parathyroid hormone–related peptide (PTHrP) gene. See text for details. The three different promoters are indicated as P1 , P2 , and P3 ; exons are shown as boxes numbered from 1 to 9. Alternative splice variants are shown by arrows . All the transcript variants are composed by a common part transcribed from exons 5 and 6 ( red arrows ) and variant specifi c parts transcribed by exon 7 ( light blue arrow ) for 1–139, by exon 8 ( green arrow ) for 1–173, and by exon 9 ( yellow arrow ) for 1–141 splice variants

56 F.O. Ranelletti and G. Monego

combined P2/P3 usage is associated with breast and bone tumor–derived cell lines, whereas P1 expression results detectable in squamous cancer and in cell lines of squamous origin [ 18, 32 ] . According to Dittmer [ 4 ] , the PTHrP gene contains sequences for the binding of transcription factors. The authors described a Tax-responsive region upstream of the P3 promoter, and immediately upstream of P3 identifi ed a 90-base region, which is probably inserted in the P3 core promoter and includes cis -acting ele-ments involved in the recruitment of TATA binding protein–containing initiation com-plex. In this region, there are one inverted Sp1 DNA-binding consensus site and two overlapping Ets factor–binding sites (EBS I and EBS II). Ets factors are a family of nuclear transcription factors involved in the regulation of PTHrP gene expression, and Ets-1 is considered to play a pivotal role, particularly in PTHrP expression by adult-cell leukemia/lymphoma (ATLL) and during the differentiation of the T-cell lineage. [ 33– 37 ] . Furthermore, Ets-1 appears to exert a critical function in the TGF- b -mediated induction of PTHrP expression in MDA-MB-231 cells. Twenty-three bases downstream from EBS I site have been individuated a site for binding Smad complex. This Smad-binding site is located thirty-four bases upstream of the starting site of P3, which is considered the unique promoter to mediate the TGF- b -dependent activation of PTHrP. It is known that PTHrP expression can be increased by TGF- b through the dimerization of its type I and type II receptors and the phosphorylation of Smad proteins.

The contiguity between EBS I and the Smad-binding site supports the hypothesis that the regulation of P3 could be based on strict interactions between Ets factors and Smad proteins.

Experiments with mutated Smad, Sp1, or EBS I and with addition of Ets-1 con-fi rmed the centrality of Ets-1 among the Ets family in PTHrP induction in breast cancer cell lines [ 38 ] . Nevertheless, the criticality of Ets-1’s role appears limited to the MDA-MB-231 cells. In fact, it has been reported that only Ets-1 is able to inter-act with Smad 3 to increase the transcriptional activity of PTHrP P3 promoter in MDA-MB-231 cells under TGF- b stimulation, whereas in MCF7 cells, Ets-2 medi-ates the increased PTHrP expression. Ets-1 is combined with the activation of PKC a second-messenger pathway, and Ets-2 is associated with the activation of PKC e second-messenger pathway, suggesting that TGF- b stimulation could be dependent on specifi c Ets factors combined with specifi c downstream signaling pathways [ 39, 40 ] .

Moreover, Ets factors also appear to be involved in the regulation of PTHrP expression by the Ras–MAPK pathway [ 41 ] . Ets transcription factors represent the downstream target of Ras–MAPK signaling cascade, which articulates in three par-allel arms terminating with ERK (extracellular signal–regulated kinase), p38, or JNK (Jun N-terminal kinase), respectively. Each of these three mitogen-activated kinases (MAPKs ) converges to the phosphorylation of transcription factors and par-ticularly of Ets family proteins [ 41 ] . In detail, ERK and JNK could interact with Ets-1 and Ets-2, which in turn could activate P3 through the EBS site upstream of the PTHrP promoter [ 42, 43 ] .

The Ras–MAPK pathway consists of a sequence of signaling molecules that can work as common signal transducer for stimuli involved in the induction of PTHrP expression [ 20 ] . This pathway is composed by several arrays of kinases from the

574 PTHrP Signaling in Cancer

surface receptors on plasma membrane to the transcription factors in the nucleus, ranging from mitogen-activated kinase kinase kinase (MAPKKK) to mitogen-activated kinase kinase (MAPKK) and fi nally to mitogen-activated kinase (MAPK). Growth factor messages are generally passed on from Raf (MAPKKK) to MEK (MAPKK) to be transmitted to ERK (MAPK), whereas cytokines and stressors use ASK1 (MAPKKK), followed by MKK4 and MKK3 (MAPKK) terminating in JNK or p38, respectively. These two arms of Ras/MAPK cascade can be connected by Ras signaling through PI3 kinase and Rac/Cdc42 [ 44 ] .

Moreover, Ras–MAPK pathway can also mediate the induction of PTHrP expres-sion indirectly through stimuli that are recognized by the sensors connected with other transduction pathways that activate signaling molecules converging on Ras. For example, calcium is recognized by the calcium-sensing receptor (CaSR), which can promote the induction of matrix metalloproteinases through G protein activa-tion, followed by mobilization of HB-EGF that can close the circuit activating EGFR and signaling through Ras–MAPK cascade [ 45– 47 ] . Furthermore, the activa-tion of PTHrP-P3 mediated by the ERK arm of the Ras–MAPK pathway could be triggered by the T-cell receptor, whereas the participation of the p38 arm to the TGF- b -dependent induction of PTHrP appears controversial [ 48, 49 ] . After all, it can be argued that different stimuli can converge on Ras–MAPK pathway in order to induce PTHrP gene expression.

The PTHrP induction driven by P3 promoter activation is associated with the convergence on Ets proteins of the Ras–MAPK, TGF- b –Smad, and HTLV-1–Tax pathways and implies the cooperative interaction with the TATA box–associated basal transcription complex involving coactivators, such as CBP/p300 [ 33, 50 ] . The other TATA-containing PTHrP promoter P1 appears regulated by a cAMP-responsive element (CRE) positioned upstream of the starting point of exon 1 [ 51 ] . The posi-tion of the regulatory element and the P1 sensitivity to the induction by cAMP suggest that CRE is probably part of the core promoter and that P1 is the principal responsive target of the cAMP/PKA/CREB regulatory axis. It is considered that this pathway could be responsible for the PTHrP overexpression in squamous carci-noma cell lines associated with hypercalcemia, such as BEN lung cancer cells [ 32, 51, 52 ] . Little is known about the GC-rich promoter P2, results of which were expressed in several cell lines and tumors. It is possible to identify some regulatory elements upstream of the P2 starting site by screening the sequence with dedicated software. In detail, a vitamin D–responsive element (VDRE), three overlapping AP-2 sites, and two NF-kB sites were individuated [ 53 ] . An atypical VDRE is posi-tioned 517–546 bp upstream of the P1 promoter of human PTHrP gene, supporting the participation of vitamin D to the regulation of PTHrP expression [ 54 ] . In this vitamin D–mediated regulatory mechanism, the vitamin D receptor (VDR), avoid-ing the recruitment of RXR (retinoid X receptor), is bound to the chromatinized atypical VDRE, and the stimulation with 1,25-(OH)

2 D

3 causes the dissociation of

the PTHrP VDRE/VDR complex, leading to the repression of gene expression from P1. The separation of VDR from the response element upstream of the promoter is caused by the phosphorylation of the receptor mediated by the catalytic subunit of the DNA-dependent protein kinase, which is recruited by 1,25-(OH)

2 D

3 [ 55 ] .

58 F.O. Ranelletti and G. Monego

1,25-(OH) 2 D

3 administration can repress PTHrP gene expression in several cell

lines, suggesting that this sterol could be able to interact with all the three promoters, as assumable based on a computerized analysis of gene sequence that identifi ed three other potential VDR consensus sites upstream of the translation starting point.

Another aspect of PTHrP gene structure is the presence of CpG dinucleotide sequences. The PTHrP gene presents a large CpG island located within the context of the GC-rich P2 promoter. Also, individual CpG sites may be positioned between P1 and P2. The functional spin-off for gene regulation of these CpG dinucleotide sequences appears still controversial. In fact, on the basis of the data reported by Broadus and Philbrick, it is assumable that methylation of residues upstream of the CpG island can repress PTHrP gene, whereas the data of Ganderton et al. suggest that methylation does not modulate gene expression [ 56– 59 ] . After all, it is suppos-able that the methylation of upstream regions of PTHrP gene can modulate the expression in cell-type or promoter-dependent manners [ 31 ] .

Also, PTHrP gene shows numerous potential glucocorticoid response elements within the region of P1 and P2 promoters, supporting the experimental evidences that suggest a strong inhibition of PTHrP expression determined by exposure to glucocorticoids in vitro [ 22, 60– 64 ] . Nevertheless, these data were not confi rmed by experiments on animal models [ 65, 66 ] . Similarly, controversy appears on the relationships between sex steroids and PTHrP expression, pointing out the need of further studies to investigate the structural bases and the mechanisms involved in the modulation of PTHrP expression by hormones [ 31 ] .

Cancer Cell Growth

There are evidences that PTHrP has tumor growth effects. In mice, specifi c over-expression of PTHrP in mammary gland produces a higher incidence of tumor formation [ 67 ] . A genetic polymorphism located in the osteostatin encoding region of the PTHrP gene, which produces Thyr/Pro PTHrP variants, was signifi cantly associated with resistance or susceptibility to skin carcinogenesis in mice, suggest-ing a role of the PTHrP gene as a cancer modifi er gene in skin carcinogenesis [ 68 ] . Treatment of rat with antisense oligonucleotides against PTHrP-RNA reduces the growth of pituitary cancer cells [ 69 ] and the size of tumor formed by implanted H-500 Leydig cells [ 70 ] . Furthermore, treatment of tumor-bearing mice with neu-tralizing PTHrP antibody inhibits growth of human MDA-MB-231 breast cancer cells metastasized to bone [ 71 ] .

The effects of PTHrP on cancer cell growth are multifaceted. They refl ect the fact that the native molecule can be processed into peptides that mediate pleiotropic actions through many molecular pathways. PTHrP should be considered as a polyhormone. In fact, a family of peptides arises from tissue-/cell-specifi c alternative splicing of the primary transcript. Moreover, alternative posttranslational endoproteolytic cleavage at dibasic amino acid regions forms N-terminal (PTHrP 1–36), midregion (PTHrP 38–94), and C-terminal (PTHrP 107–139) peptides with distinct pathophysiological

594 PTHrP Signaling in Cancer

functions (Fig. 4.2 ) and probably different cell surface receptors [ 72– 76 ] . However, to date, only the PTH1R has been cloned, which is a G protein–coupled receptor (GPCR) belonging to the secretin-like GPCR family (class B), displaying a similar affi nity for two distinct ligands, PTH and PTHrP N-terminal domains (PTHrP 1–36). The capa-bility of PTH1R to respond in a specifi c manner to two different ligands can be attrib-uted to various signal control mechanisms [ 77 ] . For example, unlike PTH, PTHrP has a second protein kinase C (PKC) activation domain, as indicated by the ability of picomolar concentrations of PTHrP to stimulate maximally membrane-associated protein kinase C (PKC) activity in the osteosarcoma cells [ 78 ] .

PTHrP (1–36) binding to PTH1R activates adenylate cyclase (AC) through the action of stimulatory G-alpha proteins (G

a s ) coupled to the receptor. In turn, AC stimu-

lates the formation of cyclic 3 ¢ ,5 ¢ -adenosine monophosphate (cAMP) which binds to the regulatory subunit of protein kinase A (PKA) and releases the active catalytic subunits of the enzyme. Moreover, PTHrP (1–36) binding to PTH1R activates phos-pholipase C b ( PLC b ) by G

a q , leading to the formation of diacylglycerol (DAG), which

activates PKC and 1,4,5-inositol triphosphate (IP3), resulting in increased intracellu-lar free Ca 2+ [ 79 ] . It has been shown that high agonist concentrations (micromolar)

Fig. 4.2 The functional domains of PTHrP protein. Signal peptide module serves to dock the nascent peptide to the secretory pathway. PTH1R indicates the receptor-binding region; midregion containing the bipartite NLS is essential for PTHrP nuclear import; osteostatin domain involved in bone turnover and b -arrestin binding. See text for details

60 F.O. Ranelletti and G. Monego

and/or high receptor density are required for effi cient activation of PLC; this is in contrast to PTH1R activation of AC, which occurs at physiologic (subnanomolar) agonist concentrations in the same cell host [ 80 ] . Interestingly, it has been observed that the Na + /H + exchanger regulatory factor (NHERF), by binding to a PDZ domain within the carboxy terminal tail of PTH1R, shifts receptor signaling from AC to PLC through effi cient coupling of the PTH1R–NHERF complex to Gq/11, which stimu-lates PLC and Gi, which inhibits AC [ 81 ] . Moreover, NHERF-mediated assembly of PTH1R and phospholipase C regulates PTHrP signaling in cells and membranes of polarized cells expressing NHERF and may account for many tissue- and cell-specifi c actions of PTH/PTHrP [ 81 ] .

Desensitization of the receptor following agonist activation occurs mainly through phosphorylation of the C-terminal domain by second messenger–dependent protein kinases and GPCR kinases which is then followed by internalization of the receptor into clathrin-coated pits, a process primarily coordinated by the arrestins. Internalization of the receptor requires both ligand binding and receptor activation but does not involve stimulation of AC/PKA or PKC [ 82 ] . b -arrestins are recruited to agonist-occupied PTH1R that have been phosphorylated by GPCR kinases and sterically inhibit receptor-G protein coupling, which results in homologous receptor desensitization. Moreover, b -arrestins act as adaptors in clathrin-mediated receptor endocytosis [ 83 ] .

In addition to their role as GPCR-specifi c endocytic adaptor proteins, b -arrestins also act as signal transducers via the formation of scaffolding complexes which control both the spatial and temporal activity of several MAPK modules, such as those of extracellular signal–regulated kinase (ERK1/2, ERK3/4, ERK5, ERK7/8), p38MAPK, and Jun N-terminal kinase (JNK)1/2/3 [ 84 ] . GPCR can stimulate ERK1/2 phosphorylation through an early G protein–dependent pathway mediated by PKA/PKC and a late G protein–independent pathway mediated by b -arrestin 1 and 2 [ 85 ] . Interestingly, it has been observed that b -arrestin and classical G pro-tein–PKA/PKC pathways can be selectively activated by stimulating PTH1R with inverse agonist for cAMP or agonist ligands, respectively. This observation suggests that the receptor can exist in more active conformations, each one being able to initi-ate distinct signaling pathways [ 85, 86 ] . b -arrestin and classical G protein–PKA/PKC pathways are not only mechanistically distinct but also perform different sig-naling functions. Thus, G protein–activated ERK1/2 generally translocate into the nucleus where they phosphorylate and activate many transcription factors, while b -arrestins-activated ERK1/2 compartimentalize in the cytoplasm where they can phosphorylate different sets of proteins [ 87, 88 ] . This mechanism could be of thera-peutic impact as the two signaling pathways, leading to different cell responses, can be dissected.

A recent advance in the understanding of PTH1R signaling is the discovery that several GPCR family members have been found to localize in the nucleus/nuclear membrane of cells. Similar to the propagation of signal through arrestins, nuclear GPCRs are providing a new avenue of investigation into the signaling potential of PTH1R [ 89 ] . PTH1R is the only member of the class B GPCR subfamily that trans-locates to the cell nucleus [ 90, 91 ] . It has been found that PTH1R contains a motif

614 PTHrP Signaling in Cancer

that fi ts the general consensus for a bipartite nuclear localization sequence (NLS). Moreover, the sequence of NLS is highly conserved across species, suggesting a key role for the nuclear import of PTH1R [ 92 ] . It has been suggested that NLS of PTH1R binds to importin a , which links the NLS-containing protein to importin b . Then, importin b docks the complex at the nuclear pore complex (NPC), facilitating entry of the PTH1R into the nucleus [ 91 ] . Nuclear PTH1R appears to be restricted to nucleoplasm and is not incorporated in the nuclear membrane [ 91 ] . PTH1R contains a nuclear export sequence (NES) which fi ts the generally accepted consensus for an NES and is highly conserved among several species. The association of PTH1R NES with chromosomal region maintenance 1 (CRM1) through a mechanism involving RanGTP results in the nucleus-to-cytoplasm translocation of the complex [ 93 ] . Nuclear–cytoplasmic shuttling of PTH1R appears to be regulated under normal physiologic conditions. In the mouse osteoblast-like cell line, MC3T3-E1, cultured in the presence of 10% fetal bovine serum, PTH1R displays both nuclear and cyto-plasmic localization. On the contrary, in cells cultured under serum-starved condi-tions, PTH1R is predominantly localized in the nucleus. However, when cells are subsequently returned to normal serum conditions, PTH1R translocates from the nucleus to the cytoplasm where it appears predominantly localized. Interestingly, this effect of serum can be mimicked by the addition of the PTH1R ligand, PTHrP, which induces nuclear–cytoplasmic translocation in a time-dependent manner [ 93 ] . These observations suggest that nuclear import of PTH1R occurs constitutively through a ligand-independent mechanism, while its nuclear export depends on the presence of PTHrP. Moreover, it has been documented that, during interphase and telophase, PTH1R is in the nucleus when DNA is in the euchromatin state and transcriptionally active. In contrast, during stages in which DNA is compacted in heterochromatin states, such as prophase, metaphase, and anaphase, PTH1R nuclear localization is at a minimum [ 91 ] . Taken together, these observations suggest that PTH1R has a defi ned role in regulating cellular activities possibly by interacting directly with DNA and functioning as a transcription factor. PTH1R nuclear localization has been reported in association with ligand-independent proliferation [ 90 ] .

PTH1R has a dual purpose in the cell; in addition to the classical membrane-bound signaling, it also has an intracellular signaling role that is largely unknown. Moreover, membrane PTH1R signaling is activated by ligand binding, while the nuclear PTH1R activity in the transcriptional control of genes is arrested by the ligand-dependent translocation of PTH1R out of the nucleus. However, if PTH1R deserves other functions, once that it is in the cytoplasm, is still unknown. Interestingly, overexpression of PTH1R confers a more aggressive phenotype to osteosarcoma cell line and results in increased proliferation, motility, and Matrigel invasion without addition of exogenous PTHrP, suggesting an autocrine mecha-nism. This cell behavior is nearly completely reversed by RNAi-mediated gene silencing [ 94 ] , suggesting that the rate-limiting step in signal transduction might be at the level of the receptor that osteosarcoma cells possess rather than the avail-ability of the ligand. In agreement with this observation, it has been reported that PTH1R is a better predictor than PTHrP for bone metastases and survival in breast cancer patients [ 95 ] .

62 F.O. Ranelletti and G. Monego

Although many biological effects of PTHrP are mediated via signal transduction pathways initiated at membrane receptor(s), it has become apparent that PTHrP exerts cell surface receptor–independent biological actions mediated through an intracrine mechanism based on nuclear/nucleolar localization of the peptide. In fact, PTHrP encodes an NLS within the 87–107 residues of the mature protein (Fig. 4.2 ) and contains at least two translational initiation sites, one that generates a conventional signal peptide and one that, beginning at CUG codons downstream from the normal start codon, results in truncated PTHrP signal peptide which does not mediate entry into the secretory pathway [ 96 ] . Then, PTHrP can be either secreted or retained in the cytoplasm and translocated to the nucleus by binding to importin b [ 97, 98 ] . Alternative potential mechanisms of PTHrP entry into the cytoplasm have been proposed [ 99– 101 ] .

PTHrP can shuttle in both directions between cytoplasm and nucleus via the NPC, and it has been demonstrated that microtubule integrity plays an important role in PTHrP nuclear import [ 102 ] . PTHrP possesses a consensus motif for phosphorylation by p33 cdk2 and p34 cdc2 cyclin-dependent kinases immediately upstream of the NLS at Thr 85 (Fig. 4.2 ), and phosphorylation at Thr 85 prevents its nuclear import [ 98 ] . Moreover, it has been reported that CRM1/exportin 1 fulfi lls the task of PTHrP nuclear export receptor [ 103 ] . Although PTHrP nucleo-cytoplasmic fl ux occurs through dis-tinct import and export receptors, the inhibition of nuclear export determines a con-current reduction of PTHrP nuclear import, suggesting that the subcellular localization of PTHrP is regulated by an integrated operating system [ 103 ] . Moreover, it has been reported that nuclear translocation of PTHrP is cell cycle–dependent. However, in human keratinocyte cell line, HaCaT, PTHrP appears localized in the nucleolus in G1, but it relocalizes to the cytoplasm in mitotic cells [ 104 ] , while in A10 vascular smooth muscle cells, PTHrP is localized in the nuclei of cells in the G

2 or M phase of the cell

cycle, suggesting that nuclear translocation is activated during cell division [ 97 ] . Since PTHrP NLS is homologous to that in other transcription factors, such as

c-jun, c-fos, and p53, that directly bind DNA, it seems that PTHrP could also be a transcription factor that directly binds DNA. Interestingly, it has been recently reported that, in MDA-MB231 cells, PTHrP (38–94) amide can directly bind in vitro both discrete sites exposed by cellular chromatin and a purifi ed 20-mer oligonucle-otide and that it is involved in the transcriptional regulation of genes encoding for apoptosis factors and caspases [ 105 ] .

As far as PTHrP proliferative effects are concerned, both positive and negative actions have been described depending on the combination of various factors, such as cell type, cell state, the effectual PTHrP domain (NH-terminal, midregion, COOH-terminal), paracrine/autocrine versus intracrine mechanisms, and the activ-ity of signaling networks [ 4, 106, 107 ] . For example, a stimulatory effect on cell growth by cAMP/PKA has been described in PC12 pheochromocytoma cells [ 108 ] , in PC-3 prostate carcinoma cells [ 109 ] , and in rat enterocytes [ 110 ] . On the con-trary, inhibition of growth has been reported in skin fi broblasts [ 106 ] and in PTHrP (1–34)-stimulated MCF-7 cells [ 111, 112 ] .

The aberrations in cancer are pleiotropic, but mitogen-activated protein kinase (MAPK) pathways feature prominently. Mutations in MAPK pathways are a

634 PTHrP Signaling in Cancer

frequent occurrence in cancer and mostly affect Ras and B-Raf in the ERK pathways. PTH1R through AC–PKA and PLC–PKC pathways modulates the MAPK modules involved in many signaling pathways which regulate critical cell functions, such as proliferation, apoptosis, and differentiation [ 113 ] . The underly-ing mechanisms regulating the cross talk between PTH1R and MAPK pathways need to be elucidated in order to provide new therapeutic approach for cancer patients. The ERK pathway is the best studied of the mammalian MAPK pathways, since it is deregulated in approximately one third of all human cancers [ 114 ] . For example, it is interesting to note that in thyroid [ 115 ] and melanoma [ 116 ] cancer cells in which B-Raf mutations are common, cAMP is reported to activate ERK signaling rather than to inhibit it.

Regulation of ERK1/2 by G s

GPCRs through G a s -coupled subunit transduce signals to adenylyl cyclase, which

converts ATP to cAMP. cAMP activates PKA, which plays a major role in G a s -

mediated stimulation as well as inhibition of MAPK modules, such as those of ERK1/2 and p38MAPK [ 117– 125 ] .

G a s -mediated stimulation of ERK1/2 appears to be mediated by a pathway

involving Rap-1 and its activation of B-Raf, one of the isoforms of Raf [ 120, 124, 126– 128 ] . It has been reported that Ga

s stimulation of ERK1/2 could be mediated at

least by three different pathways: (1) G a s activates Rap-1 through cAMP-mediated,

PKA-independent activation of EPAC (exchange protein directly activated by cAMP), a Rap-1-specifi c guanine nucleotide exchange factor [ 129– 131 ] . (2) G a

s

exerts Rap-1-mediated activation of B-Raf–MEK–ERK module via a pathway involving cAMP–PKA–Src-mediated activation of C3G (Rap-1-GEF known as Crk SH3 domain-binding guanine nucleotide-releasing factor), which, in turn, stimu-lates Rap-1 [ 127, 128, 132, 133 ] ; (3) G a

s stimulates Ras signaling to ERK1/2 mod-

ule via PKA-dependent or PKA-independent mechanism in a cell type–specifi c manner. G a

s -mediated PKA-dependent stimulation of ERK1/2 involves a PKA-

dependent Ras-GEF (Ras-GRF1) [ 134, 135 ] , whereas PKA-independent signaling involves a cAMP-responsive but PKA-independent Ras-GEF (CNrasGEF) as observed in melanoma cell lines [ 136 ] (Fig. 4.3 ).

G a s -mediated inhibition of ERK pathways involves PKA-mediated phospho-

rylation at S43, S233, and S259 sites within N-terminal domain of a specifi c isoform of Raf, known as Raf-1 or C-Raf [ 117– 119, 137– 139 ] . Every one of the three phosphorylation sites blocks C-Raf activation and C-Raf interaction with Ras when cAMP levels are elevated (Fig. 4.3 ). PKA-phosphorylated S233 and S259 sites recruit 14-3-3 proteins to the N-terminus of C-Raf [ 140 ] . It has been suggested that, in the presence of elevated cAMP levels, PKA phosphorylates C-Raf on S43 and S233, creating a new 14-3-3 binding site, causing a rearrange-ment that switches 14-3-3 from the S621 site to the S233 site, but maintaining contact with the S259 site. C-Raf is then locked in a closed conformation that cannot

64 F.O. Ranelletti and G. Monego

be activated because Ras cannot displace 14-3-3 from the N-region [ 124 ] . Interestingly, the C-terminal tail of PTH1R binds 14-3-3 proteins independently from ligand activation, and the phosphorylation of the PTH1R C-terminal tail by PKA reduces the interaction of the receptor with 14-3-3 [ 141 ] , thus freeing 14-3-3 for interactions with other partners, such as C-Raf. Such a mechanism could potentiate the inhibition of Ras–C-Raf–ERK pathway mediated by the PKA-dependent phosphorylation of 14-3-3 proteins. In fi broblast cell lines, such as NIH3T3 cells, it has been shown that the inhibition of C-Raf can also be deter-mined by G a

s -cAMP–PKA-mediated activation of Rap-1 [ 142, 143 ] . Once acti-

vated, Rap-1 binds and sequesters C-Raf from being activated by Ras as the effector domain of Rap-1 displays close sequence and structural similarities with that of Ras [ 142– 144 ] .

In addition to ERK1/2, G a s stimulates p38MAPK [ 121 ] module via cAMP–PKA

pathway. Since it has been shown that Rap-1 can stimulate p38MAPK in various cell types [ 145, 146 ] , a possible role of Rap-1 in this pathway can be hypothesized. Furthermore, G a

s inhibits ERK5 module via cAMP–PKA pathway [ 125 ] .

Fig. 4.3 G s regulation of ERK1/2 modules. See text for details. G a

s stimulates the B-Raf-mediated

activation of ERK modules via Rap-1 or Ras and inhibits Raf-1-mediated activation of ERK1/2 by phosphorylating Raf-1 through PKA. Also shown is the alternate PKA-independent pathway through which G a

s activates Rap-1-mediated ERK1/2 activation via cAMP-activated EPAC

654 PTHrP Signaling in Cancer

Regulation of ERK1/2 by G a q

The G q family of G proteins comprises G a

q , G a

11 and hematopoietic cell–specifi c

G a 14

, and G a 15/16

subunits [ 147, 148 ] , which are able to activate ERK1/2, JNK, and p38MAPK modules. GPCRs transduce signals through the a -subunits of G

q family

of G proteins to specifi c cellular responses via the activation of the effector PLC b [ 147, 149 ] . In turn, PLC b produces inositol triphosphate (IP

3 ) and diacylglycerol

(DAG) by hydrolyzing phosphatidylinositol 4,5-bisphosphate (PIP 2 ). Both IP

3 and

DAG can directly activate protein kinase C (PKC). Moreover, they can indirectly activate PKC via the release of internally stored Ca 2+ . In addition to the G a -subunit, also the b g -subunit released from G

q , activates PLC b [ 150, 151 ] , signaling through

both PLC–DAG–PKC- and PLC–IP3–Ca 2+ -mediated pathways. G a

q -activated PKC can stimulate ERK1/2 module either directly by phosphory-

lating and stimulating C-Raf [ 152– 154 ] or indirectly by Ca 2+ –calmodulin-mediated activation of Pyk2, leading to the activation of Ras–ERK1/2 [ 155– 157 ] . However, whether G a

q/11 activates ERK1/2 via the PKC–Raf signaling axis or IP3-Ca 2+ –

calmodulin–Pyk2–Src–Ras pathway appears to be cell type–dependent [ 156– 158 ] . In addition to these typical G a

q -mediated pathways, it has also been shown that

G a q can activate ERK through a novel mechanism involving a DAG- as well as a

Ca 2+ -dependent Rap-1-GEF [ 159 ] . In summary, G a q -mediated signaling to ERK1/2

is mediated by three different mechanisms: (1) activation of C-Raf mediated by PKC, (2) activation of Ras via Ca 2+ –Pyk2–Src-dependent pathway, and (3) activa-tion of B-Raf mediated by Ca 2+ –DAG-stimulated Rap1(Fig. 4.4 ). It should be noted that all of these mechanisms need not be mutually exclusive as G a

q/11 activation

results in the generation of both DAG and IP3. In addition, b g -subunits dissociate from GPCR coupled G a

q/11 and can contribute to G a

q/11 signaling to modules by

stimulating PLC b . However, GPCR coupled to G a q/11

activates ERK1/2 by utilizing preferentially PKC- and/or IP3–Ca 2+ signaling pathways rather than b g -subunits [ 160 ] .

The cell response to PKC activation can be either proliferative or antiprolifera-tive in different cell types. Generally, PKC/C-Raf/Ras/ERK 1–2 pathway leads to cell proliferation. However, PKC activation can also result in inhibition of ERK1/2 modules and blocking of cell growth [ 161 ] . The type of cell response following PKC activation is PKC isoform–dependent as novel PKC isoforms ( d , e , h , q , m ), which are activated by DAG but not Ca 2+ -dependent, inhibit ERK1/2 activation by phosphorylating C-Raf and preventing its activation by Ras. Classical isoforms ( a , b I , b I I , g ), which are both DAG- and Ca 2+ -dependent, and atypical isoforms ( z , l , i ), which are neither DAG- nor Ca 2+ -dependent, stimulate ERK1/2 module by phos-phorylating Raf kinase inhibitory protein (RKIP) and determining its dissociation from C-Raf, which, in turn, activates downstream signaling to ERK1/2 module by associating with Ras [ 162, 163 ] .

The cross talk between PTHrP and growth factor signaling pathways may result in additive or antagonistic effects on cancer cell proliferation. An example of addi-tive effect comes from human oral cancer where PTHrP potentiates epidermal

66 F.O. Ranelletti and G. Monego

growth factor (EGF) receptor (EGFR) signaling and promotes the malignancies of oral cancers [ 164 ] . EGF is secreted in the oral environment, and most oral cancer cells express abundant EGFR. Activation of EGFR upregulates the expression of PTHrP through ERK1/2 and p38 MAPK pathways. In turn, secreted PTHrP acti-vates ERK1/2 MAPK and phosphatidylinositol 3-kinase (PI3K)/Akt pathways, potentiating the effects of EGF on tumor cell proliferation/survival, migration, and invasion and thus creating a vicious cycle. This observation suggests that targeting PTHrP may be benefi cial to shut down oral squamous cell cancer progression, and the possibility that the combined application of PTHrP inhibition on dose reduction of EGFR-tyrosine kinase inhibitors may contribute to avoid the EGFR-TKI-derived adverse aspects, maintaining the antitumor potency [ 165 ] . Targeting PTHrP in pre-clinical settings has been attempted using a neutralizing antibody, antisense oligo-nucleotides, and RNAi, which resulted in prolonged survival of hypercalcemic mice

Fig. 4.4 G q regulation of ERK1/2 modules. G

q activates ERK1/2 modules via PKC- as well as

Ca 2+ -dependent pathways. Moreover, the b g subunits can activate ERK1/2 modules through CaM-kinase–calmodulin–Pyk2–Src–Shc–Sos–Ras pathway. See text for details

674 PTHrP Signaling in Cancer

[ 165 ] , decreased cell proliferation of renal carcinoma [ 166 ] , and increased apoptosis in human medulloblastomas [ 167 ] , respectively.

PTHrP and hedgehog (HH) signaling plays an important and coordinated role in regulating the differentiation of chondrocytes in the growth-plate cartilage through a negative-feedback loop [ 168 ] . PTHrP, secreted from growth-plate chondrocytes, acts on PTH1R on proliferating chondrocytes to keep them proliferating by inhibition of the cyclin-dependent kinase inhibitor p57 Kip2 [ 169 ] . When chondrocytes are no longer suffi ciently stimulated by PTHrP, they stop proliferating and synthesize Runx2 which induces the expression of Indian hedgehog (IHH) [ 170 ] which can then stimulate the production of PTHrP in growth-plate chondrocytes [ 171 ] . A similar mode of opera-tion has been reported in breast cancer cells where PTHrP expression is driven by Gli2 [ 172 ] , a mediator of HH signaling. Interestingly, cancer cells, when metastasize in the bone microenvironment, assume an osteomimicry property, responding to transforming growth factor b and taking advantage of gene regulatory mechanisms operative under the physiologic conditions. Moreover, metastatic cells use master transcription factors, such as Runx2/Cbfa1, to support their survival and to promote osteolytic disease through activation of the IHH–PTHrP pathway [ 173 ] .

Recently, a direct regulation of HH-mediated transcriptional activation by PTHrP has been uncovered by studying the interaction of the two pathways in normal and neoplastic growth-plate chondrocytes [ 174 ] . HH-activated patched (PTCH) releases its inhibition on smoothened (Smo), which converts the transcription factor Gli3 from transcriptional repressor to transcriptional activator [ 175 ] , facilitating its trans-location to the nucleus. PTHrP-activated PTH1R promotes, via PKA activity, the cleavage of the full-length activator form of Gli3 to its repressor form, thus blocking HH signaling downstream of PTCH and Smo. Then, in selected tumor type, with mutations in PTCH or Smo, such as chondrosarcoma and medulloblastoma, PTHrP treatment could be used to decrease the HH signaling pathway. However, it has been reported that Gli2, but not Gli3, expression induces an increase of PTHrP produc-tion only in those breast cancer cell lines that cause osteolytic lesions, thus favoring the PTHrP role in the bone metastasis progression [ 172 ] . Then, it is still unclear whether the PTHrP inhibitory effect on HH signaling is Gli type- (Gli3 vs. Gli2) and/or context- and cell type–dependent.

Apoptosis

Apoptosis is involved in the control of cell proliferation, and the interference with apoptosis signaling represents a potential mechanism to promote cancer growth and progression.

PTHrP is generally considered as an antiapoptotic factor able to inhibit major apoptosis signaling pathways, but variable, and sometimes contradictory, data are reported in the literature. Actually, it is not possible to come to only one point of view on the role of PTHrP in the apoptotic process. The effects of PTHrP on apoptosis probably depend on tissue and cell type, cell line and clonal variation, physiological

68 F.O. Ranelletti and G. Monego

and pathological context, as well as on peptidic fragment. For example, in regard to lung cell physiopathology, Hastings reported that A549 cells and adult rat type II pneumocytes actively express PTHrP and PTH1R proteins, showing the possibility of producing peptide and responding to it through the cognate receptors, following auto-crine/paracrine mechanisms. Hastings describes a sensitization of type II cells to apoptosis mediated by PTHrP 1–34 and PTHrP 67–86 [ 107, 176 ] . Nevertheless, Hastings et al. reported that PTHrP 1–34 and PTHrP 140–173 improve resistance of BEN cells to apoptosis induced by exposure to UV irradiation. This effect is reached through the reduction of the activity of caspase-3, -8, and -9. The modulation of cas-pases is associated with PKA activation [ 177 ] and cAMP increase. PTHrP 140–173 can regulate caspases also after stimulation of Fas (CD95) by activating antibody [ 178 ] . These data on the inhibitory infl uence of PTHrP on the apoptotic pathways are in accord with our data noticed from studying human medulloblastoma DAOY cells [ 167 ] . In fact, we observed that PTHrP gene silencing was associated with signifi cant increase of apoptotic cell number in vitro. Capase-3 showed marked elevation of mRNA levels of about seven- to eightfold, involving the two major pathways converg-ing on caspase-3 activation. Mitochondrial-mediated and death receptor–mediated signals showed different levels of activation. With respect to the intrinsic pathway, the Bax/Bcl-2 ratio mRNA levels rised to of about 160%, whereas Fas mRNA level reached a peak of about 1,700% in the context of the extrinsic pathway. Our data suggest that PTHrP can regulate apoptosis in DAOY cells prevalently by the modula-tion of death receptor–mediated signal and by the parallel minority involvement of mitochondrial-mediated signal.

The correlations between PTHrP and Fas, as well as with antiapoptotic proteins, were confi rmed by Gagiannis et al. [ 179 ] , who developed the investigation on PTHrP interference with apoptosis pathways mediated by death receptors and mitochondria. Gagiannis and coworkers studied the role of PTHrP in the resistance of Saos-2 human osteosarcoma cells to the apoptosis induced by chemotherapeutic drugs. They noticed that both N-terminal and C-terminal PTHrP could inhibit signifi cantly the apoptosis induced by doxorubicin and bleomycin, while the apoptotic effect of mitoxantrone is counteracted only by N-terminal PTHrP. This suggests that these antiapoptotic effects of PTHrP could be mediated by a PTH1R-dependent and cAMP/PKA-based mecha-nism as well as by a PTH1R-independent mechanism. At caspase level, the authors reported an inhibition of the activating effect of doxorubicin on caspase-2, -3, -6, -8, and -9 exerted by PTHrP 1–34 and PTHrP 107–139. These two peptides showed an ability to reduce the apoptosis produced by the stimulation with respective specifi c antibodies or ligands of CD95, TRAIL-R, and TNF-R, in addition with administration of cytostatic drugs, such as bleomycin and doxorubicin. The antagonistic infl uence of PTHrP on the extrinsic apoptosis signaling pathway was expressed also on the intrin-sic pathway. In fact, the destabilizing proapoptotic effects of bleomycin and doxoru-bicin on mitochondrial membranes were counteracted by N-terminal and C-terminal PTHrP, whereas only N-terminal PTHrP was able to antagonize the effect of mitoxantrone.

The exposition of Saos-2 cells to PTHrP 1–34 and PTHrP 107–139 interfered with the expression of proteins acting on mitochondria by producing accumulation

694 PTHrP Signaling in Cancer

of antiapoptotic Bcl-2 and Bcl-xl proteins while inducing downregulation of PUMA and Bax proapoptotic proteins. The consequent increase of the Bcl-2 and Bcl-xl to Bax ratio stops intrinsic apoptosis as well as the repression of the BH-3-only molecule PUMA, a direct transcriptional target of PTHrP and a promoter of oncogenic trans-formation [ 180 ] .

Upstream to the extrinsic and intrinsic pathways, both N-terminal and C-terminal PTHrP exerted a signifi cant inhibition of p53 family–mediated apoptosis. Moreover, this repression of transcriptional activation of p53 determined the consequent inhi-bition of the transactivation of target genes belonging to mitochondrial and death receptor–mediated apoptosis. In detail, N-terminal and C-terminal PTHrPs were able to inhibit p53-dependent transactivation of CD95 gene as well as the transacti-vation of Bax gene. This work reveals that PTHrP can inhibit apoptosis and confer chemoresistance by interfering with key regulator genes of apoptosis signaling cas-cade. Apoptosis modulation by PTHrP develops through p53 family–dependent as well as p53 family–independent signaling pathways and can affect both death receptor–mediated and mitochondria-mediated apoptosis. The results of PTHrP regulatory infl uence are critically linked to tumorigenesis because they consist in resistance to apoptosis induced by treatment with chemotherapeutic drugs and con-sequent promotion of tumor progression.

Invasiveness and Integrins

Invasive phenotype is an integral part of the arsenal of cancer cells. Local invasive-ness is the base of the metastatic potential of tumors, and it requires modifi cations of intercellular interactions as well as modifi cation of interactions between cancer cell and extracellular matrix (ECM). It is reasonable to assume that the development of an invasive phenotype is associated with alterations in cancer cell adhesion and migration. Also, matrix proteolysis and degradation are considered key elements of the complex process of invasion–metastasis cascade.

PTHrP intervenes in tumor invasiveness by regulating the expression of adhesion molecules, such as integrins. Integrins mediate cell–cell and cell–ECM adhesion and are considered able to infl uence cancer cell invasiveness and metastasizing capability. They belong to a family of transmembrane adhesion receptors that are heterodimers composed of a - and b -subunits. Different combinations of these subunits form receptors with different ligand specifi cities [ 181 ] . The ligands of inte-grins are the components of ECM: collagen type IV and laminin at level of base-ment membrane, and collagen type I and fi bronectin at level of interstitial stroma.

Adhesive interactions and attachment to ECM, plus local lyses and disruption of basement membrane, represent the essential steps for cancer cells to seep into stroma and to gain access to vascular compartment, spreading out through the circulation.

Modifi cations in integrin expression and combination have been reported in asso-ciation with cancer progression in vitro and in vivo [ 182– 186 ] . Moreover, integrins

70 F.O. Ranelletti and G. Monego

can support tumor development by activating intracellular signaling pathways involved in the regulation of cell growth, differentiation, apoptosis, and motility [ 187 ] . After all, integrins are considered to play a major role in the development of the aggressive behavior of cancer cells [ 188, 189 ] .

In PC-3 prostate cancer cells, Shen and Falzon observed that endogenous overexpression of wild-type PTHrP was selectively associated with increased expression of a 1, a 5, a 6, and b 4 integrin subunits, whereas in MDA-MB-231 and MCF-7 breast cancer cells, the overexpressed peptide upregulated only a 6 b 4 integ-rin [ 187, 190– 192 ] .

Other studies on PTHrP overexpression highlighted that in MDA-MB-231 cells, the expression of a 5, a 6, b 1, and b 4 integrin subunits was enhanced, while in HT-29 colon cancer cells, only the expression of a 5 and b 1 subunits was increased [ 193 ] . The authors verifi ed that the increased integrin subunit expression occurred both at transcriptional and cell surface levels, and they observed that the expression levels of the peptide directly correlated with those of the integrins. The involvement of a transcriptional mechanism in PTHrP-mediated effects on integrin expression, cell migration, and adhesion was confi rmed by gene silencing experiments.

The modulation of cell adhesion/migration is probably a PTHrP-mediated effect active in physiological conditions, exerted by the peptide at the transcriptional and/or posttranscriptional level by increasing the gene transcription of the integrin subunits.

PC-3 cells overexpressing wild-type PTHrP showed strong cytoplasmic and especially nuclear immunostaining, suggesting a nuclear accumulation of the peptide. This is in accord with the hypothesis that the intracrine pathway could mediate the regulatory effect of PTHrP. In fact, this upregulation was dependent on the presence of an intact NLS, particularly on the presence of amino acids 88–91, which are involved in importin b pathway (Fig. 4.2 ) [ 98 ] . The pivotal role of intra-crine mechanism of action is supported by the observation that the administration of exogenous PTHrP 1–34, which lacks NLS and cannot enter the nucleus/nucleolus compartments, failed to induce signifi cant modifi cation of the expression of the integrins studied. The intracrine pathway is based on an infl uence exerted by PTHrP on gene transcription, either directly probably working as a transcription factor or indirectly by regulating the activities of other transcription factors.

Integrin subunits selectively upregulated by endogenously overexpressed PTHrP are combined to assemble different heterodimeric adhesion receptors with specifi c adhesion targets. In detail, integrin a 1 b 1 is deputed to mediate the adhesion to collagen type IV of basement membrane and to collagen type I of interstitial matrix. Also at the level of basement membrane, integrin a 6 b 1 mediates the attachment to laminin, and the increased expression of this heterodimer can promote cancer cell attachment and the consequent transversion. Integrin a 6 b 4 is considered an adhe-sion receptor of the laminins [ 194 ] and is also considered able to enhance migration and invasion of non-laminin ligands, such as collagen. The adhesion to stromal fi bronectin appears mediated by a 5 b 1 integrin [ 193 ] .

Cell adhesion assays showed that PTHrP overexpression produced increased adhesion of MDA-MB-231 cells to collagen type I, laminin, and fi bronectin, whereas

714 PTHrP Signaling in Cancer

in HT29 cells, the adhesion to collagen type I and fi bronectin was enhanced. Transfection with NLS-mutant PTHrP confi rmed the suggestion that the effects on cell adhesion and integrin expression induced by the peptide require its transport to the nucleus via an intracrine mechanism.

Nevertheless, not all data obtained on the regulation of integrin expression and cell adhesion by PTHrP are concordant. For example, Anderson et al. [ 193 ] observed absence of correlation between integrin a 6 and PTHrP expression in HT29 cells, while Shen and Falzon [ 195 ] reported that in LoVo colon cancer cells, the overex-pression of PTHrP was associated with enhanced expression of a 2, a 5, a 6, b 1, and b 4 integrin subunits. Ye et al. [ 196 ] did not fi nd changes in adhesion to fi bronectin and laminin in HT29 cells overexpressing PTHrP, while, consisting with previous data, Shen and Falzon [ 195 ] reported that LoVo cells overexpressing the peptide showed increased adhesion to collagen type I, laminin, and fi bronectin. These con-fl icting evidences support the hypothesis that the regulation of integrin expression and cell adhesion exerted by PTHrP is tissue-specifi c and cell line–specifi c, and this specifi c regulation could infl uence the subsequent migration–metastasis sequence. In fact, basement membrane adhesion and transversion are the bases of tumor inva-siveness and metastatic potential [ 197– 202 ] .

Another aspect that has to be considered in PTHrP-mediated contribution to can-cer invasiveness is the upregulation of protein involved in matrix remodeling. The increased expression of matrix metalloproteases MMP2, MMP3, MMP9, and uPA (urokinase-type plasminogen activator) induced by exogenous peptides 1–141 and 1–84 in vitro could promote ECM degradation, favoring cancer cell invasion of the stroma [ 4 ] .

In vitro studies highlighted that PTHrP overexpression is directly correlated with increased migration of MDA-MB-231 and MCF-7 cells. This enhancement in breast cancer cell migration induced by PTHrP is mediated by the upregulation of integrin a 6 b 4, which represents a crucial point required for the development of PTHrP stim-ulatory effect [ 192 ] . Also, in PTHrP-overexpressing LoVo cells, migration and inva-sion were increased as well as the levels of integrin a 6 b 4 subunits [ 187 ] .

Expression/overexpression of integrin a 6 b 4 has been associated with increased cancer aggressiveness [ 203– 210 ] . Moreover, the progression of breast, thyroid, colorec-tal, gastric, and bladder tumors has been reported to correlate with the expression of integrin a 6 b 4. Furthermore, integrin a 6 can promote cancer cell metastasis to bone and engraftment in bone microenvironment by exerting its laminin-binding function on the laminins of bone extracellular matrix [ 211 ] . As reported above, in MDA-MB-231 cells, the overexpression of PTHrP induces enhanced adhesion to collagen type I, laminin, and fi bronectin, the bone being composed of 95% of collagen type I, with laminin and fi bronectin included in ECM [ 212 ] . This correspondence between upregulated integrin profi le and presence of its ligands in the target tissue can help to explain the tendency of a primary tumor, such as breast cancer, to metastasize predominantly to a selected organ, such as bone. Another aspect of this integrin-mediated tropism is based on the prevalence in the space of Disse of fi bronectin and collagen type I, which are probably targeted by gastrointestinal cancer cell overex-pressing a 5 b 1 integrin subunits, as demonstrated by Anderson et al. [ 193 ] .

72 F.O. Ranelletti and G. Monego

Besides modulating cell adhesion and migration, PTHrP-mediated modulation of integrin expression can support cancer development by other strategies involving cell proliferation and survival. In fact, integrins appear also able to infl uence intrac-ellular signaling pathways involved in the regulation of cell growth and apoptosis [ 188, 189 ] .

Overexpressing PTHrP in MDA-MB-231 and MCF-7 cells was associated with a signifi cant increase in cell survival, which was reversed by cell transfection with PTHrP siRNA [ 192 ] . The PTHrP-overexpressing cells showed reduced apoptosis, while gene silencing produced an increase in apoptotic process [ 192 ] . These protective effects of the peptide against apoptosis were dependent on a 6 b 4 subunit expression. Moreover, in PTHrP-overexpressing cells, augmented levels of phosphorylated Akt (p-Akt) and phosphorylated glycogen synthase kinase-3 (p-GSK-3) were detectable.

In LoVo cells, Shen et al. [ 187 ] noted parallel increases in the expression of PTHrP, integrin a 6 b 4, and PI3-K pathway components. Based on these data, it is assumable that the increased expression of PTHrP could increase the expression of integrin a 6 b 4, which, in turn, could activate the pathway of phosphatidylinositol 3-kinase (PI3-K) [ 204 ] . PI3-K is a ubiquitous lipid kinase that can mediate the trans-duction of signals from tyrosine kinase receptors and GPCRs and is considered able to infl uence colon cancer progression [ 213– 219 ] . PI3-K effects are mediated by its downstream effector Akt, which appears increased in several cancers, and especially in colon cancer, it correlates with clinicopathological parameters suggestive of can-cer progression [ 220– 222 ] . In LoVo colon cancer cells, the overexpression of PTHrP correlates with the levels of the phosphorylated Akt (p-Akt), which corresponds to the active form of Akt [ 187, 223, 224 ] . Similarly, the levels of p-Akt paralleled the expression of integrin a 6 b 4 and PTHrP in MDA-MB-231 and MCF-7 cells, and also the levels of p-GSK-3 increased [ 192 ] . In fact, the phosphorylation of Akt leads to the phosphorylation of GSK-3 (glycogen synthase kinase-3). This glycogen syn-thase kinase-3 phosphorylates many proteins, such glycogen synthase, c-Myc, and cyclin D, keeping them inactivated or leading them to degradation [ 225 ] . So, the phosphorylation/inactivation of GSK-3 induces the derepression of pathways normally repressed, and this can be the strategy employed by PTHrP to indirectly promote cell survival and proliferation by triggering PI3-K/p-Akt pathway through integrin a 6 b 4 upregulation.

The a 6 b 4 integrin works as a powerful activator of PI3-K in carcinoma cells [ 205, 211 ] , but we cannot rule out the involvement of other survival pathways [ 192 ] . For example, Akt can be activated in a PI3-K-independent manner in the context of a pathway downstream to GPCRs, such as the PTH/PTHrP receptor PTH1R [ 226 ] .

Moreover, upstream to PI3-K, a 6 b 4 integrin can infl uence cell growth through the Ras-MAPK cascade [ 227, 228 ] and can also interact with some growth factor receptors, such as ErbB2 and Met [ 229, 230 ] . In particular, b 4 subunit signaling is reported to promote cell proliferation via ErbB2, suggesting the possibility of a b 4/ErbB2 pathway for cancer cell growth and survival [ 231– 233 ] .

After all, the net effect of PTHrP-induced integrin a 6 b 4 upregulation is a signifi cant increase in cell proliferation, migration, invasion, and anchorage-independent cell

734 PTHrP Signaling in Cancer

growth, as reported by Shen et al. [ 187 ] in their work on LoVo cells. Moreover, in support of in vitro data, they described an increase of LoVo xenograft growth, with engrafted tumor cells overexpressing a 6 b 4 subunits as well as PI3-K subunits (p85 a regulatory and p110 a catalytic) and p-Akt, plus total Akt. These experimental results highlight the pivotal role of the prosurvival and proinvasive integrin a 6 b 4 in cancer progression [ 234 ] , as confi rmed by the experimental evidences that emerged from studies on the pharmacologic treatment of prostate cancer cell lines PC-3 and C4-2. Shen et al. [ 235 ] noted that the exposure to 1,25(OH)

2 D

3 induced signifi cant

downregulation of PTHrP and integrin a 6 b 4 expression in C4-2 cells. The decrease of integrin a 6 b 4 expression followed the earlier decrease of PTHrP, supporting the mechanism based on the PTHrP-mediated control of integrin a 6 b 4 expression. These effects resulted in cell proliferation reduction, as expected on the bases of the PTHrP/ a 6 b 4 control axis of cell proliferation described above.

Moreover, recent data collected by Bhatia et al. demonstrated that the intrac-rine PTHrP signaling can protect C4-2 and PC-3 cells against the apoptosis induced by doxorubicin. This protective effect requires the a 6 b 4-mediated activa-tion of PI3-K/Akt pathway and results associated with enhanced level of c-Myc and increased ratio of antiapoptotic to proapoptotic members of Bcl-2 family. In this model, PTHrP is reported to increase the activity of nuclear factor kB as well as the anchorage-independent cell growth. The critical role played by integrin a 6 b 4 in the induction of these survival/proliferation pathways is proved by the block of PTHrP-mediated activation of PI3-K/Akt pathway produced by a 6 b 4 silencing [ 236 ] .

Also a 5 b 1 integrin results involved in an antiapoptotic pathway based on the selective activation of PI3-K [ 237 ] and probably PTHrP overexpression exerts its protective effect against apoptosis through the upregulation of a 5 subunit [ 190 ] .

PTHRP and Bone Metastases

Based on literature data, there is a correlation between PTHrP expression by primary tumor and metastatic diffusion to bone tissue, and virtually all tumors that metastasize to bone are considered expressing PTHrP.

Bone metastases are a frequent and serious complication of cancer and are associ-ated with worsening of quality of life and considerable social costs. Bone metastases are often a “point of no return” in tumor clinical history because they are usually incurable and associated with devastating consequences, as severe bone pain, patho-logic fractures, life-threatening hypercalcemia, and neural compression syndromes. The exact extent of skeletal metastatic involvement is not defi ned but, for example, it is estimated that in the United States, 350,000 patients affected by bone metastases die every year [ 238 ] . Bone metastases occur in up to 70% of patients with advanced can-cer of breast or prostate [ 239 ] , whereas in carcinoma of the lung, stomach, colon, rectum, uterus, kidney, bladder, or thyroid, the incidence is comprised from 15% to 30% approximately [ 240 ] .

74 F.O. Ranelletti and G. Monego

Bone appears to be a preferred site of cancer metastasis, and this “predilection” is probably due to several structural and functional factors connected to bone microenvironment. First off, the high blood fl ow in red marrow areas can favor the localization of cancer cells in these sites [ 241 ] . In bone microenvironment, adhesive interactions can develop based on adhesive molecules, such as integrins, expressed by tumor cells. The adhesion of cancer cells to bone matrix and marrow stromal cells starts a bidirectional series of signals that gives rise to the development of a sort of fertile niche for metastatic cells. In fact, these adhesive interactions induce tumor cells to produce angiogenic factors and bone-resorbing factors that support tumor colony growth [ 242 ] . Moreover, bone resorption can mobilize and activate several growth factors previously embedded in bone matrix. The release of trans-forming growth factor b (TGF- b ), insulin-like growth factors I and II (IGFs), fi bro-blast growth factors (FGFs), platelet-derived growth factors (PDGFs), bone morphogenic proteins (BMPs), and calcium can impact tumor growth, providing a suitable milieu for cancer cell proliferation [ 243, 244 ] . This is in accord with the “seed and soil” hypothesis suggested by Paget to describe the mechanism of bone metastasis [ 245 ] . However, when cancer cells metastasize to bone, a new altered microenvironment develops, and this causes the deregulation of bone remodeling. This dysregulated remodeling is a pathologic process that can range from osteolytic lesions to osteoblastic lesions, often showing both lesions coexisting in mixed forms of metastases. In fact, with the exception of the purely osteolytic lesions produced by multiple myeloma [ 246 ] , it would be more correct to speak about predominantly osteolytic metastases as those generally associated with breast cancer or predomi-nantly osteoblastic metastases as those in prostate cancer [ 247, 248 ] . Furthermore, the bone destruction caused by osteolytic metastasis is generally associated with an osteoblastic reaction fi nalized to bone neoformation, and so, there is also an increased component of osteosynthesis against the dominant osteolysis [ 249 ] .

After all, the result is a poor quality of bone, which is exposed to the risk of pathologic fractures.

In this picture, which role is played by the PTHrP/PTH1R system? In osteolytic metastases, the osteoclasts are liable of bone damage rather than

cancer cells [ 250, 251 ] . However, tumor cells can act as pseudo-osteoblast by producing and releasing factors that can mediate the activation of osteoclasts: interleukin-1 (IL-1), interleukin-6 (IL-6), prostaglandin E

2 (PGE

2 ), tumor necrosis

factor- a (TNF a ), macrophage colony-stimulating factor (M-CSF), macrophage infl ammatory protein-1 a , and receptor activator of nuclear factor-kB ligand (RANKL) [ 240, 252 ] . Among tumoral osteoclastogenic factors, there is PTHrP, which is considered the primary stimulator of osteolytic destruction by bone metas-tases. PTHrP promotes bone resorption indirectly by binding PTH1R and inducing the expression of RANKL on osteoblastic and marrow stromal cells in bone microenvironment. The upregulated RANKL binds to RANK (receptor activator of nuclear factor-kB) on the surface of osteoclast precursors. RANKL signals can be transmitted downstream to RANK through the nuclear factor-kB and Jun N-terminal kinase pathways, inducing the maturation of osteoclasts and prolonging their survival by preventing apoptosis.

754 PTHrP Signaling in Cancer

Osteoclasts are the direct mediators of bone destruction through the release of acids and proteases at the level of the ruffl ed border of their plasma membrane, which is considered as a cellular resorbing organelle adhering to bone.

As in the case of other bone-resorptive cytokines, the effect of PTHrP converges on preosteoclasts to promote the differentiation to mature and actively bone-resorb-ing osteoclasts. On the other hand, bone destruction results in release of IGFs, FGFs, BMPs, PDGF, and TGF- b from extracellular matrix. These growth factors in asso-ciation with increased levels of extracellular calcium can feedback to cancer cells, stimulating proliferation and PTHrP production. Moreover, it has been reported that TGF- b is able to amplify PTHrP signaling by increasing the stability of PTHrP mRNA and prolonging its half-life [ 17 ] . So, a bidirectional interaction between cancer cells and bone microenvironment is set up. This reciprocal symbiotic inter-action produces a vicious cycle that works as a support system for tumor localiza-tion and growth in bone, associated with progressive bone loss.

Bone resorption is critical not only for osteolytic metastases development but also for tumor burden. In fact, experimental and clinical evidences suggest a close correlation between bone erosion and tumor growth since the pharmacologic block of bone destruction is associated with the decrease of tumor burden [ 253, 254 ] . Moreover, the inhibition of metastasization to skeleton can be associated with an improvement of clinical outcome [ 255 ] .

The mechanism of osteolytic metastases from breast cancer is a paradigmatic example of the vicious circle structured around PTHrP expression by tumor cells.

PTHrP is overexpressed in breast cancer cells that metastasize to bone, and it is not clear if this is due to an intrinsic functional property of tumor cell or is induced by the interaction with bone microenvironment. By the way, the metastasization to bone is associated with a marked increase in PTHrP expression, since only 50% of primary tumors produce the peptide, whereas 92% of bone metastases are verifi ed to be PTHrP-expressing [ 256 ] . The production of PTHrP by bone metastatic cancer cells is upregulated by the increased expression of Runx2 /CBFA1 (core-binding factor a 1), a master transcription factor involved in the control of a cohort of genes required for bone development and turnover as well as for tumor growth and metas-tasis [ 173 ] . Breast cancer metastatic cells overexpress Runx2, and this activates Indian hedgehog (IHH) by binding to its promoter. In accord to physiologic sequence, the activation of IHH induces the downstream target gene PTHrP proba-bly through Gli proteins, the mediators of hedgehog signaling. As mentioned before, PTHrP upregulation leads to RANKL expression and to osteoclastic activation, completing the bone-destructive mechanism operative in breast cancer cells. So, in breast cancer, the highly expressed Runx2 works through the physiological axis formed by the IHH–PTHrP pathway, and this supports the hypothesis that tumor cells in bone acquire osteomimicry property [ 257 ] , gaining a growth boost by taking advantage of gene regulatory mechanisms active under physiologic conditions.

Osteoclast-mediated resorption demineralizes bone matrix, increasing extracel-lular levels of calcium, which can promote cancer cell proliferation and PTHrP synthesis by signaling through CaSR (calcium-sensing receptor). The overproduced PTHrP can impact cancer proliferation by regulating the expression of its downstream

76 F.O. Ranelletti and G. Monego

target gene cyclin D1, a key cell cycle controller that can support tumor develop-ment [ 258 ] . Furthermore, metastatic cells actively synthesize several factors, such as M-CSF, IL-6, IL-1, TNF- a , and PGE

2 , which can contribute to osteoclast matura-

tion and bone erosion. The osteolysis causes the release of growth factors and cytok-ines stored in mineralized extracellular matrix, resulting in a feedback support system for cancer growth. Among these growth factors mobilized from bone matrix, TGF- b can mediate an increase in PTHrP production via Smad and MAPK (mitogen-activated protein kinase) pathways.

In this TGF- b -mediated induction of PTHrP, Runx2 plays an important role by directly activating IHH and stimulating the IHH downstream target gene PTHrP. This IHH-dependent induction of PTHrP requires a sort of activation complex that involves the synergistic interaction of Runx2 with coregulatory factors, such as Smad proteins and Ets proteins as well as the cooperation with hedgehog signaling molecules, such as Gli proteins, and the activation of MAPK signaling.

Moreover, the signals of PTHrP and TGF- b converge on cyclin D1, which is an important target gene of both these factors for skeletal development [ 259, 260 ] . As mentioned above, cyclin D1 is a critical regulatory protein of cell cycle, and the signaling of PTHrP and TGF- b can contribute to the deregulation of cell prolifera-tion by targeting cyclin D1 [ 258, 261 ] . This input to proliferation of cancer cells closes the vicious circle that links bone microenvironment to metastatic cells, improving progressively tumor burden and bone destruction.

All these data support the concept that PTHrP plays a major role in osteolytic metastases from breast cancer and other solid tumors.

Nevertheless, PTHrP, as well as PTH, can exert anabolic effects in bone through their common receptor. In detail, PTH inhibits collagen synthesis and osteoblast differentiation and, similarly to PTHrP, inhibits matrix mineralization probably through the matrix gla protein (MGP) [ 262, 263 ] . By contrast, PTHrP effect is more complex, depending on cell differentiation state. In fact, the peptide stops prolifera-tion of confl uent differentiated osteoblasts whereas increases the growth of osteo-blastic cells proliferating under low-serum conditions by upregulating its target gene cyclin D1 [ 260, 264 ] . So, in bone microenvironment, the presence of different cellular pools at various differentiation stages makes the effect of PTHrP released by metastatic cells articulated. Moreover, posttranslational processing of PTHrP can produce multiple peptides characterized by different, and sometimes opposite, effects. The amino-terminal PTHrP is a potent enhancer of osteoclastogenesis through the binding with PTH1R, whereas the carboxyl-terminal is considered an inhibitor of osteoclast-mediated bone erosion and is defi ned osteostatin [ 265 ] . The complexity of PTHrP signaling accounts for the possibility that the interactions between cancer cells and bone microenvironment could give rise to a pathological structural rearrangement potentially oriented toward bone formation or toward bone destruction. In certain conditions, PTHrP could synergize with tumor-derived growth factors to support a predominant osteoblastic activity with osteoblast prolif-eration, whereas in other conditions, the peptide could work as an inhibitor of osteo-blast development and as a powerful stimulator of osteoclastogenesis and bone

774 PTHrP Signaling in Cancer

catabolism by interacting cooperatively with matrix-derived factors and structuring the vicious circle of osteolytic metastasis.

Osteoblastic metastasis is the opposite extreme of osteolytic metastasis in the pathologic bone remodeling process caused by cancer metastasization to skeleton. The histology of this type of metastasis is composed by increased newly formed woven bone with irregular structure of more abundant trabeculae and numerous osteoblasts.

Osteoblastic lesions are rare and generally associated with cancer of the prostate. The mechanisms of osteoblastic metastases are still not defi nitively known, but some evidences suggest that a vicious circle could be involved also in this case. The vicious sequence could be based on an osteoblast-inducing activity performed by tumor cells followed by the production and the release by osteoblasts of growth fac-tors that can improve tumor growth. The growth factors involved in the development of osteoblastic lesions are endothelin-1 and PDGF [ 266, 267 ] . The cancer of the prostate spreads metastases to the skeleton, and these lesions are predominantly osteoblastic. Prostate cancer cells release endothelin-1, PDGF, urokinase and uroki-nase-type plasminogen activator (u-PA), and prostate-specifi c antigen (PSA). Increased production of u-PA by prostate cancer cells results in an increase of bone metastases [ 268 ] .

PSA is a kallikrein serine protease produced by prostate cancer cells. The release of PSA by tumor cells can indirectly impact on bone remodeling. In fact, PSA can cleave PTHrP at the amino-terminal part of peptide, cutting the site of binding to PTH1R and stopping the induction of bone resorption. PTHrP shows intense posi-tive immunostaining in bone metastatic lesions and colocalizes with PSA. PSA can also take part in the activation of insulin-like growth factors I and II, and TGF- b . The release of these osteoblastic growth factors in bone microenvironment during metastases development represents the possible completion of the vicious cycle hypothesized above.

As mentioned before, osteoblastic and osteolytic processes coexist in the dereg-ulated bone remodeling induced by cancer metastases. In fact, in bone metastases of prostate cancer, the osteoblastic lesions are associated with increase of bone resorption markers. Probably, osteoclast-mediated bone resorption is an integral part in the pathogenesis of osteoblastic bone metastases and can represent an initial event followed by massive osteoblast activation with consequent extensive bone formation [ 266 ] .

Another emerging aspect of PTHrP produced by the bone metastasizing cancer cells is the potential impact of the peptide on hematopoietic red marrow and, in par-ticular, on stem cell niche. The hypothesis is that PTHrP could support bidirectional communication between tumor cells and hematopoietic cells. In detail, PTHrP, like PTH, could act on the PTH1R on osteoblast, inducing the expression of Jagged 1. Jagged 1 is a ligand of Notch, which is expressed on hematopoietic cells and is con-sidered critical to support many steps of hematopoietic stem cell differentiation. So, PTHrP could promote hemopoiesis through the Jagged 1/Notch pathway. The increases in hematopoietic cells could, in turn, favor neoangiogenesis contributing to

78 F.O. Ranelletti and G. Monego

a fertile environment for cancer cells in bone. Moreover, PTHrP and PTH revealed ability to regulate hemopoiesis-relevant genes such as M-CSF (macrophage colony-stimulating factor), MCP-1 (monocyte chemotactic protein-1), and VCAM-1 (vascu-lar cell adhesion molecule 1) [ 269– 271 ] .

References

1. Suva, L. J., Winslow, G. A., Wettenhall R. E., Hammonds, R. G., Moseley, J. M., Diefenbach-Jagger, H., Rodda, C. P., Kemp, B. E., Rodriguez, H., Chen, E.Y. 1987, Science, 237, 893.

2. Philbrick, W. M., Wysolmerski, J. J., Galbraith, S., Holt, E., Orloff, J.J., Yang, K. H., Vasavada, R. C., Weir, E. C,, Broadus, A. E., and Stewart, A. F. 1996, Physiol. Rev., 76, 127.

3. Pecherstorfer, M., Schilling, T., Blind, E., Zimmer-Roth, I., Baumgartner, G., Ziegler, R., and Raue F. 1994, J. Clin. Endocrinol. Metab. 78, 1268.

4. Dittmer, J. 2004, Gene Ther. Mol. Biol., 8, 451. 5. Luparello, C., Romanotto, R., Tipa, A., Sirchia, R., Olmo, N., Lopez de Silanes, I., Turnay,

J., Lizarbe, A., and Stewart, A. F. 2001, J. Bone Miner. Res., 16, 2173. 6. Dougherty, K. M., Blomme, E. A., Koh, A. J., Henderson, J. E., Pienta, K. J., Rosol, T..J.,

and Mc Cauley, L. K. 1999, Cancer Res., 59, 6015. 7. Hastings, R. H., Burton, D. W., Quintana, R. A., Biederman, E., Gujral, A., and Deftos, L. J.

2001, Cancer, 92, 1402. 8. Massfelder, T., Lang, H., Schordan, E., Lindner, V., Rothhut, S., Welsch, S., Simon-Assmann,

P., Barthelmebs, M., Jacqmin, D., and Helwig, J. J. 2004, Cancer Res., 64, 180. 9. Comings, D. 1972, Nature, 238, 455. 10. Mangin, M., Ikeda, K., Dreyer, B.E., Milstone, L., and Broadus, A.E. 1988, Mol Endocrinol.,

2, 1049. 11. Mangin, M., Ikeda, K., Dreyer, B.E., and Broadus, A.E. 1989, Proc. Nat. Acad. Sci. U.S.A.,

86, 2408. 12. Suva, L.J., Mather, K.A., Gillespie, M.T., Webb, G.C., Ng, K.W., and Winslow, G.A. 1989,

Gene, 1989; 77, 95. 13. Yasuda, T., Banville, D., Hendy, G.N., and Goltzman, D. 1993, Mol. Endocrinol., 7, 273. 14. Vasavada, R. C., Wysolmerski, J. J., Broadus, A. E., and Philbrick, W. M. 1993, Mol.

Endocrinol., 7, 273. 15. Mangin, M., Ikeda, K., Dreyer, B.E., and Broadus, A.E. 1990, 4, 851. 16. Campos, R.V., Wang, C., and Drucker, D.J. 1992, Mol. Endocrinol., 6,1642. 17. Sellers, R.S., Luchin, A.I., Richard, Brena, R.M., Lima, D. and Rosol, T.J. 2004, J. Mol.

Endocrinol., 33, 227. 18. Southby, J., O’Keeffe, L.M., Martin, T.J., and Gillespie, M.T. 1995, Br. J. Cancer, 72, 702. 19. Yasuda, T., Banville, D., Hendy, G. N., and Goltzman, D. 1989, J. Biol. Chem., 264, 7720. 20. Gillespie, M.T., and Martin, T.J. 1994, Mol. Cell. Endocrinol., 100, 143. 21. Ikeda, K., Arnold, A., Mangin, M., Kinder, B., Vydelingum, N.A., Brennan, M.F., and

Broadus, A.E. 1989, J. Clin. Endocrinol. Metab., 69, 1240. 22. Ikeda, K., Lu, C., Weir, E.C., Mangin, M. and Broadus, A.E. 1989, J. Biol. Chem., 264, 15743. 23. Shaw, G., and Kamen, R. 1986, Cell, 46, 659. 24. Martin, T.J., Moseley, J.M., and Gillespie, M.T. 1991, Crit. Rev. Biochem. Mol. Biol., 26, 377. 25. Power, D.M., Ingleton, P.M., Flanagan, J., Canario, A.V., Danks, J., Elgar, G., and Clark,

M.S. 2000, Gene, 250, 67. 26. Ikeda, K., Lu, C., Weir, E.C., Mangin, M., and Broadus, A.E. 1990, J. Biol. Chem., 265, 5398. 27. Sellers, R.S., LeRoy, B.E., Blomme, E.A., Tannehill-Gregg, S., Corn, S., and Rosol, T.J.

2004, Prostate, 58, 366. 28. Wilson, G.M., Sutphen, K., Chuang, K., and Brewer, G. 2001, J. Biol. Chem., 276, 8695.

794 PTHrP Signaling in Cancer

29. Chen, C.Y., Gherzi, R., Ong,S.E., Chan, E.L., Raijmakers, R., Pruijn, G.J., Stoecklin, G., Moroni, C., Mann, M., and Karin, M. 2001, Cell, 107, 451.

30. Ikeda, K., Okazaki, R., Inoue, D., Ogata, E., and Matsumoto, T. 1993, J. Biol. Chem., 268, 1174. 31. Richard, V., Rosol, T.J., and Foley, J. 2005, Crit. Rev. Eu. Gene Exp., 15, 115. 32. Southby, J., Murphy, L.M., Martin, T.J., and Gillespie, M.T. 1996, Endocrinology, 137, 1349. 33. Oikawa, T., and Yamada, T. 2003, Gene, 303, 11. 34. Dittmer, J., Gitlin, S.D., Reid, R.L., and Brady, J.N. 1993, J. Virol., 67, 6087. 35. Dittmer, J., Gegonne, A., Gitlin, S.D., Ghysdael, J., and Brady J.N. 1994, J. Biol. Chem.

269, 21428. 36. Dittmer, J., Pise-Masison, C.A., Clemens, K.E., Choi, K.S., and Brady, J.N. 1997, J. Biol.

Chem. 272, 4953. 37. Levine, M., and Tjian, R. 2003, Nature, 424, 147. 38. Lindemann, R.K., Ballschmieter, P., Nordheim, A., and Dittmer, J. 2001, J. Biol. Chem.,

276, 46661. 39. Lindemann, R.K., Braig, M., Ballschmieter, P., Guise, T.A., Nordheim, A., and Dittmer, J.

2003. Int. J. Oncol., 22, 799. 40. Lindemann, R.K., Braig, M., Hauser, C.A., Nordheim, A., and Dittmer, J. 2003, Biochem.

J., 372, 787. 41. Wasylyk, B., Hagman, J., and Gutierrez-Hartmann, A. 1998. Trends Biochem. Sci., 23, 213. 42. Aklilu, F., Gladu, J., Goltzman, D., and Rabbani, S.A. 2000, Cancer Res., 60, 1753. 43. Cho, Y.M., Lewis, D.A., Koltz, P.F., Richard, V., Gocken, T.A., Rosol, T.J. Konger, R.L.,

Spandau, D.F., and Foley, J. 2004, J. Endocrinol., 181, 179. 44. Arbabi, S., and Maier, R. 2002, Crit. Care Med., Suppl 1: S74. 45. MacLeod, R.J,, Chattopadhyay, N., and Brown, E.M. 2003, Am. J. Physiol. Endocrinol.

Metab., 284, E435. 46. Tfelt-Hansen, J., MacLeod, R.J., Chattopadhyay, N., Yano, S., Quinn, S., Ren, X. Terwilliger,

E.F., Schwarz, P., and Brown, E.M. 2003, Am. J. Physiol. Endocrinol. Metab., 285, E329. 47. MacLeod, R.J., Yano, S., Chattopadhyay, N., and Brown, E.M. 2004, Biochem. Biophys.

Res. Commun. 320, 455. 48. Kakonen, S.M., Selander, K.S., Chirgwin, J.M., Yin, J.J., Burns, S., Rankin, W.A., Grubbs,

B.G., Dallas, M., Cui, Y., and Guise, T.A. 2002, J. Biol. Chem., 277, 24571. 49. Lindeman, R.K., Nordheim, A., and Dittmer, J. 2003, Mol. Cancer, 2, 20. 50. Yang, C., Shapiro, L.H., Rivera, M., Kumar, A., and Brindle, P.K. 1998, Mol. Cell. Biol., 18, 2218. 51. Chilco, P.J., Leopold, V., and Zajac, J.D. 1998, Mol. Cell. Endocrinol., 138, 173. 52. Wysolmerski, J.J., Vasavada, R., Foley, J., Weir, E.C., Burtis, W.J., Kukreja, S.C., Guise,

T.A., Broadus, A.E., and Philbrick, W.M. 1996, Cancer Res., 56, 1043. 53. Quandt, K., Frech, K., Karas, H., Wigender, E., and Werner, T. 1995, Nucleic Acid. Res. 23, 4878. 54. Nishishita, T., Okazaki, T., Ishikawa, T., Igarashi, T., Hata, K., Ogata, E., and Fujita, T.

1998, J. Biol. Chem. 273, 10901. 55. Okazaki, T., Nishimori, S., Ogata, E., and Fujita, T. 2003, Biochem. Biophys. Res. Commun.

2003, 304, 632. 56. Holt, E.H., Vasavada, R.C., Bander, N.H., Broadus, A.E., and Philbrick, W.M. 1993, J. Biol.

Chem., 268, 20639. 57. Ganderton, R.H., Day, I.N., and Briggs, R.S. 1995, Eur. J. Cancer, 31A, 1697. 58. Ganderton, R.H., and Briggs, R.S. 1997, Biochem. Biophys. Acta., 1352, 303. 59. Ganderton, R.H., and Briggs, R.S. 2000, Eur. J. Cancer., 36, 2128. 60. Liu, B., Goltzman, D., and Rabbani, S.A. 1993, Endocrinology,132, 1658. 61. Asadi, F., Faraj, M., Malakouti, S., and Kukreja, S.C. 2001, Int. Urol. Nephrol., 33, 47. 62. Merryman, J.I., Capen, C.C., McCauley, L.K., Werkmeister, J.R., Suter, M.M., and Rosol,

T.J. 1993, Lab. Invest., 69, 347. 63. Glatz, J.A., Heath, J.K., Southby, J., O’Keeffe, L.M., Kiriyama, T., Moseley, J.M., Martin,

T.J., and Gillespie, M.T. 1994, Mol. Cell. Endocrinol., 101, 295. 64. Kasono, K., Isozaki, O., Sato, K., Sato, Y., Shizume, K., Ohsumi, K., and Demura, H. 1991,

Jpn. J. Cancer Res., 82, 1008.

80 F.O. Ranelletti and G. Monego

65. Schilling, T., Pecherstorfer, M., Blind, E., Kohl, B., Wagner, H., Ziegler, R., and Raue, F. 1996, Bone, 18, 315.

66. Cohen-Solal, M. E., Bouizar, Z., Denne, M. A., Graulet, A. M., Gueris, J., Bracq, S., Jullienne, A., and de Vernejoul, M. C. 1995, Horm. Metab. Res., 27, 403.

67. Wysolmerski, J .J., Dann, P.R., Zelazny, E., Dunbar, M. E., Insogna, K.L., Guise, T.A., and Perkins, A. S. 2002, J. Bone Miner. Res., 17, 1164.

68. Manenti, G., Peissel, B., Gariboldi, M., Falvella, F. S., Zaffaroni, D., Allaria, B., Pazzaglia, S., Rebessi, S., Covelli, V., Saran, A., and Dragani, T.A. 2000, Oncogene, 19, 5324.

69. Akino, K., Ohtsuru, A., Yano, H., Ozeki, S., Namba, H., Nakashima, M., Ito, M., Matsumoto, T. and Yamashita, S. 1996, Cancer Res., 56, 77.

70. Rabbani, S.A., Gladu, J., Liu, B., and Goltzman, D. 1995, Endocrinology, 136, 5416. 71. Guise, T. A., Yin, J. J., Taylor, S. D., Kumagai, Y., Dallas, M., Boyce, B. F., Yoneda, T, and

Mundy, G. R. 1996, J. Clin. Invest., 98, 1544. 72. Orloff, J. J., Reddy, D., de Papp, A.E.,Yang, K., Soifer, N.E., Stewart, A.F. 1994, Endocrine

Rev., 15, 40. 73. Plawner, L. L., Philbrick, W. M., Burtis, W. J., Broadus, A. E., and Stewart, A. F. 1995, J.

Biol. Chem., 270, 14078. 74. Wu, T. L., Vasavada, R. C., Yang, K., Massfelder, T., Ganz, M., Abbas, S. K., Care, A. D.,

and Stewart, A. F. 1996, J. Biol. Chem., 271, 24371. 75. Deftos, L.J., Burton, D.W., Hastings, R.H., Terkeltaub, R., and Hook, V.Y. 2001, Endocrine,

15, 217. 76. Hook, V.Y., Burton, D., Yasothornsrikul, S., Hastings, R. H., and Deftos, L. J. 2001,

Biochem. Biophys. Res. Commun., 285, 932. 77. Gensure, R. C., Gardella, T. J., and Juppner, H. 2005, Biochem. Biophys. Res. Commun.,

328, 666. 78. Gagnon, L., Jouishomme, H., Whitfi eld, J. F., Durkin, J. P., MacLean, S., Neugebauer, W.,

Willick, G., Rixon, R. H., and Chakravarthy, B. 1993, J. Bone Miner. Res. 8: 497–503. 79. Abou-Samra, A. B., Juppner, H., Force, T., Freeman, M. W., Kong, X. F., Schipani, E.,

Urena, P., Richards, J., Bonventre, J. V., Potts, J. T. Jr., Kronenberg, H. M., and Segre, J. V. 1992, Proc. Natl. Acad. Sci. USA, 89, 2732.

80. Bringhurst, F.R., Juppner, H., Guo, J., Urena, P., Potts, J.T. Jr., Kronenberg, H.M., Abou-Samra, A.B. and Segre, G.V. 1993, Endocrinology, 132, 2090.

81. Matthew, J., Mahon, M. J., Donowitz, M., Yun, C. C., and Segre, G. V. 2002, Nature 417, 858. 82. Tawfeek, H.A., Che, J., Qian, F., and Abou-Samra, A. B. 2001, 281, E545. 83. Ferguson, G. S. S. 2001, Pharmacol. Rev. 53, 1. 84. Luttrell, L.M. 2005, J Mol Neurosci., 26, 253. 85. Gesty-Palmer, D., Chen, M., Reiter, E., Ahn, S., Nelson, C. D., Wang, S., Eckhardt, A. E., Cowan,

C. L., Spurney, R. F., Luttrell, L. M., and Lefkowitz, R. J. 2006, J. Biol. Chem., 281, 10856. 86. Azzi, M., Charest, P. G., Angers, S., Rousseau, G., Kohout, T., Bouvier, M., and Pineiro, G.

2003, Proc. Natl. Acad. Sci. USA, 100, 11406. 87. Pierce, K. L., Luttrell, L. M., and Lefkowitz, R. J. 2001, Oncogene, 20, 1532. 88. Tohgo, A., Pierce, K. L., Choy, E. W., Lefkowitz, R. J., and Luttrell, L. M. 2002, J. Biol.

Chem., 277, 9429. 89. Watson, P. H., and Pickard, B. W. 2008, Crit. Rev. Eukaryot. Gene Expr., 18, 151. 90. Watson, P. H., Fraher, L. J., Natale, B. V., Kisiel, M., Hendy, G. N., and Hodsman, A. B.

2000, Bone, 26, 221. 91. Pickard, B. W., Hodsman, A. B., Fraher, L. J., and Watson, P. H. 2006, 147, 3326. 92. Watson, P. H., Fraher, L. J., Hendy, G. N., Chung, U. I., Kisiel, M., Natale, B. V., and

Hodsman, A. B. 2000, J. Bone Miner. Res., 15, 1033. 93. Pickard, B. W., Hodsman, A. B., Fraher, L. J., and Watson, P. H. 2007, Endocrinology,

148, 2282. 94. Yang, R., Hoang, B. H., Kubo, T., Kawano, H., Chou, A., Sowers, R., Huvos, A. G., Meyers,

P. A., Healey, J. H., and Gorlick, R. 2007, Int. J. Cancer, 121, 943.

814 PTHrP Signaling in Cancer

95. Linforth, R., Anderson, N., Hoey, R., Nolan, T., Downey, S., Brady, G., Ashcroft, L., and Bundred, N. 2002, Clin. Cancer. Res., 8, 3172.

96. Nguyen, M., He, B., and Karaplis, A. 2001, Endocrinology, 142, 694. 97. Massfelder, T., Dann, P., Wu, T. L., Vasavada, R., Helwig, J. J., and Stewart, A. F. 1997,

Proc. Natl. Acad. Sci. U. S. A., 94, 13630. 98. Lam, M. H., Briggs, L. J., Hu, W., Martin, T. J., Gillespie, M. T., and Jans, D. A. 1999, J.

Biol. Chem., 274, 7391. 99. Meerovitch, K., Wing, S., and Goltzman, D. 1998, J. Biol. Chem., 273, 21025. 100. Aarts, M.M., Rix, A., Guo, J., Bringhurst, R., and Henderson, J.E. 1999, J. Bone Miner.

Res., 14, 1493. 101. Fiaschi-Taesch, N. M., Stewart, A. F. 2003, Endocrinology, 144, 407. 102. Lam, M. H., Thomas, R.J., Loveland, K. L., Schilders, S., Gu, M., Martin, T. J., Gillespie.

M. T., and Jans, D.A. 2002, Mol. Endocrinol., 16, 390. 103. Lam, M. H., Henderson, B., Gillespie, M. T., and Jans, D. A. 2001, Traffi c, 2, 812. 104. Lam, M. H., Olsen, S. L., Rankin, W. A., Ho, P. W., Martin, T. J., Gillespie, M. T., and

Moseley, J. M. 1997, J. Cell. Physiol., 173, 433. 105. Luparello, C., Sirchia, R., and Lo Sasso, B. 2008, Breast Cancer Res. Treat., 111, 461. 106. Fortino, V., Torricelli, C., Gardi, C., Valacchi, G., Rossi Paccani, S., and Maioli, E. 2002,

Cell.Mol. Life Sci., 59, 2165. 107. Hastings, R.H. 2004, Respiratory Physiology & Neurobiology, 142, 95. 108. Erhardt, P., Troppmair, J., Rapp, U. R., and Cooper, G. M. 1995, Mol. Cell. Biol., 15, 5524. 109. Tovar Sepulveda, V. A., and Falzon, M. 2002, Regul. Pept., 105, 109. 110. Gentili, C., Morelli, S., Boland, R., and de Boland, A. R. 2001, Biochim. Biophys. Acta,

1540, 201. 111. Falzon, M., and Du, P. 2000, Endocrinology, 141, 1882. 112. Maioli, E., and Fortino, V. Br. J. Cancer, 90, 1293. 113. Goldsmith, Z. G., and Dhanasekaran, D. N. 2007, Oncogene, 26, 3122. 114. Dhillon, A.S., Hagan, S., Rath, O., and Kolch, W. 2007, Oncogene, 26, 3279. 115. Iacovelli, L., Capobianco, L., Salvatore, L., Sallese, M., D’Ancona, G. M., and De Blasi, A.

2001, Mol. Pharmacol., 60, 924. 116. Busca, R., Abbe, P., Mantoux, F., EMBO J., 19, 2900. 117. Cook, S.J., and McCormick, F. 1993, Science, 262, 1069.. 118. Graves, L.M., Bornfeldt, K. E., Raines, E. W., Potts, B. C., Macdonald, S. G., Ross, R., and

Krebs, E. G. 1993, Proc. Natl. Acad. Sci. U.S.A., 90, 10300. 119. Wu, J., Dent, P., Jelinek, T., Wolfman, A., Weber, M. J., and Sturgill, T. W. 1993, Science,

262,1065. 120. Wan, Y., and Huang, X, Y. 1998, J. Biol. Chem., 273, 14533. 121. Zheng, M., Zhang, S. J., Zhu, W.Z., Ziman, B., Kobilka, B. K., and Xiao, R. P. 2000, J. Biol.

Chem., 275, 40635. 122. Laroche-Joubert, N., Marsy, S., Michelet, S., Imbert-Teboul, M., and Doucet, A. 2002, J.

Biol. Chem., 277, 18598. 123. Stork, P. J., and Schmitt, J. M. 2002, Trends Cell. Biol., 12, 258. 124. Dumaz, N., and Marais, R. 2005, FEBS J., 272, 3491. 125. Pearson, G. W., Earnest, S., and Cobb, MH. 2006, Mol. Cell. Biol., 26, 3039. 126. Vossler, M. R., Yao, H., York, R. D., Pan, M. G., Rim, C. S., and Stork, P. J. 1997, Cell, 89, 73. 127. Weissman, J. T., Ma, J. N., Essex, A., Gao, Y., and Burstein, E. S. 2002, Oncogene, 23, 241. 128. Wang, Z., Dillon, T. J., Pokala, V., Mishra, S., Labudda, K., Hunter, B., and Stork, P. J. 2006,

Mol. Cell. Biol., 26, 2130. 129. de Rooij, J., Zwartkruis, F.J., Verheijen, M.H., Cool, R.H., Nijman, S.M., Wittinghofer, A.,

and Bos, J.L. 1998, Nature, 396, 474. 130. Quilliam, L. A., Rebhun, J. F., and Castro, A. F. 2002; Prog. Nucleic Acid Res. Mol. Biol., 71, 391. 131. Bos, J.L. 2006, Trends Biochem. Sci., 31, 680. 132. Schmitt, J. M., and Stork, P. J. 2000, J. Biol. Chem., 275, 25342.

82 F.O. Ranelletti and G. Monego

133. Obara, Y., Labudda, K., Dillon, T. J., and Stork, P. J. 2004, J. Cell Sci., 117, 6085. 134. Norum, J. H., Methi, T., Mattingly, R. R., and Levy, FO. 2005, FEBS J., 272, 2304. 135. Norum, J. H., Dawood, H., Mattingly, R. R, Sandnes, D., and Levy, F. O. 2007, FEBS Lett.,

581, 15. 136. Amsen, E.M., Pham, N., Pak, Y., and Rotin, D. 2006, J. Biol. Chem., 281, 121. 137. Sidovar, M.F., Kozlowski, P., Lee, J. W., Collins, M. A., He, Y., and Graves, L. M. 2000, J.

Biol. Chem., 275, 28688. 138. Dhillon, A.S., Pollock, C., Steen, H., Shaw, P.E., Mischak, H., and Kolch, W. 2002, Mol.

Cell. Biol., 22, 3237. 139. Dumaz, N., Light, Y., and Marais, R. 2002, Mol. Cell. Biol., 22, 3717. 140. Dumaz, N., Marais, R. 2003, J. Biol. Chem., 278, 29819. 141. Tazawa, H., Takahashia, S., and Zilliacus, J. 2003; Biochim. Biophys. Acta, 1620, 32. 142. Schmitt, J. M., and Stork, P. J. 2001, Mol. Cell Biol., 21, 3671. 143. Schmitt, J. M., and Stork, P. J. 2002, Mol. Cell, 9, 85. 144. Bos, J.L. 1998, EMBO J., 17, 6776. 145. Ahn, Y.H., Jung, J.M., and Hong, S.H. 2005, Cancer Res., 65, 4896. 146. Ahn, Y.H., Han, J.H., and Hong, S.H. 2006, J Cell. Physiol., 209, 1039. 147. Simon, M. I., Strathmann, M. P., and Gautam, N. 1991, Science, 252, 802. 148. Hubbard, K. B., and Hepler, J. R. 2006, Cell. Signal., 18, 135. 149. Johnson, G. L., and Dhanasekaran, N. 1989, Endocr. Rev., 10, 317. 150. Camps, M., Carozzi, A., Schnabel, P., Scheer, A., Parker, P.J., and Gierschik, P. 1992,

Nature, 360, 684. 151. Katz, A., Wu, D., and Simon, M. I. 1992, Nature, 360, 686. 152. Kolch, W., Heidecker, G., Kochs, G., Hummel, R., Vahidi, H., Mischak, H. Finkenzeller, G.,

Marmé, D., and Rapp, U. R. 1993, Nature, 364, 249. 153. Ueda, Y., Hirai, S., Osada, S., Suzuki, A., Mizuno, K., and Ohno, S. 1996, J. Biol. Chem.,

271, 23512. 154. Schonwasser, D. C., Marais, R. M., Marshall, C. J., and Parker, P. J. 1998, Mol. Cell Biol.,

18, 790. 155. Lev, S., Moreno, H., Martinez, R., Canoll, P., Peles, E., Musacchio, J. M., Plowman, G. D.,

Rudy, B., and Schlessinger J. 1995, Nature, 376, 737. 156. Dikic, I., Tokiwa, G., Lev, S., Courtneidge, S.A., and Schlessinger J. 1996, Nature, 383, 547. 157. Della Rocca, G.J., van Biesen, T., Daaka, Y., Luttrell, D.K., Luttrell, L.M., and Lefkowitz,

R.J. 1997, J. Biol. Chem., 272, 19125. 158. Hawes, B. E., van Biesen, T., Koch, W. J., Luttrell, L. M., and Lefkowitz R. J. 1995, J. Biol.

Chem., 270, 17148. 159. Guo, F. F., Kumahara, E., and Saffen, D. 2001, J. Biol. Chem., 276, 25568. 160. Blaukat. A,, Barac, A., Cross, M.J., Offermanns, S., and Dikic, I. 2000, Mol. Cell. Biol., 20, 6837. 161. Vucenik, I., Ramakrishna, G., Tantivejkul, K., Anderson, L., and Mand Ramljak, D. 2005,

Breast Cancer Res. Treat., 91, 35. 162. Corbit, K. C., Trakul, N., Eves, E. M., Diaz, B., Marshall, M., and Rosner, M. R. 2003, J.

Biol. Chem., 278, 13061. 163. Maioli, E., Torricelli, C., and Fortino, V. 2006, Cell. Mol. Life Sci., 63, 637. 164. Yamada, T., Tsuda, M., Ohba, Y., Kawaguchi, H., Totsuka, Y., and Shindoh, M. 2008,

Biochem. Biophys. Res. Commun., 368, 575. 165. Sato, K., Yamakawa, Y., Shizume, K., Satoh, T., Nohtomi, K., Demura, H., Akatsu, T.,

Nagata, N., Kasahara, T., and Ohkawa, H. 1993, J. Bone Miner. Res., 8, 849. 166. Talon, I., Lindner, V., Sourbier, C., Schordan, E., Rothhut, S., Barthelmebs, M., Lang, H.,

Helwig J.J., and Massfelder, T. 2006, Carcinogenesis, 27, 73. 167. Gessi, M., Monego, M., Calviello, G., Lanza, P., Giangaspero, F., Silvestrini, A., Lauriola,

L., and Ranelletti, F. O. 2007, Acta Neuropathol., 114, 135. 168. Kronenberg, H. M. 2003, Nature, 423, 332. 169. MacLean, H.E., Guo, J., Knight, M.C., Zhang, P., Cobrinik, D., and Kronenberg, HM. 2004,

J. Clin. Invest., 113, 1343.

834 PTHrP Signaling in Cancer

170. Lai, L. P., and Mitchell, J. 2005, J. Cell. Biochem. 96: 1173. 171. Vortkamp, A., Lee, K., Lanske, B., Segre, G. V., Kronenberg, H. M., and Tabin, C. J. 1996,

Science, 273, 613. 172. Sterling, J. A., Oyajobi, B. O., Grubbs, B., Padalecki, S. S., Munoz, S. A., Gupta, A., Story,

B., Zhao, M., and Mundy, G. R. 2006, Cancer Res., 66, 7548. 173. Pratap, J., Wixted, J. J., Gaur, T., Zaidi, S. K., Dobson, J., Gokul, K.D., Hussain, S., van

Wijnen, A. J., Stein, J. L., Stein, G. S., and Lian, J. B. 2008, Cancer Res., 68, 7795. 174. Alman, B. A., and Wunder, J. S. 2008, Ann. N.Y. Acad. Sci., 1144, 36. 175. Ogden, S.K., Casso, D. J., Ascano, M. Jr., Yore, M. M., Kornberg, T. B., Robbins, D. J.

2006, J. Biol. Chem., 281, 7237. 176. Hastings, R.H., Summers-Torres, D., Cheung, T.C., Ditmer, L.S., Burton, D.W., Petrin,

E.M., Spragg, R.G., Li, J. and Deftos, L.J. 1996, Am. J. Physiol. Cell. Physiol. 270, L353. 177. Hastings, R.H., Araiza, F., Burton, D.W., Bedley, M. and Deftos, L.J. 2004, Am. J. Physiol.

Cell. Physiol., 287, 1616. 178. Hastings, R.H., Araiza, F., Burton, D.W., Zhang, L., Bedley, M. and Deftos, L.J. 2003, Am.

J. Physiol. Cell. Physiol., 285, C1429. 179. Gagiannis, S., Müller, M., Uhlemann, S., Koch, A., Melino, G., Krammer, P.H., Nawroth,

P.P., Brune, M. and Schilling, T. 2009, Int. J. Cancer. 180. Hemann, M.T., Zilfou, J.T., Zhao, Z., Burgess, D.J., Hannon, G.J. and Lowe, S.W. 2004,

Proc. Nat. Acad. Sci. U.S.A., 101, 9333. 181. Ivaska, J., and Heino, J. 2000, Cell. Mol. Life Sci., 57,16. 182. Lang, S.H., Clarke, N.W., George, N.J., Testa, N.G. 1997, Clin. Exp. Metastasis, 15: 218. 183. Juliano, R.L., and Varner, J.A. 1993, Curr. Opin Cell. Biol., 5, 812. 184. Sato, M., Narita, T., Kawakami-Kimura, N., Higashiyama, S., Taniguchi, N., Akiyama, S.,

Hashimoto, T., Manabe, T., Kannagi, R. 1996, Cancer Lett., 102, 183. 185. Fishman, D.A., Kearns, A., Chilukuri, K., Bafetti, L.M., O’Toole, E.A., Georgapoulos, J.

et al. 1998, Invasion Metastasis. 1998, 18: 15. 186. Lundstrom, A., Holmbom, J., Lindqvist, C., and Nordstrom, T. 1998, Biochem. Biophys.

Res. Commun., 250: 735. 187. Shen, X., Rychahou, P.G., Evers, B.M., and Falzon, M. 2007, Cancer Letters, 258, 241. 188. Ruoslahti, E. 1991, J Clin Invest., 87, 1. 189. Ruoslahti, E., Noble, N.A., Kagami, S. and Border, W.A. 1994, Kidney Int., 45 (Suppl.44), S17. 190. Shen, X., and Falzon, M. 2003, Regul. Peptides, 113, 17. 191. Shen, X., Qian, L., and Falzon, M. 2004, Exp. Cell Res., 294, 420. 192. Shen, X., and Falzon, M. 2006, Exp. Cell., Nov 15, 312 (19), 3822. 193. Anderson, J.A., Grabowska, A.M. and Watson, S.A. 2007, Br. J. Cancer, 96, 1394. 194. Mercurio, A.M. 1995, Trends Cell. Biol., 5, 419. 195. Shen, X. and Falzon, M. 2005, Regul. Pept., 125, 17. 196. Ye, Y., Seitz, P.K. and Cooper, C.W. 2001, Regul. Pept., 101, 19. 197. Hemler, M.E., Crouse, C., Sonnenberg, A. 1989, J. Biol. Chem., 264, 6529. 198. Dedhar, S., and Saulnier, R. 1990, J. Cell. Biol. 1990, 110, 481. 199. Ramos, D.M., Cheng, Y.F., and Kramer, R.H. 1991, Invasion Metastasis, 11, 125. 200. Rabinovitz, I., Nagle, R.B. and Cress, A.E. 1995, Clin. Exp. Metastasis,13, 481. 201. Shaw, L.M., Chao, C., Wewer, U.M., and Mercurio, A.M. 1996, Cancer Res., 56, 959. 202. Mercurio, A.M., and Rabinovitz, I. 2001, Semin. Cancer Biol., 11, 129. 203. Chao, C., Lotz, M.M., Clarke, A.C., Mercurio, A.M. 1996, Cancer Res., 56, 4811. 204. Shaw, L.M., Rabinovitz, I., Wang, H.H., Toker, A., and Mercurio, A.M. 1997, Cell, 91: 949. 205. Rabinovitz, I., and Mercurio, A.M. 1997, J. Cell. Biol., 139, 1873. 206. O’Connor, K.L., Shaw, L.M., and Mercurio, A.M. 1998, J. Cell. Biol. 1997, 139, 1749. 207. Rabinovitz, I., Toker, A., and Mercurio, A.M. 1999, J. Cell. Biol., 146, 1147. 208. Rabinovitz, I., Gibson, I.K., and Mercurio, A.M. 2001, Mol. Cell. Biol., 12, 4030. 209. Chung, J., Bachelder, R.E., Lipscomb, E.A., Shaw, L.M., and Mercurio, A.M. 2002, j. Cell.

Biol., 158, 165.

84 F.O. Ranelletti and G. Monego

210. Lipscomb, E.A. and Mercurio, A.M. 2005, Cancer Metastasis Rev., 24, 413. 211. King, T.E., Pawar, S.C., Majuta, L., Sroka, I.C., Wynn, D., Demetriou, M.C., Nagle, R.B.,

Porreca, F., and Cress, A.E. 2008, Plos One, 3, e3535. 212. Vinturi, C.L., Alvarez-Silva, M., Trentin, A.G. and Borelli, P. 2000, Braz. J. Med. Biol. Res.,

33, 889. 213. Fruman, D.A., Meyers, R.E. and Cantley, L.C. 1998, Annu. Rev. Biochem., 67, 481. 214. Vanhaesebroeck, B. and Waterfi eld, M.D. 1999, Exp Cell Res., 253, 239. 215. Semba, S, Itoh, M., Itoh, E.M., Youssef, M., Harado, W., Kimura, M. and Yamakawa, M.

2002, Cancer Res., 8, 3824. 216. Shao, J., Evers, B.M. and Sheng, H. 2004, Cancer Res., 64, 229. 217. Rychahou, P.G., Murillo, C.A. and Evers, B.M. 2005, Surgery, 138, 391. 218. Ikenoue, T., Kanai, Y., Hibika, Y., Kunai, F., Obata, T., Tanaka, Y., Imamura, J., Ohta, M.,

Jazag, A., Guleng, B., Tateishi, K., Asaoka, Y., Matsumara, M., Kawabe, T. and Omata, M. 2005, Cancer Res., 65, 4562.

219. Rychahou, P.G., Jackson, L.N., Silva, S.R., Rajaraman, B.M. and Evers, B.M. 2006, Ann. Surg., 243, 833.

220. Fresno Vara, J.A., Casado, E., de Castro, E.J., Cejas, P., Belda-Iniesta, C., and Gonzalez-Barón, M. 2002, Cancer Treat. Res., 30, 193.

221. Roy, H.K., Olusola, B.F., Clemens, D.L., Karolski, W.J., Ratashak, A., Lynch, H.T., and Smyrk, T.C. 2002, Carcinogenesis, 23, 201.

222. Khaleghpour, K., Li, Y., Banville, D., Yu, Z., and Shen, S.H. 2004, Carcinogenesis, 25, 241. 223. Itoh, N., Semba, S., Ito, M., Takeda, H., Kawata, S. and Yamakawa, M. 2002, Cancer, 94, 3127. 224. Shen, X., Mula, R.V.R., Evers, B.M. and Falzon, M. 2007, Reg. Peptides, 141, 61. 225. Cross, D.A., Alessi, D.R., Cohen, P., Andjelkovich, M. and Hemmings, B.A. 1995, Nature,

378, 785. 226. Sable, C.L., Filippa, N., Hemmings, B. and Van Obberghen, E. 1997, FEBS Lett., 409, 253. 227. Maniero, F., Pepe, A., Wary, K.K., Spinardi, L., Mohammadi, M., Schlessinger, J. and

Giancotti, F.G. 1995, EMBO J., 14, 4470. 228. Maniero, F., Murgia, C., Wary, K.K., Curatola, A.M., Pepe, A., Blumemberg, M., Westwick,

J.K., Der, C.J. and Giancotti, F.G. 1997, EMBO J., 16, 2365. 229. Falcioni, R., Antonini, A., Nistico, P., DiStefano, S., Crescenzi, M., Natali, P.G. and Sacchi,

A. 1997, Exp. Cell. Res., 236, 76. 230. Trusolino, L., Bertotti, A. and Comoglio, P.M. 2001, Cell, 107, 643. 231. Hu, Y.P., Venkateswarlu, S., Sergina, N., Howell, G., St Clair, P., Humphrey, L.E., Li, W.,

Hauser, J., Zborowska, E., Willson, J.K.V. and Brattain, G. 2005, J. Biol. Chem., 280, 27383. 232. Zhou, Y. and Brattain, M.G. 2005, Cancer Res., 65, 5848. 233. Guo, W., Pylayeva, Y., Pepe, A., Yoshioka, T., Muller, W.J., Inghirami, G. and Giancotti,

F.G. 2006, Cell, 126, 489. 234. Rabinovitz, I., and Mercurio, A.M. 1996, Biochem. Cell. Biol., 74, 811. 235. Shen, X., Mula, R.V.R., Li, J., Weigel, N.L. and Falzon, M. 2007, Steroids, 72, 14, 930. 236. Bhatia, V., Mula, R.V., Weigel, N.L. and Falzon, M. 2009, Mol. Cancer Res., 7, 1119. 237. Lee, J.W., and Juliano, R.L. 2000, Mol. Cell. Biol., 11, 1973. 238. Mundy, G.R. 2002, Nat. Rev. Cancer, 2, 584. 239. Coleman, R.E., and Rubens, R.D. 1987, Br. J. Cancer, 55, 61. 240. Roodman, G.D. 2004, Mechanisms of bone metastases, N. Engl. J. Med., 350: 1655. 241. Kahn, D., Weiner, G.J., Ben-Haim, S., Ponto, L.L., Madsen, M.T., Bushnell, D.L., Watkins,

G.L., Argenyi, E.A., and Hichwa, R.D. 1994, Blood, 84: 3602. 242. Van der Pluijm, G., Sijmons, B., Vloedgraven, H., Deckers, M., Papapoulos, S. and Lowik,

C. 2001, J. Bone Miner. Res. 16, 1077. 243. Hauschka, P.V., Mavrakos, A.E., Iafrati, M.D., Doleman, S.E., and Klagsbrun, M. 1986, J.

Biol. Chem., 261, 12665. 244. Pfeilschifter, J., and Mundy, G.R. 1987, Proc. Nat. Acad. Sci. U.S.A., 84, 2024. 245. Paget, S. 1889, Lancet, 1, 571.

854 PTHrP Signaling in Cancer

246. Taube, T., Beneton, M.N., McCloskey, E.V., Rogers, S., Greaves, M., and Kanis, J.A. 1992, Eur. J. Haematol., 49, 192.

247. Charhon, S.A., Chapuy, M.C., Delvin, E.E., Valentin-Opran, A., Edouard, C.M., and Meunier, P.J. 1983, Cancer, 51, 918.

248. Coleman, R.E., and Seaman, J.J. 2001, Semin. Oncol., 28, Suppl 6, 11. 249. Schneider, A., Kalikin, L.M., Mattos, A.C., Keller, E.T., Allen, M.J., and Pienta, K.J. 2005,

Endocrinology, 146, 1727. 250. Boyde, A., Maconnachie, E., Reid, S.A., Delling, G., and Mundy, G.R. 1986, Scan. Electron.

Microsc., 4, 1537. 251. Taube, T., Elomaa, I., Blomqvist, C., Beneton, M.N.C., and Kanis, J.A. 1994, Bone, 90, 161. 252. Roodman, G.D. 2001, J. Clin. Oncol., 19, 3562. 253. Croucher, P,I,, Shipman, C.M., Lippitt, J., Perry, M., Asosingh, K., Hijzen, A., Brabbs, A.C.,

van Beek, E.J., Holen, I., Skerry, T.M., Dunstan, C.R., Russell, G.R., Van Camp, B., and Vanderkerken, K. 2001, Blood, 98, 3534.

254. Oyajobi, B.O., and Mundy, G.R. 2003, Cancer, 97, Suppl. 813. 255. Powles, T., Paterson, S., Kanis, J.A., McCloskey, E., Ashley, S., Tidy, A., Rosenqvist, K.,

Smith, I., Ottestad, L., Legault, S., Pajunen, M., Nevantaus, A., Männistö, E., Suovuori, A., Atula, S., Nevalainen, J., and Pylkkänen, L. 2002, J. Clin. Oncol., 20, 3219.

256. Powell, G.J., Southby, J., and Danks, J.A. 1991, Cancer Res., 51, 3059. 257. Logothetis, C.J., and Lin, S.H. 2005, Nat. Rev. Cancer, 5, 21. 258. Alao, J.P. 2007, Mol. Cancer, 6, 24. 259. Beier, F., Ali, Z., and Mok, D. 2001, Mol. Biol. Cell, 12, 3852. 260. Datta, N.S., Pettway, G.J., Chen, C., Koh, A.J., and McCauley, L.K. 2007, J. Bone Miner.

Res., 22, 951. 261. Guo, J., Chung, U.I., Yang, D., Karsenty, G., Bringhurst, F.R., and Kronemberg, H.M. 2006,

Dev. Biol., 292, 116. 262. Koh, A.J., Beecher, C.A., Rosol, T.J., and McCauley, L.K. 1999, Endocrinology, 140, 3154. 263. Gopalakrishnan, R., Ouyang, H., Somerman, M.J., McCauley, L.K., and Franceschi, R.T.

2001, Endocrinology, 142, 4379. 264. Datta, N.S., Chen, C., Berry, J.E., and McCauley, L.K. 2005, J. Bone Miner. Res., 20, 1051. 265. Fenton, A.J., Kemp, B.E., Kent, G.N., Moseley, J.M., Zheng, M.H., Rowe, D.J., Britto, J.M.,

Martin, T.J., and Nicholson, G.C. 1991, Endocrinology, 129, 1762. 266. Yi, B., Williams, P.J., Niewolna, M., Wang, Y., and Yoneda, T. 2002, Cancer Res., 62, 917. 267. Guise, T.A., Yin, J.J., and Mohammad, K.S. 2003, Cancer, 97, Suppl. 779. 268. Achbarou, A., Kaiser, S., Tremplay, G., Ste-Marie, L.G., Brodt, P., Goltzman, D., and

Rabbani, S.A. 1994, Cancer Res., 54, 2372. 269. Weir, E.C., Philbrick, W.M., Amling, M., Neff, L.A., Baron, R., and Broadus, A.E. 1996,

Proc. Nat. Acad. Sci. U.S.A., 93, 10240. 270. Li, X., and Qin, L. and Partridge, N.C. A.S.B.M.R. 27th Annual Meeting. 271. Berry, J.E., Datta, N., Pettway, G.J., and McCauley, L. 2006, J. Dent. Res. 2006. Int. Ass.

Dent. Res. Presented in Brisbane, Australia.

87M. Chatterjee and K. Kashfi (eds.), Cell Signaling & Molecular Targets in Cancer, DOI 10.1007/978-1-4614-0730-0_5, © Springer Science+Business Media, LLC 2012

Epidemiology and Aetiology

Multiple myeloma (MM) comprises approximately 10% of all haematological malignancies with an annual incidence of four to fi ve cases per 10 5 . Over the last years, the apparent rise in incidence is best attributable to a refi nement of the diagnostic techniques rather than to a de facto increase of the MM cases. After non-Hodgkin’s lymphomas, MM represents the second most common haematological malignancy. MM is a disease that affects the elderly, as the median age of patients is ranging from 65 to 70 years. There is a slight male predominance, and black people are more prone to the disease, while Asian population is less affected.

The etiologic factors driving MM onset are largely unknown. Genotoxic agents have been involved in a fraction of cases, like radiation exposure and environmental toxics (herbicides and insecticides, organic solvents). Familiarity has been described in clusters of families. Chronic infl ammation has also been invoked as a causative condition, and experimental evidence has supported this hypothesis, even though no specifi c infectious or other types of agents have been identifi ed.

Pathobiology of MM

MM pathogenesis is a multistep process [ 1 ] . MM plasma cells (MM PCs) are char-acterised by a low proliferation index and a strict dependence on the bone marrow microenvironment for their survival and growth; they are post-germinal centre

G. Semenzato (*) Department of Clinical and Experimental Medicine, Haematology-Immunology Section and Venetian Institute of Molecular Medicine, Haematological Malignancies Unit , Padua University School of Medicine, Padua , 35128 Padova , Italy e-mail: g.semenzato@unipd.it

Chapter 5 Signalling Molecules as Selective Targets for Therapeutic Strategies in Multiple Myeloma

Francesco Piazza and Gianpietro Semenzato

88 F. Piazza and G. Semenzato

lymphocytes, harbouring class-switched IgH genes and extensive hypermutations of their Ig genes [ 2 ] . Phenotypically, MM PCs are distinguished from normal plasma cells for the loss of expression of CD19 and the gain of expression of CD56. Cytogenetically, almost all MGUS and MM tumours are characterised by primary and secondary chromosomal translocations and aberrations [ 3 ] . The for-mer occur very likely in the early steps of the disease, affect the immunoglobulin (IgH) locus at 14q and are believed to be caused by errors during the heavy-chain switch recombination or, more rarely, during the somatic hypermutation in the ger-minal centre reaction; primary chromosomal translocations are present in: 40–50% of MGUS and smouldering MM (SMM), 50–80% of intramedullary MM, 85% of primary plasma cell leukaemia (PCL) and more than 90% of MM cell lines [ 1, 4 ] . The IgH gene locus has been described to fuse with at least fi ve different partners, in 40% of MGUS and MM: (1) MMSET and FGFR3 at 4p16 , (2) CyclinD3 at 6p21 , (3) Cyclin D1 at 11q13 , (4) c-MAF at 16q23 , (5) MAFB at 20q11 .

Late stage-associated secondary translocations affecting the IgH locus involve infrequent but recurrent partner loci. The cMYC gene, located at 8q24, can be a fusion partner of the Ig enhancer, but it can also be involved in other complex trans-locations (with an overall prevalence of 15%) [ 5 ] .

Other types of aberrations in the number and structure of chromosomes have been widely documented in MM tumours, some of which bear prognostic signifi cance, such as loss of chromosome 13/13q/13q14 sequences (in 50–60% of MM and 45% of MGUS) that have been associated with a poor outcome [ 6 ] or other prognostically negative cytogenetic alterations, such as gains at 1q21 [ 7, 8 ] and hypodiploidy/pseudo-diploidy or subtetraploidy [ 9, 10 ] .

Recent gene expression profi le studies have also provided insights into the patho-genesis and prognosis of plasma cell dyscrasias [ 11 ] . For instance, the expression levels of cyclin D1, D2, D3 and the presence of non-random chromosomal translo-cations in MM can identify distinct prognostic classes [ 12– 15 ] .

Further molecular alterations observed in MM affect H-Ras p21, which is increased in approximately 70% of MM cases, and specifi c mutations have been shown to portend a poor prognosis: the tumour suppressor TP53, which displays point mutations in a variable percent of cases, and the tumour suppressor Rb-1, which is deleted in approximately 50% of cases.

The tumoural niche of MM in its intra-medullary phase is represented by the bone marrow (BM). Physiologically, the terminally differentiated PCs that have completed the maturation process reside in the BM where they receive survival inputs and are committed to expand if the immunological context requires doing so. This same environment is modifi ed by the malignant transformation of the PCs and gains specifi c and critical features. MM cell survives, adheres to stromal cellular and extracellular components, gains the ability to stimulate neo-angiogenesis, as well as interferes with osteoblast and osteoclast development and function in the BM milieu. Here, several signalling pathways play critical roles in these processes, and the dissection of the mechanisms that control them have provided the frame-work for the development of novel therapeutic approaches to MM [ 16 ] .

895 Signalling Molecules as Selective Targets for Therapeutic Strategies…

The acquisition of escaping drug-induced apoptosis is acquired by MM cell contact with fi bronectin in the extracellular matrix. This phenotype is called also cell adhesion-mediated drug resistance (CAM-DR) [ 17 ] . Furthermore, autocrine and paracrine loops that lead to the production of cytokines, such as IL-6, TNF a , IL-1 b , IGF-I, TGF b and VEGF, are instrumental for regulating MM growth in the BM [ 18 ] . Myeloma bone disease is also a pathological consequence of the interaction of MM cells with the BM mesenchymal components: an imbalance between the generation of osteoblasts and new bone synthesis and the activation of bone-resorb-ing cells, the osteoclasts, is linked with alterations of cell-adherent and soluble mediators, such as the RANKL–RANK receptors, osteoprotegerin [ 19, 20 ] , MIP1 a and MIP1 b [ 21 ] , SDF1 [ 22 ] and, as recently shown, Wnt-signalling inhibitors DKK1 [ 23 ] and sFRP2 [ 24 ] .

The crucial importance of the MM tumoural environment has pushed the research efforts to identify novel anti-myeloma therapies towards “microenvironment”-targeting approaches associated with strategies that hit aberrant signalling pathways intrinsic of the malignant PCs. This concept now represents a crucial starting point for the development of novel biologically based therapies for this disease (Figs. 5.1 and 5.2 ).

Targeting Growth- and Survival-Promoting Signalling Cascades in MM PCs

MM cells are infl uenced for their growth by intrinsic, genetically determined alterations as well as by external, paracrine or autocrine stimuli. Many signalling pathways have been described to be constitutively active as a consequence of mutations affecting growth-controlling genes. The triggering of growth-promoting signalling cascades often results from the deregulation of the function of pivotal molecules. For instance, cyclin Ds-mediated signalling is altered as a consequence of translocations; similarly, Ras, p53, c-myc, NF- k B are targeted by somatic mutations that cause an aberrant function conditioning MM cell growth.

The IL-6 Signalling System

Interleukin-6 (IL-6) represents one of the most important growth factor for MM plasma cells. IL-6 engagement of its receptor leads to the activation of three signalling pathways that have a relevant importance in MM plasma cell biology. IL-6 receptor forms a hexameric membrane complex (formed by IL-6, IL-6Ralpha and gp130 subunits), and upon its autophosphorylation, the JAK family of cytoplasmic tyrosine kinases are recruited to the complex, forming a scaffolding platform able to gather the STAT family of transcription factors. JAKs phosphorylate STAT on tyrosine resi-dues (Tyr 705 on STAT3). This phosphorylation causes intramolecular modifi cations

90 F. Piazza and G. Semenzato

that lead STAT3 translocation into the nucleus and activation of STAT3 target genes. IL-6 engagement of its receptor also activates the MAPK pathway through upstream of Ras mediators Grb2 and SOS1 and downstream molecules RAF1 and MAPKKs. Finally, the IL-6R-induced signalling activates also another crucial survival path-way in MM cells, the PI3K/PKB cascade.

IL-6 can be secreted by MM PCs spontaneously, or upon engagement of CD40 thus acting as an autocrine factor [ 25 ] . It can also be secreted under the stimulation of other cytokines present in the bone marrow microenvironment (i.e. TNF a , VEGF and IL-1); however, the major source of IL-6 paracrine secretion in the MM microenvironment are the bone marrow stromal cells (BMSCs). BMSC secrete IL-6 when in contact with

angiogenesis

dendritic cells

collagen fibersextracellular matrixfibronectin/integrins

VEGF TNFa

monocytes

TGFb

growth factorsIGF-IHGFCSF

stromal cells

immunomodulationlymphocytes,NK cells

VCAM

VLA4

VEGF-R

chemotactic factorsIGF-ISDF1chemokines

adhesion

Chemokine receptorsGrowth factor receptorsassociated with tyrosinekinase activity

myeloma plasmacells

myeloma plasmacells

myeloma plasmacells

VEGF-R

endothelial cells

TGFbR

Immune cells

Fig . 5.1 The bone marrow microenvironment in multiple myeloma pathogenesis. Schematic rep-resentation of the bone marrow milieu components playing a role in MM pathogenesis. The bone marrow microenvironment is composed of the extracellular matrix (ECM) and of the bone marrow stromal cells (fi broblasts, adipocytes, dendritic cells). Myeloma plasmacells contact the ECM (fi bronectin) through surface integrins, interact with stromal cells through adhesion molecules (i.e. VCAM, ICAM, VLA-4), and express chemokine receptors and tyrosine kinase receptors for chemotactic agents and growth factors. Stromal cells may secrete growth factors (i.e. IGF-I, IL-6, HGF, CSF), chemotactic agents (i.e. IGF-I, SDF-I, chemokines), molecules that stimulate angio-genesis (VEGF) and molecules that modulate the immune response (i.e. TNFα, TGFβ). VCAM vascular cell adhesion molecule; ICAM intercellular adhesion molecule; VLA-4 very late antigen-4; IGF-I insulin-like growth factor-I; IL-6 interleukin-6; HGF hepatocyte growth factor; CSF colony stimulating factor; SDF-1 stromal cell derived factor-1; VEGF vascular endothelial cell growth factor; VEGF-R vascular endothelial cell growth factor-receptor; TNFα tumor necrosis factor α; TGFβ transforming growth factor β

915 Signalling Molecules as Selective Targets for Therapeutic Strategies…

Fig. 5.2 Signalling cascades involved in myeloma plasma cell biology. Schematic representation of some signalling pathways whose role in MM plasma cell biology has been established and of the levels of their possible molecular targeting with innovative therapeutic approaches (in particu-lar, inhibitors of tyrosine kinase receptors, MAPK inhibitors, NF- k B inhibitors and proteasome inhibitors). The different cytokines and growth factors are produced either in a paracrine or in a autocrine manner. IL-6 signals to the nucleus upon engagement of its membrane-associated receptor and the activation of downstream tyrosine kinases (Tyk2 and Jak) and transcription factors STAT3; IGF-I, by means of its cognate receptor, triggers the activation of the PI3K/AKT as well as the MAPK signalling modules, which lead to the transmission of transcriptional inputs through ERK and FKHR regulated gene expression; similarly, TGF b -TGFbR interaction activates the SMAD transcription factors through phosphorylation and subsequent nuclear translocation; the cytokine TNFa stimulates the activation of the NF- k B pathway and nuclear shuttling by activation both the TRAF/RIP and the MEKK signalling modules. Note that more than one pathway can be activated by the same stimulus and different stimuli can trigger the same pathway. For instance, IL-6 acti-vates the JAK/STAT and the PI3K/AKT module, TGF b is able to stimulate the SMAD as well as the MAPK signalling routes; similarly, the NF- k B pathway may be the point of convergence of several distinct stimuli. IGF-I insulin-like growth factor-I; IGF-IR insulin-like growth factor-I receptor; IL-6 interleukin-6; IL-6R interleukin-6 receptor; TNFα tumour necrosis factor α; TNFαR tumour necrosis factor α receptor; TGF b transforming growth factor b ; TGF b R transforming growth factor b receptor; Tyk2 tyrosine kinase 2; JAK Janus protein kinase; STAT3 signal trans-ducer and activator of transcription 3; MEKK MAP-ERK kinase protein kinase; MAPK mitogen activated protein kinase; MEK MAP-ERK protein kinase; ERK extracellular signal-regulated pro-tein kinase; PI3K phospoinositide-3’ kinase; AKT/PKB AKR thymoma/protein kinase B; FKHR forkhead rhabdomyosarcoma; GSK3 glycogen synthase kinase 3; SMADs SMA and MAD related proteins; TRAF TNF receptor-associated factor; receptor-interacting kinase; IKK I k B kinase; I k B inhibitor of k B

92 F. Piazza and G. Semenzato

MM PCs [ 26 ] or when exposed to TNF a [ 27 ] , VEGF [ 28 ] or TGF b [ 29 ] . The major effects of IL-6 on MM plasma cells are the stimulation of proliferation [ 30 ] , survival [ 31 ] and resistance to drugs [ 32 ] . Interestingly, the levels of IL-6 and its receptor in the serum of MM patients, which are paralleled by the serum levels of C-reactive protein, are prognostic markers, and this might be particularly relevant in light of recent work that has shown that in most MM cases, STAT3 is constitutively active [ 33 ] .

Molecular strategies targeting IL-6 signalling have been investigated. Antibodies against IL-6 have been developed and tested already in MM. Tocilizumab, a humanised anti-IL-6 receptor mAb, is currently being studied in MM. A recent study demonstrated in a murine MM model the effectiveness of tocilizumab in vitro and in vivo [ 34 ] . Another chimeric monoclonal anti-IL-6 antibody, CNTO 328, has shown anti-myeloma effi cacy in preclinical studies [ 35 ] . This molecule has under-gone phase I clinical trials whose results are still to be published. Moreover, Sant7, an IL-6 superagonist with high affi nity and blocking activity for IL-6R is another anti-IL-6 strategy under investigation in MM, both in preclinical setting [ 36 ] .

IGF-I Signalling

Insulin-like growth factor-I is a molecule whose role in cancer cell biology has become increasingly clear over the last years. IGF-I signals through the binding to its receptor-activating signalling pathways that promote cell proliferation and survival, adhesion and migration. IGF-I mostly activates the Ras/Raf/MEK/ERK and the PI3K/PKB pathways. IGF-I also activates the NF-kappaB signalling pathway, result-ing in up-regulation of anti-apoptotic signalling molecules. Therefore, targeting the IGF-I-dependent signalling pathways represents a rational anti-cancer therapeutic approach but is troublesome because of achieving selectivity. NVP-ADW742 is a selective IGF-IR tyrosine kinase inhibitor that has shown signifi cant anti-myeloma activity in vitro in MM cell lines and in mouse tumour xenograft models [ 37, 38 ] . The human monoclonal antibody IMC-A12 directed against IGF-IR blocks IGF-IR-mediated signalling and showed a remarkable anti-cancer activity. IMC-A12 is being tested in phase I clinical trials in multiple myeloma patients [ 39 ] . Very recently, other IGF-IR inhibitors (picropodophyllin or PPP) have been tested in a murine MM model [ 38 ] . These compounds were able to lead to cell cycle arrest of MM cells. In vivo treatment of MM-bearing mice led to a reduction of tumour burden, serum parapro-tein and bone marrow angiogenesis [ 40 ] . Altogether, these studies suggest that the IGF-I axis represents a potentially important therapeutic target for MM.

The NF- k B Pathway

NF- k B transcription factors are important survival molecules for cancer cells [ 41, 42 ] . The NF- k B pathway is a highly inducible signalling system that is kept in an “off” state by the binding of NF- k B members to the inhibitor I k B a . In the presence

935 Signalling Molecules as Selective Targets for Therapeutic Strategies…

of a stimulus (which can be manifold, like GFs, DNA damage, various cellular stress), the cascade is “switched on” by the phosphorylation, ubiquitination and pro-teasome-mediated degradation of I k B a . NF- k B transcription factors then migrate in the nucleus and activate the transcription of target genes. In a fraction of MM PCs from patients and MM cell lines, NF- k B is constitutively active due to extrinsic stim-ulation or gene mutations affecting members of its signalling pathway [ 33, 43, 44 ] . NF- k B has been shown to protect MM cells against dexamethasone-induced apopto-sis [ 45 ] . Moreover, NF- k B has been shown to be downstream of several signalling pathways that regulate MM cell growth and survival, such as the TNF a , IL-1 b , PI3K/AKT and Ras/MAPK cascades. The usefulness of targeting NF- k B in MM was established through the use of proteasome inhibitors [ 46 ] . However, since activation of NF- k B may occur through the activity of the I k B kinase IKK, specifi c inhibitors of this kinase have been evaluated as potential therapeutic drugs [ 47– 49 ] . Moreover, other work has recently shown that substances displaying an inhibitory effect on IKK, such as curcumin (diferuloylmethane), cause down-regulation of NF- k B activ-ity, MM plasma cell growth arrest and apoptosis [ 50 ] .

The PI3K/AKT Pathway

This signal transduction pathway is activated by several extracellular signals, includ-ing IL-6 and IGF-I, and it regulates many cellular processes such as proliferation, survival, cell adhesiveness, protein synthesis and others. Phosphatidylinositol 3,4,5-triphosphate (PIP3) is generated by PI3K at the plasma membrane and triggers the activation of several downstream protein kinases, of which AKT/protein kinase B (PKB) critically regulates cell survival, proliferation and oncogenesis. The activity of PI3K is modulated by PTEN, a dual specifi city phosphatase able to inactivate PIP3 by dephosphorylation and an essential tumour suppressor mutated or altered in a wide variety of cancers [ 51 ] . The PI3K/AKT signalling pathway is critical for MM cell survival [ 52 ] . Thus, it has attracted the attention of investigators as a therapeutic target in this disease. An inhibitor of AKT, perifosine, is a synthetic alkylophospholipid able to inhibit the phosphorylation occurring at the membrane and AKT activation dose dependently. Perifosine has shown effi cacy in inhibiting MM cell growth and also in collaborating with other agents, such as proteasome inhibitors in causing MM cell death [ 47, 53, 54 ] . These preclinical results prompted a phase I and II clinical trials in association with the novel agent lenalidomide in patients with relapsed/refractory MM and relapsed/resistant to bortezomib MM, demonstrating encouraging and remarkable clinical activity (ASH meeting, 2008).

Bcl-2 Protein Family

The Bcl-2 family of proteins is critical in the regulation of intrinsic apoptosis and cell death. It includes both proapoptotic and antiapoptotic members, subdivided

94 F. Piazza and G. Semenzato

into three main classes, based in part on sharing homology within the so-called Bcl-2 homology (BH) 1–4 domains. Bcl-2, Bcl-xL, Mcl-1, A1 and Bcl-w are the antiapoptotic members. The proapoptotic Bax and Bak have BH 1–3 domains; however, they need an activation event to bind Bcl-2 and Bcl-xL. The so-called BH3-only proapoptotic members, such as Bid, Bad, Bim, Noxa, Puma, are proximal sensors that transmit signals of death downstream diverse stimuli [ 55, 56 ] . In MM, Bcl-2 function is altered and contributes to malignant plasma cell resistance to apoptosis [ 57 ] . Bcl-2 can be targeted by anti-sense oligonucle-otides (oblimersen, G3139) and inhibitors of Bcl-2/Bcl-xL. Oblimersen under-went already phase II clinical trials in association with thalidomide and dexamethasone or phase III clinical trials with high-dose dexamethasone [ 58, 59 ] , encouraging further experimentation with other agents, such as IMiDs and bort-ezomib. Moreover, a small molecule inhibitor that binds strongly with Bcl-2 and Bcl-xL, ABT-737, is able to impend the sequestration of proapoptotic mole-cules, therefore shifting the balance towards cell apoptosis. Preclinical studies have proven that ABT-737 induces MM cell apoptosis and shows synergy with other anti-myeloma agents [ 60– 62 ] . A structurally similar molecule, ABT-263, displayed a better oral bioavailability profi le than that of ABT-737. This mole-cule has been investigated in xenograft mouse models of different human tumours. The treatment of xenotransplanted mice with the OPM-2 MM cell line with ABT-263 in association with bortezomib displayed a greater tumour-killing effi cacy than single treatments. One proposed mechanism of synergy is the simultaneous reduction of Mcl-1 (by bortezomib) and Bcl-2/Bcl-xL (by ABT-263) [ 62 ] .

Farnesyltransferase Inhibitors (FTIs)

The rationale of employing agents that inhibit farnesyltransferase (FTIs) in MM is based on the relatively high frequency of Ras GDP/GTP-binding GTPase muta-tions found in this cancer [ 63 ] . Moreover, growth factors such as IL-6 and IGF-I may also activate the Ras/Raf/MAPK pathway in MM cells [ 64 ] . The covalent addition of a 15–carbon isoprenoid chain (farnesyl group) to the Ras molecule allows Ras to be subsequently attached to the intracellular membranes. MM cells were found to be sensitive to treatment with FTIs R11577 (tipifarnib ® , Zarnestra), which caused cell growth arrest [ 65, 66 ] , perillic acid [ 67 ] and FTI-277, which was active also on chemoresistant cell lines [ 68 ] . In the clinical setting, R11577 was tested in a phase I trial in chronic myelogenous leukaemia, myelofi brosis and MM patients. The compound displayed clinical activity, and one MM patient had a reduction of the monoclonal protein of about 34% [ 69 ] . In a phase II trial, R11577 was administered to 43 advanced MM patients: 64% of patients had stable disease, which did not correlate with the in vivo inhibition of farnesylation. This study also demonstrated that tipifarnib may suppress oncogenic pathways (PI3K/AKT and STAT3) in vivo in MM cells [ 70 ] . Recent studies have demonstrated a synergistic

955 Signalling Molecules as Selective Targets for Therapeutic Strategies…

effect of tipifarnib and the proteasome inhibitor bortezomib in MM and acute myeloid leukaemia cells [ 71 ] and of another farnesyltransferase inhibitor, lona-farnib and bortezimib in inducing MM cell death [ 72 ] . Interestingly, a role for geranylgeranylated proteins in MM cell growth has been demonstrated in a recent study [ 73 ] , providing the rationale for associating FTIs with geranylgeranyltrans-ferase inhibitors [ 74 ] .

TRAIL

TRAIL/Apo2L (tumour necrosis factor-related apoptosis-inducing ligand/apoptosis ligand 2) is a member of the TNF superfamily that has the peculiar property of inducing apoptosis in cancer cells while sparing non-cancer cells. When TRAIL binds to its cognate receptors DR4 or DR5, it activates a death-inducing signal-ling complex (DISC) next to the intracellular domain of the receptor, which leads to the triggering of the extrinsic apoptotic pathway [ 75 ] . TRAIL was shown to induce apoptosis in MM cell lines and freshly isolated cells from patients [ 76 ] and to kill a panel of drug-sensitive and drug-resistant MM cell lines and to cause a considerable reduction of tumour burden in myeloma- bearing mice in a xenotransplant MM model [ 77 ] . More recent studies have investigated the mechanisms underlying TRAIL–induced apoptosis in MM and will help in designing better strategies to use this molecule in the therapy of this disease [ 78, 79 ] .

Targeting Protein Maturation, Degradation and Acetylation

Hsp90 Inhibitors

Molecular chaperones permit intracellular traffi cking, ternary and quaternary structure conformations and correct folding of cellular proteins. Heat shock pro-teins (HSPs) are molecular chaperones whose levels are increased under certain protein-denaturing stressors. This family of proteins has gained growing impor-tance in cancer pathogenesis as they can affect the levels and the activity of many oncoproteins [ 80 ] . One of the most abundant HSPs in the cell is Hsp90. A number of natural and synthetic compounds have been shown to inhibit Hsp90. Geldanamycin (GA) is one of such natural compounds that acts by inhibiting the ATPase activity of Hsp90, and it has been tested on MM cells. GA was shown to cause a decrease in IGF-I and IL-6 receptor expression on MM cells; it reduced the levels of AKT, Raf and IKK, of antiapoptotic proteins FLIP, XIAP, cIAP and inhibited the NF- k B pathway [ 81 ] . Another Hsp90 inhibitor, analogue of GA, 17-AAG (17-(demethoxy)-17-allylamino geldanamycin, tanespimycin or KOS-953)

96 F. Piazza and G. Semenzato

has recently been shown to exert an anti-myeloma activity on drug-resistant MM cells and to inhibit the growth of MM cells in an in vivo murine model [ 71 ] and is currently being tested in phase II/III clinical trials in relapsed MM in asso-ciation with bortezomib. Other newly developed HSP inhibitors are currently undergoing phase I clinical evaluation in MM. Retaspimycin (IPI-504) is a new HSP inhibitor derivative of geldanamycin and 17-AAG. It is highly soluble in water and well tolerated. Early phase I/II trials have demonstrated activity in NSCLC and gastrointestinal stromal tumour. Phase I/II trials are currently under-way to evaluate the dosing schedules and activity of IPI-504 in relapsed/refractory MM (information available on www.clinicaltrials.gov ).

Proteasome Inhibitors

The ubiquitin-proteasome degradation pathway may control the turnover of proteins involved in cancer pathogenesis [ 82 ] . Ubiquitin is a short chain of about 80 amino acids, which serves as a signal that instructs to target proteins to which it is covalently attached for proteolysis by the 26S proteasome, a macromolecular protease complex [ 83, 84 ] .

Bortezomib

Bortezomib (Velcade ® , Millennium, Cambridge, MA; formerly known as PS-341) is a boronic acid compound that binds to and inhibits the portion of the 26S protea-some that displays a chymotrypsin-like activity [ 85 ] . This compound was demonstrated to have in vitro and in vivo cytotoxic activity against several tumours, including MM [ 85– 88 ] , and one pilot clinical study in relapsed/refractory haematological malignancies showed a peculiar activity (in terms of response rates) in MM [ 89 ] . Three additional trials demonstrated the usefulness of bortezomib in MM. Two phase II studies (SUMMIT and CREST trials) showed signifi cant clinical activity in patients with relapsed/refractory MM [ 90, 91 ] . A subsequent phase III study (the APEX trial) compared bortezomib with high-dose dexamethasone in relapsed MM patients, showing an improved clinical outcome in the bortezomib-treated group as compared to the high-dose dexamethasone-treated group [ 92 ] .

Proteasome inhibitors may favour apoptosis in more than one way [ 85, 93– 95 ] . One of these is through inhibition of I k B a degradation and sequestration of inactive NF- k B transcription factors in the cytoplasm [ 46 ] . In addition to apop-tosis, proteasome inhibitors may target other signalling pathways [ 85, 93, 94 ] . Prolonged exposure to proteasome inhibitors may lead to the development of resistance, and several compounds have been used with bortezomib to overcome this drawback, such as the camptothecin analogue CPT-11 [ 96 ] , the antagonist of the mitochondrial peripheral benzodiazepine receptor PK11195 [ 97 ] , TRAIL [ 98– 100 ] and other compounds [ 101 ] . Intriguingly, novel PIs are currently under development [ 102, 103 ] .

975 Signalling Molecules as Selective Targets for Therapeutic Strategies…

NPI-0052

This molecule (salinosporamide A) represents a second generation proteasome inhibitor derived from marine bacteria Salinospora [ 104 ] . NPI-0052 displayed remarkable activity against MM cells in vitro, even when grown in the protective BM microenvironment. NPI-0052 inhibits all the three protease activity of the proteasome, and it induces apoptosis principally through the FADD/caspase-8 pathway. An important feature of this molecule is its oral bioavailability [ 102 ] . Phase I clinical trials are ongoing in relapsed/refractory MM.

Carfi lzomib (PR-171)

Carfi lzomib is another new irreversible proteasome inhibitor. It inhibits the chymotrypsin-like as well as the immunoproteasome activity. Carfi lzomib can induce apoptosis of bortezomib-resistant MM cells [ 105 ] . This drug is currently being evaluated in clinical trials in haematological malignancies including MM.

HDAC Inhibitors

This novel group of molecules has recently gained interest for its ability to inhibit a particular class of enzymes, i.e. HDACs (histone deacetylases), inducing apoptosis and differentiation in cancer cells. Histone acetylation and deacetylation is believed to be instrumental for the generation of a “histone code” responsible for the overall transcriptional outcome in a cell [ 106 ] . Among haematopoietic malignancies, mainly acute myeloid leukaemias and myelodysplastic syndromes have been asso-ciated with deregulation of these processes and have been tested for their sensitivity to the treatment with HDACi [ 107, 108 ] . The mechanisms through which HDACi cause their effects on cancer cells very likely rely on different methods of action besides those directly exerted on the HDAC [ 109 ] . Early reports showed that HDACi were able to increase the levels of cell-cycle inhibitors, and they induce apoptosis in MM cells [ 110 ] . More recently, suberoylanilide hydroxaminic acid (SAHA) , a pro-totypic HDACi, was shown to cause apoptosis and several molecular changes in MM cells and a reduction of IL-6 production by bone marrow stromal cells [ 111, 112 ] . Another HDACi, depsipeptide, was demonstrated to induce growth arrest of IL-6-dependent MM cells and to decrease the levels of antiapoptotic proteins [ 113 ] . Moreover, the proteasome inhibitor bortezomib was demonstrated to synergize with HDACi (SAHA and sodium butyrate) in inducing apoptosis [ 114 ] . Another study has recently shown that by inhibiting a particular HDAC, HDAC6, with tubacin, the aggresome-dependent protein catabolism is impaired. This resulted in a synergistic cytotoxic effect with bortezomib on MM cells [ 115 ] , suggesting that other cellular processes regulated by HDACs act as relevant therapeutic targets.

98 F. Piazza and G. Semenzato

Targeting the Myeloma Malignant Bone Marrow Microenvironment

Immunomodulatory Therapies

Thalidomide (N-phthalimido-glutarimide and lenalidomide) is a synthetic glutamic acid, derivative originally employed as a sedative and anti-emetic in the 1950s. Because of teratogenic effects, its use was at that time discontinued. Subsequently, in the 1960s, the discovery of anti-infl ammatory and anti-angiogenic properties of thalidomide prompted to study its mode of action, and in the early 1990s, experi-mental data demonstrated that it could inhibit TNF a synthesis by monocytes [ 116 ] and other cellular sources [ 117 ] and could hamper basic fi broblast growth factor (bFGF)-induced angiogenesis [ 118 ] . The rationale for the use of thalidomide in MM is based on the observation that in MM, the bone marrow microvessel density is increased, and this negatively correlates with prognosis (reviewed in [ 115 ] ). In the fi rst report of the clinical use of thalidomide in relapsed/refractory MM patients, the drug was administered daily from 200 mg up to 800 mg orally for a median of 80 days [ 119 ] . A clinical benefi t of thalidomide was demonstrated in 30–40% of patients, of which 10% obtained a complete or near complete remission and 25% a partial remission, as evaluated by >50% reduction in serum or urine monoclonal paraprotein levels [ 119 ] . Thalidomide was then tested as a single agent or in combination with dexamethasone and other drugs in several clinical trials that have demonstrated its clinical effi cacy [ 120– 122 ] and is currently being analysed in several ongoing clinical studies. One recently published study have assessed the role of thalidomide in association with HDT and ASCT [ 123 ] , demonstrating that its incorporation into aggressive protocols may increase the ORR without affecting, however, the OS.

Besides the teratogenic potential, which precludes its use in pregnant women, the most common adverse side effects observed with thalidomide include sedation (which indicates its assumption at bedtime), constipation, cutaneous manifestations (dry and itchy skin) and sensorimotor peripheral neuropathy, especially of the limbs. Rarer side effects are hepatotoxicity, hypothyroidism and neutropenia [ 122 ] . It has been proposed that thalidomide-mediated reduction of TNF a , bFGF and VEGF production might contribute to MM PC cytotoxicity, together with the increased activation of myeloma-directed T lymphocytes [ 124 ] .

More active thalidomide-derived immunomodulatory drugs (IMiDs) have shown similar effects in inhibiting MM PC growth. The mechanisms of these anti-myeloma effects include induction of apoptosis, inhibition of the MAPK pathway, inhibition of NF- k B activation and blockage of VEGF-induced cell migration [ 125 ] . Lenalidomide (Revlimid ® , Celgene Corp) is a thalidomide derivative that is up to 30,000 times more potent a TNF a inhibitor than thalidomide and is also more active in stimulating T-cell proliferation, production of IL-2 and IFN g [ 126 ] . In the clinical setting, lenalidomide has been utilised in a phase I trial in relapsed/refractory MM

995 Signalling Molecules as Selective Targets for Therapeutic Strategies…

patients. There was an anti-myeloma clinical activity (decreases in serum parapro-tein levels of >25%) in 66% and stabilisation or decrease in 79% of patients [ 127 ] . Importantly, lenalidomide treatment was associated to fewer side effects than thali-domide; in particular, less constipation, sedation and neuropathy were seen. Based on this, phase II and phase III trials with Revlimid ® are currently under development [ 128 ] . One of these phase II trials has recently been completed [ 129 ] . Lenalidomide was associated with dexamethasone as fi rst-line treatment in 34 MM patients. The administration schedule was 25 mg daily on days 1–21 of a 28-day cycle for lenali-domide and dexamethasone orally 40 mg daily on days 1–4, 9–12, 17–20 of each cycle. Six percent of patients achieved a complete response, and 32% a very good partial response or a near complete response, with an overall response rate of 91%. Fatigue and muscle weakness were the major adverse effects experienced [ 129 ] . Very recently, the results of a phase II trials testing the effectiveness of lenalidomide as monotherapy in relapsed/refractory MM, given at two different dosing schedules (15 mg twice daily or 30 mg once daily, oral) were published, demonstrating its activity and well tolerability [ 127 ] . Based on this, lenalidomide has been approved for the treatment of refractory/relapsed MM.

Anti-angiogenic Therapy

VEGF Inhibitors

Since vascular endothelial growth factor (VEGF) has been shown to regulate not only neo-angiogenesis in MM bone marrow but also proliferation and migration of MM cells which express high levels of VEGFR [ 130, 131 ] , and increased microvessel density in MM bone marrow correlates with a worse clinical course [ 132 ] , investigators have been prompted study the effects of the interruption of the VEGF–VEGFR axis as a potentially useful anti-MM therapy. Preclinical studies with a small syn-thetic specifi c VEGFR inhibitor, PTK787 (Novartis and Schering), showed a direct inhibition of MM cell proliferation and an inhibitory activity on IL-6 production in the bone marrow microenvironment [ 133 ] . In another study, a pan-VEGFR inhibi-tor, GW654652, displayed an antagonistic effect on MM PC migration and prolif-eration triggered by VEGF [ 134 ] . A tyrosine kinase inhibitor with selectivity for VEGFR2, SU5416 (Sugen), has been used in a phase II clinical trial on relapsed/refractory MM patients. This study showed no clinical activity but confi rmed bio-logical activity in vivo (reduction of plasma VEGF levels) [ 135 ] . However, more recent clinical studies have demonstrated that the use of pazopanib (GW786034), an oral angiogenesis inhibitor targeting VEGFR, platelet-derived growth factor recep-tor (PDGFR) and c-kit, as a single agent had no clinical effectiveness in relapsed/refractory MM [ 136 ] . Taken together, these studies suggest that the usefulness of hampering the VEGF–VEGFR in treating MM deserves further investigation.

100 F. Piazza and G. Semenzato

Fibroblast Growth Factor Receptor 3 (FGFR3) Inhibitors

FGFs display pro-angiogenic activity and are secreted in the MM BM milieu by BMSCs. They also bind the receptor tyrosine kinase FGFR on MM cells and stimulate MM cell growth. The importance of this family of GFs in MM biology is highlighted by the rearrangement of FGFR3 in the t(4;14) (p16.3; q32.3) [ 137 ] . This translocation is present in approximately 15% of MM. Thus, FGFR3 has attracted the attention of researchers as a potential therapeutic target in MM. In one recent study, two FGFR selective inhibitors, SU5402 and SU10991 (Sugen), have been tested. These com-pounds inhibited the growth of FGFR3+ MM cell lines in vitro and in murine MM models [ 138 ] . Also the synthetic compound PD173074 caused cell growth arrest, increase of plasma cell differentiation markers and, eventually, apoptosis of FGFR3+ MM cells [ 139 ] . Recently, the small-molecule tyrosine kinase inhibitor PKC412 was found able to inhibit the growth of B cells expressing mutated FGFR3 and TEL-FGFR3 fusion protein and of MM cell lines harbouring FGFR3 rearrangements [ 140 ] . Moreover, another approach using an anti-FGFR3 neutralising antibody, PRO-001, has been demonstrated to be effective in inducing MM cell death [ 141 ] .

Other Signalling Pathways

P38 MAP Kinase Inhibitors

The rationale of targeting p38 MAP kinase resides in its role upstream from the bortezomib-induced Hsp27 up-regulation, which could partly account for the resistance of MM cells to this agent. Indeed, p38 MAPK inhibition with a novel compound, SCIO-469 (Scios Inc., USA), while not responsible for signifi cant MM cell toxicity, enhanced the bortezomib-induced apoptosis of MM cells together with a reduction of p38 MAPK phosphorylation and Hsp27 up-regulation [ 142 ] . Importantly, this compound rendered bortezomib-resistant MM cells sensitive to the proteasome inhibitor. Recently, a study demonstrated that the inhibition of p38 MAPK rescues the function of dendritic cells in MM by rendering them more able to elicit an anti-myeloma humoral and cellular immune response [ 143 ] .

TGF b Inhibitors

Initial studies demonstrated an increased production of TGF b by bone marrow stromal cells and malignant PCs in MM and showed that this cytokine stimulated the secretion of IL-6 by bone marrow stromal cells [ 144, 145 ] . Subsequently, different properties have been assigned to TGF b in MM, such as immunomodu-lation [ 146, 147 ] , regulation of osteoblast biology and other processes [ 148 ] . Recently, the TGF b I receptor inhibitor SD-208 was used on MM cells. SD-208

1015 Signalling Molecules as Selective Targets for Therapeutic Strategies…

determined a reduction in IL-6 and VEGF secretion from bone marrow stromal cells and in MM PC growth induced by the adhesion to stromal cells. At a molec-ular level, this compound blocked the accumulation of Smad2/3 and HIF1 a downstream from TGF b signalling, thus altering IL-6 and VEGF transcription, respectively [ 149 ] .

Summary

The success of employing more targeted therapeutic strategies in acute promyelo-cytic leukaemia (all-trans retinoic acid) and chronic myeloid leukaemia (imatinib, inhibitor of ABL kinase), has opened the avenue to the research of the identifi cation of signalling molecules suitable of pharmacological treatment also in other diseases, including MM.

To this regard, in recent years, multiple myeloma has become a model to test novel therapeutic strategies targeting several signalling mechanisms that are deregulated in the malignant plasma cell. These molecular pathways are now better understood, and the expectations are for new agents that specifi cally target these mechanisms.

The passage from the preclinical to the clinical setting has been faster in the last years, and novel, molecular-based treatments are currently under investigation in clinical trials. Collectively, the general strategy to follow is the identifi cation of the best combination of drugs to induce clinically relevant responses. The goals are manifold, such as re-sensitise chemoresistant targets, capitalise on differences in mechanisms of action and gain an advantage in terms of systemic toxicity of con-ventional chemotherapeutics.

Acknowledgements Supported by AIRC (Milan) and AIRC Regional Project with Fondazione CARIPARO e CARIVERONA.

We are grateful to all the members of the Unit of Haematological Malignancies at VIMM and of the Haematology–Immunology Section at Padua University Hospital for support and suggestions.

References

1. Kuehl WM, Bergsagel PL. Multiple myeloma: evolving genetic events and host interactions. Nat Rev Cancer . 2002; 2 :175–187.

2. Bakkus MH, Heirman C, Van Riet I, Van Camp B, Thielemans K. Evidence that multiple myeloma Ig heavy chain VDJ genes contain somatic mutations but show no intraclonal varia-tion. Blood . 1992; 80 :2326–2335.

3. Fonseca R, Barlogie B, Bataille R, et al. Genetics and cytogenetics of multiple myeloma: a workshop report. Cancer Res . 2004; 64 :1546–1558.

4. Fonseca R, Blood E, Rue M, et al. Clinical and biologic implications of recurrent genomic aberrations in myeloma. Blood . 2003; 101 :4569–4575.

5. Avet-Loiseau H, Gerson F, Magrangeas F, Minvielle S, Harousseau JL, Bataille R. Rearrangements of the c-myc oncogene are present in 15% of primary human multiple myeloma tumors. Blood . 2001; 98 :3082–3086.

102 F. Piazza and G. Semenzato

6. Tricot G, Barlogie B, Jagannath S, et al. Poor prognosis in multiple myeloma is associated only with partial or complete deletions of chromosome 13 or abnormalities involving 11q and not with other karyotype abnormalities. Blood . 1995; 86 :4250–4256.

7. Hanamura I, Stewart JP, Huang Y, et al. Frequent gain of chromosome band 1q21 in plasma-cell dyscrasias detected by fl uorescence in situ hybridization: incidence increases from MGUS to relapsed myeloma and is related to prognosis and disease progression following tandem stem-cell transplantation. Blood . 2006; 108 :1724–1732.

8. Carrasco DR, Tonon G, Huang Y, et al. High-resolution genomic profi les defi ne distinct clin-ico-pathogenetic subgroups of multiple myeloma patients. Cancer Cell . 2006; 9 :313–325.

9. Debes-Marun CS, Dewald GW, Bryant S, et al. Chromosome abnormalities clustering and its implications for pathogenesis and prognosis in myeloma. Leukemia . 2003; 17 :427–436.

10. Smadja NV, Bastard C, Brigaudeau C, Leroux D, Fruchart C. Hypodiploidy is a major prog-nostic factor in multiple myeloma. Blood . 2001; 98 :2229–2238.

11. Zhan F, Huang Y, Colla S, et al. The molecular classifi cation of multiple myeloma. Blood . 2006; 108 :2020–2028.

12. Bergsagel PL, Kuehl WM. Molecular pathogenesis and a consequent classifi cation of multi-ple myeloma. J Clin Oncol . 2005; 23 :6333–6338.

13. Zhan F, Hardin J, Kordsmeier B, et al. Global gene expression profi ling of multiple myeloma, monoclonal gammopathy of undetermined signifi cance, and normal bone marrow plasma cells. Blood . 2002; 99 :1745–1757.

14. Davies FE, Dring AM, Li C, et al. Insights into the multistep transformation of MGUS to myeloma using microarray expression analysis. Blood . 2003; 102 :4504–4511.

15. Mattioli M, Agnelli L, Fabris S, et al. Gene expression profi ling of plasma cell dyscrasias reveals molecular patterns associated with distinct IGH translocations in multiple myeloma. Oncogene . 2005; 24 :2461–2473.

16. Duhrsen U, Hossfeld DK. Stromal abnormalities in neoplastic bone marrow diseases. Ann Hematol . 1996; 73 :53–70.

17. Damiano JS, Cress AE, Hazlehurst LA, Shtil AA, Dalton WS. Cell adhesion mediated drug resistance (CAM-DR): role of integrins and resistance to apoptosis in human myeloma cell lines. Blood . 1999; 93 :1658–1667.

18. Mitsiades CS, Mitsiades N, Munshi NC, Anderson KC. Focus on multiple myeloma. Cancer Cell . 2004; 6 :439–444.

19. Pearse RN, Sordillo EM, Yaccoby S, et al. Multiple myeloma disrupts the TRANCE/ osteoprotegerin cytokine axis to trigger bone destruction and promote tumor progression. Proc Natl Acad Sci USA . 2001; 98 :11581–11586.

20. Giuliani N, Bataille R, Mancini C, Lazzaretti M, Barille S. Myeloma cells induce imbalance in the osteoprotegerin/osteoprotegerin ligand system in the human bone marrow environment. Blood . 2001; 98 :3527–3533.

21. Abe M, Hiura K, Wilde J, et al. Role for macrophage infl ammatory protein (MIP)-1alpha and MIP-1beta in the development of osteolytic lesions in multiple myeloma. Blood . 2002; 100 :2195–2202.

22. Zannettino AC, Farrugia AN, Kortesidis A, et al. Elevated serum levels of stromal-derived factor-1alpha are associated with increased osteoclast activity and osteolytic bone disease in multiple myeloma patients. Cancer Res . 2005; 65 :1700–1709.

23. Tian E, Zhan F, Walker R, et al. The role of the Wnt-signaling antagonist DKK1 in the development of osteolytic lesions in multiple myeloma. N Engl J Med . 2003; 349 :2483–2494.

24. Oshima T, Abe M, Asano J, et al. Myeloma cells suppress bone formation by secreting a soluble Wnt inhibitor, sFRP-2. Blood . 2005; 106 :3160–3165.

25. Urashima M, Chauhan D, Uchiyama H, Freeman GJ, Anderson KC. CD40 ligand triggered interleukin-6 secretion in multiple myeloma. Blood . 1995; 85 :1903–1912.

26. Chauhan D, Uchiyama H, Akbarali Y, et al. Multiple myeloma cell adhesion-induced inter-leukin-6 expression in bone marrow stromal cells involves activation of NF-kappa B. Blood . 1996; 87 :1104–1112.

1035 Signalling Molecules as Selective Targets for Therapeutic Strategies…

27. Hideshima T, Chauhan D, Schlossman R, Richardson P, Anderson KC. The role of tumor necrosis factor alpha in the pathophysiology of human multiple myeloma: therapeutic appli-cations. Oncogene . 2001; 20 :4519–4527.

28. Dankbar B, Padro T, Leo R, et al. Vascular endothelial growth factor and interleukin-6 in paracrine tumor-stromal cell interactions in multiple myeloma. Blood . 2000; 95 : 2630–2636.

29. Franchimont N, Rydziel S, Canalis E. Transforming growth factor-beta increases interleu-kin-6 transcripts in osteoblasts. Bone . 2000; 26 :249–253.

30. Ogata A, Chauhan D, Teoh G, et al. IL-6 triggers cell growth via the Ras-dependent mitogen-activated protein kinase cascade. J Immunol . 1997; 159 :2212–2221.

31. Heinrich PC, Behrmann I, Haan S, Hermanns HM, Muller-Newen G, Schaper F. Principles of interleukin (IL)-6-type cytokine signalling and its regulation. Biochem J . 2003; 374 :1–20.

32. Hideshima T, Nakamura N, Chauhan D, Anderson KC. Biologic sequelae of interleukin-6 induced PI3-K/Akt signaling in multiple myeloma. Oncogene . 2001; 20 :5991–6000.

33. Bharti AC, Shishodia S, Reuben JM, et al. Nuclear factor-kappaB and STAT3 are constitu-tively active in CD138+ cells derived from multiple myeloma patients, and suppression of these transcription factors leads to apoptosis. Blood . 2004; 103 :3175–3184.

34. Yoshio-Hoshino N, Adachi Y, Aoki C, Pereboev A, Curiel DT, Nishimoto N. Establishment of a new interleukin-6 (IL-6) receptor inhibitor applicable to the gene therapy for IL-6-dependent tumor. Cancer Res . 2007; 67 :871–875.

35. Voorhees PM, Chen Q, Small GW, et al. Targeted inhibition of interleukin-6 with CNTO 328 sensitizes pre-clinical models of multiple myeloma to dexamethasone-mediated cell death. Br J Haematol . 2009; 145 :481–490.

36. Tassone P, Neri P, Burger R, et al. Combination therapy with interleukin-6 receptor superan-tagonist Sant7 and dexamethasone induces antitumor effects in a novel SCID-hu In vivo model of human multiple myeloma. Clin Cancer Res . 2005; 11 :4251–4258.

37. Mitsiades CS, Mitsiades NS, McMullan CJ, et al. Inhibition of the insulin-like growth factor receptor-1 tyrosine kinase activity as a therapeutic strategy for multiple myeloma, other hematologic malignancies, and solid tumors. Cancer Cell . 2004; 5 :221–230.

38. Menu E, Jernberg-Wiklund H, Stromberg T, et al. Inhibiting the IGF-1 receptor tyrosine kinase with the cyclolignan PPP: an in vitro and in vivo study in the 5T33MM mouse model. Blood . 2006; 107 :655–660.

39. Rowinsky EK, Youssoufi an H, Tonra JR, Solomon P, Burtrum D, Ludwig DL. IMC-A12, a human IgG1 monoclonal antibody to the insulin-like growth factor I receptor. Clin Cancer Res . 2007; 13 :5549 s–5555 s.

40. Stromberg T, Ekman S, Girnita L, et al. IGF-1 receptor tyrosine kinase inhibition by the cyclolignan PPP induces G2/M-phase accumulation and apoptosis in multiple myeloma cells. Blood . 2006; 107 :669–678. Epub 2005 Sep 2015.

41. Karin M, Cao Y, Greten FR, Li ZW. NF-kappaB in cancer: from innocent bystander to major culprit. Nat Rev Cancer . 2002; 2 :301–310.

42. Karin M, Greten FR. NF-kappaB: linking infl ammation and immunity to cancer development and progression. Nat Rev Immunol . 2005; 5 :749–759.

43. Keats JJ, Fonseca R, Chesi M, et al. Promiscuous mutations activate the noncanonical NF-kappaB pathway in multiple myeloma. Cancer Cell . 2007; 12 :131–144.

44. Annunziata CM, Davis RE, Demchenko Y, et al. Frequent engagement of the classical and alternative NF-kappaB pathways by diverse genetic abnormalities in multiple myeloma. Cancer Cell . 2007; 12 :115–130.

45. Feinman R, Koury J, Thames M, Barlogie B, Epstein J, Siegel DS. Role of NF-kappaB in the rescue of multiple myeloma cells from glucocorticoid-induced apoptosis by bcl-2. Blood . 1999; 93 :3044–3052.

46. Hideshima T, Chauhan D, Richardson P, et al. NF-kappa B as a therapeutic target in multiple myeloma. J Biol Chem . 2002; 277 :16639–16647.

47. Hideshima T, Catley L, Yasui H, et al. Perifosine, an oral bioactive novel alkylphospholipid, inhibits Akt and induces in vitro and in vivo cytotoxicity in human multiple myeloma cells. Blood . 2006; 107 :4053–4062.

104 F. Piazza and G. Semenzato

48. Jourdan M, Moreaux J, Vos JD, et al. Targeting NF-kappaB pathway with an IKK2 inhibitor induces inhibition of multiple myeloma cell growth. Br J Haematol . 2007; 138 :160–168.

49. Hideshima T, Chauhan D, Kiziltepe T, et al. Biologic sequelae of I{kappa}B kinase (IKK) inhibition in multiple myeloma: therapeutic implications. Blood . 2009; 113 :5228–5236.

50. Bharti AC, Donato N, Singh S, Aggarwal BB. Curcumin (diferuloylmethane) down-regulates the constitutive activation of nuclear factor-kappa B and IkappaBalpha kinase in human mul-tiple myeloma cells, leading to suppression of proliferation and induction of apoptosis. Blood . 2003; 101 :1053–1062.

51. Di Cristofano A, Pandolfi PP. The multiple roles of PTEN in tumor suppression. Cell . 2000; 100 :387–390.

52. Tu Y, Gardner A, Lichtenstein A. The phosphatidylinositol 3-kinase/AKT kinase pathway in multiple myeloma plasma cells: roles in cytokine-dependent survival and proliferative responses. Cancer Res . 2000; 60 :6763–6770.

53. Hideshima T, Catley L, Raje N, et al. Inhibition of Akt induces signifi cant downregulation of survivin and cytotoxicity in human multiple myeloma cells. Br J Haematol . 2007; 138 :783–791.

54. Gajate C, Mollinedo F. Edelfosine and perifosine induce selective apoptosis in multiple myeloma by recruitment of death receptors and downstream signaling molecules into lipid rafts. Blood . 2007; 109 :711–719.

55. Danial NN, Korsmeyer SJ. Cell death: critical control points. Cell . 2004; 116 :205–219. 56. Danial NN. BCL-2 family proteins: critical checkpoints of apoptotic cell death. Clin Cancer

Res . 2007; 13 :7254–7263. 57. Ludwig H. Advances in biology and treatment of multiple myeloma. Ann Oncol .

2005; 16 :ii106–112. 58. Badros AZ, Goloubeva O, Rapoport AP, et al. Phase II study of G3139, a Bcl-2 antisense

oligonucleotide, in combination with dexamethasone and thalidomide in relapsed multiple myeloma patients. J Clin Oncol . 2005; 23 :4089–4099.

59. Chanan-Khan AA, Niesvizky R, Hohl RJ, et al. Phase III randomised study of dexamethasone with or without oblimersen sodium for patients with advanced multiple myeloma. Leuk Lymphoma . 2009; 50 :559–565.

60. Trudel S, Stewart AK, Li Z, et al. The Bcl-2 family protein inhibitor, ABT-737, has substan-tial antimyeloma activity and shows synergistic effect with dexamethasone and melphalan. Clin Cancer Res . 2007; 13 :621–629.

61. Kline MP, Rajkumar SV, Timm MM, et al. ABT-737, an inhibitor of Bcl-2 family proteins, is a potent inducer of apoptosis in multiple myeloma cells. Leukemia . 2007; 21 :1549–1560.

62. Tse C, Shoemaker AR, Adickes J, et al. ABT-263: a potent and orally bioavailable Bcl-2 family inhibitor. Cancer Res . 2008; 68 :3421–3428.

63. Rasmussen T, Kuehl M, Lodahl M, Johnsen HE, Dahl IM. Possible roles for activating RAS mutations in the MGUS to MM transition and in the intramedullary to extramedullary transi-tion in some plasma cell tumors. Blood . 2005; 105 :317–323.

64. Hu L, Shi Y, Hsu JH, Gera J, Van Ness B, Lichtenstein A. Downstream effectors of oncogenic ras in multiple myeloma cells. Blood . 2003; 101 :3126–3135.

65. Le Gouill S, Pellat-Deceunynck C, Harousseau JL, et al. Farnesyl transferase inhibitor R115777 induces apoptosis of human myeloma cells. Leukemia . 2002; 16 :1664–1667.

66. Ochiai N, Uchida R, Fuchida S, et al. Effect of farnesyl transferase inhibitor R115777 on the growth of fresh and cloned myeloma cells in vitro. Blood . 2003; 102 :3349–3353.

67. Beaupre DM, McCafferty-Grad J, Bahlis NJ, Boise LH, Lichtenheld MG. Farnesyl trans-ferase inhibitors enhance death receptor signals and induce apoptosis in multiple myeloma cells. Leuk Lymphoma . 2003; 44 :2123–2134.

68. Bolick SC, Landowski TH, Boulware D, et al. The farnesyl transferase inhibitor, FTI-277, inhibits growth and induces apoptosis in drug-resistant myeloma tumor cells. Leukemia . 2003; 17 :451–457.

69. Cortes J, Albitar M, Thomas D, et al. Effi cacy of the farnesyl transferase inhibitor R115777 in chronic myeloid leukemia and other hematologic malignancies. Blood . 2003; 101 :1692–1697.

1055 Signalling Molecules as Selective Targets for Therapeutic Strategies…

70. Alsina M, Fonseca R, Wilson EF, et al. Farnesyltransferase inhibitor tipifarnib is well toler-ated, induces stabilization of disease, and inhibits farnesylation and oncogenic/tumor survival pathways in patients with advanced multiple myeloma. Blood . 2004; 103 :3271–3277.

71. Mitsiades CS, Mitsiades NS, McMullan CJ, et al. Anti-myeloma activity of heat shock pro-tein-90 inhibition. Blood . 2005; 107 :1092–1100.

72. David E, Sun SY, Waller EK, Chen J, Khuri FR, Lonial S. The combination of the Farnesyl transferase inhibitor (Lonafarnib) and the proteasome inhibitor (Bortezomib) induces syner-gistic apoptosis in human myeloma cells that is associated with down-regulation of p-AKT. Blood . 2005; 106 :4322–4329.

73. van de Donk NW, Lokhorst HM, Nijhuis EH, Kamphuis MM, Bloem AC. Geranylgeranylated proteins are involved in the regulation of myeloma cell growth. Clin Cancer Res . 2005; 11 :429–439.

74. Morgan MA, Sebil T, Aydilek E, Peest D, Ganser A, Reuter CW. Combining prenylation inhibitors causes synergistic cytotoxicity, apoptosis and disruption of RAS-to-MAP kinase signalling in multiple myeloma cells. Br J Haematol . 2005; 130 :912–925.

75. Wang S, El-Deiry WS. TRAIL and apoptosis induction by TNF-family death receptors. Oncogene . 2003; 22 :8628–8633.

76. Gazitt Y. TRAIL is a potent inducer of apoptosis in myeloma cells derived from multiple myeloma patients and is not cytotoxic to hematopoietic stem cells. Leukemia . 1999; 13 :1817–1824.

77. Mitsiades CS, Treon SP, Mitsiades N, et al. TRAIL/Apo2L ligand selectively induces apop-tosis and overcomes drug resistance in multiple myeloma: therapeutic applications. Blood . 2001; 98 :795–704.

78. Gomez-Benito M, Balsas P, Bosque A, Anel A, Marzo I, Naval J. Apo2L/TRAIL is an indi-rect mediator of apoptosis induced by interferon-alpha in human myeloma cells. FEBS Lett . 2005; 579 :6217–6222.

79. Crowder C, Dahle O, Davis RE, Gabrielsen OS, Rudikoff S. PML mediates IFN-alpha-induced apoptosis in myeloma by regulating TRAIL induction. Blood . 2005; 105 :1280–1287.

80. Whitesell L, Lindquist SL. HSP90 and the chaperoning of cancer. Nat Rev Cancer . 2005; 5 :761–772.

81. Mitsiades N, Mitsiades CS, Poulaki V, et al. Molecular sequelae of proteasome inhibition in human multiple myeloma cells. Proc Natl Acad Sci USA . 2002; 99 :14374–14379.

82. Mani A, Gelmann EP. The ubiquitin-proteasome pathway and its role in cancer. J Clin Oncol . 2005; 23 :4776–4789.

83. Ciechanover A, Orian A, Schwartz AL. Ubiquitin-mediated proteolysis: biological regulation via destruction. Bioessays . 2000; 22 :442–451.

84. Ciechanover A. Proteolysis: from the lysosome to ubiquitin and the proteasome. Nat Rev Mol Cell Biol . 2005; 6 :79–87.

85. Adams J. Proteasome inhibition in cancer: development of PS-341. Semin Oncol . 2001; 28 :613–619.

86. Elliott PJ, Ross JS. The proteasome: a new target for novel drug therapies. Am J Clin Pathol . 2001; 116 :637–646.

87. Hideshima T, Richardson P, Chauhan D, et al. The proteasome inhibitor PS-341 inhibits growth, induces apoptosis, and overcomes drug resistance in human multiple myeloma cells. Cancer Res . 2001; 61 :3071–3076.

88. LeBlanc R, Catley LP, Hideshima T, et al. Proteasome inhibitor PS-341 inhibits human myeloma cell growth in vivo and prolongs survival in a murine model. Cancer Res . 2002; 62 :4996–5000.

89. Orlowski RZ, Stinchcombe TE, Mitchell BS, et al. Phase I trial of the proteasome inhibitor PS-341 in patients with refractory hematologic malignancies. J Clin Oncol . 2002; 20 :4420–4427.

90. Richardson PG, Barlogie B, Berenson J, et al. A phase 2 study of bortezomib in relapsed, refractory myeloma. N Engl J Med . 2003; 348 :2609–2617.

91. Jagannath S, Barlogie B, Berenson J, et al. A phase 2 study of two doses of bortezomib in relapsed or refractory myeloma. Br J Haematol . 2004; 127 :165–172.

106 F. Piazza and G. Semenzato

92. Richardson PG, Sonneveld P, Schuster MW, et al. Bortezomib or high-dose dexamethasone for relapsed multiple myeloma. N Engl J Med . 2005; 352 :2487–2498.

93. Adams J, Palombella VJ, Sausville EA, et al. Proteasome inhibitors: a novel class of potent and effective antitumor agents. Cancer Res . 1999; 59 :2615–2622.

94. Rajkumar SV, Richardson PG, Hideshima T, Anderson KC. Proteasome inhibition as a novel therapeutic target in human cancer. J Clin Oncol . 2005; 23 :630–639.

95. Zhang HG, Wang J, Yang X, Hsu HC, Mountz JD. Regulation of apoptosis proteins in cancer cells by ubiquitin. Oncogene . 2004; 23 :2009–2015.

96. Cusack JC, Jr., Liu R, Houston M, et al. Enhanced chemosensitivity to CPT-11 with protea-some inhibitor PS-341: implications for systemic nuclear factor-kappaB inhibition. Cancer Res . 2001; 61 :3535–3540.

97. Chauhan D, Li G, Podar K, et al. Targeting mitochondria to overcome conventional and bort-ezomib/proteasome inhibitor PS-341 resistance in multiple myeloma (MM) cells. Blood . 2004; 104 :2458–2466.

98. Sayers TJ, Brooks AD, Koh CY, et al. The proteasome inhibitor PS-341 sensitizes neoplastic cells to TRAIL-mediated apoptosis by reducing levels of c-FLIP. Blood . 2003; 102 :303–310.

99. Sayers TJ, Murphy WJ. Combining proteasome inhibition with TNF-related apoptosis-induc-ing ligand (Apo2L/TRAIL) for cancer therapy. Cancer Immunol Immunother . 2005.

100. Nikrad M, Johnson T, Puthalalath H, Coultas L, Adams J, Kraft AS. The proteasome inhibitor bortezomib sensitizes cells to killing by death receptor ligand TRAIL via BH3-only proteins Bik and Bim. Mol Cancer Ther . 2005; 4 :443–449.

101. Chauhan D, Li G, Podar K, et al. A novel carbohydrate-based therapeutic GCS-100 overcomes bortezomib resistance and enhances dexamethasone-induced apoptosis in multiple myeloma cells. Cancer Res . 2005; 65 :8350–8358.

102. Chauhan D, Catley L, Li G, et al. A novel orally active proteasome inhibitor induces apoptosis in multiple myeloma cells with mechanisms distinct from Bortezomib. Cancer Cell . 2005; 8 :407–419.

103. Chauhan D, Catley L, Li G, et al. Preclinical evaluation of a novel and orally active protea-some inhibitor as a therapy in relapsed/refractory multiple myeloma. ASCO Annual Meeting Proceedings . 2005; 23 :3122.

104. Williams PG, Buchanan GO, Feling RH, Kauffman CA, Jensen PR, Fenical W. New cyto-toxic salinosporamides from the marine Actinomycete Salinispora tropica. J Org Chem . 2005; 70 :6196–6203.

105. Kuhn DJ, Chen Q, Voorhees PM, et al. Potent activity of carfi lzomib, a novel, irreversible inhibitor of the ubiquitin-proteasome pathway, against preclinical models of multiple myeloma. Blood . 2007; 110 :3281–3290.

106. Peterson CL, Laniel MA. Histones and histone modifi cations. Curr Biol . 2004; 14 :R546–551. 107. Piazza F, Semenzato G. Molecular therapeutic approaches to acute myeloid leukemia: target-

ing aberrant chromatin dynamics and signal transduction. Expert Rev Anticancer Ther . 2004; 4 :387–400.

108. Minucci S, Pelicci PG. Histone deacetylase inhibitors and the promise of epigenetic (and more) treatments for cancer. Nat Rev Cancer . 2006; 6 :38–51.

109. Marks PA, Richon VM, Miller T, Kelly WK. Histone deacetylase inhibitors. Adv Cancer Res . 2004; 91 :137–168.

110. Lavelle D, Chen YH, Hankewych M, DeSimone J. Histone deacetylase inhibitors increase p21(WAF1) and induce apoptosis of human myeloma cell lines independent of decreased IL-6 receptor expression. Am J Hematol . 2001; 68 :170–178.

111. Mitsiades N, Mitsiades CS, Richardson PG, et al. Molecular sequelae of histone deacetylase inhibition in human malignant B cells. Blood . 2003; 101 :4055–4062.

112. Mitsiades CS, Mitsiades NS, McMullan CJ, et al. Transcriptional signature of histone deacety-lase inhibition in multiple myeloma: biological and clinical implications. Proc Natl Acad Sci USA . 2004; 101 :540–545.

113. Khan SB, Maududi T, Barton K, Ayers J, Alkan S. Analysis of histone deacetylase inhibi-tor, depsipeptide (FR901228), effect on multiple myeloma. Br J Haematol . 2004; 125 : 156–161.

1075 Signalling Molecules as Selective Targets for Therapeutic Strategies…

114. Pei XY, Dai Y, Grant S. Synergistic induction of oxidative injury and apoptosis in human multiple myeloma cells by the proteasome inhibitor bortezomib and histone deacetylase inhibitors. Clin Cancer Res . 2004; 10 :3839–3852.

115. Hideshima T, Bradner JE, Wong J, et al. Small-molecule inhibition of proteasome and aggresome function induces synergistic antitumor activity in multiple myeloma. Proc Natl Acad Sci USA . 2005; 102 :8567–8572.

116. Sampaio EP, Sarno EN, Galilly R, Cohn ZA, Kaplan G. Thalidomide selectively inhibits tumor necrosis factor alpha production by stimulated human monocytes. J Exp Med . 1991; 173 :699–703.

117. Deng L, Ding W, Granstein RD. Thalidomide inhibits tumor necrosis factor-alpha production and antigen presentation by Langerhans cells. J Invest Dermatol . 2003; 121 :1060–1065.

118. D’Amato RJ, Loughnan MS, Flynn E, Folkman J. Thalidomide is an inhibitor of angiogenesis. Proc Natl Acad Sci USA . 1994; 91 :4082–4085.

119. Singhal S, Mehta J, Desikan R, et al. Antitumor activity of thalidomide in refractory multiple myeloma. N Engl J Med . 1999; 341 :1565–1571.

120. Barlogie B, Desikan R, Eddlemon P, et al. Extended survival in advanced and refractory mul-tiple myeloma after single-agent thalidomide: identifi cation of prognostic factors in a phase 2 study of 169 patients. Blood . 2001; 98 :492–494.

121. Alexanian R, Weber D, Anagnostopoulos A, Delasalle K, Wang M, Rankin K. Thalidomide with or without dexamethasone for refractory or relapsing multiple myeloma. Semin Hematol . 2003; 40 :3–7.

122. Barlogie B, Zangari M, Spencer T, et al. Thalidomide in the management of multiple myeloma. Semin Hematol . 2001; 38 :250–259.

123. Barlogie B, Tricot G, Anaissie E, et al. Thalidomide and hematopoietic-cell transplantation for multiple myeloma. N Engl J Med . 2006; 354 :1021–1030.

124. Vacca A, Scavelli C, Montefusco V, et al. Thalidomide downregulates angiogenic genes in bone marrow endothelial cells of patients with active multiple myeloma. J Clin Oncol . 2005; 23 :5334–5346. Epub 2005 Jun 5336.

125. Anderson KC. The role of immunomodulatory drugs in multiple myeloma. Semin Hematol . 2003; 40 :23–32.

126. Richardson P, Anderson K. Immunomodulatory analogs of thalidomide: an emerging new therapy in myeloma. J Clin Oncol . 2004; 22 :3212–3224.

127. Richardson PG, Blood E, Mitsiades CS, et al. A randomized phase 2 study of lenalidomide therapy for patients with relapsed or relapsed and refractory multiple myeloma. Blood . 2006.

128. Bartlett JB, Tozer A, Stirling D, Zeldis JB. Recent clinical studies of the immunomodulatory drug (IMiD) lenalidomide. Br J Cancer . 2005; 93 :613–619.

129. Rajkumar SV, Hayman SR, Lacy MQ, et al. Combination therapy with lenalidomide plus dexamethasone (Rev/Dex) for newly diagnosed myeloma. Blood . 2005; 106 :4050–4053. Epub 2005 Aug 4023.

130. Podar K, Tai YT, Davies FE, et al. Vascular endothelial growth factor triggers signaling cas-cades mediating multiple myeloma cell growth and migration. Blood . 2001; 98 :428–435.

131. Podar K, Tai YT, Lin BK, et al. Vascular endothelial growth factor-induced migration of multiple myeloma cells is associated with beta 1 integrin- and phosphatidylinositol 3-kinase-dependent PKC alpha activation. J Biol Chem . 2002; 277 :7875–7881.

132. Vacca A, Ribatti D. Bone marrow angiogenesis in multiple myeloma. Leukemia . 2006; 20 :193–199. 133. Lin B, Podar K, Gupta D, et al. The vascular endothelial growth factor receptor tyrosine

kinase inhibitor PTK787/ZK222584 inhibits growth and migration of multiple myeloma cells in the bone marrow microenvironment. Cancer Res . 2002; 62 :5019–5026.

134. Podar K, Catley LP, Tai YT, et al. GW654652, the pan-inhibitor of VEGF receptors, blocks the growth and migration of multiple myeloma cells in the bone marrow microenvironment. Blood . 2004; 103 :3474–3479.

135. Zangari M, Anaissie E, Stopeck A, et al. Phase II study of SU5416, a small molecule vascular endothelial growth factor tyrosine kinase receptor inhibitor, in patients with refractory multiple myeloma. Clin Cancer Res . 2004; 10 :88–95.

108 F. Piazza and G. Semenzato

136. Prince HM, Honemann D, Spencer A, et al. Vascular endothelial growth factor inhibition is not an effective therapeutic strategy for relapsed or refractory multiple myeloma: a phase 2 study of pazopanib (GW786034). Blood . 2009; 113 :4819–4820.

137. Chesi M, Nardini E, Brents LA, et al. Frequent translocation t(4;14)(p16.3;q32.3) in multiple myeloma is associated with increased expression and activating mutations of fi broblast growth factor receptor 3. Nat Genet . 1997; 16 :260–264.

138. Paterson JL, Li Z, Wen XY, et al. Preclinical studies of fi broblast growth factor receptor 3 as a therapeutic target in multiple myeloma. Br J Haematol . 2004; 124 :595–603.

139. Trudel S, Ely S, Farooqi Y, et al. Inhibition of fi broblast growth factor receptor 3 induces dif-ferentiation and apoptosis in t(4;14) myeloma. Blood . 2004; 103 :3521–3528.

140. Chen J, Lee BH, Williams IR, et al. FGFR3 as a therapeutic target of the small molecule inhibitor PKC412 in hematopoietic malignancies. Oncogene . 2005; 24 :8259–8267.

141. Trudel S, Stewart AK, Rom E, et al. The inhibitory anti-FGFR3 antibody, PRO-001 is cytotoxic to t(4;14) multiple myeloma cells. Blood . 2006; 7 :7.

142. Hideshima T, Podar K, Chauhan D, et al. p38 MAPK inhibition enhances PS-341 (bortezomib)-induced cytotoxicity against multiple myeloma cells. Oncogene . 2004; 23 :8766–8776.

143. Wang S, Yang J, Qian J, Wezeman M, Kwak LW, Yi Q. Tumor evasion of the immune system: inhibiting p38 MAPK signaling restores the function of dendritic cells in multiple myeloma. Blood . 2006; 107 :2432–2439.

144. Urashima M, Ogata A, Chauhan D, et al. Transforming growth factor-beta1: differential effects on multiple myeloma versus normal B cells. Blood . 1996; 87 :1928–1938.

145. Kroning H, Tager M, Thiel U, et al. Overproduction of IL-7, IL-10 and TGF-beta 1 in multiple myeloma. Acta Haematol . 1997; 98 :116–118.

146. Cook G, Campbell JD, Carr CE, Boyd KS, Franklin IM. Transforming growth factor beta from multiple myeloma cells inhibits proliferation and IL-2 responsiveness in T lymphocytes. J Leukoc Biol . 1999; 66 :981–988.

147. Abildgaard N, Glerup H, Rungby J, et al. Biochemical markers of bone metabolism refl ect osteo-clastic and osteoblastic activity in multiple myeloma. Eur J Haematol . 2000; 64 :121–129.

148. Wright N, de Lera TL, Garcia-Moruja C, et al. Transforming growth factor-beta1 down- regulates expression of chemokine stromal cell-derived factor-1: functional consequences in cell migration and adhesion. Blood . 2003; 102 :1978–1984.

149. Hayashi T, Hideshima T, Nguyen AN, et al. Transforming growth factor beta receptor I kinase inhibitor down-regulates cytokine secretion and multiple myeloma cell growth in the bone marrow microenvironment. Clin Cancer Res . 2004; 10 :7540–7546.

109M. Chatterjee and K. Kashfi (eds.), Cell Signaling & Molecular Targets in Cancer, DOI 10.1007/978-1-4614-0730-0_6, © Springer Science+Business Media, LLC 2012

Introduction

Bile acids are synthesized in the liver through the oxidation of cholesterol, are excreted into the gallbladder, and are then released into the intestinal tract. Bile acids are required for cholesterol excretion and lipid absorption. They include the primary bile acids, cholic acid and chenodeoxycholic acid, their glycine and taurine conju-gates, and the secondary bile acids, deoxycholic acid and lithocholic acid. Through the activity of the intestinal anaerobic bacterial fl ora, the primary bile acids undergo 7 a -dehydroxylation to yield deoxycholic acid and lithocholic acid, respectively [ 1 , Fig. 6.1 ]. Deoxycholic acid is partially reabsorbed in the large intestine and enters into the enterohepatic circulation. Lithocholic acid is fairly insoluble, and little is reabsorbed.

Besides their roles in dietary lipid absorption and cholesterol homeostasis, it has become clear that bile acids also are signaling molecules with endocrine function. They affect lipid and glucose metabolism and also energy homeostasis. Bile acids activate the nuclear receptor, farnesoid X receptor (FXR, NR1H4) [ 2– 4 ] . FXR regu-lates the transcription of genes encoding pivotal bile acid biosynthetic enzymes and transport proteins. These include CYP7A1, for 7 a -cholesterol hydroxylase, which is the rate-limiting enzyme for bile acid synthesis, ileal bile acid-binding protein, and FGF15, an essential factor for fi lling the gallbladder [ 5, 6 ] . FXR is expressed in the adrenal glands, intestine, kidney, and liver. FXR binds to the FXR response element after heterodimerization with the retinoid X receptor (RXR).

H. Yasuda (*) Division of Gastroenterology and Hepatology , St. Marianna University School of Medicine , 2-16-1 Sugao, 216-8511 Kawasaki , Japan e-mail: hyasuda@marianna-u.ac.jp

Chapter 6 Role of Bile Acids in Carcinogenesis of Gastrointestinal Tract

Hiroshi Yasuda and Fumio Itoh

110 H. Yasuda and F. Itoh

Bile acids activate several intracellular protein kinases, such as mitogen-activated protein kinase (MAPK) and protein kinase C (PKC). Recently, a membrane-type bile acid receptor TGR5, which has seven transmembrane domains and couples to trimeric G protein, has been identifi ed [ 7, 8 ] . This review focuses on the role of bile acids in gastrointestinal carcinogenesis as a luminal toxin and endocrine modulator. We discuss our recent results on bile acid-induced activation of the EGFR–MAPK pathway via TGR5 activation and its role in gastrointestinal carcinogenesis.

Bile Acids and Carcinogenesis

Cook et al. fi rst reported that malignant tumors developed after repeated injection of deoxycholic acid into the fl anks of mice [ 9 ] . This was the fi rst experimental report of malignant growths stimulated by a compound that is present normally in the human body. Bile acids have been reported as tumor promoters of known mutagens in animal experiments, but no tumors were detected in the colons of rats given bile acid alone without a known mutagen. Bile acids have been studied predominantly in relation to colorectal carcinogenesis; however, bile acids now have been impli-cated in playing roles in carcinogenesis throughout the gastrointestinal tract [ 10 ] . Dietary habits may affect stool and serum concentrations of bile acids, which may affect colorectal carcinogenesis. Bile acids can induce mucosal injury, stimulate cell proliferation, and promote tumorigenesis. In addition, bile acids affect anatomical regions exposed abnormally for prolonged periods to high bile acid concentrations,

R1 R2

cholic acid OHOH

OHchenodeoxycholic acid Hdeoxycholic acid H OHlithocholic acid H H

Free acid, X= OH

Glyco, X= NHCH2CO2H

Tauro, X= NHCH2CH2SO3H

Fig. 6.1 Chemical structures of the major human bile acids

1116 Role of Bile Acids in Carcinogenesis of Gastrointestinal Tract

such as the resected stomach, gastric pylorus, and esophagogastric junction with refl ux of bile acids from the duodenum and stomach.

Bile Acids and COX-2 Expression in Gastrointestinal Carcinogenesis

Cyclooxygenase (COX) is a membrane-bound glycoprotein that functions as a rate-limiting enzyme in prostaglandin (PG) synthesis. COX catalyzes the conversion of arachidonic acid to the common precursor prostanoids , prostaglandins (PG) H

2 and

PGG 2 . PGH

2 is subsequently converted to a variety of PGs, including PGE

2 , PGD

1 ,

PGF 2a

, PGI 2 , and thromboxane A

2 , by the respective PG synthetase. Each of these

fi nal metabolites binds to a specifi c GPCR to trigger intracellular responses. Several isoforms of COX enzymes have been reported. COX-1 is constitutively expressed and considered to be a housekeeping enzyme. Prostanoids synthesized via the COX-1 pathway are responsible for cytoprotection of the gastric mucosa, for the production of thromboxane by platelets, and for vasodilation of the kidney. In con-trast, COX-2 is an immediate early gene induced by cytokines, growth factors, tumor promoters, and viral transformation. Its pathophysiological role has been connected to infl ammation, the immune system, ovulation, and carcinogenesis [ 11– 13 ] . Many different stimuli induce COX-2 expression.

In 1971, Vane and colleagues demonstrated fi rst that aspirin and indomethacin inhibited PG production by blocking COX activity [ 14 ] . Since then, it has been reported that nonsteroidal anti-infl ammatory drugs (NSAIDs) affect COX activity directly. It is well documented that COX inhibitors reduce cancer growth. Prostanoids produced by COX-2, especially PGE

2 , enhance cell proliferation in normal and can-

cer cells through specifi c receptors [ 15, 16 ] . PGE 2 receptors, namely EP1-4, are a

family of GPCRs. PGE 2 also is a potent immunosuppressor [ 17 ] . PGE

2 inhibits the

production of immune regulatory lymphokines, T-cell and B-cell proliferation, and the cytotoxic activity of NK cells, thus favoring tumor growth. In addition, COX-2 induces the production of vascular endothelial growth factor (VEGF), a proangio-genic growth factor, and may promote angiogenesis [ 18, 19 ] . Furthermore, pros-tanoids are involved in inhibition of cancer cell apoptosis [ 20 ] .

Elevated expression of COX-2 has been reported in esophageal, gastric, and colon cancers. Elevated expression of COX-2 was associated with the reduced sur-vival of patients undergoing surgery. COX-2 was involved in VEGF expression and angiogenesis and immunomodulation in these tumors. In the upper gastrointestinal tract, duodeno-gastro-esophageal refl ux is one of the major factors for increased COX-2 expression. Bile acids have been reported to induce COX-2 expression in many cell culture systems, including cells from the gastrointestinal tract, which indicates a relationship with carcinogenesis [ 21– 23 ] . Bile acids induced COX-2 by both transcriptional and post-transcriptional mechanisms [ 21 ] . Bile acids are potent activators of PKC isoenzymes in the colonic mucosa [ 24 ] . PKC is implicated as being important for bile acid-mediated induction of COX-2 [ 25, 26 ] .

112 H. Yasuda and F. Itoh

Bile Acids and Human Gastrointestinal Cancer

Esophagus

Esophageal Squamous Cell Carcinoma

The two major histological types of esophageal cancer are squamous cell carcinoma (SCC) and Barrett adenocarcinoma. In East Asia, SCC is the predominant histologi-cal type of esophageal cancer. Factors associated with increased risk of esophageal SCC include smoking and alcohol intake. Refl ux of gastroduodenal contents after gastrectomy also has been reported as a risk factor of esophageal SCC [ 27, 28 ] . In an animal study, esophageal SCC or adenocarcinoma developed in rats with surgi-cally induced gastro-duodeno-esophageal or duodeno-esophageal refl ux [ 29 ] .

Barrett’s Epithelium and Esophageal Adenocarcinoma

Adenocarcinoma of the esophagus is one of most rapidly increasing cancers in Caucasian males in the United States, where the incidence of SCC of the esophagus has declined. Five-year survival rates rarely exceed 25%, even after intentionally curative resection, and early detection of esophageal adenocarcinoma is of great clinical signifi cance. Barrett’s epithelium (BE) is a premalignant condition of the distal esophagus and is associated with a 30–125-fold higher risk and 0.5–1% con-version rate of developing esophageal adenocarcinoma, compared with individuals in the general population. BE is characterized by the replacement of the normal esophageal squamous epithelium with a metaplastic epithelium resembling a more distal intestine and is considered to be induced by chronic gastroesophageal refl ux disease (GERD). Factors that increase gastroesophageal refl ux are dietary compo-nents, increasing body mass index and eradicating Helicobacter pylori ( H. pylori ) .

BE could arise from two alternative cellular origins. One possibility is direct transdifferentiation from mature squamous cells. The other is that certain pluripo-tent stem cells from squamous epithelium or bone marrow might contribute to the development of BE [ 30 ] . The luminal environment of the distal esophagus may stimulate these cells to develop BE. Mixed refl ux of the gastric and duodenal con-tents is common in GERD patients. Chronic exposure to duodeno-gastric refl uxate, especially bile acids and gastric acid, is critical. These may affect intracellular sig-naling systems and genetic or epigenetic factors. Because treatment with proton pump inhibitors does not seem to reverse or halt the progression of Barrett adeno-carcinoma, attention has turned to the role of bile acids in the genesis of BE and metaplasia. The bile acid compositions reported in esophageal aspirates include mostly glycine or taurine conjugated or sulfated forms. Duodenal refl uxate into the esophagus of these patients can yield peak concentrations of bile acids up to 2 mM at levels as high as the maximum bile acid concentration reported in the fecal water of the colon after a high-fat diet [ 31, 32 ] . Moreover, the bile acid concentration of

1136 Role of Bile Acids in Carcinogenesis of Gastrointestinal Tract

esophageal aspirates was higher in patients with esophagitis and BE [ 33, 34 ] . Of note, conjugated bile acids stimulated cell proliferation in esophageal cell lines through the p38 MAPK and p42/44 MAPK pathways [ 35 ] .

CDX-2 and Barrett’s Epithelium

CDX-2 is a member of the caudal-related homeobox transcription factor gene fam-ily that plays an important role in the early differentiation and maintenance of the intestinal epithelium. CDX-2 is a direct transcriptional activator of many intestine-specifi c genes, such as MUC-2, sucrase-isomaltase, and guanylyl cyclase. While CDX-2 is not expressed in the normal esophageal epithelium, increased expression of CDX-2 protein and mRNA were observed in mucosa from BE [ 36, 37 ] . CDX-2 positive cells were observed in columnar epithelium of BE model rats with esophago-jejunal anastomosis [ 38, 39 ] . An association between CDX-2 expression and intes-tinal metaplasia also has been reported in the stomach. While the normal gastric mucosa does not express CDX-2, intestinal metaplastic tissues in the human stom-ach stain intensively for the protein. In transgenic mice that overexpress CDX-2 in gastric parietal cells, the gastric fundic mucosa was changed into intestinal meta-plastic mucosa [ 40, 41 ] . Of note, refl ux of bile acids seems to be involved in CDX-2 expression and transdifferentiation from squamous to columnar epithelium. In cul-tured esophageal cells, bile acids induced CDX-2 expression via an NF k B-dependent pathway [ 37, 38 ] . Moreover, overexpression of CDX-2 in cultured rat esophageal keratinocytes induced MUC2. While CDX-2 is important for maintaining the intes-tinal phenotype, its expression was decreased in BE with dysplasia to Barrett adeno-carcinoma [ 42 ] . In accordance with this, reduced expression of CDX-2 protein has been reported also in gastric and colon carcinomas and may be responsible for car-cinogenesis [ 43 ] . Accordingly, exogenous CDX-2 expression in CRC cell lines inhibited cell proliferation [ 44 ] . Moreover, CDX-2 +/− mice developed multiple intes-tinal adenomatous polyps in the proximal colon [ 45 ] , and in addition, mice doubly heterozygous for APC D 716 and Cdx-2 +/− developed six times the number of colonic polyps than their APC D 716 and CDX-2 +/− littermates [ 46 ] . Interestingly, CDX-2 was shown to reduce COX-2 expression. In CRC cell lines, CDX-2 inhibited transcrip-tion of COX-2 by interfering with the binding of NF- k B to the NF- k B binding site [ 47, 48 ] . Collectively, CDX-2 seems to have a tumor-suppressive role in matured intestinal or metaplastic epithelium.

COX-2 Expression and Bile Acids in Esophageal Adenocarcinoma

COX-2 has been implicated in the neoplastic progression of BE. COX-2 immunore-activity was detected in most specimens of esophageal adenocarcinoma. Its expres-sion was enhanced in the metaplastic and dysplastic epithelium of BE and in adenocarcinoma in a progressively increasing fashion [ 49 ] . Elevated expression of COX-2 was associated with reduced survival of patients undergoing surgery for

114 H. Yasuda and F. Itoh

esophageal adenocarcinoma [ 50 ] . Bile acids have been implicated in COX-2 expression in BE and Barrett adenocarcinoma. In in vitro studies, chenodeoxycholic acid and deoxycholic acid induced COX-2 mRNA expression and enhanced PGE

2 produc-

tion in human esophageal adenocarcinoma cell lines [ 21 ] . Unconjugated bile acids induce COX-2 expression in esophageal cell lines via the reactive oxygen species-AKT mediated signaling pathway. Chenodeoxycholic acid induced COX-2 expression and VEGF production in esophageal adenocarcinoma and SCC cell lines [ 51 ] . In a BE model rat with esophagoduodenal anastomosis, COX-2 expression was induced in the BE and in esophageal adenocarcinoma formed in the distal esophagus during bile refl ux [ 52 ] . Therapeutic strategies for Barrett adenocarcinoma targeting COX-2 have been investigated. Selective inhibition of COX-2 by NS-398 decreased cell growth and increased the rate of apoptosis in human esophageal adenocarcinoma cell lines [ 53 ] . A COX-2 inhibitor was effective in preventing cancer in an animal model of BE and esophageal adenocarcinoma [ 54 ] .

Stomach

Gastric cancer is one of the most common and lethal malignancies worldwide. Histologically, human gastric carcinoma may be divided into the intestinal type and diffuse type. Pathogenesis of the intestinal-type cancer has been connected to pre-cursor changes, such as chronic atrophic gastritis, intestinal metaplasia, and dyspla-sia. Factors associated with an increased risk of gastric cancer include smoking, H. pylori infection, high salt intake, and low consumption of raw vegetables and fresh fruit. Among them, chronic H. pylori infection is most important and is associ-ated with the development of both intestinal and diffuse types of gastric cancer [ 55 ] . Prophylactic eradication of H. pylori after endoscopic resection for early gastric cancer reduced the risk of the subsequent development of metachronous gastric cancer [ 56 ] .

Gastric Carcinogenesis and Duodeno-gastric Refl ux

In addition to the factors mentioned above, duodeno-gastric refl ux has been consid-ered to be involved in gastric carcinogenesis. In particular, the Billroth II procedure resulted in a higher incidence of subsequent cancer than the Billroth I procedure [ 57 ] . This is likely because patients usually have a larger amount of duodenal refl ux containing bile in the gastric stump after Billroth II gastrectomy than do those after Billroth I. Among the various components of the duodenal refl ux, bile acids seem the most important in gastrointestinal carcinogenesis. Rats treated with NMMG ( N -methyl- N ¢ -nitro- N -nitrosoguanidine) and taurocholic acids had a higher inci-dence of neoplastic lesions in the stomach [ 58 ] . Furthermore, duodenal refl ux induced gastric adenocarcinoma in rats with gastrojejunal stomata [ 59 ] . No cancer was seen in rats with pancreaticoduodenal refl ux, whereas rats with bile refl ux and

1156 Role of Bile Acids in Carcinogenesis of Gastrointestinal Tract

rats with combined refl ux had gastric carcinoma. Thus, bile acids, and not pancrea-ticoduodenal secretions, were related to gastric carcinogenesis in rats with refl ux through the pylorus [ 60 ] .

Gastric Carcinogenesis and COX-2

COX-2 is an important factor in gastric carcinogenesis. Normal gastric mucosa expresses COX-1, but COX-2 expression is very low. COX-2 is overexpressed by the neoplastic cells in intestinal-type gastric cancer [ 61– 63 ] . COX-2 expression increased gradually during the sequential development of metaplastic epithelium from dyspla-sia to carcinoma in the stomach [ 64 ] . COX-2 overexpression was correlated with tumor invasion into the lymphatic vessels in the gastric wall, lymph node metastasis, and TMN staging in patients with gastric cancer [ 65 ] . H. pylori has been implicated as an inducer of COX-2 in the stomach. COX-2 was expressed in H. pylori -associated gastritis. H. pylori induced COX-2 expression and enhanced PGE

2

production in a human gastric carcinoma cell line [ 66– 68 ] . COX-2 expression was observed in stump cancers and conventional primary gastric cancer. In addition to H. pylori infection, physiological duodeno-gastric refl ux in the non-resected stomach led to increased expression of COX-2. The gastric pylorus is a common site for the occurrence of gastric cancer (Fig. 6.2 ). COX-2 expression was higher in early intestinal-type gastric cancers located in the gastric pylorus compared to tumors occurring in other area of stomach [ 69 , Fig. 6.3 ]. Exposure to high bile acid concentrations seems to be an additional mechanism for COX-2 induction in the pyloric area because of its anatomical location. In accordance with these observa-tions, bile acids induced COX-2 expression and enhanced PGE

2 production in

human gastric adenocarcinoma cell lines via the EGFR-p42/44 MAPK pathways. Thus, duodeno-gastric refl ux in the non-resected stomach could cause gastric carcinogenesis.

Fig. 6.2 Early gastric intestinal-type carcinoma in the pyloric area

116 H. Yasuda and F. Itoh

Colorectal Cancer

Colorectal cancer (CRC) is one of the three leading causes of cancer mortality worldwide. CRC may be sporadic, hereditary, or on a background of infl ammatory bowel disease (IBD) [ 70 ] . The majority of sporadic CRCs occur in adenomas due to local imbalance of growth regulation arising out of alteration of proto-oncogenes, loss of tumor suppressor gene activity, and abnormalities in genes involved in DNA mismatch repair. In hereditary CRC syndromes such as familial adenomatous poly-posis (FAP) and hereditary non-polyposis colon cancer (HNPCC), there are inher-ited genetic mutations in either tumor suppressor genes (APC gene in FAP) or genes associated with DNA mismatch repair function (hMSH genes in HNPCC). IBD-associated CRC is thought to represent an infl ammation-dysplasia-carcinoma sequence [ 71 ] .

Colon Cancer and Bile Acids

Environmental factors are also important in human colorectal carcinogenesis. Dietary habits constitute a major environmental factor. The consumption of animal fat is positively related to the incidence of colon cancer. A high-fat and low-fi ber diet tends to increase secretion of bile acid. The predominant secondary bile acids

Fig. 6.3 Immunohistochemical staining of COX-2 in early gastric carcinoma

1176 Role of Bile Acids in Carcinogenesis of Gastrointestinal Tract

formed in the human colon are the 7 a -dehydroxylated products of deoxycholic acid and lithocholic acid. They are the main bile acids in human fecal water [ 72 ] and have been implicated in CRC. In animal experiments, taurodeoxycholic acid, litho-cholic acid, deoxycholic acid, and chenodeoxycholic acid had a promoting effect in colon carcinogenesis induced in rats by MNNG [ 73, 74 ] . Cholic acid had a promot-ing effect in colon carcinogenesis induced by intrarectal administration of MNU ( N -methyl- N -nitrourea). This promoting effect might be exerted through conversion of cholic acid to deoxycholic acid by the intestinal bacterial fl ora. Dietary adminis-tration of chenodeoxycholic acid increased tumors in the duodenum of Apc MIN/+ mice without standard carcinogen such as MNNG [ 75 ] . In a clinical study, the serum concentration of unconjugated secondary bile acids such as deoxycholic acid and lithocholic acid was elevated in patients with colorectal adenomas [ 76 ] . Colonic mucosal proliferation was related to serum deoxycholic acid levels but not to litho-cholic, cholic, or chenodeoxycholic acid levels [ 77 ] .

Not all bile acids seem to act as carcinogens. Ursodeoxycholic acid (UDCA), a tertiary bile acid, is a “good bile acid” and dissolves cholesterol gallstones and shows cytoprotective effects in primary biliary cirrhosis [ 78 ] . UDCA, with its equatorial 7 b -hydroxyl group, is a poor detergent and has been shown to be cyto-protective. UDCA inhibited proliferation of CRC cell lines in vitro and protected against deoxycholic acid-induced apoptosis by stimulating Akt-dependent survival signaling in a human colon cancer cell line [ 79 ] . UDCA feeding reduced the size and number of colon tumors induced by NMU or azoxymethane and reduced fecal levels of cytotoxic deoxycholic acid in rats [ 80 ] . Ulcerative colitis (UC) is associ-ated with an increased risk of developing CRC. UC often is associated with pri-mary sclerosing cholangitis (PSC). UDCA, which was used initially because of its hepatoprotective effect for PSC, caused a marked decrease in the risk for the devel-opment of CRC or dysplasia in patients with UC and PSC [ 81 ] . UDCA treatment for primary biliary cirrhosis (PBC) was associated with decreases in the probabil-ity of recurrences of colorectal adenoma following colonoscopic removal [ 82 ] . In a larger study, it was shown that UDCA treatment after removal of colorectal ade-noma was associated with a reduction in recurrence of adenomas with high-grade dysplasia [ 83 ] .

Colorectal Cancer and COX-2

COX-2 has been studied intensively in colon carcinogenesis [ 84 ] . COX-2 was unde-tectable in the normal intestine, but its expression was increased in CRC [ 85, 86 ] . COX-2 was overexpressed in 50% of benign polyps and 80–85% of CRCs. Human CRC patients with COX-2 positive tumors showed augmented neovascularization and had a poorer prognosis than those with tumors negative for COX-2. They had pathologically unfavorable fi ndings, such as tumor size, differentiation, number of metastatic lymph nodes, and Duke’s stage [ 87 ] . Among the various prostanoids produced by COX-2, PGE

2 seems important in colon carcinogenesis. PGE

2 increased

the growth and motility of the LS-174 human colorectal carcinoma cell line via the

118 H. Yasuda and F. Itoh

PI3 kinase/AKT pathway [ 88 ] . Disruption of the gene encoding COX-2 in the APC D 716 heterozygote, a mouse model of human FAP, markedly reduced the num-ber and size of intestinal polyps [ 12 ] . In addition, disruption of EP

2 reduced the

number and size of adenomas in APC D 716 mice, indicating that EP2 was the major receptor mediating the PGE

2 signal in intestinal polyposis [ 89 ] . Of note, bile acids

induced cell proliferation [ 90 ] and COX-2 expression in colon cancer cells. A liquid extract of human fecal water and deoxycholic acid induced COX-2 promoter activ-ity in the CRC cell line HCT166 [ 22 ] .

Epidemiologic research indicates that there is a 40–50% reduction in mortality from colorectal cancer in individuals who take aspirin or other NSAIDs on a regular basis. Patients with FAP have an almost 100% risk of CRC. Chemoprevention of CRC with sulindac or the COX-2 selective inhibitor celecoxib caused regression of colorectal adenomatous polyps in patients with FAP and can be considered practical in a very high-risk population [ 91– 93 ] .

Bile Acid Receptors and Gastrointestinal Carcinogenesis

GPCR and EGFR Crosstalk and Carcinogenesis

The EGFR and its family members play a pivotal role in tumor development, and their expression strongly affects the clinical outcome of cancer patients. EGFR is overexpressed frequently in gastrointestinal tumors where the expression levels cor-relate with decreased 5-year survival rates [ 94 ] . EGFR activation has been shown in various cancer cell lines, including colon, non-small cell lung cancer, head and neck squamous cell carcinoma (HNSCC), pancreatic cancer, breast cancer, and prostate cancer. EGFR is emerging as an important therapeutic target for several epithelial tumors. The EGF ligand family consists of EGF, heparin-binding EGF-like growth factor (HB-EGF), transforming growth factor (TGF)- a , epiregulin, amphiregulin, neuregulins, and betacellulin [ 95 ] . The phosphorylation cascade stimulated by EGFR includes phosphatidylinositol 3-kinase, MAPK, including p38 MAPK , p42/44 MAPK , c-jun-N-terminal kinases (JNK), and PKC.

Various extracellular stimuli unrelated to EGFR ligands, such as agonists of GPCR, cytokines, and chemical and environmental stressors [ 96– 99 ] , are able to utilize the EGFR as a downstream signaling partner in the generation of mitogenic signals. Among them, GPCR-mediated EGFR activation has drawn much attention. GPCR-mediated activation of EGFR was described originally in Rat-1 fi broblasts. Stimulation of these cells with the GPCR ligands of lysophosphatidic acid (LPA), endothelin-1 (ET-1), and thrombin induced phosphorylation of EGFR and the sub-sequent expression of p42/44 MAPK or c- fos gene [ 96 ] . Two mechanisms have been proposed for EGFR transactivation by GPCRs: intracellular, ligand-independent and extracellular, ligand-dependent mechanisms. Several intracellular molecules have been identifi ed in the ligand-independent mechanism. Non-receptor tyrosine kinases of the Src family have been suggested as both upstream and downstream

1196 Role of Bile Acids in Carcinogenesis of Gastrointestinal Tract

mediators of the ligand-independent EGFR transactivation. Angiotensin II was reported to induce ligand-independent and Src-dependent EGFR activation in vas-cular smooth muscle cells [ 100 ] . G b g subunits have been reported to mediate Src-dependent EGFR phosphorylation [ 101 ] . PKC also has been shown to be involved in EGFR transactivation. ET-1 mediated EGFR activation was PKC-dependent in rat cardiomyocytes [ 102 ] . The Ca 2+ -regulated tyrosine kinase Pyk2 has been shown to activate EGFR transactivation in PC12 cells [ 103 ] . The activation of EGFR and Pyk2 by Src following GPCR stimulation of fi broblasts from Src-, Pyk2-, and EGFR-defi cient mice did not require EGFR, Src, and Pyk2 kinases to link GPCR with the MAP kinases signaling cascade [ 104 ] .

In terms of a ligand-independent mechanism, metalloprotease has been shown to be involved in GPCR-mediated EGFR transactivation in a series of experiments using metalloprotease inhibitors. EGFR transactivation requires activation of a dis-integrin and metalloproteinase (ADAM), which induce the shedding of EGF ligand ectodomains during their transition to soluble bioactive factors [ 105 ] . Many GPCR agonists, cytokines, and stressors appear to mediate EGFR transactivation by acti-vating metalloprotease-dependent HB-EGF shedding [ 106, 107 ] .

GPCR-mediated EGFR transactivation has been reported in various cancer cells. For instance, LPA stimulated cell proliferation and EGFR transactivation in HNSCC cells in an MMP-dependent manner [ 108 ] . LPA stimulated EGFR in human colon cancer cells. LPA interacts with at least three GPCR, LPA-1, -2, and -3, although LPA-2 was overexpressed in colon cancer tissue [ 109 ] . In addition, PGE

2 activated both EGFR and c-Met receptor and resulted in b -catenin and

increased expression of the urokinase-type plasminogen activator receptor (uPAR) in human colon cancer cell lines [ 110 ] . ET-1 increased DNA replication in colorec-tal cancer cells via the ET

A receptor. This action was mediated via the pertussis

toxin-sensitive G-proteins, PI3K, PKC, and transactivation of EGFR [ 111 ] . Interleukin-8 (IL-8), a member of the chemokine superfamily that binds to GPCR IL-8R

A and IL8R

B , was shown to activate EGFR via the release of HB-EGF and to

promote cell proliferation in the human colon cancer cell line Caco-2 [ 112 ] . On the other hand, the proteinase-activated receptor (PAR)-1 is a predominant receptor for thrombin. PAR-1 is absent from normal human colon epithelial cells but aberrantly expressed during colonic carcinogenesis [ 113 ] . Activation of PAR-1 by thrombin induced matrix metalloprotease (MMP)-dependent release of TGF- a , transactiva-tion of EGFR, and subsequent activation of p42/p44 MAPK in the human colon cancer cell line HT-29 [ 114 ] .

Bile Acid Receptors and EGFR Transactivation

Several reports have suggested that the cellular effects of bile acids involve activa-tion of MAPK and EGFR. It was reported originally that deoxycholic acid induced the rapid activation of p42/44 MAPK and EGFR in rat primary hepatocytes [ 115 ] . Moreover, it was reported that bile acids induced EGFR phosphorylation and enhanced COX-2 expression in a human cholangioma cell line. Bile acid-induced

120 H. Yasuda and F. Itoh

EGFR phosphorylation was associated with subsequent activation of p42/44 MAPK , p38 MAPK , and JNK. Src kinase activity was required for EGFR phosphorylation. Bile acid-induced COX-2 expression was dependent on the p42/44 MAPK and p38 MAPK pathways in these cells [ 116 ] . Although it was originally reported that bile acid-induced EGFR activation in hepatocytes was ligand independent [ 115 ] , bile acids stimulate MMP-3-mediated release of TGF- a with consequent activation of EGFR in human cholangiocyte cell lines [ 117 ] .

Bile Acids as Ligands for GPCR

The nuclear receptor FXR was identifi ed fi rst as a bile acid receptor and has been studied widely. Recently, GPCR type bile acid receptors have been identifi ed, and their role in gastrointestinal carcinogenesis has been investigated.

M 3 Muscarinic Receptor and EGFR Activation

It was reported originally that bile acids caused a rapid increase in cytosolic calcium in isolated rat hepatocytes [ 118 ] . Lithocholic acid and the conjugates taurolitho-cholic acid and taurolithocholic acid sulfate caused release of calcium from an Ins(1,4,5)P

3 -sensitive intracellular store [ 119 ] . Taurine- and glycine-conjugated bile

acids , such as lithocholyltaurine and lithocholylglycine, have a similar molecular structure to acetylcholine. They mimic the action of acetylcholine and have been reported to activate the M

3 muscarinic receptor and to transactivate EGFR [ 120–

122 ] . Of note, the M 3 muscarinic receptor agonist carbachol stimulated EGFR trans-

activation and mediated MMP-mediated cleavage of TGF- a in T84 human colonic epithelial cells [ 123 ] . In studies using colon cancer cell lines, bile acids stimulated cell proliferation by a mechanism involving matrix metalloproteinase 7 (MMP-7)-mediated release of an EGFR ligand and subsequent post-EGFR cell signaling [ 124 ] . In clinical studies, expression of MMP-7 (matrilysin) has been detected in SCC of the esophagus, neck, and lung and in adenocarcinomas of the breast, endometrium, prostate, stomach, and colon, which increased progressively with more advanced grades of colonic dysplasia and cancer [ 125 ] . Loss of matrilysin-defi ciency in Apc Min/+ mice led to a 60% reduction in the number of tumors formed, along with a signifi cant decrease in tumor size [ 126 ] .

TGR5 and EGFR Transactivation

A novel GPCR known as membrane-type bile acid receptor (M-BAR), or TGR5 [ 7, 8 ] , was identifi ed in a search of the GenBank TM data base for ligands for the orphan GPCRs. TGR5 has 30%, 29%, 26%, and 26% amino acid identity with EDG (sphin-gosine-1-phosphate receptor)-6, EDG-8, EDG-1, and EDG-7, respectively, and is a

1216 Role of Bile Acids in Carcinogenesis of Gastrointestinal Tract

member of the class 1 (rhodopsin-like) GPCR superfamily. Taurolithocholic acid increased [ 35 S]GTP g S binding in membrane fractions from TGR5-transfected cells. Treatment of CHO cells expressing TGR-5 with bile acids induced intracellular cAMP production and activation of p42/44 MAPK . The rank of order of potency of cAMP production in TGR5-transfected cells was lithocholic acid > deoxycholic acid > chenodeoxycholic acid > cholic acid. Their EC

50 values were 0.035, 0.575,

4.0, >10 m M, respectively. Their taurine- or glycine-conjugated forms or UDCA also was active. The absence of a change in intracellular Ca 2+ following stimulation of TGR5-transfected cells with bile acid suggested G

s , not to G

q or G

i , coupling to

TGR5. Expression of TGR5 has been detected in most human tissues, including stomach, duodenum, ileum, jejunum, and colon, but not esophagus and rectum. TGR5 mRNA also is expressed in monocytes/macrophages. TGR5 also was expressed in sinusoidal endothelial cells in the rat liver [ 127 ] .

Several metabolic roles of TGR5 have been explored. TGR5 was involved in bile acid-induced GLP secretion from intestinal neuroendocrine cells [ 128 ] . Recently, bile acids were shown to infl uence energy consumption in brown adipose tissue through the TGR5/cAMP pathway [ 129 ] . In addition, TGR5 seems to play a critical role in maintenance of bile acid homeostasis and cholesterol metabolism. The total bile acid pool size was decreased signifi cantly in TGR5 disrupted mice. A high-fat diet led to fat accumulation with body weight gain in these mice [ 130 ] . They did not form cholesterol gallstones when fed a cholic acid-containing high-fat diet [ 131 ] .

Recently, it was shown that TGR5 is involved in bile acid-induced transactiva-tion of EGFR (Fig. 6.4 ). In AGS human gastric carcinoma cells, siRNA-mediated down-regulation of TGR5 was associated with suppression of deoxycholic acid-induced transactivation of EGFR [ 132 ] . In addition, siRNA-mediated down-regula-tion of ADAM-17 suppressed deoxycholic acid-induced transactivation of EGFR. Activation of ADAM-17 led to shedding of HB-EGF ectodomains, which activated EGFR. EGFR transactivation protected these cells partially from deoxycholic acid-induced apoptosis. Upregulated expression of ADAM-17 and EGFR was observed in human colon cancer tissue [ 133 ] . The TGR5–ADAM17–EGFR pathway seems to participate in the genesis and apoptosis of gastric carcinoma cells and thus may serve as a target for cancer prevention.

FXR and Colon Carcinogenesis

In contrast to the tumorigenic roles of bile acid-induced GPCR activation, evidence from experiments using knockout mice [ 134 ] suggested a protective role of the bile acid nuclear receptor FXR in intestinal carcinogenesis. In a clinical study of FAP patients, FXR expression was decreased in tumors compared to normal mucosa. Increased colonic cell proliferation and increased prevalence and size of azoxymethane-induced adenocarcinoma were observed in the colons of FXR-defi cient mice [ 135 ] . Moreover, loss of FXR in the Apc Min/+ mice resulted in early mortality and increased tumor progression by promotion of Wnt signaling [ 136 ] . FXR seems to protect against colon carcinogenesis in several ways. Firstly, mice

122 H. Yasuda and F. Itoh

lacking FXR expression have elevated levels of serum bile acids and an increase in the bile acid pool size [ 137 ] . Of note, FXR-defi cient mice developed hepatocellular adenoma and carcinoma spontaneously after 12–15 months of age [ 138, 139 ] . A major role of FXR seems to protect the liver and intestine from the deleterious effect of bile acid overload by decreasing their endogenous production and by accelerating biotransformation and excretion. Secondly, FXR is important in protecting against colonic mucosal infl ammation. Chronic infl ammation is an important factor in colon carcinogenesis in patients with IBD. Mice lacking FXR had increased ileal levels of bacteria and a compromised epithelial barrier. Notably, FXR synthetic agonist GW4064 was able to reverse intestinal bacterial overgrowth following surgical

Fig. 6.4 Effect of deoxycholic acid on the subcellular localization of EGFR in human gastric adenocarcinoma AGS cells. Cells were incubated with ( lower ) or without ( upper ) 50 m M deoxycholic acid for 5 min, and EGFR immunofl uorescence was examined using a confocal laser microscope

1236 Role of Bile Acids in Carcinogenesis of Gastrointestinal Tract

biliary obstruction in wild type but not in FXR-defi cient mice. [ 140 ] . Thirdly, FXR is essential for glucose metabolism. Glucose was shown to regulate the expression of FXR, and streptozotocin-induced diabetes results in a down-regulation of hepatic FXR gene expression [ 141 ] . FXR-defi cient mice developed severe fatty liver and elevated circulating free fatty acids, which was associated with impaired glucose tolerance and insulin resistance. In these mice, insulin signaling was impaired in peripheral insulin-sensitive tissue, such as skeletal muscle and white adipose tissue [ 142, 143 ] . Adiponectin is a key hormone responsible for insulin sensitization [ 144 ] . Reduced plasma levels of adiponectin have been reported to correlate with the risk of CRC [ 145 ] . When azoxymethane treated adiponectin-defi cient mice were fed with a high-fat diet, increased numbers of colon polyps and reduced survival were observed [ 146 ] . It is likely that dysregulation of FXR expression in a diabetic and insulin resistant state may contribute to the increased incidence of CRC observed in the obese population. Collectively, FXR seems to protect against colon carcinogen-esis by maintaining both bile acids and glucose homeostasis. There is a potential chemopreventive role for a selective FXR agonist.

Conclusions

Several factors, including environmental, genetic, and epigenetic factors, are involved in gastrointestinal carcinogenesis. Among them, bile acids are important as luminal and endocrine factors through GPCRs and nuclear receptor pathways. In the upper gastrointestinal tract, bile acids in duodenal refl uxate induce COX-2 expression by the esophageal and gastric epithelium during duodeno-gastric-esoph-ageal refl ux. A high-fat and low-fi ber diet increases secretion of bile acids and is related to the incidence of CRC. Bile acids activate EGFR and MAPK, and induce COX-2 expression, in gastrointestinal cells via GPCR. GPCR may serve as a target for cancer prevention. In contrast to GPCRs, FXR protects against colon carcino-genesis by modulating glucose and bile acid homeostasis.

References

1. Russell, D.W., 2003, Ann. Rev. Biochem., 72, 137–174. 2. Makishima, M., Okamoto, A.Y., Repa, J.J., Tu, H., Learned, M., Luk, A., Hull, M.V.,

Lustig, K.D., Mangelsdorf, D.J., Shan, B., 1999, Science, 284, 1362–1365. 3. Park, D.J., Blanchard, S.G., Bledsoe, R.K., Chandra, G., Consler, T.G., Kliewer, S.A.,

Stimmel, J.B., Willson, T.M., Zavacki, A. M., Moore, D.D., Lehmann, J.M., 1999, Science, 284, 1365–1368.

4. Wang, H., Hung, J., Hollister, K., Sowers, L.C., Forman, B.M., 1999, Mol. Cell, 17, 683–694.

5. Lefebvre, P. Cariou, B., Lien, F., Kuipers, F., Staels, B., 2009, Physiol. Rev., 89, 147–191.

124 H. Yasuda and F. Itoh

6. Choi, M., Moschetta, A., Bookout A.L., Peng, L., Umetani, M., Holmstrom, S.R., Suino-Powell, K., Xu, H.E., Richardson, J.A., Gerard, R.D., Mangelsdorf, D.J., Kliewer, S.A., 2006, Nature Med., 12, 1253–1255.

7. Maruyama, T., Miyamoto, Y., Nakamura, T., Tamai, Y., Okada, H., Sugiyama, E., Nakamura, T., Itadani, H., Tanaka, K., 2002, Biochem. Biophys. Research Comm., 298, 714–719.

8. Kawamata, Y., Fujii, R., Hosoya, M., Harada, M., Yoshida, M., Miwa, M., Fukusumi, S., Habata, Y., Itoh, T., Shintani, Y., Hinuma, S., Fujisawa, Y., Fujino, M., 2003, J. Biol. Chem. 278, 9435–9440.

9. Cook, J.W., Kennaway, E.L., Kennaway, N.M., 1940, Nature, 3647, 627. 10. Bernstein, H., Bernstein, C., Payne, C.M., Dvorakova, K., Garewal, H., 2005, Mutation

Research, 589, 47–65. 11. Williams, C.S., Mann, M., Dubois, R.N., 1999, Oncogene, 18, 7908–7916. 12. Oshima, M., Dinchuk, J.E., Kargman, S.L., 1996, Cell, 87, 803–809. 13. Iniguez, M.A., Punzon, C., Fresno, M., 1999, J. Immunol., 163, 111–119. 14. Vane, J.R., 1971, Nat. New Biol., 231, 232–235. 15. Narumiya, S., Sugimoto, Y., Ushikubi, F., 1999, Physiol. Rev., 79, 1193–1221. 16. Pai, R., Soreghan, B., Szabo, I.L., Pavelka, M., Baatar, D., S. Tarnawski, A.S., 2002, Nature

Med., 8, 289–293. 17. Phipps, R.P., Stein, S.H., Roper, R.L., 1991, Immunol. Today, 12, 349–352. 18. Tsujii, M., Kawano, S., Tsuji, S,. Sawaoka, H., Hori, M., DuBois, R.N., 1998, Cell, 93,

705–716. 19. Pai, R., Szabo, I.L., Soreghan, B.A., Atay, S., Kawanaka, H., Tarnawski, A.S., 2001, Biochem.

Biophys. Res. Commun., 286, 923–928. 20. Tsujii, M., Dubois, R.N., 1995, Cell, 83, 493–501. 21. Zhang, F., Subbaramaiah, K., Altorki, N., Dannenberg, A.J., 1998, J. Biol. Chem. 273,

2424–2428. 22. Glinghammar, B., Rafter, J., 2001, Gastrotenterol., 120, 401–410. 23. Zhang, F., Altorki, N.K., Wu, Y.-C., Soslow, R.A., Subbaramaiah, K., Dannenberg AJ., 2001,

Gastroenterol., 121, 1391–1399. 24. Craven, P.A., Pfanstiel, J., DeRubertis, F.R., 1987, J. Clin. Invest., 79, 532–541. 25. Guillem, J.G., O’Brian, C.A., Fitzer, C.J., Johnson, M.D., Forde, K.A., LoGerfo, P., Weinstein,

I.B., 1987, Arch. Surg., 122. 1475–1478. 26. Jones, B.A., Rao, Y.P., Stravitz, R.T., Gores, G.J., 1997, Am. J. Physiol., 272, G1109–1115. 27. Maeta, M., Koga, S., Shimizu, T., Matsui, K., 1990, J. Surgical Oncol., 44, 20–24. 28. Kitabayashi, K., Nakano, Y., Saito, H., Ueno, K., Kita, I., Takashima, S., Kurose, N., Nojima, T.,

2001, Surgery Today, 31, 670–674. 29. Miwa, K., Hasegawa, H., Fujimura, T., Matsumoto, H., Miyata, R., Kosaka, T., Miyazaki, I.,

Hattori, T., 1996, Int. J. Cancer, 67, 269–274. 30. Fitzgerald, R.C., 2006, Gut, 55, 1810–1818. 31. Kauser, W.K.H., Peters, J.H., DeMeester, T.R., Feussner, A.P., Ireland, H.J., Stein, R.J.,

Siewert, R.J., 1997, Surgery, 122, 874–881. 32. Stadler J., Stern, H.S., Yeung, K.S., McGuire, V., Furrer, R., Marcon, N., Bruce, W.R., 1988,

Gut, 29, 1326–1331. 33. Nehra, D., Howell, P., Williams, C.P., Pye, J.K., Beynon, J., 1999, Gut, 44, 598–602. 34. Menges, M., Müller, M., Zeitz, M., 2001, Am. J. Gastroenterol., 96, 331–337 35. Jaiswal, K., Lopez-Guzman, C., Souza, R.F., Spechler, S.J., Sarosiet, G.A., 2006, Am.

J. Physiol., 290, G335–G342. 36. Eda, A., Osawa, H., Satoh, K., Yanaka, I., Kihira, K., Ishino, Y., Mutoh, H., Sugano, K., 2003,

J. Gastroenterol., 38, 14–22. 37. Wong, N.S.C.S., Wilding, J., Bartlett, S., Liu, Y., Warren, B.F., Piris, J., Marynard, N.,

Marshall, R., Bodmer, W.F., 2005, Proc. Natl. Acad. Sci., 102, 7565–7570. 38. Kazumori, H., Ishihara, S., Rumi, M.A.K., Kadowaki, Y., Kinoshita, Y., 2006, Gut, 55, 16–25. 39. Kazumori, H., Ishihara, S., Kinoshita, Y., 2009, Gut, 58, 620–628.

1256 Role of Bile Acids in Carcinogenesis of Gastrointestinal Tract

40. Silberg, D.G., Sullivan, J.S., Kang, E., Swain, G.P., Moffett, J., Sund, N.J., Sackett, S.D., Kaestiner, K.H., 2002, Gastrotenterol., 122, 689–696.

41. Mutoh, H., Hakamata, Y., Sato, K., Eda, A., Yanaka, I., Honda, S., Osawa, H., Kaneko, Y., Sugano, K., 2002, Biochem. Biophys. Res. Commun., 294, 470–479.

42. Villanacci, V., Rossi, E., Zambelli, C., Galletti, A., Cestari, R., Missale, G., D. Della Casa, D., Bassott, G., 2007. Digestive Liver Disease, 39, 305–311.

43. Liu, Q., Teh, M., Ito, K., Shah, N., Ito, Y., Yeoh, K.G., 2007, Modern Pathology 20, 1286–1297.

44. Vidal Mallo, G., Soubeyran, P., Lissitzky, J.C., André, F., Farnarier, C., Marvaldi, J., Dagorn, J.C., Iovanna, J.L., 1998, J. Biol. Chem., 273: 14030–14036.

45. Chawengsaksophak, K., James, R., Hammond, V.E., Köntgen, F., Beck, F., 1997, Nature, 386, 84–87.

46. Aoki, K., Tamai, Y., Horiikem S., Oshima, M., Taketo, M.M., 2003, Nature Genet., 35, 323–330.

47. Kim, S.-P., Park, J.-W., Lee, S.-H., Lim, J.H., Jang, B.-C., Lee, S.-H., Jang, I.-H., Lee, S.-H., Jang, I.-H., Freund, J.-N., Suh, S.-I., Mun, H.C., Song, D.-K., Ha, E.-M., Lee, W.-J., Kwon, T.K., 2004, Biochem. Biophys. Re. Comm., 315, 93–99.

48. Mutoh, H., Hayakawa, H., Sakamoto, H., Sugano, K., 2007, J. Gastroenterol., 42, 719–729. 49. Shirvani, V.N., Ouatu-Lascar, R., Kaur, B.S., Omary, M.B., Triadafi lopoulos, G., 2000,

Gastroenterol., 118, 487–496. 50. Buskens, C.J., van Rees, B.P., Sivula, A., Reitsma, J.B., Haglund, C., Bosma, P.J., Offerhaus, G.J.,

van Lanschot, J.J.B., Ristimäki, A., 2002, Gastroenterol., 122, 1800–1807. 51. Soma, T., Kaganoi, J., Kawaba, A., Kondo, K., Tsunoda, S., Imamura, M., Shimada, Y., 2006,

Int. J. Cancer, 119, 771–782. 52. Song, S., Guha, S., Liu, G., Buttar, N.S., Bresalier, R.S., 2007, Gut, 56, 1512–1521. 53. Souza, R.F., Shewmake, K., Beer, D.G., Cryer, B., Spechler, S.J., 2000, Cancer Res., 60,

5767–5772. 54. Buttar, N.S., Wang, K.K., Leontovich, O., Westcott, J.Y., Pacifi co, R.J., Anderson, M.A.,

Krishnadath, K.K., Lutzke, L.S., Burgart, L.J., 2002, Gastrotenterol., 122, 1101–1112. 55. Uemura, N., Okamoto, S., Yamamoto, S., Matsumura, N., Yamaguchi, S., Yamakido, M.,

Taniyama, K., Sasaki, N., Schlemper, R., 2001, N. Engl. J. Med., 345, 784–789. 56. Fukase, K., Kato, M., Kikuchi, S., Inoue, K., Uemura, N., Okamoto, S., Terao, S., Amagai,

K., Hayashi, S., Asaka, M., for the Japan Gast Study Group, 2008, Lancet, 372, 392–397. 57. Lundegardh, G., Adami, H.O., Helmick, C., Zack, M., Meirik, O., 1988, N. Engl. J. Med.,

319, 195–200. 58. Kobori, O., Shimizu, T., Maeda, M., Atomi, Y., Watanabe, J., Shoji, M., Morioka, Y., 1984, J.

Natl. Cancer Inst., 73, 853–861. 59. Miwa, K., Hasegawa, H., Fujimura, T., Matsumoto, H., Miyata, R., Kosaka, T., Miyazaki, I.,

Hattori, T., 1992, Carcinogenesis 13, 2313–2316. 60. Miwa, K., Fujimura, T., Hasegawa, H., Kosaka, T., Miyata, R., Miyazaki, I., Hattori, T., 1992,

J. Cancer Res. Clin. Oncol., 118, 1570–4. 61. Ristimäki, A., Honkanen, N., Jänkälä, H., Sipponen, P., Härkönen, M., 1997, Cancer Res., 57,

1276–1280. 62. Saukkonen, K., Nieminen, O., van Rees, B., Vilkki, S., Härkönen, M., Juhola, M., Mecklin, J.P.,

Sipponen, P., Ristimäki, A., 2001, Clin. Cancer Res., 7, 1923–1931. 63. Saukkonen, K., Rintahaka, J., Sivula, A., Buskens, C.J., van Rees, B.P., Rio, M.C., Haglund, C.,

van Lanschot, J.B., Offerhaus, G.J.A., Ristimaki, A., 2003, APMIS 111, 915–925. 64. van Rees, B.P., Saukkonen, K., Ristimaki, A., Polkowski, W., Tytgat, G.N.J., Drillenburg, P.,

Offerhaus, J.A., 2002, J. Pathology, 196,171–179. 65. Murata, H., Kawano, S., Tsuji, S., Tsujii, M., Sawaoka, H., Kimura, Y., Shiozaki, H., Hori,

M., 1999, Am. J. Gastrotenterol., 94, 451–455. 66. Romano, M., Vittorio, R,. Memoli, A., Tuccilli, C., Di Popolo, A., Sommi, P., Acquaviva,

A.M., Blanco, C.D.V., Bruni, C.B., Zarrilli, R., 1998, J. Biol. Chem., 273, 28560–28563.

126 H. Yasuda and F. Itoh

67. Fu, S., Ramanujam, K.S., Wong, A., Wong, A., Fantry, G.T., Drachenberg, C.B., James, S.P., Meltzer, S.J., Wilson, K.T., 1999, Gastroenterol., 116, 1319–1329.

68. McCarthy, C.J., Crofford, L.J., Greenson. J., Scheiman, J.M., 1999, Am. J. Gastroenterol., 94, 1218–1223.

69. Yasuda, H., Yamada, M., Endo, Y., Inoue, K., Yoshiba, M. 2005, J. Gastroenterol., 40, 690–697. 70. Kinzler, K.W., Vogelstein, B., 1996, Cell, 87, 159–170. 71. Itzkowitz, S.H., Yio, X., 2004, Am. J. Pysiol., 287, G7-G17. 72. De Kok, T.M.C.M., van Faassen, A., Glinghammar, B., Pachen, D.M.F.A., Rafter, J.J., Baeten,

C.G.M.I., Engels, L.G.J.B., Kleinjans, J.C.S., 1999, Digest. Dis. Sci., 44, 2218–2225. 73. Reddy, B.S., Narasawa, T., Weisburger, J.H., Wynder, E.L., 1976, J., Natl., Cancer Inst., 56,

441–442. 74. Reddy, B.S., Watanabe, K., Weisburger, J.H., Wynder, E.L., 1977, Cancer Research, 37,

3238–3242. 75. Mahmoud, N.N., Dannenberg, A.J., Bilinski, R.T., Mestre, J.R., Chadburn, A., Churchill, M.,

Martucci, C., Bertagnolli, M.M., 1999. Carcinogenesis, 20. 299–303. 76. Bayerdörffer, E., Mannes, G.A., Ochsenkühn, T., Dirschedl, P., Wiebecke, B., Paumgartner, G.,

1995, Gut, 36, 268–273. 77. Ochsenkühen, T., Bayerdörffer, E., Meining, A., Schinkel, M., Thiede, C., Nüssler, V.,

Sackmann, M., Hatz, R., Neubauer, A., Paumgartner, G., 1999, Cancer, 85, 1664–1669. 78. Rubinm R.A., Kowalski, T.E., Khandelwal, M., Malet, P.F., 1994, Ann. Intern. Med. 121,

207–218. 79. Im, E., Akare, S., Powell, A.A., Martinez, J.D., 2005, Nutr. Cancer., 51, 110 – 116. 80. Batta, A.K., Salen, G., Holubec, H., Brasitus, T.A., Alberts, D., Earnest, D.L., 1998, Cancer

Research, 58, 1684–1687. 81. Pardi, D.S., Loftus Jr., E.V., Kremers, W.K., Keach, J., Lindor, K.D., 2003, Gastroenterol.,

124, 889–893. 82. Serfaty, L., De Leusse, A., Rosmordiuc, O., Desalint, B., Flejou, J.F., Chazoulleres, O.,

Poupon, R.E., Poupon, R., 2003, Hepatology, 38, 203–209. 83. Alberts, D.S., Martìnez, M.E., Hess, L.M., Einspahr, J.G., Green, S.B., Bhattacharyya, A.K.,

Guillen, J., Krutzsh, M., Batta, A.K., Salen, G., Fales, L., Koonce, K., Parish, D., Clouser, M., Roe, D., Lance, P. 2005, J. Natl. Cancer Inst., 97, 846–853.

84. Marnett, L.J., Dubois, R.N., 2002, Annu. Rev. Pharmacol. Toxicol.,42, 55–80. 85. Eberhart, C. E., Coffey, R. J., Radhika, A., Giardiello, F. M., Ferrebach, S., Dubois, R. N.,

1994, Gastroenterol., 107: 1183–1188. 86. Sano, H., Kawahito, Y., Wilder, R.L., Hashiramoto, A., Mukai, S., Asai, K., Kimura, S., Kato,

H., Kondo, M., Hla, T., 1995, Cancer Res., 55, 3785–3789. 87. Masunaga, R., Kohno, H., Dhar, D.K., Ohno, S., Shibakita, M., Kinugasa, S., Yoshimura, H.,

Tachibana, M., Kubota, H., Nagasue, N., 2000, Clin. Cancer Res., 6, 4064–4068. 88. Sheng, H., Shao, J., Washington, M.K., Dubois, R.N., 2001, J. Biol. Chem., 276,

18075–18081. 89. Sonoshita, M., Takazu, K., Sasaki, N., Sugimot, Y., Ushikubi, F., Narumiya, S., Oshima, M.,

Taketo, M.M., 2001, Nature Med., 7, 1048–1051. 90. Pai, R., Tarnawski, A.S., Tran, T., 2004, Mol. Biol. Cell, 15, 2156–2163. 91. Giardiello, F.M., Hamilton, S.R., Kruch, A.J., Piantadosi, S., Hylind, L.M., Celano, P.,

Booker, S.V., Robinson, C.R., Offerhaus, J.A., 1993, N. Engl. J. Med., 328, 1313–1316. 92. Steinbach, G., Lynch, P.M., Phillips, R.K.S., Wallace, M.H., Hawk, E., Gordon, G.B.,

Wakabayashi, N., Saunders, B., Fujimura, T., Su, L.K., Levin, B., 2000, N. Engl. J. Med., 342, 1946–1952.

93. Das, D., Arber, N., Jankowski, J.A., 2007, Digestion, 76, 51–67. 94. Sebastian, S., Settleman, J., Reshkin, S.J., Azzariti, A., Bellizzi, A., Paradiso, A., 2006,

Biochim. Biophys. Acta, 1766, 120–139 95. Yarden, Y., MSliwkowski, M.X., 2001, Nat. Rev. Mol. Cell Biol. 2, 127–137. 96. Daub, H., Weuss, F.U., Wallasch, C., Ullrich, A., 1996, Nature 379, 557–560.

1276 Role of Bile Acids in Carcinogenesis of Gastrointestinal Tract

97. Carpenter, G., J. Cell Biol., 146 (1999) 697–702. 98. Reardon, D.B., Contessa, J.N., Mikkelsen, R.B., Valerie, K., Amir, C., Dent, P., Schmidt-

Ullrich, R.K., 1999, Oncogene,18, 4756–4766. 99. Warmuth, I., Harth, Y., Matsui, M.S., Wang, N., DeLeo, V.A., 1994, Cancer Res., 54,

374–376. 100. Bokemeyer, D., Schmitz, U., Kramer, H.J., 2000, Kidney Int., 58, 549–558. 101. Luttrell, L.M., Della Rocca, G.J., van Biesen, T., Luttrell, D.K., Lefkowitz, R.J., 1997, J. Biol.

Chem., 272, 4637–4633. 102. Kodama, H., Fukuda, K., Takahashi, T., Sano, M., Kato, T., Tahara, S., Hakuno, D., Sato, T.,

Manabe, T., Konishi, F., Ogawa, S., 2002, J. Molecular Cellular Cardiol., 34, 139–150. 103. Soltoff, S.P., 1998, J. Biol. Chem., 273, 23110–23117. 104. Andreev, J., Galisteo, M.L., Kranenburg, O., Logan, S.K., Chiu, E.S., Okigaki, M., Cary,

L.A., Moolenaar, W.H., Schlessinger, J., 2001, J. Biol. Chem., 276, 20130–20135. 105. Prenzel, M., Zwick, E., Daub, H., Leserer, M., Abraham, R., Wallasch, C., Ullrich, A., 1999,

Nature, 402, 884–888. 106. Mifune, M., Ohtsu, H., Suzuki, H., Nakashima, H., Brailoiu, E., Dun, N.J., Frank, G.D.,

Inagami, Higashiyama, T.S., Thomas, W.G., Eckhart, A.D., Dempsey, P.J., Eguchi, S., 2005, J. Biol. Chem. 280, 26592–26599.

107. Higashiyama, S., Nanba, D., 2005, Biochim. Biophys. Acta., 1751, 110–117. 108. Gschwind, A., Prenzel, N., Ullrich, A., 2002, Cancer Research, 62, 6329–6336. 109. Shida, D., Watanabe, T., Aoki, J., Hama, K., Kitayama, J., Sonoda, H., Kishi, Y., Yamaguchi,

H., Sasaki, S., Sako, A., Konishi, H., Nagawa, H., 2004, Lab. Invest., 84, 1352–1362. 110. Pai, R., Nakamura, T., Moon, W.S., Tarnawski, A.S., 2003, FASEB J., 17, 1640–1647. 111. Grant, K., Knowles, J., Dawas, K., Burnstock, G., Taylor, I., Loizidou, M. 2007, Br. J. Surgery,

94, 106–112. 112. Itoh, Y., Joh, T., Tanida, S., Sasaki, M., Kataoka, H., Itoh, K., Oshima, T., Ogasawara, N.,

Togawa, S., Wada, T., Kubota, H., Mori, Y., Ohara, H., Nomura, T., Higashiyama, S., Itoh, M., Cytokine, 29, 275–282.

113. Darmoul, D., Gratio, V., Devaud, H., Lehy, T., Laburthe, M., 2003, Am. J. Pathol., 162, 1503–1513.

114. Darmoul, D., Gratio, V., Devaud, H., Peiretti, F., Laburthe, M., 2004, Mol. Cancer Res., 2. 514–522.

115. Quao, L., Studer, E., Leach, K., McKinstry, R., Gupta, G., Decker, R., Kukreja, R., Valerie, K., Nagarkatti, P., Deiry, W.E.D., Molkentin, J., Schmidt-Ullrich, R., Fisher, P.B., Grant, S., Hylemon, P.B., Dent, P., 2001, Mol. Biol. Cell, 12, 2629–2645.

116. Yoon, J.H., Higuchi, H., Werneburg, N.W., Kaufman, S.H., Gores, G.J., 2002, Gastroenterol., 122, 985–993.

117. Werneburg, W.W., Yoon, J.H., Higuchi, H., Gores, G.J., 2003, Am. J. Physiol., 285, G31-G36.

118. Anwer, M.S., Engelking, L.R., Nolan, K., Sullivan, D., Zimniak, P., Lester, R., 1988, Hepatology, 8, 887–891.

119. Combettes, L., Berthon, B., Doucet, E., erlinger, S., Claret, M., 1989, J. Biol., Chem., 264, 157–167.

120. Raufman, J.-P., Zimniak, P., Bartoszko-Malik, A., 1998, Am. J. Physiol., 274, G997-G1004. 121. Raufman, J.P., Cheng, K., Zimnial, P., 2003, Digestive Disease Sciences, 48,1431–1444. 122. Cheng, K., JRaufman, J.P., 2005, Biochem. Pharmacol., 70, 1035–1047. 123. McCole, D.F., Keely, S.J., Coffey, R.J., Barrett, K.E., 2002, J. Biol. Chem., 277,

42603–42612. 124. Cheng, K., Xie, G., Raufman, J.P., 2007, Biochem. Pharmacol., 73, 1001–1012. 125. Shattuck-Brandt, R.L., Lamps, L.W., Heppner Goss, K.J., DuBois, R.N., Matrisian, L.M.,

1999, Mol. Carcinogenesis, 24, 177–187. 126. Wilson, C.L., Heppner, K.J., Labosky, P.A., Hogan, B.L., Matrisian, L.M., 1997, Proc. Natl.

Acad. Sci. USA, 94, 1402–1407.

128 H. Yasuda and F. Itoh

127. Keitel, V., Reinehr, R., Gatsios, P., Rupprecht, C., Göerg, B., Häussinger, D., Kubitz, R., 2007, Hepatology, 45, 695–704.

128. Katsuma, S., Hirasawa, A., Tsujimoto, G., 2005, Biochem. Biophys. Res. Comm., 329, 386–390.

129. Watanabe, M., SHouten, S.M., Mataki, C., Christoffolete, M.A., Kim, B.W., Sato, H., Messaddeq, N., Harney, J.W., Ezaki, O., Kodama, T., Schoonjans, K., ABianco, A.C., Auwerx, J., 2006, Nature, 439, 484–489.

130. Maruyama, T., Tanaka, K., Suzuki, J., Miyoshi, H., Harada, N., Nakamura, T., Miyamoto, Y., Kanatani, A., Tamai, Y. 2006, J. Endocrinol., 191, 197.

131. Vassileva, G., Golovko, A., Markowitz, L., Abbondanzo, S.J., Zeng, M., Yang, S., Hoos, L., Tetzloff, G., Levitan, D., Murgolo, N.J., Keane, K., Davis, H.R., Hedrick, J., Gustafson, E.L., 2006, Biochem. J., 398, 423.

132. Yasuda, H., Hirata, S., Inoue, K., Mashima, H., Ohnishi, H., Yoshiba, M. 2007, Biochem. Biophys. Res. Commun., 354: 154–159.

133. Blanchot-Jossic, F., Jarry, A., Masson, D., Bach-Ngohou, K., Paineau, J., Denis, M., Laboisse, C., Mosnier, J.F., 2005, J. Pathology, 207, 156–163.

134. Sinal, C.J., Tohkin, M., Miyata, M., Ward, J.M., Lambert, G., Gonzalez, F.J., 2000, Cell, 102, 731–744.

135. Maran, R.R., Thomas, A., Roth, M., Sheng, Z., Esterly, N., Pinson, D., Gao, X., Zhang, Y., Ganapathy, V., Gonzalez, F.J., Guo, G.L., 2009, J. Pharmacol. Exp. Ther., 328, 469–477,

136. Modica, S., Murzilli, S., Salvatore, L., Schmidt, D.R., Moschetta, A., 2008, Cancer Res., 68, 9589–9594.

137. Kok, T., Hulsebos, C.V., Wolter, H., Havinga, R., Agellon, L.B., Stellaard, F., Shan, B., Schwarz, M., Kuipers, F., 2003, J. Biol. Chem. 278, 41930–41937.

138. Kim, I., Morimura, K., Shah, Y., Yang, Q., Ward, J.M., Gonzalez, F.J., 2007, Carcninogenesis, 28, 940–946.

139. Yang, F., Huang, X., Yi, T., Yen, Y., Moore D.D., Huang, W., 2007, Cancer Res, 67, 863–867.

140. Inagaki, T., Moschetta, A., Lee, Y.K., Peng, L., Zhao, G., Downes, M., Yu, R.T., Shelton, J.M., Richardson, J.A., Repa, J.J., Mangelsdorf, D.J., Kliewer, S.A., 2006, Proc. Natl. Acad. Sci., 103, 3920–3295.

141. Duran-Sandoval, D., Mautino, G., Martin, G., Percevault, F., Barbier, O., Fruchart, J.C., Kuipers, F., Staels, B., 2004, Diabetes, 53, 890–898.

142. Ma, K., Saha, P.K., Chan, L., Moore, D.D., 2006, J. Clin. Invest., 116, 1102–1109. 143. Cariu, B., van Harmelen, K., Duran-Sandoval, D., van Dijk, T.H., Grefhorst, A., Abdelkarim,

M., Caron, S., Torpier, G., Fruchart, J.C., Gonzalez, F.J., Kuipers, F., Staels, B., 2006, J. Biol. Chem., 281, 11039–11049.

144. Yamauchi, T., Kamon, J., Wakim H., Terauchi, Y., Kubota, N., Hara, K., Mori, Y., Ide, T., Murakami, K., Tsuboyama-Kasaoka, N., Ezaki, O., Akanuma, Y., Gavrilova, O., Vinson, C., Reitman, M.L., H. Kagechika, Shudo, K., Yoda, M., Y. Nakano, Tobe, K., Nagai, R., Kimura, S., Tomita, M., Froguel, P., Kadowaki, T., 2001, Nature Med., 7, 941–946.

145. Wei, E.K., Giovanmucci, E., Fuchs, C.F., Wilett, W.C., Mantzoros, C.S., 2005, J.Natl.Cancer inst., 97, 1688–1694.

146. Fujisawa, T., Endo, h., Tomimoto, A., Sugiyama, M., Takahashi, H., Saito, S., Inamori, M., Nakajima, N., Watanabe, M., Kubota, N., Yamauchi, T., Kadowaki, T., Wada, K., Nakagama, H., Nakajima, A., 2008, Gut, 57, 1531–1538.

129M. Chatterjee and K. Kashfi (eds.), Cell Signaling & Molecular Targets in Cancer, DOI 10.1007/978-1-4614-0730-0_7, © Springer Science+Business Media, LLC 2012

Introduction: Cancer Etiology and Signal Transduction

Cancer risk is determined by a combination of environmental factors and genetic predisposition. The etiology of cancer has a multi-factorial origin in which several elements impact tumor initiation and development with different degrees of rele-vance. Some of the factors contributing to cancer development have physiological implications and integrate disorders in signaling molecules that either in circulation or in a more localized environment directly affect cellular growth and proliferation. It is well-established that these factors, related to the expressing levels of hormones, growth factors, and cytokines, display a major role in cancer etiology [ 1, 2 ] . There are also alterations in transducers and effectors that mimic these signaling mole-cules. Hence, to counteract the excess of signaling, several therapeutic strategies have been developed against specifi c intracellular signaling networks for which inhibitory agents are currently undergoing clinical testing [ 3 ] .

Another important factor that signifi cantly predisposes for cancer is the genetic background inherited. The study of familial cancers has allowed the discovery of specifi c mutations in genes that strongly increase the chances to develop cancer in those relatives who inherited them. Most of these genes are tumor suppressors and their mutations are associated with lack of expression or function. Another charac-teristic of these tumor suppressors is that they are frequently associated to the risk of cancer in specifi c tissues such as BRCA1 and BRCA2 in breast and ovary [ 4 ] , APC in colon [ 5 ] , among others.

J. Font de Mora (*) Laboratory of Cellular and Molecular Biology , Centro de Investigación Príncipe Felipe , Avenida Autopista del Saler 16, 46010 Valencia , Spain e-mail: jfont@cipf.es

Chapter 7 AIB1: A Transcriptional Coactivator Which Integrates Signaling Cross Talk in Cancer Cells

Macarena Ferrero and Jaime Font de Mora

130 M. Ferrero and J. Font de Mora

The level of contribution of environmental factors to cancer is more diffi cult to assess, although it is defi nitely very important, transuding with time in cancer development. Lifestyle, including diet and exercise [ 6 ] , smoking and stress [ 7 ] are among others of signifi cant infl uence that have come along with our current social habits.

Finally, there are factors related to other diseases, such as viral infections [ 8 ] , obesity [ 9, 10 ] , and other genetic disorders such as ataxia telangiectasia [ 11 ] and oth-ers. It is very diffi cult to defi ne how all of these factors contribute to cancer etiology, but what it is clear to researchers is that they all converge in chromosomal instability and eventually in alterations of the signal transduction pathways (see Fig. 7.1 ). An alteration of these pathways disables the cell to response adequately to other incom-ing signals. Cancer progression as a result of new modifi cations in the pathways that control transcriptional regulation, cell metabolism, proliferation, and survival is altered directing the cell to malignant transformation. Therefore, it is very important to understand these pathways and how they are altered in tumors in order to fi nd new therapeutic approaches to more effi ciently palliate each specifi c tumor.

Fig. 7.1 Cancer etiology and signal transduction pathways. Cancer etiology is infl uenced by mul-tiple diverse factors, all converging in chromosomal instability and alterations of signal transduc-tion pathways. Two of the most frequently altered pathways in cancer are the phosphoinositide 3-kinase PI3K/AKT pathway and the Ras/ERK pathway that regulate key cellular processes and physiology

1317 AIB1 is a Potential Therapeutical Target in Cancer Progression…

The Steroid Receptor Coactivator or p160 Family

The SRC proteins were fi rstly identifi ed as factors that interacted with ligand-bounded nuclear receptors and were able to enhance their dependent transcription.

Nuclear receptors (NRs), such as thyroid hormone receptors, retinoid receptors, or estrogen receptors comprise a large family of ligand-dependent and DNA sequence-specifi c transcription factors which are implicated in many aspects of the animal physiology, involving reproduction, development, and energy homeostasis. They also play important roles in the initiation, progression, and treatment of numer-ous diseases including cancer.

The activities of most NRs are regulated by small lipophilic molecules, includ-ing steroid/thyroid hormones, vitamin D3, and retinoids which fi nally control gene expression. Each type of ligand binds to and thereby activates one or a closely related set of a few nuclear receptor isoforms. Many NRs remain orphan receptors because they have no known ligand yet. On the other hand, it seems clear now that many receptors can infl uence transcription in the absence of ligand. Structurally, all members of the nuclear receptor family share a common structure with three major functional domains. The DNA-binding domain (DBD), in the middle region, is the most conserved one, and it is responsible for site-specifi c DNA binding at its response elements and for protein–protein interactions. The second most conserved domain is the transcriptional activation function 2 (AF-2), located at the carboxyl-terminal extreme . This region is composed of 12–13 alpha-helices folded into a globular structure and is responsible for ligand binding and aspects of homo-and/or hetero-dimerization. In some cases, it has the active conformation in the absence of ligand. Finally, within the amino-terminal extreme lies the transcriptional activation function 1 (AF-1). Unlike AF-2, AF-1 shows weak conservation and weaker transcriptional activity. This domain functions as a ligand-independent transcriptional activator and is responsible for interactions with proteins relevant to the transcription initiation such as TIFIIB and other accessory proteins. Although either AF-1 or AF-2 is able to regulate transcription alone, full transcriptional activity requires synergy between both domains. It is well understood that in order to orchestrate gene expression, NRs cooperate with several corregulators. Depending on the activating or suppressing effect of these corregulators upon gene transcription they are referred as coactivators or core-pressors respectively [ 12, 13 ] . The initial step in transcriptional coactivation is the release of nuclear receptor corepressors. In general, after ligand binding, the receptor undergoes a conformational change that results in dissociation from these corepressors and recruitment of a diverse set of coactivators and regulatory mol-ecules. Following this recruitment, the coactivator complex triggers chemical and structural modifi cations in the chromatin and communicates with the basal tran-scriptional machinery activating the gene transcription.

Among the broad spectrum of identifi ed coactivators, the proteins of the SRC family have been the most extensively studied. Three members comprise this family so far.

132 M. Ferrero and J. Font de Mora

They are: SRC-1/nuclear receptor coactivator 1 (NCoA1) [ 14 ] , SRC-2/nuclear receptor coactivator 2 (NCoA2)/transcriptional intermediary factor 2 (TIF2)/gluco-corticoid receptor interacting protein 1 (GRIP1) [ 15 ] and SRC-3/nuclear receptor coactivator 3 (NCoA3)/amplifi ed in breast cancer 1 (AIB1)/retinoid acid receptor-interacting protein 3 (RAC3)/acetyltransferase (ACTR)/thyroid hormone receptor-activated molecule 1 (TRAM-1) or p300/CBP-interacting protein (p/CIP) [ 16– 21 ] .

SRC proteins are encoded by different genes located in the human chromosomal regions 2p23, 8q21.1, and 20q12 [ 16, 22, 23 ] . These coactivators are about 160 KDa in size and share around 50–55% of sequence similarity and 43–48% of sequence identity.

Structurally (see Fig. 7.2 ), at the amino-terminal region, all three members contain a basic helix-loop-helix (bHLH) followed by a double PAS domain (Per/Ah receptor nuclear translocator/Sim domain) which is the most conserved region among the SRC proteins. This domain was initially identifi ed in Drosophila [ 24 ] and it was implicated in DNA binding and protein–protein interactions. Although SRCs can interact with some transcription factors independently of the bHLH/PAS domain, in other cases, this domain is required to interact and subsequently coactivate a few others, such as TEF-4, MEF-2C, and STAT5 [ 25– 27 ] . In addition, this domain can also contribute to the coactivation function by recruitment of downstream coactivators, including GAC63, CoCoA, Flightless 1, and ANCO1 [ 28– 31 ] .

The central region, which is relatively conserved, contains several LXXLL motifs (L = Leucine and X = any amino acid) also called NR boxes because they are respon-sible for interaction with ligand-bounded NRs. Structural analysis has revealed that the LXXLL motif forms an amphipatic a -helix when bounded to a groove in the AF-2 domain of the nuclear receptors. Several studies have shown that the LXXLL

Fig. 7.2 Structural domains of SRC proteins. The amino-terminal region contains the bHLH/PAS domain which is the most conserved domain; S/T, serine/threonine-rich regions; 1–9, LXXLL motifs; RID, nuclear receptor interaction domain; CID, CBP/p300 interaction domain; HAT, intrinsic histone acetyltransferase activity; squared yellow Q, glutamine-rich region; AD-1, activa-tion domain 1; AD-2, activation domain 2

1337 AIB1 is a Potential Therapeutical Target in Cancer Progression…

motif is necessary and suffi cient to mediate binding with NRs [ 32– 35 ] . However, not all the LXXLL motifs exhibit the same binding affi nity for different NRs [ 36 ] , suggesting that NRs show preferences over one coactivator or another. In fact, the LXXLL motif is necessary in the binding, but amino acids fl anking this core motif are important in nuclear receptor recognition [ 37 ] .

Within the carboxi-terminal region, there are two intrinsic transcriptional activa-tion domains, AD-1 and AD-2. A transcriptional activation domain is defi ned in transcriptional assays with reporter genes and fusion proteins containing the Gal4 DNA-binding domain and fragments of SRC proteins. AD-1 is responsible for interaction with histone acetyltransferases (HATs), such as CBP/p300, pCAF, and more recently GCN5 [ 38 ] . Interestingly, in this region, there are several LXXLL-like motifs which are different from those recognizing NRs. It has been demon-strated that directed mutagenesis in key residues of these motifs or deletion of the motifs impairs the recruitment of CBP/p300 and subsequently, the coactivation function of SRC factors [ 35, 39, 40 ] . This fact suggests the importance of CBP/p300 interaction for the function of SRCs. Furthermore, a weak HAT activity has been attributed to SRC-1 and AIB1 [ 17, 41 ] , raising the possibility that SRC family members may be directly involved in chromatin remodeling. Nonetheless, the importance of this activity still remains unclear. Recently, it has been observed that AIB1 and SRC-1 can acetylate ER81 in vitro (AIB1 also in vivo), but the degree is much lower than the acetylation by CBP/p300. Apparently, this acetylation does not contribute to the ER81 transcriptional activity, whereas acetylation by CBP/p300 is crucial [ 42 ] . The AD-2 region is responsible for interactions with histone methyl-transferases such as CARM-1 and PRMT1 which also play an important role in chromatin remodeling and basal transcriptional machinery assembly. Within this domain, AIB1 presents a polyglutamine-rich region. Although the biological sig-nifi cance of this repeat is not established, it has been observed that short polyglu-tamine genotypes promote aggressive malignant phenotypes of ovarian carcinomas [ 43 ] . On the other hand, there is no evidence for an increased risk of breast cancer in BRCA1; BRCA2 mutation carriers associated with the length of this glutamine chain in AIB1 [ 44, 45 ] .

Functionally, SRC coactivators have been proposed as bridge proteins among NRs and the basal transcriptional machinery. However, all three members are able to interact and coactivate not only NRs but also certain transcription factors, includ-ing AP-1 [ 46, 47 ] , nuclear factor-кB (NF-кB) [ 48– 50 ] , signal transducers and acti-vators of transcription (STATs) [ 27, 51– 53 ] , hepatocyte nuclear factors (HNFs) [ 54, 55 ] , mitogen-activated protein kinase (MAPK)-dependent transcription factors (Ets) [ 42, 56 ] , p53 [ 57 ] , and E2F1 [ 58 ] . This means that p160 proteins play a much broader role in cell regulation than originally expected. In this way, changes in the levels and activities of these coactivators may greatly affect the expression levels of many genes and, as a consequence, infl uence a great number of cellular processes.

The activities of SRC proteins can be regulated by a variety of post-translational modifi cations, including phosphorylations, ubiquitinations, sumoylations, methyla-tions, and acetylations (reviewed in 59 ] . In Table 7.1 , a summary of different AIB1-interacting proteins responsible for these modifi cations as well as for other cellular

134 M. Ferrero and J. Font de Mora

Tabl

e 7.

1 N

on-t

rans

crip

tiona

l fac

tors

that

inte

ract

with

AIB

1, r

egul

atin

g its

fun

ctio

n

Inte

ract

ing

prot

eins

Fu

nctio

n O

ther

s Fe

atur

es

Ref

eren

ces

GA

S SR

C-1

spe

cifi

c in

tera

ctio

n E

R a

coa

ctiv

ator

G

1/S

cell

cycl

e tr

ansi

tion

[ 211

] A

NC

AA

A

AA

+ A

TPa

se

ER

a c

oact

ivat

or

Faci

litat

es th

e as

sem

bly

of c

oreg

ulat

or

com

plex

es to

the

loca

l chr

omat

in

[ 212

]

Pin

1 Pe

ptid

yl is

omer

ase

NR

coa

ctiv

ator

M

odul

ates

AIB

1 co

activ

atio

n fu

nctio

n an

d re

gula

tes

its tu

rnov

er

[ 213

]

CH

IP

Ubi

quiti

n lig

ase

Dow

nreg

ulat

es S

mad

and

Tw

ist

Red

uces

tum

or g

row

th a

nd m

etas

tasi

s [ 1

66 ]

E6A

P U

biqu

itin

ligas

e In

tera

cts

with

AIB

1 ca

rbox

i-te

rmin

al e

xtre

me

in v

itro

Med

iate

s A

IB1

prot

easo

mal

deg

rada

tion

[ 214

]

SCF

Fbw

7 a

Ubi

quiti

n lig

ase

Ubi

quiti

nate

s K

723

and

K78

6 E

nhan

ces

ubiq

uitin

atio

n an

d ev

entu

al tr

ansc

rip-

tion-

coup

led

degr

adat

ion

of A

IB1

[ 62 ]

SUG

1 26

S pr

otea

som

e A

TPa

se

Inte

ract

s w

ith A

IB1

and

coac

tivat

es R

A ta

rget

ge

nes

[ 215

]

BR

CA

-IR

IS

Prom

otes

cel

l pro

lifer

atio

n du

ring

S-p

hase

In

tera

cts

with

AIB

1 an

d al

so w

ith

SRC

-1

Act

ivat

es c

yclin

D1

expr

essi

on

[ 178

]

Impo

rtin

a -3

N

ucle

ar s

huttl

ing

carr

ier

Med

iate

s nu

clea

r im

port

of

AIB

1 [ 2

16 ]

SIP

Cel

l gro

wth

reg

ulat

or

Sequ

este

rs S

RC

s pr

otei

ns in

the

cyto

sol a

nd

inhi

bits

est

roge

n-st

imul

ated

pro

lifer

atio

n of

m

amm

ary

carc

inom

a ce

lls

[ 217

]

NC

oA p

rote

ins

NR

coa

ctiv

ator

s N

CoA

pro

tein

s ar

e ab

le to

in

tera

ct e

ach

othe

r th

roug

h PA

S-B

dom

ain

Infl u

ence

s th

e fo

rmat

ion

and

recr

uitm

ent o

f th

e co

activ

ator

com

plex

to th

e ge

ne p

rom

oter

s [ 5

3 ]

1357 AIB1 is a Potential Therapeutical Target in Cancer Progression… In

tera

ctin

g pr

otei

ns

Func

tion

Oth

ers

Feat

ures

R

efer

ence

s

Kin

ases

and

pho

spha

tase

s p3

8 K

inas

e Ph

osph

oryl

ates

AIB

1, a

t lea

st in

pa

rt, i

n S8

60

Coa

ctiv

ates

RA

R a

-med

iate

d tr

ansc

ript

ion

and

afte

r, st

imul

ates

AIB

1 de

grad

atio

n [ 6

3 ]

GSK

3 K

inas

e Ph

osph

oryl

ates

S50

5 Sw

itche

s ub

iqui

tinat

ion

and

tran

scri

ptio

nal

coup

led

degr

adat

ion

of A

IB1

[ 62 ]

IKK

K

inas

e Ph

osph

oryl

ates

AIB

1 A

ctiv

ates

NF-

кB-m

edia

ted

tran

scri

ptio

n in

re

spon

se to

TN

F a a

nd a

lso

ER

-res

pons

ive

gene

s in

res

pons

e to

est

roge

ns

[ 50,

157

]

ER

K1/

2 K

inas

e Ph

osph

oryl

ates

in S

857

and

S860

Fa

cilit

ates

AIB

1 in

tera

ctio

n w

ith E

R

[ 147

] C

K1 d

K

inas

e Ph

osph

oryl

ates

S60

1 E

nhan

ces

inte

ract

ion

with

ER

a , c

oact

ivat

ion

capa

city

, and

pro

teas

omal

sta

bilit

y [ 6

4 ]

Abl

kin

ase

Kin

ase

Phos

phor

ylat

es Y

1357

Fa

vors

inte

ract

ion

with

ER

a a

nd p

300

[ 148

] PK

C z

Kin

ase

Phos

phor

ylat

es in

the

carb

oxi-

term

inal

reg

ion

Stab

ilize

s A

IB1

by in

hibi

ting

its in

tera

ctio

n w

ith th

e 20

S pr

otea

som

e [ 6

5 ]

PP-1

Ph

osph

atas

e D

epho

spho

ryla

tes

AIB

1 at

S10

1 an

d S1

02

Stab

ilize

s A

IB1

and

inhi

bits

its

activ

ity

[ 218

]

136 M. Ferrero and J. Font de Mora

functions is shown . Regarding degradation, it has been previously demonstrated that SRC family members are targets of the ubiquitin-proteasome system [ 60 ] and more recently that AIB1 can also be degraded in a ubiquitin and ATP-independent manner [ 61 ] . Furthermore, there are several factors that are involved in SRCs stabil-ity, such as subcellular distribution, phosphorylation by several kinases, including p38MAPK, GSK3, APKC, and CK1 d , methylation by CARM-1, etc. [ 62– 67 ] . The SRC family is well known for its oncogenic potential; hence, the study of all these factors affecting levels, activities, and subcellular distribution of p160 coactivators is of great importance as it may open new therapeutic approaches in cancer research.

Role of AIB1 in Physiology

Most of our current knowledge on the role of AIB1 in physiology has been given by the study of animal models. AIB1 is mainly expressed in tissues of strong response to endocrine hormones, suggesting that AIB1 displays an important role in endo-crine responsiveness. The study of the phenotypes developed by animal models re-enforces this hypothesis.

Role of AIB1 During Development

Genetic disruption of AIB1 in mice results in a pleiotropic phenotype showing dwarfi sm, delayed puberty, reduced female reproductive function, and blunted mammary gland development [ 68 ] . Reduced somatic growth and body size in AIB1-defi cient mice is the result of both altered regulation of IGF-I gene expression in specifi c tissues and a defect of response to IGF-I [ 69 ] . In contrast, no alterations in somatic growth and fertility are observed in SRC-1 knockout mice [ 70 ] . All these results support that the physiological role of AIB1 is different from that of SRC-1 and proof the functional diversity among coactivator family members. In prostate cancer cells, it was observed that AIB1 overexpression resulted in increased AKT (or protein kinase B – PKB)/mTOR signaling activation and cell growth in a ste-roid-independent manner [ 71 ] . However, downregulation of AIB1 expression by small interfering RNA decreased cell growth, leading to a smaller cell size. Similarly, in AIB1 null mutant mice, AKT signaling is downregulated in those tissues that would normally express AIB1 in wild-type mice. Furthermore, AIB1 overexpres-sion in the mammary epithelium increases mammary IGF-I mRNA and serum IGF-I protein levels together with the activation of the IGF-I receptor and downstream signaling molecules [ 72 ] . On the contrary, IGF-I circulating levels were reduced in AIB1 −/− mice, although IGF-I mRNA levels were not affected [ 68 ] . Low IGF-I lev-els in AIB1 −/− mice were the result of a rapid degradation of IGF-I. In the absence of AIB1, transcription of the vitamin D receptor (VDR)-target gene IGF-binding

1377 AIB1 is a Potential Therapeutical Target in Cancer Progression…

protein 3 (IGFBP3) was reduced, resulting in the instability of IGF-I [ 73 ] . Both, acid-labile subunit (ALS) and IGF-binding proteins form complexes with IGF-I to maintain its circulating concentration and endocrine function. But in AIB1 knock-out mice, IGFBP3 was specifi cally affected and not ALS or growth hormone (GH). Taken together, these results suggest that AIB1 is an important modulator for mam-malian cell growth and that IGF-I signaling is an important effector of its physiolog-ical function.

Role of AIB1 in Reproductive Tissues

Knockin mice expressing b -galactosidase in one of the AIB1 alleles demonstrated that it is specifi cally expressed in oocytes and its total ablation is very probably the cause of the low estrogen levels in females [ 68 ] . AIB1 −/− females display delayed development of the reproductive functions. In contrast, mice lacking TIF2 have impaired fertility in both sexes [ 74 ] . Hypofertility in TIF2 −/− males is due to defects in both spermiogenesis (teratozoospermia) and age-dependent testicular degenera-tion. TIF2 expression appears to be essential for adhesion of Sertoli cells to germ cells. Female hypofertility is due to a placental hypoplasia that most probably refl ects a requirement for maternal TIF2 in decidua stromal cells that face the devel-oping placenta.

The progesterone receptor has shown to be an essential mediator of female fer-tility and development of reproductive tissues [ 75 ] . A transgenic mouse model that utilizes a progesterone receptor (PR) activity indicator (PRAI) system was very useful to defi ne dynamic regulation of PR activity in vivo [ 76 ] . The study revealed the spatiotemporal activation of PR in female reproductive tissues. Importantly, PRAI mice under the genetic background of AIB1 −/− showed that PR distinctly coordinates the p160 transcriptional coactivators in the different tissues [ 77 ] . Whereas AIB1 is the primary coactivator for PR in the breast, SRC-1 is the pri-mary coactivator for PR in the uterus. Selective abrogation of TIF2 in PR express-ing cells showed to be an indispensable coregulator for uterine and mammary gland responses that require progesterone [ 78 ] . In the absence of TIF2, uterine cells posi-tive for PR were incapable of facilitating embryo implantation, a necessary fi rst step toward the establishment of the materno-fetal interface. Importantly, such an implantation defect is not exhibited by knockouts for SRC-1 or AIB1, underscor-ing the unique coregulator importance of TIF2 in peri-implantation biology. Moreover, despite normal levels of PR, SRC-1, and AIB1, progesterone-dependent branching morphogenesis and alveologenesis fails to occur in the murine mam-mary gland in the absence of TIF2, thereby establishing a critical coregulator role for TIF2 in signaling cascades that mediate progesterone-induced mammary epi-thelial proliferation. Finally, the recent detection of TIF2 in the human endome-trium and breast suggests that this coregulator may also represent a new clinical target for the future management of female reproductive health and/or breast cancer.

138 M. Ferrero and J. Font de Mora

Role of AIB1 in the Central Nervous System

In the brain, AIB1 is expressed in the olfactory bulb and the hippocampus as well as SRC-1 and at lower levels TIF2. However, SRC-1 is also highly expressed in the piriform cortex, amygdala, hypothalamus, cerebellum, and brainstem. Importantly, disruption of SRC-1 specifi cally delays the Purkinje cells development and matura-tion in early stages and results in moderate motor dysfunction in adulthood [ 79 ] . In the nervous system, AIB1 and the other p160 coactivator family members display different functions depending on the cell type. In response to glucocorticoids, the glucocorticoid receptor (GR) differentially recruits p160 family members: In Schwann cells, GR recruits SRC-1a, SRC-1e (two distinct SRC-1 isoforms differing in their C-terminal region [ 80 ] ), or AIB1, whereas in astrocytes, GR recruits SRC-1e and TIF2, and to a lesser extent AIB1 [ 81 ] . This can be explained by the different intra-cellular distribution of the p160 coactivators. For example, within astrocytes, SRC-1 and TIF2 were mainly nuclear, whereas AIB1 unexpectedly localized to the lumen of the Golgi apparatus. In contrast, in Schwann cells, SRC-1 showed a nucleocyto-plasmic shuttling depending on hormonal stimulation, whereas TIF2 remained strictly nuclear and AIB1 remained predominantly cytoplasmic. Altogether, these results highlight the cell specifi city and the time dependence of p160s recruitment by the activated GR in glial cells, revealing the complexity of GR-p160 assembly in the nervous system [ 82 ] .

In a T3-1 pituitary cells, treatment with gonadotropin-releasing hormones induced progesterone receptor phosphorylation and translocation to the nucleus. Further transactivation of progesterone responsive genes required the recruitment of AIB1 to the activated PR transcriptional complexes, thus demonstrating the essen-tial role of AIB1 in these pituitary cells [ 83 ] . Noteworthy, nuclear overexpression of AIB1 occurs in proliferative prolactinoma cells concomitantly with estrogen recep-tor a (ER a ) and aromatase positivity [ 84 ] , suggesting a novel mechanism whereby the abnormal high conversion of testosterone to estradiol is mediated by aromatase in these pituitary cells, upregulating AIB1 expression and or function, and leading to an increase in lactotroph proliferation.

Role of AIB1 in Energy Homeostasis

AIB1 has been shown to control the metabolism resulting from increased mitochon-drial function and energy expenditure as a consequence of activation of PGC-1 a [ 85 ] . In this way, PGC-1 a is an essential effector of AIB1 function, controlling mitochondrial function and energy homeostasis. Mechanistically, AIB1 regulates the expression of GCN5, the only acetyltransferase known to acetylate PGC-1 a and consequently inhibiting its activity. Importantly, caloric ingestion induces AIB1 expression , resulting in the inhibition of PGC-1 a and energy expenditure. On the

1397 AIB1 is a Potential Therapeutical Target in Cancer Progression…

contrary, caloric restriction reduces AIB1 levels leading to enhanced PGC-1 a activity and energy expenditure. Collectively, these data suggest that SRC-3 is a critical link in a cofactor network that uses PGC-1 a as an effector to control mito-chondrial function and energy homeostasis. In addition, AIB1 is a critical regulator of white adipocyte development [ 86 ] . In the absence of AIB1, adipocyte differentia-tion is impaired, reducing the transactivation capacity of the transcription factor CCAAT/enhancer-binding protein (C/EBP) and decreasing the expression levels of PPAR

g 2. Similarly, gene ablation studies previously identifi ed SRC-1 and TIF2 as

being involved in the control of energy homeostasis [ 87 ] . However, whereas TIF2 −/− mice are protected against obesity and display enhanced adaptive thermogenesis, SRC-1 −/− mice are prone to obesity due to reduced energy expenditure. A genomic approach using microarray analysis demonstrated that the molecular targets of TIF2 in the liver stimulate fatty acid degradation and glycolytic pathway, whereas fatty acid, cholesterol, and steroid biosynthetic pathways were downregulated [ 88 ] . These fi ndings strongly support the idea that gene expression changes are specifi c for each coactivator and non-overlapping in the liver.

Role of AIB1 in Other Tissues

Another target of AIB1 is the thyroid hormone receptor beta (TR b ). Mutations in the TR b develop thyroid hormone resistance and impaired growth. A novel mouse model harboring a mutation in TR b (TR b PV mice) previously found to cause resistance to thyroid hormone (RTH) in humans faithfully reproduces RTH of humans. Interestingly, depletion of AIB1 in this mouse model partially rescued dysfunction of the pituitary-thyroid axis, but growth impairment was worsened [ 89 ] . The lack of AIB1 reduced the growth of both the pituitary and the thyroid in TR b PV mice, thereby lessening the dysregulation of the pituitary-thyroid axis. In contrast, the lack of AIB1 exacerbated the growth impairment observed in TR b PV mice. The modulatory effect of AIB1 on growth is mediated via the IGF-1/PI3K/AKT/mTOR signaling pathway. This dual action in the pituitary-thyroid axis and in growth can be explained by two mechanisms, one via its role as a receptor coregulator and the other via its growth regulatory role through the IGF-I/PI3K/AKT/mTOR signaling.

AIB1 is also expressed in vascular smooth muscle cells and endothelial cells, and its defi ciency in knockout mice reveals its role in the inhibition of neointimal growth, suggesting its ER-dependent vasoprotective effects under conditions of vascular trauma [ 90 ] .

An important physiological role of AIB1 has also being described in the infl am-matory process. In macrophages, AIB1 has a novel cytoplasmic function by which activates the translational silencers TIA-1 and TIAR and thus inhibits the translation of proinfl ammatory cytokines [ 91 ] . The observation was originally made in AIB1 −/− macrophages that produced signifi cantly more proinfl ammatory cytokines, such as

140 M. Ferrero and J. Font de Mora

TNF- a , IL-6, and IL-1 b , in response to induced endotoxicity, although the mRNA levels remained the same. Hence, AIB1 displays a protective action against the lethal endotoxic shock triggered by an acute infl ammatory response.

Based on the observations made in AIB1 −/− mice, hematopoyesis is also affected. AIB1 regulates lymphopoiesis by inhibiting proliferation of lymphocytes. Absence of AIB1 decreases platelet and increases lymphocytes numbers, leading to the development of malignant B-cell lymphomas upon aging [ 92 ] . Lymphoid lineage derived from knockout mice displays constitutive activation of NF k B due to increased I k B kinase and consequently lower I k B levels, activations that can be reversed upon ectopic expression of AIB1. Therefore, taken all together, AIB1 exerts multiple functions depending on the cell type, causing proliferation and pre-venting from apoptosis in certain types like in the epithelial and inhibiting prolifera-tion in others like in lymphoid cells.

Overexpression of AIB1 Affects Both Cancer Initiation and Progression

Among the three coactivators of the SRC family, AIB1 has received more attention because compelling evidences demonstrate that this coactivator is a new oncogene intervening in both initiation and progression of cancer.

Evidences from Biopsies and Animal Models

AIB1 has been implicated in the pathogenesis of a number of malignancies, includ-ing breast cancer, endometrial cancer, prostate cancer, ovarian cancer [ 16, 106– 115 ] , urothelial cancer [ 93 ] , nasopharyngeal cancer [ 94 ] , esophageal squamous cell car-cinoma [ 95, 96 ] , colorectal cancer [ 97– 100 ] , hepatocellular carcinoma [ 101 ] , pancre-atic carcinoma [ 102, 103 ] , gastric cancer [ 104 ] , and cutaneous melanoma [ 105 ] .

The fi rst indication that AIB1 might confer an advantage in cell growth came from Anzick et al. They examined AIB1 copy number by fl uorescence in situ hybridization (FISH) in a series of ER-positive and ER-negative breast cancer cell lines and found that AIB1 was amplifi ed in four of fi ve ER-positive cell lines and none of six ER-negative [ 16 ] . Through Northern blotting assays, AIB1 was seen highly overexpressed in the cell lines which showed amplifi cation but also in cell lines without amplifi cation of the gene. In contrast, the levels of SRC-1 and GRIP1 remained constant. They also evaluated 105 specimens of breast cancer for FISH and found amplifi cation of AIB1 in 9.5% of the cases. However, the amplifi cation was not as high as in the cell lines. In these specimens, overexpression was observed in overall 64%, suggesting that overexpression without amplifi cation of a gene was possible in breast cancers. They also demonstrated that AIB1 overexpression

1417 AIB1 is a Potential Therapeutical Target in Cancer Progression…

increased ER-dependent transactivation in a dose-dependent manner. In a larger study, Bautista et al. observed amplifi cation of AIB1 gene in 56 of 1,157 breast tumors (4.5%). They also analyzed 122 ovarian tumors fi nding a 7.4% of amplifi ca-tion [ 106 ] . Interestingly, a splice variant of AIB1 that lacks the bHLH domain and a proportion of the PAS domain (AIB1-Delta3 isoform) has also been observed overexpressed in breast cancer biopsies and in the breast cancer derived cell line MCF-7. This isoform has an enhanced effi cacy activating nuclear receptors as well as potentiating EGF signaling compared to the full-length AIB1 [ 107 ] . There are more studies that show amplifi cation and overexpression of AIB1 not only in breast tumors but also in endometrial, ovarian, and prostate carcinomas, including prostate cancer cell lines, such as LNCaP and prostate stromal cells where AIB1 is an impor-tant androgen receptor (AR) coactivator and may have a role in the progression of prostate cancer [ 108– 112 ] .

In general, malignant tumors are classifi ed according to their size, grade of dif-ferentiation from their parental tissues, degree of spread to regional lymph nodes, and presence of metastasis. Tumors with high grade show little differentiation and poor prognosis. Interestingly, high expression of AIB1 has been correlated with poor patient outcome [ 113 ] . In line with this, breast tumors that show high levels of AIB1 have signifi cantly shorter disease-free and overall survival times after surgery [ 114 ] . Similarly, it has been observed in endometrial carcinomas a correlation between AIB1 expression and clinical stage, myometrial invasion and dedifferentia-tion [ 115– 118 ] . In ovarian cancer, Han et al . found a 36% of tumors with AIB1 overexpressed. They also observed high expression in poorly differentiated tumors at late stage and tumors with lymph node involvement [ 119 ] . These observations suggest that AIB1 may play a role in cancer progression.

Amplifi cation and overexpression of AIB1 is not restricted to endocrine tumors; there are also increased copy number and/or high levels of this coactivator in non-endocrine sensitive tumors, such as pancreatic and gastric cancer [ 103, 104 ] , esoph-ageal squamous cell carcinomas [ 95, 96 ] , nasopharyngeal carcinomas [ 94 ] , colorectal carcinomas [ 97– 100 ] , hepatocellular carcinomas [ 101 ] , and cutaneous melanomas [ 105 ] . Henke et al. examined a series of pancreatic tissues and also observed high expression levels of AIB1 as malignancy staged. High levels of both mRNA and protein existed in pancreatic adenocarcinomas. Interestingly, AIB1 staining was located within the nucleus, whereas some cytoplasmic protein was also found in normal epithelia and low grade intraepithelial pancreatitis. Amplifi cation of AIB1 gene was found in 37% of pancreatic adenocarcinomas [ 102 ] . In general, there is an association between AIB1 overexpression and tumor staging. All these fi ndings suggest that AIB1 overexpression may be important in the acquisition of an invasive and/or metastatic phenotype, and hence, AIB1 could be used as a marker to predict prognosis in cancer.

The development of animal models has improved our understanding of AIB1 and its role in cancer progression. Torres-Arzayus et al. established an AIB1 transgenic mouse under the control of the mouse mammary tumor virus (MMTV)/long termi-nal repeat (LTR) promoter/enhancer. They observed a more extensive degree of ductal branching, larger size of the cells, higher BrdU-positive cells, and less number

142 M. Ferrero and J. Font de Mora

of epithelial cells undergoing apoptosis in the transgenic (tg) mammary glands than in the wild-type (WT) glands. At 5 months of age, mammary glands of tg mice showed numerous hyperplastic lesions. These tg mice presented more tumor inci-dence than WTs. Tumors developed not only in breast but also in other organs, including lung, pituitary, and uterus, supporting the hypothesis that AIB1 was indeed involved in a wide range of cancers. Analysis of the mammary glands revealed that AIB1 activated PI3K/AKT/mTOR signaling pathway by increasing IGF-I circulating levels [ 72 ] . Therefore, it seemed that AIB1 was a potent oncogene and that the mechanism of its oncogenicity might involve the PI3K/AKT/mTOR signal transduction pathway. A transgenic mouse harboring the AIB1-Delta3 iso-form was also generated [ 120 ] . Expression of the isoform in transgenic mice was driven by the human cytomegalovirus immediate early gene 1 ( h CMVIE1) pro-moter. Although no tumors were seen, mice showed increased mammary prolifera-tion and gland mass together with increased expression levels of cyclin D1, IGF-IR, and C/EBP b liver-enriched inhibitory protein (LIP) isoform. These results sug-gested that AIB1 worked through different pathways. Avivar et al. created a mouse model which expressed moderate levels of AIB1 to analyze its role during the fi rst steps of cancer [ 121 ] . Similarly to the AIB1-Delta3 tg mice, these mice did not generate tumors. However, they displayed mammary hyperplasia at the onset of puberty. Interestingly, primary mammary epithelial cultures derived from these mice presented enhanced proliferation and augmented levels of cyclin D1 and E-cadherin. Therefore, overexpression of AIB1 may represent one of the pre-neo-plastic changes in breast tissue.

On the other hand, the lack of AIB1 in mice has been studied as well. The (MMTV)/ v -Ha- ras (ras) transgenic mouse is a model with high frequency of mam-mary carcinomas. The lack of AIB1 in this transgenic mouse delays mammary tumor latency, reduces mammary tumor frequency, and suppresses primary tumor growth and metastasis to the lung [ 122 ] . Palpable breast tumors were fi rst observed in AIB1 +/+ -ras and AIB1 +/− -ras at ages 14 and 18 weeks, respectively, whereas the fi rst tumor in AIB1 −/− -ras was observed much later, at 40 weeks. Moreover, only 17% of AIB1 −/− -ras mice presented focal lung tumors compared to 39% of AIB1 +/− -ras and 42% of AIB1 +/+ -ras mice. Cell lines generated from the mammary tumors of AIB1 +/+ -ras and AIB1 −/− -ras mice showed less migration ability and reduced levels of IRS-1 and IRS-2 when AIB1 was deleted. The MMTV-Neu/AIB1 +/− or AIB1 −/− mice also present tumor latency delayed and protection from tumorigenesis [ 123 ] . Furthermore, in another study, it is reported that AIB1-knockout mice treated with the carcinogen 7,12-dimethylbenz[ a ]anthracene (DMBA) show mammary ductal morphogenesis and delayed onset of palpable tumors in comparison with WT rodents [ 124 ] . Hence, AIB1 defi ciency protects against DMBA-induced tumorigen-esis. Levels of IRS-1, IRS-2, p-AKT, and cyclin D1 were augmented in DMBA-induced WT tumors but not in DMBA-induced AIB1 −/− tumors. The results revealed that AIB1 was required for IGF/PI3K/AKT signaling pathway-stimulated upregula-tion of cyclin D1 during DMBA-induced breast tumor initiation and progression. The role of AIB1 defi ciency has also been studied in prostate and thyroid cancer

1437 AIB1 is a Potential Therapeutical Target in Cancer Progression…

using TRAMP or TR b PV/PV mice models, respectively. In the case of TRAMP mice, loss of AIB1 signifi cantly prolonged life and suppressed tumor progression. WT/TRAMP mice presented poor differentiated prostate adenocarcinomas at 30 weeks, whereas AIB1 −/− /TRAMP mice only formed early stage well-differentiated adeno-carcinomas [ 125 ] . Unlike AIB1, loss of SRC-1 does not suppress either prostate cancer tumorigenesis or metastasis in the SRC-1 −/− /TRAMP mice probably due to a compensation of AIB1 overexpression [ 126 ] . In TR b PV/PV rodents, the lack of AIB1 triggered a decrease in genes involved in cell cycle progression, including E2F1, Cdk2, Cdc6, and Cdc25a phosphatase. Due to this fact, thyroid carcinogenesis was delayed. Moreover, AIB1 −/− /TR b PV/PV mice did not develop either vascular invasion or metastasis [ 127 ] .

Cell models provide also useful information complementary to the one obtained with animal models. MCF10 cell line is an ER-negative, spontaneously immortal-ized, non-transformed human mammary epithelial cell line that has been exten-sively used to evaluate the activity of a great number of oncogenes. MCF10 infected with adenovirus expressing AIB1 displayed high frequency of colony formation in agar plates, while no colony was observed in the control infected with adenovirus expressing GFP [ 128 ] . Hence, this result is in accordance with animal model observations.

Altogether, clinical studies, animal models, and cellular models reveal a clear oncogenic ability for AIB1. Therefore, factors which infl uence cellular levels and activity of this p160 family member could be of great importance in determining the potential for growth and transformation of a tissue.

Mechanisms of AIB1 Oncogenic Activity

Hormone-Dependent Mechanisms: The Steroid Receptor Signaling

Sex hormones or sex steroids, such as estrogen, androgen, and progesterone, affect the growth and function of reproductive organs, the development of sex characteris-tics, and the behavioral patterns of animals. However, they are also implicated in diseases, including breast, ovarian, endometrial, and prostate cancer. In line with this, Lathrop and Loeb found that an early ovariectomy prevented tumor incidence in a great number of mice because it eliminated sex steroids production [ 129 ] . Since sex steroids mediate their function through nuclear receptors and AIB1 is a NR coactivator, it is reasonable to think that overexpression of AIB1 together with a high exposition to steroids results in more NR activity (Fig . 7.3 ). Supporting this idea in breast cancer, AIB1 amplifi cation and overexpression have been correlated with ER and PR positivity [ 106, 112, 130, 131 ] . It has been demonstrated that AIB1 and ER can be associated and, in fact, colocalize to the nuclei of ER-positive cells [ 132 ] . Furthermore, AIB1 is required for ER-binding to its target gene promoters. Treatment with 17- b -estradiol induces a dramatic increase in occupancy of both ER a

144 M. Ferrero and J. Font de Mora

and AIB1 at the CATD, pS2, and c-Myc gene promoters in MCF-7 cells [ 133 ] , and in contrast, suppression of AIB1 with small interference RNA decreases the association between ER and promoters [ 134 ] . Hence, it is hypothesized that AIB1 is involved in cancer progression by overstimulating ER function. Accordingly, it has been observed that during breast cancer tumorigenesis there is a signifi cant

Fig. 7.3 Schematic view of major signaling pathways converging on AIB1. AIB1 can stimulate PI3K/AKT signaling by increasing expression levels of several components of the pathway as well as enhance HER2/Neu pathway by augmenting its phosphorylated levels (not represented in the fi gure). Phosphorylation of AIB1 is necessary for its activity. Steroids, cytokines, and growth fac-tors can induce AIB1 phosphorylation. Once activated, it will be able to interact and coactivate a variety of transcription factors. In response to estrogens, AIB1 can be recruited to the estrogen-responsive regions in target genes and stimulating cell cycle progression. Estrogen treatment facili-tates the association of IKK a , ER a , and AIB1 to estrogen-responsive promoters and increases IKK a -mediated phosphorylation of ER a , AIB1, and histone H3. Alternatively, growth factor stimulation triggers ER and/or AIB1 phosphorylation, resulting in ER-mediated activation of cell proliferation independently of estrogens, developing resistance to endocrine therapy. Signal stimu-lation by cytokines activates the IKK complex and leads to phosphorylation of I k B as well as to nuclear localization of AIB1. In this sense, cytokines can enhance activities of both NF- k B and steroid receptor pathways. In addition, AIB1 also interacts and coactivates Ets and AP-1 transcrip-tion factors to stimulate the expression of MMPs which will subsequently allow the invasion of peripheral tissues. Noteworthy, HER2/Neu promoter is a target for Ets and AP-1; therefore, AIB1 might also increase its expression, promoting cell proliferation and generating again endocrine resistance. Finally, AIB1 is able to enhance transcription of E2F1-responsive genes, including cyclin E, cyclin A, Cdk2, AIB1, and E2F1 itself. AIB1 potentiates cell cycle progression and establishes a positive feedback loop with E2F1

1457 AIB1 is a Potential Therapeutical Target in Cancer Progression…

upregulation of ER signaling in ER-positive tumors. This is due to an increased ER expression along with increased levels of factors that might activate ER function [ 135 ] . Interestingly, AIB1-Delta3 isoform has an enhanced effi cacy coactivating ER a compared to AIB1 full-length probably because it is more available to NR when bHLH/PAS domain is lost. Tumors that overexpress this isoform might have more estrogenic stimulation of proliferation [ 136 ] . On the other hand, AIB1 deple-tion reduces estrogen-dependent proliferation of MCF-7 cells by decreasing the ability of estrogen to inhibit apoptosis [ 137 ] . Unlike AIB1, the role of SRC-1 in breast cancer seems to be less pronounced because SRC-1 is unable to compensate AIB1 loss [ 137 ] . Noteworthy, it has been demonstrated that SRC-1 interacts less with ER than AIB1 after estrogen treatment in MCF-7 cells [ 138 ] . Thus, AIB1 might have a specifi c role in mediating estrogen-dependent transcription in breast cancer. Of interest, another major ER downstream target gene to promote cell cycle in breast cancer cells is cyclin D1 [ 139 ] . AIB1 along with ER can be recruited to the estrogen-responsive cyclin D1 promoter to enhance cyclin D1 expression and hence, cell proliferation [ 140 ] .

Taken all together, these observations suggest that overexpression of AIB1 might contribute to tumorigenesis by overstimulating steroid receptor-mediated transacti-vation. However, while it is likely that increased levels of AIB1 contribute to cancer progression through this mechanism in endocrine tumors, AIB1 overexpression has also been observed in ER-, PR-, and AR-negative tumors and cancer cell lines [ 141, 142 ] , indicating that hormone-independent mechanisms exist in the process of can-cer in response to AIB1.

Hormone-Independent Mechanisms

Many facts support the idea that AIB1 is involved in tumorigenesis via several sig-naling pathways: (1) AIB1 has the ability to interact and coactivate not only steroid-responsive nuclear receptors but also non-responsive nuclear receptors and other transcription factors, (2) its overexpression does not always correlate with ER or PR expression but instead correlates with HER2/Neu, and (3) AIB1 has been found amplifi ed and overexpressed in a number of hormone-independent cancers. It is hence reasonable to believe that AIB1 might perturb signal integration by multiple transduction pathways other than steroid receptor signaling .

During the last years, extensive efforts have been done to study the importance of AIB1 as a non-steroid receptor coactivator in cell growth, cell proliferation, and tumor development. So far, AIB1 has been observed to affect several signal trans-duction pathways, including IGF-I/Phosphatidylinositol 3-Kinase (PI3K)/AKT, HER2/Neu, NF-кB, and E2F1 signaling pathways.

The IGF/PI3K/AKT Signaling Pathway

The binding of the insulin-like growth factor 1 (IGF-I) to its receptor (IGF-IR) initi-ates signaling via the insulin receptor substrates (IRS-1 and IRS-2) which associate

146 M. Ferrero and J. Font de Mora

to and activate several intracellular kinases including PI3K. Once activated, PI3K phosphorylates the membrane phospholipid phosphatidylinositol 4,5-bisphosphate (PIP

2 ) to phosphatidylinositol 3,4,5-trisphosphate (PIP

3 ) creating a binding site for

the kinases PDK-1 and AKT. PDK-1 then triggers AKT phosphorylation, and in turn, activated AKT directly or indirectly phosphorylates a great number of sub-strates, including glycogen synthase kinase-3 b (GSK3 b ), mammalian target of rapamycin (mTOR), p70S6K, caspase 9, BAD, and a few others to control pro-cesses, such as metabolism, cell survival, and cell proliferation [ 143 ] .

Animal models, human tumors, and cell lines have demonstrated that AIB1 is involved in the regulation of AKT activity. There is a correlation between AIB1 and the expression levels of components of the IGF-I/PI3K/AKT signaling path-way. Mammary glands of AIB1 transgenic mice show high levels of phosphory-lated IGF-IR and AKT indicating that PI3K/AKT pathway is more active in these animals [ 72 ] . The increased activity is due to an augment in the circulating levels of IGF-I. Interestingly, CMV-AIB1-Delta3 mice also display increased IGF-IR expression [ 120 ] . On the other hand, deletion of AIB1 in mice results in growth retardation as well as in overall reduction of IGF-I levels [ 68, 69, 71 ] . Wang et al. found a 30–50% decrease of IGF-I levels in AIB1 null rodents. Xu et al . registered a similar reduction (40%) with unaltered growth hormone levels. In addition, whereas no signifi cant differences were found in IGF-IRß levels, levels of IGF-I, IRS-1, and IRS-2 were signifi cantly reduced in MMTV-AIB1 −/− -ras tumors com-pared to MMTV-AIB1 +/+ -ras or MMTV-AIB1 +/− -ras tumors [ 122 ] . In human pros-tate cancers, strong AIB1 expression correlated with signifi cant higher rate of proliferation and high p-AKT levels [ 142 ] . Results in cell lines agree with those from biopsies and animal models. One study found a decrease in IGF-I-induced colony formation after AIB1 depletion in the human breast cancer cell line MCF-7 [ 144 ] . Cyclin D1, Bcl-2, ERK2, IGF-IR, and IRS-1 expression levels were also reduced, even in the presence of anti-estrogens, suggesting that AIB1 activity was important to maintain AKT signaling independently of its role in ER-dependent signaling in the breast cancer. In the prostate cancer cell lines LNCaP and PC3, AIB1 overexpression promotes cell growth by augmenting AKT activity [ 71 ] . Additional increase in AKT activity is not observed when LNCaP cells are treated with androgens indicating that AIB1 functions through steroid-independent path-ways to regulate AKT activity. In contrast, AIB1 downregulation results in reduced cellular size and decreased AKT activity in these cells. Accordingly, overexpres-sion of AIB1 in LNCaP cells reveals augmented expression levels of several com-ponents of the PI3K/AKT pathway, including IGF-I, IGF-II, IRS-1, IRS-2, PIK3CA, and AKT1, whereas AIB1 depletion produces a decrease of these pro-teins [ 47 ] . Noteworthy, AIB1 is recruited to the promoter regions of IGF-I, IGF-II, IRS-1, IRS-2, PIK3CA, AKT1, and Bcl-2, suggesting a direct function of AIB1 in the transcription of these genes.

These observations demonstrate that AIB1 is required for IGF-I-dependent cell proliferation and survival in breast and prostate cancers. AIB1 opens another way of promoting cell growth independently of steroid hormones, suggesting that over-expression of AIB1 may play a role in endocrine resistance through enhancing growth factor signaling and reveals a new platform for cancer therapy.

1477 AIB1 is a Potential Therapeutical Target in Cancer Progression…

The ErbB/HER Signaling Pathway

In oncology, the HER family or ErbB family is one of the most important tyrosine kinase signaling networks. The HER family, also known as the epidermal growth factor receptor (EGFR) family, is composed of four main members. These recep-tors are well-known mediators of cell proliferation, differentiation, migration, and apoptosis [ 145 ] . The activation of HER receptors by the epidermal growth factors (EGFs) initiates a signal transduction cascade that ultimately leads to gene expression.

A correlation between overexpression of AIB1 and HER2/Neu positivity in breast tumors has been observed [ 141, 146 ] . Interestingly, AIB1 is a target of the EGFR/HER-downstream activated kinases, such as ERK1/2 and c-Abl kinase [ 147– 149 ] . The phosphorylation of AIB1 by these kinases promotes its nuclear localization and stimulates its transactivation by increasing the ability to interact with ER a and other transcription factors (Fig . 7.3 ), and recruit components of the basal transcriptional machinery such as CBP/p300. On the other hand, AIB1 and the AIB1-Delta isoform can also potentiate HER2/Neu signaling by increasing its phophorylation levels [ 107, 123, 150 ] . Therefore, it created a positive feedback loop in which AIB1 increases HER2/Neu signaling, and in turn, HER2/Neu signaling stimulates AIB1 function as a coactivator. The fi nal outcome of this cross talk is not clear, but it could also constitute another mechanism for resistance to Herceptin (humanized monoclonal antibody which targets and inhibits HER2/Neu) [ 151 ] . Moreover, clinical studies have demonstrated that ER-positive breast tumors over-expressing both AIB1 and HER2/Neu frequently undergo resistance to endocrine therapies due to an increase of the agonistic activity of tamoxifen versus the antag-onistic activity upon the ER [ 152 ] .

The NF-кB Signaling Pathway

Nuclear factor-кB (NF-кB) comprises a family of transcription factors that are implicated in the expression of genes controlling immune response and infl amma-tion as well as cell cycle and apoptosis [ 153 ] . NF-кB consists in dimers of proteins that contain the Rel homology dimerization domain. Inactive NF-кB is sequestered to the cytosol by inhibitor proteins known as I k Bs. Exposure of the cell to a variety of stimuli, including cytokines such as interleukin-1 (IL-1) or tumor necrosis factor- a (TNF- a ), leads to the activation of the I k B kinase complex (IKK complex) which phophorylates I k B triggering its ubiquitination and subsequent degradation. Once released from the inhibitory I k B complex, NF- k B is translocated to the nucleus where it transactivates the expression of numerous target genes .

AIB1 and SRC-1 can interact and enhance NF-кB-mediated transcription upon physiological stimulus in cell culture [ 48, 49 ] . However, only AIB1 interacts with IKK complex. In response to TNF- a , IKK complex phosphorylates AIB1 triggering its translocation to the nucleus where it encounters and coactivates NF- k B [ 50 ] . Estrogen treatment also augments AIB1 phosphorylation status to activate estrogen-mediated transcription [ 154– 156 ] . It has been recently shown that IKK a leads the

148 M. Ferrero and J. Font de Mora

phophorylation of both AIB1 and ER- a in response to estrogen, stimulating their nuclear localization. Within the nucleus, all three components form a complex to transactivate cyclin D1 expression [ 157 ] . However, the cyclin D1 promoter is not only regulated by ER- a but also by NF- k B [ 158 ] . Hence, it is likely that AIB1 can target more than one transcriptional pathway to activate cyclin D1 expression. Noteworthy, IKK can also be activated by AKT leading to activation of NF- k B [ 159, 160 ] . Since AIB1 overexpression can increase AKT activity, this would rep-resent another possible mechanism through which AIB1 might promote cyclin D1 expression and cell cycle progression (Fig . 7.3 ). All these fi ndings suggest that both AIB1 overexpression and exposure of tumor cells to estrogens and/or cytokines promote AIB1 oncogenic activity raising its phosphorylated levels in the nucleus and augmenting its transcriptional coactivation capacity.

The Rb/E2F1 Signaling Pathway

The mammalian cell cycle is a process orchestrated by the expression and activa-tion of a series of genes that form a highly organized and regulated network. The Rb/E2F1 pathway regulates G1/S transition and constitutes a key regulatory mechanism in the cell cycle [ 161 ] . Deregulation of any of the processes govern-ing cell cycle is frequently associated with growth abnormalities including cancer.

As a transcriptional coactivator, the discovery that AIB1 could also interact with E2F1 gave a novel role for AIB1 in cell cycle progression. AIB1 promoted cell proliferation by stimulating the expression of E2F1-responsive genes, such as cyclin E, cyclin A, cyclin B, Cdk2, p107, and E2F1 itself [ 58 ] . This increased proliferation occurred even in the presence of anti-estrogens, indicating again that AIB1 could function independently of steroids. Moreover, ChIP assays showed that the complex E2F1/AIB1 was recruited to the AIB1 promoter, suggesting a positive feedback regulatory loop in which high levels of both AIB1 and E2F1 were maintained [ 128, 162 ] . This result could explain a mechanism to achieve high levels of AIB1 inde-pendently of its gene amplifi cation. Since it seems that AIB1 overexpression can bypass the growth-suppressive effects of anti-estrogens by activating E2F1- respon-sive gene expression, these fi ndings are of great importance to explain how tumors acquire endocrine resistance.

Invasiveness Mechanisms

AIB1 is also implicated in late stages of tumorigenesis: cell invasiveness and metas-tasis. The fi rst observation suggesting a novel role for steroid hormones in cell motility and invasiveness was done in Drosophila [ 163 ] . It was reported that muta-tions in Taiman, the AIB1 orthologue in Drosophila , caused defects in migration of the border cells in the ovary. Another complementary study revealed that MCF-7 cells respond to 17- b -estradiol (E2) treatment by extending motile lamellipodia, but this behavior was suppressed in the presence of anti-estrogen [ 164 ] . These fi ndings

1497 AIB1 is a Potential Therapeutical Target in Cancer Progression…

suggested that steroids might stimulate invasive cell behavior. In the last few years, great efforts have been made to determine the mechanisms through which steroid receptor coactivators are affecting these processes.

Clinical studies have correlated AIB1 not only with high cell proliferation and growth but also with metastatic stages of cancer [ 94, 99, 101, 102, 109 ] , suggesting a role for AIB1 in tumor invasiveness and metastasis. The hallmark of cancer cells is to achieve the ability to migrate and invade surrounding tissues, reach blood ves-sels, and colonize distant organs. One important event in this process is the epithe-lial-mesenchymal transition or EMT. During this process, epithelial cells loose adhesion by repressing E-cadherin expression and acquire the capacity to migrate. Several transcription factors are known to suppress E-cadherin expression, includ-ing Twist and Snail [ 165 ] . Interestingly, a recent report correlated high levels of AIB1 with high levels of Twist [ 166 ] . The authors also observed an inverse correla-tion between the U-box-like ubiquitin ligase CHIP and AIB1 levels in breast cancer cells, indicating a role for CHIP in AIB1 degradation through the ubiquitin-protea-some system. CHIP levels were diminished with the concomitant increase of AIB1 levels in advanced tumor stages. That increase in AIB1 levels correlated with high levels of Smad-2 and EMT markers, including b -catenin, Twist, and vimentin. These results clearly indicate that high AIB1 levels might confer an invasive advan-tage through the stimulated expression of Twist. Although it has been demonstrated that SRC-1 does not affect either tumor initiation or growth, it seems to have impor-tance in metastasis since its depletion in PyMT mice (SRC-1 −/− /PyMT) drastically decreases the intravasation of mammary tumor cells and the frequency of metastasis [ 167 ] . Interestingly, SRC-1 correlates inversely with E-cadherin and potentiates PEA3-mediated Twist expression [ 168 ] . Hence, SRC-1 and AIB1 can both promote EMT and invasiveness. However, cells do not only have to lose adhesion but are also required to destruct biological barriers such as the basement membrane to make migration and invasion possible. That purpose can be achieved by the matrix metal-loproteases (MMPs) that degrade the extracellular matrix proteins (ECMs). In line with this notion, AIB1 overexpression stimulates invasiveness and it functions as an AP-1 coactivator to upregulate the expression of MMP-7 and MMP-10 in breast cancer cell lines [ 169 ] . Similar results are obtained in prostate cancer cell lines in which AIB1 overexpression enhances coactivation of the transcription factors PEA3 (an Ets family member) and AP-1, thus increasing the levels of MMP-2 and MMP-13 and resulting in greater ability to migrate [ 170 ] . These different expression pat-terns suggest that AIB1-induced MMP expression depends on the cellular context. In transgenic rodents for lung metastasis (MMTV-polyomavirus middle T antigen or PyMt mice), AIB1 defi ciency extends tumor latency and suppresses lung metastasis [ 171 ] . Moreover, cells derived from these mice (AIB1 −/− /PyMT and WT/PyMT) expressed low levels of MMP-2 and MMP-9 when AIB1 was knocked-down. The expression of these two MMPs was possible through PEA3 transactiva-tion activity. The same report correlates positively the expression of AIB1, PEA3, MMP-2, and MMP-9 in breast cancer specimens. AIB1 has also been associated with ER81, another member of the Ets family, to stimulate the expression of MMP-1 [ 42 ] . In this process, HER2/Neu is involved by activating ER81 together with its coactivators AIB1 and p300 and facilitating ER81-mediated transcription (Fig . 7.3 ).

150 M. Ferrero and J. Font de Mora

Of interest, the HER2/Neu promoter is a target for Ets (reviewed in 172 ] . Since AIB1 can interact and coactivate this transcription factor, AIB1 overexpression might be directly implicated in HER2/Neu overexpression. Again, the same molecules partici-pate in a vicious cycle to favor proliferation and endocrine resistance.

Therefore, it seems that high levels of AIB1 may play a role in tumor invasion and metastasis in addition to its function in cell proliferation and tumor growth. Blocking the PEA3/or ER81/AIB1 axis in cancer may represent a good approach to control invasiveness and cancer progression.

A large body of compelling evidence reveals that AIB1 is an oncogene . AIB1 amplifi cation and/or its overexpression occur in a wide range of human tumors, including breast, ovarian, prostate, pancreatic, gastric, hepatic, and colorectal carci-nomas [ 16, 98, 100, 101, 103, 104, 106, 108, 110, 112 ] . Experiments in rodents have demonstrated that AIB1 alone is suffi cient to initiate tumorigenesis [ 72 ] . In contrast, AIB1 defi ciency protects from tumors [ 122– 125, 127 ] . As described above, the mechanisms of AIB1 to promote cancer initiation, progression, and endocrine resistance involve a variety of signaling pathways, including ER, IGF/PI3K/AKT, HER2, NF- k B, and Ets as well as cell cycle regulation. However, the levels of AIB1 protein are not the unique determinants in AIB1 oncogenic function. Post-translational modifi cations such as phosphorylation have also a great importance [ 155 ] . The phosphorylation of AIB1 is necessary for its activity and can be induced by steroids, cytokines, and growth factors [ 50, 147– 149, 156 ] . Therefore, a correct understanding of the processes controlling AIB1 activity and half-life is necessary for future experimentation and drug discovery.

Cell Cycle Regulation by AIB1

The cell cycle is a highly regulated process by which cells duplicate genetic dosage and end up with cell division. It involves a complex dynamic transcriptional pro-gram through which cyclins, cyclin-dependent kinases, checkpoint regulators, DNA repair machinery, and replication proteins are timely expressed. Extracellular sig-nals along with intracellular signals decide whether a cell will divide or not. The Rb/E2F1 pathway plays the major role in the initiation of the cell cycle [ 173 ] . Firstly, E2F1 is associated to the tumor suppressor protein Rb, and this association prevents E2F1-mediated transcription. Upon growth factor-mediated stimulation, Ras is acti-vated inducing an increase of cyclin D1 levels. In this way, association of cyclin D1 with Cdks is favored, promoting Rb phosphorylations and its consequently release from the E2F1 interaction and inhibition. Once released from Rb, E2F1 initiates the expression of molecules required for the entry and completion of the S-phase, such as cyclin E, cyclin A, and DNA replication proteins. The E2F family comprises 8 members referred to as E2F1-8. While E2F1-3 are positive regulators of the cell cycle, E2F4-8 function as transcriptional repressors. Because both cyclin D1 and E2F1 are important initiators of cell cycle, it is not surprising to fi nd them deregu-lated in cancer [ 174, 175 ] .

1517 AIB1 is a Potential Therapeutical Target in Cancer Progression…

Cyclin D1 is one of the major ER-downstream gene targets [ 139 ] . It has been demonstrated that the functional coupling of ER at the cyclin D1 promoter is achieved through the actions of several intermediary proteins including AIB1. In fact, AIB1 is recruited to the cyclin D1 promoter, and moreover, its overexpression can enhance the ability of ER to interact with this promoter in an estrogen-depen-dent fashion [ 140, 157 ] . SRC-1 and TIF2 can also enhance cyclin D1 expression. However, in MCF-7 cells, ER preferentially interacts with AIB1 after estrogen treatment, highlighting a specifi c role for AIB1 in mediating estrogen-dependent gene transactivation in breast cancer cells. Nonetheless, there are ER-negative tumors that also overexpress cyclin D1 raising the possibility that its expression could also be regulated through other pathways. For instance, in certain mammary carcinoma cell lines, cyclin D1 expression was not as potently induced by estrogen as by serum, suggesting that other pathways are involved in its expression [ 176 ] . Furthermore, cyclin D1 promoter can be regulated by several transcription factors, including ER, STATs, AP-1, and NF- k B (reviewed in [ 177 ] ). One possible way to activate cyclin D1 expression in a hormone-independent manner might involve AP-1. Nakuci et al. have demonstrated that c-Jun/AP-1 complex in the cyclin D1 promoter recruits BRCA-IRIS (a BRCA1 splice variant) alone or together with coactivators [ 178 ] . Since AIB1 is also a coactivator of AP-1 [ 47 ] , it would be not surprising that AIB1 overexpression increases cyclin D1 levels through this path-way (Fig . 7.3 ). In addition, AIB1 can enhance NF- k B and STAT6 transcriptional activities [ 49, 179 ] increasing the possibilities. It seems clear that AIB1 plays an important function in activating cyclin D1 expression. Animals and AIB1 gene interfering in cancer cell lines also confi rm that observation. When AIB1 is depleted in breast and prostate cancer cell lines the levels of cyclin D1 decrease [ 144, 180 ] . And in animals, knockdown of AIB1 results in lower levels of cyclin D1 in compari-son to WTs [ 123, 124 ] . All these fi ndings suggest that overexpression of AIB1 may confer a cell growth advantage by increasing the expression of cell cycle regulators such as cyclin D1. The overexpression of cyclin D1 might be one of the fi rst steps in cancer progression induced by AIB1.

AIB1 associates with the cell cycle positive regulator E2F1 but not with the cell cycle repressor E2F4 [ 58 ] , participating in the core machinery for cell cycle progres-sion. In fact, AIB1 depletion inhibited both the E2-dependent and-independent cell proliferation [ 58, 128 ] . This depletion decreased S-phase population with a concomi-tant increase in G0/G1-phase, suggesting a role of AIB1 in G1 to S-phase progres-sion. In contrast, overexpression of AIB1 in breast cancer cell lines increased cell proliferation independently of E2, and more intriguingly, the elevated levels of AIB1 could promote the cell cycle even in the continuous presence of anti-estrogens [ 58 ] . In an attempt to fi nd out why AIB1 overexpression could enhance cell proliferation under different conditions, these authors investigated the expression of cell cycle regulators when AIB1 levels were elevated. They found an increase in cyclin E, cyclin A, cyclin B, Cdk2, p107, and E2F1 expression levels; all of them are crucial genes for G1/S progression and well-characterized targets of the E2F1 transcrip-tional activity. Moreover, they observed that AIB1 was recruited independently of estrogen to the promoters of all those genes. This recruitment increased as cells

152 M. Ferrero and J. Font de Mora

entered S-phase [ 128 ] , suggesting that AIB1 promotes cell cycle by facilitating the expression of genes essential for G1/S transition. In summary, all these fi ndings demonstrate that AIB1 was an E2F1 coactivator and that its overexpression could override the anti-estrogen action of tamoxifen by functionally coactivating E2F1 allowing cell cycle progression.

Importantly, AIB1 expression is cell cycle regulated with its protein levels peak-ing at G1–S-phase [ 128 ] . Moreover, Avivar et al. observed a correlation between BrdU incorporation and AIB1 nuclear staining in the mammary glands of both WT and AIB1 transgenic mice, whereas non-proliferative cells contained lower levels of AIB1 which were restricted to the cytoplasm [ 121 ] . This indicates a novel function of AIB1 during or after S-phase, in addition to its function during G1 as described previously. Interestingly, AIB1 promoter can also be regulated by the E2F1–AIB1 complex [ 128, 162 ] , and the recruitment is increased at late G1 and decreased dur-ing S-phase, supporting the notion of regulated AIB1 expression during the cell cycle. These fi ndings are important because it creates a positive feedback loop between high level of AIB1 and E2F1 and also might explain endocrine resistance in human cancers.

AIB1 increases the expression of numerous cell cycle regulators, including cyclin D1, cyclin E, cyclin A, E2F1, and a few others. Hence, AIB1 plays a direct role in cell cycle regulation. One possible stepwise progress in ER-positive breast tumor evolution could be as follows: (1) during cancer initiation, AIB1 would coactivate ER function by interacting with ligand-bounded ER; (2) as tumor stages, amplifi cation, and overexpression of AIB1 would increase the levels of PI3K/AKT signaling pathway components; (3) more active AKT and/or more activated HER2/Neu could stimulate ER and AIB1 phosphorylation resulting in increased hormone-independent ER-mediated transcription; (4) high AIB1 levels could also potentiate E2F1 function further increasing its levels and boosting cell cycle progression; (5) in addition, repression of E-cadherin starts to be effective and EMT initiates; and (6) PEA3-mediated expression of MMPs favors invasion of peripheral tissues and expression of metastasic genes such as TWIST mediates metastasis.

IGF-I Is a Mediator of AIB1 Signaling

There are strong evidences, both in vitro and in vivo, that receptor tyrosine kinases play a key role in the formation and progression of human cancers. In particular, the insulin-like growth factor receptor (IGF-IR), a tyrosine kinase receptor for IGF-I and IGF-II, and to a lesser extent for insulin, has been well documented in cell culture, animal studies, and humans to play a role in malignant transformation, pro-gression, and protection from apoptosis and metastasis [ 181 ] . Transgenic mouse models have shown that AIB1 can act as an oncogene [ 72, 121 ] , giving rise to a premalignant hyperplastic mammary phenotype as well as to a high incidence of mammary tumors that are primarily ER-positive. In these models, the AIB1 transgene is responsible for continued activation of the insulin-like growth factor-I

1537 AIB1 is a Potential Therapeutical Target in Cancer Progression…

receptor, suggesting a role for the stimulation of PI3K/AKT/mTOR pathway in the premalignant phenotype and tumor development . Importantly, treatment of AIB1 transgenic mice with the mTOR inhibitor RAD001 reverts the premalignant pheno-type [ 182 ] . Moreover, combination of mTOR inhibition and ER-targeted endocrine therapy with 4-hydroxytamoxifen improves the outcome of the subset of ER-positive breast cancers overexpressing AIB1. This data provides preclinical support for the clinical development of RAD001 and suggests that AIB1 may be a predictive factor of RAD001 response.

So far, IGF-I seems to be an important mediator of AIB1-induced tumor devel-opment. Although AIB1 is an important cofactor for estrogen and progesterone receptors, both animal models and human cancer cell line studies support a role for IGF-I in AIB1-dependent tumors. In human breast cancer cells, AIB1 is rate-limit-ing for IGF-I-dependent phenotypic changes and gene expression controlling the cell cycle and apoptosis [ 144 ] . These results reveal that AIB1 is required for IGF-I-induced proliferation, signaling, cell survival, and gene expression in human breast cancer cells, independently of its role in estrogen receptor signaling. However, an N-terminal truncated isoform of AIB1 found being overexpressed in breast cancer can also induce mammary hyperplasia in mice without affecting serum IGF-I circu-lating levels [ 120 ] , suggesting that perhaps other oncogenic mechanisms indepen-dent of IGF-I are also being activated by AIB1. Therefore, IGF-I could be just one of the several pathways activated by AIB1 that contribute together to the fi nal out-come in cancer initiation and progression.

Noteworthy, AIB1 upregulates the expression of multiple genes in the IGF-I/AKT signaling pathway that are involved in cell proliferation and survival [ 47 ] . Of interest, prostate tumors of treated patients with the proteasome inhibitor Bortezomib and cell-derived cell lines underwent an unexpected higher proliferative expansion due to increased levels of AIB1 followed by increased AKT activation levels. Therefore, dual therapies targeting both the proteasome and AKT activation may improve effi cacy [ 183 ] . In addition, AIB1 is recruited to the promoter of IRS2 and IGF-I by the transcription factor activator protein-1 AP-1, favoring proliferation and survival of cancer cells in a ligand-independent manner. These results strongly sup-port the earliest observation connecting AIB1 and somatic growth through the regu-lation of IGF-I expression. Accordingly, the small size phenotype of AIB1 knockout mice refl ects both altered regulation of IGF-1 gene expression in specifi c tissues and a cell-autonomous defect of response to IGF-1, including ineffective transcriptional activities by several classes of regulated transcription factors under specifi c condi-tions [ 69 ] . Regulation of IGF-I circulating levels has also been reported to be medi-ated by the regulation of IGFBP3 expression (see above in the role of AIB1 during development). Transcription of IGFBP3 is mediated by VDR and AIB1, resulting in increased IGF-I stability [ 73 ] .

Novel insights in IGF-I-mediated oncogenesis by AIB1 were obtained by gener-ating AIB1( +/+ ), AIB1( +/− ), and AIB1( −/− ) mice harboring the mouse mammary tumor virus/v-Ha-ras transgene that induces breast tumors [ 122 ] . This study revealed that mammary tumorigenesis was signifi cantly suppressed in AIB1 defi cient mice independently of ovarian hormone levels, suggesting that AIB1 and ovarian hormones contribute to mammary carcinogenesis through different pathways.

154 M. Ferrero and J. Font de Mora

Importantly, AIB1 defi ciency also caused partial resistance to IGF-I because of a signifi cant reduction in the insulin receptor substrates. The impaired IGF-I signal-ing was responsible in part for the suppression of mammary tumorigenesis and metastasis caused by inhibition of cell proliferation and migration. These interest-ing results support the notion for dual therapies to control breast cancer by targeting AIB1 together with antihormone therapy. Hence, further studies should be done focused in developing new strategies to override AIB1 oncogenic signals.

Overexpression of AIB1 and HER2/NEU Correlates with Tamoxifen Resistance

Primary tumors are mostly classifi ed as ER-positive or HER2/Neu-positive based in the staining results with specifi c antibodies. Therapy with the antiestrogenic com-pound tamoxifen has been frequently given to breast cancer patients with positive staining for ER. However, antiestrogen resistance is a major clinical problem in the treatment of breast cancer [ 184 ] . Noteworthy, development of resistance correlates with the novel expression of HER2/Neu [ 185 ] . Recent studies have provided impor-tant clues for the understanding on how this process is being triggered. Two inde-pendent mechanisms have been demonstrated so far, and curiously, AIB1 has been implicated in both of them. One mechanism is upstream of HER2/Neu controlling its transcription as a result of a competitive regulatory pathway. The second mecha-nism is downstream of HER2/Neu and depends on a bidirectional cross talk between HER2/Neu and the AIB1/ER transcriptional complex. Both mechanisms will be discussed further ahead in this section.

Initially, broad studies with breast and ovarian tumors revealed a correlation between ER and PR positivity with AIB1 amplifi cation [ 106, 112 ] , suggesting a cooperative pathway for triggering cancer. Since AIB1 is an important cofactor for ER and PR transcriptional activity, it seemed reasonable at that time that AIB1 overexpression that ensued from amplifi cation at 20q12-13 would enhance ER and PR signaling and result in the predicted pathological outcome. Subsequent studies demonstrated that AIB1 is overexpressed at the mRNA level in up to 60% of pri-mary breast carcinomas; however, only 5% of these tumors show DNA amplifi ca-tion [ 110, 141 ] . In contrast with previous reports, one later study showed no correlation between AIB1 overexpression and ER and PR positivity, but instead it showed correlation with strong protein staining for HER2/Neu [ 141 ] . In addition, amplifi cation of AIB1 and EGFR genes has been associated with lymph node metas-tasis of oral squamous cell carcinoma [ 186 ] . These additional fi ndings suggested that AIB1 overexpression may promote breast cancer by different mechanisms involving either HER2/Neu overexpression or steroid receptor coexpression. In this way, AIB1 could be in the middle of the cross talk between different signals that modulate the pathological behavior of the tumor.

Studies of endocrine therapy have revealed differential advantages depending on the association of AIB1 overexpression with ER or with HER2/Neu. Failure of the antitumor activity of tamoxifen is actually determined by both the levels of and

1557 AIB1 is a Potential Therapeutical Target in Cancer Progression…

the interaction between AIB1 and HER2/Neu [ 187 ] . In fact, AIB1 overexpression correlates with increased levels of HER2/Neu and its ligand and resistance to tamox-ifen therapy [ 141, 152, 188 ] . Based on the variety of tumors overexpressing AIB1 and the prognostic differences depending on the expression of other markers, it is clear that more data needs to be contrasted in order to have the big picture of all the signaling pathways leading to AIB1. For instance, it has been observed that ER b positive tumors do not express ER a protein, suggesting that a substantial fraction of ER b positive tumors could falsely be considered estrogen receptor negative [ 109 ] .

Several molecular mechanisms leading to tamoxifen resistance have been postu-lated. Chromatin immunoprecipitation (ChIP)-on-chip analyses in ER-positive MCF-7 cells allowed the identifi cation of an intronic ER-binding site within HER2/Neu gene. Noteworthy, treatment with either tamoxifen or estrogen induced the promoter recruit-ment of the paired box 2 gene product (PAX2), a crucial mediator of HER2/Neu repres-sion by ER [ 189 ] . Conversely, expression of AIB1 competed with PAX2 for binding to the HER2/Neu-regulatory element, and this resulted in increased HER2/Neu transcrip-tion and cell proliferation in the presence of tamoxifen. Positive immunostaining for PAX2 corresponded to a signifi cantly improved recurrence-free survival in patients relative to PAX2-negative tumors. Furthermore, within the PAX2-positive tumors, only those that were also positive for AIB1 had a worse clinical outcome than the tumors that were AIB1 negative. These results reveal the intrinsic role of AIB1-PAX2 expres-sion in the development of tamoxifen resistance (Fig. 7.4 ).

There are yet two mechanisms emanating from HER2/Neu cross talk that are also suggested to interplay an essential role in tamoxifen resistance. One mechanism pro-motes AIB1 transcriptional activity and the other inhibits its degradation, thus result-ing in higher protein levels (Fig. 7.4 ). HER2/Neu is a cell surface tyrosine-kinase receptor that gets auto-phosphorylated upon activation, recruiting several transducer molecules that recognize and bind to the new phosphorylated sites. In this way, sev-eral signaling pathways are also becoming activated and transduce the signal to key regulatory molecules controlling metabolism, cell cycle, and survival and transcrip-tional regulation to generate the proper response to the incoming signal. Two of these pathways are the Ras/ERK pathway and the PI3K/AKT pathway (Figs. 7.1 and 7.4 ). Activation of both pathways results in the phosphorylation of ER a in its AF-1 domain. However, only induced phosphorylation by AKT at Ser167 is important for enhanced interaction with AIB1 and tamoxifen resistance [ 190 ] . In addition, acti-vated ERK1/2 results in AIB1 phosphorylation allowing the recruitment of the tran-scriptional coactivators CBP/p300 [ 149 ] . As a result, activated macromolecular complexes with strong histone acetyltransferase activity are being formed around phosphorylated AIB1 and its bounded hormone receptor. Hence, in ER-positive tumors, ERK and AKT activation augments AIB1-ER transcriptional activity in a way that may even override antiestrogenic activity of tamoxifen (Fig. 7.4 ).

Amplifi cation of AIB1 gene at its genetic locus in 20q12 has been shown to be a mechanism leading to AIB1 overexpression [ 16 ] . However, such an amplifi cation only occurs in only 5% of the tumors out of the approximately 60% that overexpress AIB1. Therefore, other mechanisms must be altered in tumors that increase AIB1 protein levels. One of these mechanisms is the activation of the PI3K/AKT pathway

156 M. Ferrero and J. Font de Mora

that stabilizes AIB1 protein by inhibiting its ubiquitination and its proteasomal degradation [ 66 ] . As a result, AIB1 protein levels arise and may hypersensitize the ER-AIB1 transcriptional complex that even in the presence of tamoxifen may displace the equilibrium to the transcription of genes involved in tumor progression (Fig. 7.4 ). The result is again the resistance to the antiestrogenic therapy . Similar mechanisms could also explain the resistance to the aromatase inhibitor letrozole [ 191 ] . Taken all together, available data supports that AIB1 overexpression is involved in antiestrogenic resistance and, therefore, should be considered a new target for combined therapy.

Predictive and Prognostic Factors: Targeting AIB1 in Cancer Therapy

Since the early discovery and characterization of AIB1 in 1997, efforts have been made to correlate the expression of AIB1 with either natural progression of the disease (“prognostic factor”) or with response to tamoxifen (“predictive factor”),

Fig. 7.4 Mechanisms for tamoxifen resistance. Three different mechanisms have been postulated so far for the development of resistance to tamoxifen. Tamoxifen-bound ER recruits PAX2 and represses Her2/Neu transcription [ 185 ] . Patients with PAX2 negative tumors develop resistance and display poorer recurrence-free survival. Activation of the PI3K/AKT pathway prevents protea-somal degradation of AIB1 [ 66 ] , thus resulting in its overexpression and overriding antiestrogenic effect of tamoxifen. Finally, phosphorylation of AIB1 by ERK1 and 2 allows the recruitment of p300 to the coactivation complexes and enhancing their transcriptional activity [ 140 ]

1577 AIB1 is a Potential Therapeutical Target in Cancer Progression…

and to analyze potential correlations with tumor characteristics. As a prognostic factor, patients with breast tumor overexpressing AIB1 had signifi cantly shorter disease-free and overall survival times after surgery [ 114 ] . Tamoxifen is one of the most successful treatments of breast cancer. However, resistance to tamoxifen is frequently developed [ 184 ] . Response to tamoxifen has been associated to the expression of AIB1 in tumor cells and varies depending on the coexpression of other molecules, such as HER2/Neu, ER a , and PAX2 [ 187, 189, 192 ] . Conversely, expression of ER a corepressors NCOR1 [ 193 ] or the scaffold attachment factors SAFB1 and SAFB2 (SAFB) [ 194 ] shows that low protein levels of these negative regulators of ER a predict poor prognosis of breast cancer patients.

Special interest has been given in the scientifi c literature to the length of polyglu-tamine stretch, which has been studied as a risk factor for cancer. This stretch con-stitutes a polymorphism ranging from 26 to 32 glutamines with a heterozygosity of 54% [ 195 ] . Although AIB1 repeat genotype does not infl uence postmenopausal breast cancer risk [ 44 ] , it showed a signifi cative infl uence in BRCA1/2-associated breast cancer risk [ 196 ] . A more careful study revealed that longer repeat length correlated with elevated risk among BRCA1 mutation carriers, but not among BRCA2 mutation carriers [ 197 ] . However, contradictory results were obtained later showing no signifi cant effect of AIB1 genetic variation on breast cancer risk, nei-ther in BRCA1 mutation carriers nor in BRCA2 carriers [ 198, 199 ] . In contrast, ovarian cancer patients with short AIB1 genotype (28 glutamines or less] showed shorter time to disease recurrence and decreased overall survival [ 43 ] . To settle down all these discrepancies, a more recent study with a very large international sample size to detect previously reported effects concluded that the AIB1 glutamine repeat does not substantially modify risk of breast cancer in BRCA1 and BRCA2 mutation carriers [ 45 ] . Independently of all the controversy, it is still not clear enough the real function of this domain in AIB1 stability or binding capacity to other coactivators, implementing other non-studied partners for risk of cancer devel-opment and/or prognosis.

Other predictive factors have been focused in the phosphorylation status of the ER a . Low phosphorylation of ER a at Ser118 was associated with signifi cantly improved disease-free and overall survival, whereas AIB1 overexpression was sig-nifi cantly associated with activated ERK, AKT, HER2, and phosphorylation of ER a at Ser118 [ 200 ] . These results suggested that phosphorylation of ER a Ser118 affects survival in ER-positive breast cancer and could be helpful in distinguishing patients who are likely to benefi t from endocrine therapy alone from those who are not.

As discussed in the preceding section, association of AIB1 expression with HER2/Neu in tumors correlates with poor prognosis and tamoxifen resistance. In these cases, tamoxifen behaves like an estrogen agonist like in ER-positive breast cancer cells, resulting in de novo resistance. Based on crosses between AIB1 knockouts and HER2/Neu transgenic animals, HER2/Neu/AIB1( +/− ) tumors dis-play decreased phosphorylated HER2/Neu, cyclin D1, and cyclin E. Cellular proliferation is also reduced in these tumors, and AKT and JNK activation is barely detectable [ 123 ] . Similarly, v- ras -induced tumors are also reduced and less aggressive in the absence of AIB1 (also explained at the end of Sect. 7.7 ]. These data

158 M. Ferrero and J. Font de Mora

indicate that AIB1 is required for the oncogenic activity of HER2/Neu and v-ras. It is therefore predictable that reducing AIB1 levels or activity could potentiate therapies aimed at inhibiting HER2/Neu signaling in the mammary epithelium of breast cancers or Ras signaling in colon and pancreas cancers where AIB1 is also overexpressed. In fact, knockdown of AIB1 levels can eliminate the ER/HER2/Neu crosstalk and restores the inhibitory effect of tamoxifen on cell proliferation [ 201, 202 ] . Knockdown of AIB1 in prostate cancer cells where it is also frequently overexpressed suppresses cell growth [ 203 ] . Resistance to the treatment against HER2/Neu activity with the antibody Herceptin has also been observed, but com-bination of this therapy with tamoxifen can improve the results [ 204 ] .

As a factor with clinical signifi cance, nuclear expression of AIB1 was initially correlated with the ER a status, and patients with AIB1 nuclear expression tended to be successfully treated by hormonal therapy [ 205 ] . Estrogen-bound ER produces a specifi c conformation enabling the recruitment of p160 class of coactivators [ 206 ] . This recruitment is suffi cient for gene activation and for the growth stimulatory actions of estrogen in breast cancer supporting a model in which ER cofactors play unique roles in estrogen signaling [ 133 ] . Conversely, the tamoxifen-bound ER dis-ables coactivator binding but recruits corepressors instead. In this regard, it would be of therapeutic interest to develop molecules that create steric hindrance or simply prevent ER interaction with coactivators such as AIB1 even in the presence of estro-gen. Small peptide-like molecules mimicking LXXLL motifs with high specifi c affi nity for estrogen-bounded ER could be an interesting approach for further investigation.

Several preliminary approaches have been developed to target AIB1. High-throughput screens have been used to discover small molecules that act as coactiva-tor binding inhibitors that are able to disrupt this interaction of ER with AIB1 and ligands [ 207 ] . For this purpose, it was designed and optimized a set of time-resolved fl uorescence resonance energy transfer (TR-FRET) assays to monitor the interac-tion of ER with SRC-3 and ligands. This system opens exciting expectancies for its high sensibility and its capacity to distinguish between conventional antagonists and coactivator binding inhibitors. Another approach used a combination of a mam-malian two-hybrid screen to select compounds that disrupt the interaction between the ligand binding domain of ER a and AIB1 and a virtual screen to select com-pounds that fi t onto the surface of ER a that interacts with LXXLL motifs, based on the X-ray crystal structure of the ER a complexed with a LXXLL peptide [ 208 ] . In contrast to classical ER antagonists, these novel inhibitors poorly displace estradiol in the ER-ligand competition assay. These small molecules may represent new classes of ER antagonists and may have the potential to provide an alternative for the current anti-estrogen therapy.

MicroRNAs (miRNA) are single-stranded RNA molecules of 21–23 nucleotides in length, partially complementary to one or more messenger RNA (mRNA) mole-cules, and their main function is to downregulate gene expression. The microRNA Mir-17-5p has extensive complementarity to AIB1 mRNA and can downregulate AIB1 expression in cell culture experiments through translational inhibition [ 209 ] . Expression levels of Mir-17-5p have pathological consequences since they are low

1597 AIB1 is a Potential Therapeutical Target in Cancer Progression…

in breast cancer cell lines, and downregulation of AIB1 by Mir-17-5p decreased proliferation of breast cancer cells. Importantly, miRNAs are on the scope for diag-nostic potential in human cancer and even miRNA-based cancer therapies may be on the horizon [ 210 ] . The development of these novel inhibitors for cancer therapy requires further clinical studies. Undoubtedly, the next decade will see new insights into the basic biology of AIB1 which will facilitate the potential clinical applica-tions which we have discussed in the context of this chapter.

References

1. Foster, J.R. 2001, Int J Exp Pathol, 82, 171. 2. Lupulescu, A.P. 1996, Cancer, 78, 2264. 3. Adjei, A.A., and Hidalgo, M. 2005, J Clin Oncol, 23, 5386. 4. Radice, P. 2002, J Exp Clin Cancer Res, 21, 9. 5. Fodde, R. 2002, Eur J Cancer, 38, 867. 6. Pan, S.Y., and DesMeules, M. 2009, Methods Mol Biol, 472, 191. 7. Chida, Y., Hamer, M., Wardle, J., and Steptoe, A. 2008, Nat Clin Pract Oncol, 5, 466. 8. Ziegler, J.L., and Buonaguro, F.M. 2009, Front Biosci, 14, 3455. 9. LeRoith, D., Novosyadlyy, R., Gallagher, E.J., Lann, D., Vijayakumar, A., and Yakar, S.

2008, Exp Clin Endocrinol Diabetes, 116 Suppl 1, S4. 10. Pischon, T., Nothlings, U., and Boeing, H. 2008, Proc Nutr Soc, 67, 128. 11. Mavrou, A., Tsangaris, G.T., Roma, E., and Kolialexi, A. 2008, Anticancer Res, 28, 401. 12. Hermanson, O., Glass, C.K., and Rosenfeld, M.G. 2002, Trends Endocrinol Metab, 13, 55. 13. Lonard, D.M., and O’Malley, B.W. 2006, Cell, 125, 411. 14. Onate, S.A., Tsai, S.Y., Tsai, M.J., and O’Malley, B.W. 1995, Science, 270, 1354. 15. Hong, H., Kohli, K., Garabedian, M.J., and Stallcup, M.R. 1997, Mol Cell Biol, 17, 2735. 16. Anzick, S.L., Kononen, J., Walker, R.L., Azorsa, D.O., Tanner, M.M., Guan, X.Y., Sauter, G.,

Kallioniemi, O.P., Trent, J.M., and Meltzer, P.S. 1997, Science, 277, 965. 17. Chen, H., Lin, R.J., Schiltz, R.L., Chakravarti, D., Nash, A., Nagy, L., Privalsky, M.L.,

Nakatani, Y., and Evans, R.M. 1997, Cell, 90, 569. 18. Li, H., Gomes, P.J., and Chen, J.D. 1997, Proc Natl Acad Sci U S A, 94, 8479. 19. Suen, C.S., Berrodin, T.J., Mastroeni, R., Cheskis, B.J., Lyttle, C.R., and Frail, D.E. 1998, J

Biol Chem, 273, 27645. 20. Takeshita, A., Cardona, G.R., Koibuchi, N., Suen, C.S., and Chin, W.W. 1997, J Biol Chem,

272, 27629. 21. Torchia, J., Rose, D.W., Inostroza, J., Kamei, Y., Westin, S., Glass, C.K., and Rosenfeld, M.G.

1997, Nature, 387, 677. 22. Carapeti, M., Aguiar, R.C., Chase, A., Goldman, J.M., and Cross, N.C. 1998, Genomics, 52, 242. 23. Kalkhoven, E., Valentine, J.E., Heery, D.M., and Parker, M.G. 1998, Embo J, 17, 232. 24. Huang, Z.J., Edery, I., and Rosbash, M. 1993, Nature, 364, 259. 25. Belandia, B., and Parker, M.G. 2000, J Biol Chem, 275, 30801. 26. Chen, S.L., Dowhan, D.H., Hosking, B.M., and Muscat, G.E. 2000, Genes Dev, 14, 1209. 27. Litterst, C.M., Kliem, S., Marilley, D., and Pfi tzner, E. 2003, J Biol Chem, 278, 45340. 28. Chen, Y.H., Kim, J.H., and Stallcup, M.R. 2005, Mol Cell Biol, 25, 5965. 29. Kim, J.H., Li, H., and Stallcup, M.R. 2003, Mol Cell, 12, 1537. 30. Lee, Y.H., Campbell, H.D., and Stallcup, M.R. 2004, Mol Cell Biol, 24, 2103. 31. Zhang, A., Yeung, P.L., Li, C.W., Tsai, S.C., Dinh, G.K., Wu, X., Li, H., and Chen, J.D. 2004,

J Biol Chem, 279, 33799.

160 M. Ferrero and J. Font de Mora

32. Ding, X.F., Anderson, C.M., Ma, H., Hong, H., Uht, R.M., Kushner, P.J., and Stallcup, M.R. 1998, Mol Endocrinol, 12, 302.

33. Heery, D.M., Kalkhoven, E., Hoare, S., and Parker, M.G. 1997, Nature, 387, 733. 34. Li, H., and Chen, J.D. 1998, J Biol Chem, 273, 5948. 35. Voegel, J.J., Heine, M.J., Tini, M., Vivat, V., Chambon, P., and Gronemeyer, H. 1998, Embo

J, 17, 507. 36. Leo, C., Li, H., and Chen, J.D. 2000, J Biol Chem, 275, 5976. 37. Savkur, R.S., and Burris, T.P. 2004, J Pept Res, 63, 207. 38. Brown, K., Chen, Y., Underhill, T.M., Mymryk, J.S., and Torchia, J. 2003, J Biol Chem, 278,

39402. 39. Demarest, S.J., Deechongkit, S., Dyson, H.J., Evans, R.M., and Wright, P.E. 2004, Protein

Sci, 13, 203. 40. McInerney, E.M., Rose, D.W., Flynn, S.E., Westin, S., Mullen, T.M., Krones, A., Inostroza,

J., Torchia, J., Nolte, R.T., Assa-Munt, N., Milburn, M.V., Glass, C.K., and Rosenfeld, M.G. 1998, Genes Dev, 12, 3357.

41. Spencer, T.E., Jenster, G., Burcin, M.M., Allis, C.D., Zhou, J., Mizzen, C.A., McKenna, N.J., Onate, S.A., Tsai, S.Y., Tsai, M.J., and O’Malley, B.W. 1997, Nature, 389, 194.

42. Goel, A., and Janknecht, R. 2004, J Biol Chem, 279, 14909. 43. Li, A.J., Lerner, D.L., Gapuzan, M.E., and Karlan, B.Y. 2005, Cancer Epidemiol Biomarkers

Prev, 14, 2919. 44. Haiman, C.A., Hankinson, S.E., Spiegelman, D., Colditz, G.A., Willett, W.C., Speizer, F.E.,

Brown, M., and Hunter, D.J. 2000, Breast Cancer Res, 2, 378. 45. Spurdle, A.B., Antoniou, A.C., Kelemen, L., Holland, H., Peock, S., Cook, M.R., Smith, P.L.,

Greene, M.H., Simard, J., Plourde, M., Southey, M.C., Godwin, A.K., Beck, J., Miron, A., Daly, M.B., Santella, R.M., Hopper, J.L., John, E.M., Andrulis, I.L., Durocher, F., Struewing, J.P., Easton, D.F., and Chenevix-Trench, G. 2006, Cancer Epidemiol Biomarkers Prev, 15, 76.

46. Lee, S.K., Kim, H.J., Na, S.Y., Kim, T.S., Choi, H.S., Im, S.Y., and Lee, J.W. 1998, J Biol Chem, 273, 16651.

47. Yan, J., Yu, C.T., Ozen, M., Ittmann, M., Tsai, S.Y., and Tsai, M.J. 2006, Cancer Res, 66, 11039.

48. Na, S.Y., Lee, S.K., Han, S.J., Choi, H.S., Im, S.Y., and Lee, J.W. 1998, J Biol Chem, 273, 10831.

49. Werbajh, S., Nojek, I., Lanz, R., and Costas, M.A. 2000, FEBS Lett, 485, 195. 50. Wu, R.C., Qin, J., Hashimoto, Y., Wong, J., Xu, J., Tsai, S.Y., Tsai, M.J., and O’Malley, B.W.

2002, Mol Cell Biol, 22, 3549. 51. Giraud, S., Bienvenu, F., Avril, S., Gascan, H., Heery, D.M., and Coqueret, O. 2002, J Biol

Chem, 277, 8004. 52. Litterst, C.M., and Pfi tzner, E. 2002, J Biol Chem, 277, 36052. 53. Razeto, A., Ramakrishnan, V., Litterst, C.M., Giller, K., Griesinger, C., Carlomagno, T., Lakomek,

N., Heimburg, T., Lodrini, M., Pfi tzner, E., and Becker, S. 2004, J Mol Biol, 336, 319. 54. Iordanidou, P., Aggelidou, E., Demetriades, C., and Hadzopoulou-Cladaras, M. 2005, J Biol

Chem, 280, 21810. 55. Soutoglou, E., Papafotiou, G., Katrakili, N., and Talianidis, I. 2000, J Biol Chem, 275,

12515. 56. Myers, E., Hill, A.D., Kelly, G., McDermott, E.W., O’Higgins, N.J., Buggy, Y., and Young,

L.S. 2005, Clin Cancer Res, 11, 2111. 57. Lee, S.K., Kim, H.J., Kim, J.W., and Lee, J.W. 1999, Mol Endocrinol, 13, 1924. 58. Louie, M.C., Zou, J.X., Rabinovich, A., and Chen, H.W. 2004, Mol Cell Biol, 24, 5157. 59. Li, S., and Shang, Y. 2007, Cell Signal, 19, 1101. 60. Yan, F., Gao, X., Lonard, D.M., and Nawaz, Z. 2003, Mol Endocrinol, 17, 1315. 61. Li, X., Lonard, D.M., Jung, S.Y., Malovannaya, A., Feng, Q., Qin, J., Tsai, S.Y., Tsai, M.J.,

and O’Malley, B.W. 2006, Cell, 124, 381. 62. Wu, R.C., Feng, Q., Lonard, D.M., and O’Malley, B.W. 2007, Cell, 129, 1125.

1617 AIB1 is a Potential Therapeutical Target in Cancer Progression…

63. Gianni, M., Parrella, E., Raska, I., Jr., Gaillard, E., Nigro, E.A., Gaudon, C., Garattini, E., and Rochette-Egly, C. 2006, Embo J, 25, 739.

64. Giamas, G., Castellano, L., Feng, Q., Knippschild, U., Jacob, J., Thomas, R.S., Coombes, R.C., Smith, C.L., Jiao, L.R., and Stebbing, J. 2009, Nucleic Acids Res,

65. Yi, P., Feng, Q., Amazit, L., Lonard, D.M., Tsai, S.Y., Tsai, M.J., and O’Malley, B.W. 2008, Mol Cell, 29, 465.

66. Ferrero, M., Avivar, A., Garcia-Macias, M.C., and de Mora, J.F. 2008, Cancer Res, 68, 5450.

67. Naeem, H., Cheng, D., Zhao, Q., Underhill, C., Tini, M., Bedford, M.T., and Torchia, J. 2007, Mol Cell Biol, 27, 120.

68. Xu, J., Liao, L., Ning, G., Yoshida-Komiya, H., Deng, C., and O’Malley, B.W. 2000, Proc Natl Acad Sci U S A, 97, 6379.

69. Wang, Z., Rose, D.W., Hermanson, O., Liu, F., Herman, T., Wu, W., Szeto, D., Gleiberman, A., Krones, A., Pratt, K., Rosenfeld, R., Glass, C.K., and Rosenfeld, M.G. 2000, Proc Natl Acad Sci U S A, 97, 13549.

70. Xu, J., Qiu, Y., DeMayo, F.J., Tsai, S.Y., Tsai, M.J., and O’Malley, B.W. 1998, Science, 279, 1922. 71. Zhou, G., Hashimoto, Y., Kwak, I., Tsai, S.Y., and Tsai, M.J. 2003, Mol Cell Biol, 23, 7742. 72. Torres-Arzayus, M.I., Font de Mora, J., Yuan, J., Vazquez, F., Bronson, R., Rue, M., Sellers,

W.R., and Brown, M. 2004, Cancer Cell, 6, 263. 73. Liao, L., Chen, X., Wang, S., Parlow, A.F., and Xu, J. 2008, Mol Cell Biol, 28, 2460. 74. Gehin, M., Mark, M., Dennefeld, C., Dierich, A., Gronemeyer, H., and Chambon, P. 2002,

Mol Cell Biol, 22, 5923. 75. Conneely, O.M., Mulac-Jericevic, B., Lydon, J.P., and De Mayo, F.J. 2001, Mol Cell

Endocrinol, 179, 97. 76. Han, S.J., Tsai, S.Y., Tsai, M.J., and O’Malley, B.W. 2007, Endocrinology, 148, 2471. 77. Han, S.J., DeMayo, F.J., and O’Malley, B.W. 2007, Ernst Schering Found Symp Proc, 25. 78. Mukherjee, A., Amato, P., Allred, D.C., DeMayo, F.J., and Lydon, J.P. 2007, Nucl Recept

Signal, 5, e011. 79. Nishihara, E., Yoshida-Komiya, H., Chan, C.S., Liao, L., Davis, R.L., O’Malley, B.W., and

Xu, J. 2003, J Neurosci, 23, 213. 80. Hayashi, Y., Ohmori, S., Ito, T., and Seo, H. 1997, Biochem Biophys Res Commun, 236, 83. 81. Grenier, J., Trousson, A., Chauchereau, A., Amazit, L., Lamirand, A., Leclerc, P., Guiochon-

Mantel, A., Schumacher, M., and Massaad, C. 2004, Mol Endocrinol, 18, 2866. 82. Grenier, J., Trousson, A., Chauchereau, A., Cartaud, J., Schumacher, M., and Massaad, C.

2006, Mol Endocrinol, 20, 254. 83. An, B.S., Selva, D.M., Hammond, G.L., Rivero-Muller, A., Rahman, N., and Leung, P.C.

2006, J Biol Chem, 281, 20817. 84. Blanco, E.J., Hernandez, C.M., Rubio, M., Riesco, J.M., Carretero, M., Perez, E., Herrero,

J.J., de Mora, J.F., Burks, D.J., and Carretero, J. 2007, Journal of Anatomy, 210, 632. 85. Coste, A., Louet, J.F., Lagouge, M., Lerin, C., Antal, M.C., Meziane, H., Schoonjans, K.,

Puigserver, P., O’Malley, B.W., and Auwerx, J. 2008, Proc Natl Acad Sci U S A, 105, 17187.

86. Louet, J.F., Coste, A., Amazit, L., Tannour-Louet, M., Wu, R.C., Tsai, S.Y., Tsai, M.J., Auwerx, J., and O’Malley, B.W. 2006, Proc Natl Acad Sci U S A, 103, 17868.

87. Picard, F., Gehin, M., Annicotte, J., Rocchi, S., Champy, M.F., O’Malley, B.W., Chambon, P., and Auwerx, J. 2002, Cell, 111, 931.

88. Jeong, J.W., Kwak, I., Lee, K.Y., White, L.D., Wang, X.P., Brunicardi, F.C., O’Malley, B.W., and DeMayo, F.J. 2006, Mol Endocrinol, 20, 1138.

89. Ying, H., Furuya, F., Willingham, M.C., Xu, J., O’Malley, B.W., and Cheng, S.Y. 2005, Mol Cell Biol, 25, 7687.

90. Yuan, Y., Liao, L., Tulis, D.A., and Xu, J. 2002, Circulation, 105, 2653. 91. Yu, C., York, B., Wang, S., Feng, Q., Xu, J., and O’Malley, B.W. 2007, Mol Cell, 25, 765.

162 M. Ferrero and J. Font de Mora

92. Coste, A., Antal, M.C., Chan, S., Kastner, P., Mark, M., O’Malley, B.W., and Auwerx, J. 2006, Embo J, 25, 2453.

93. Luo, J.H., Xie, D., Liu, M.Z., Chen, W., Liu, Y.D., Wu, G.Q., Kung, H.F., Zeng, Y.X., and Guan, X.Y. 2008, Int J Cancer, 122, 2554.

94. Liu, M.Z., Xie, D., Mai, S.J., Tong, Z.T., Shao, J.Y., Fu, Y.S., Xia, W.J., Kung, H.F., Guan, X.Y., and Zeng, Y.X. 2008, Am J Clin Pathol, 129, 728.

95. Xu, F.P., Liu, Y.H., Zhuang, H.G., Li, L., Luo, X.L., and Wen, J.M. 2008, Zhonghua Bing Li Xue Za Zhi, 37, 250.

96. Xu, F.P., Xie, D., Wen, J.M., Wu, H.X., Liu, Y.D., Bi, J., Lv, Z.L., Zeng, Y.X., and Guan, X.Y. 2007, Cancer Lett, 245, 69.

97. Grivas, P.D., Tzelepi, V., Sotiropoulou-Bonikou, G., Kefalopoulou, Z., Papavassiliou, A.G., and Kalofonos, H. 2009, Int J Colorectal Dis.

98. Lassmann, S., Weis, R., Makowiec, F., Roth, J., Danciu, M., Hopt, U., and Werner, M. 2007, J Mol Med, 85, 293.

99. Xie, D., Sham, J.S., Zeng, W.F., Lin, H.L., Bi, J., Che, L.H., Hu, L., Zeng, Y.X., and Guan, X.Y. 2005, Hum Pathol, 36, 777.

100. Zeng, S.D., Xie, D., Lin, F., Wang, C.X., Tao, Y., and Zhang, M. 2005, Zhonghua Wei Chang Wai Ke Za Zhi, 8, 67.

101. Wang, Y., Wu, M.C., Sham, J.S., Zhang, W., Wu, W.Q., and Guan, X.Y. 2002, Cancer, 95, 2346. 102. Henke, R.T., Haddad, B.R., Kim, S.E., Rone, J.D., Mani, A., Jessup, J.M., Wellstein, A.,

Maitra, A., and Riegel, A.T. 2004, Clin Cancer Res, 10, 6134. 103. Ghadimi, B.M., Schrock, E., Walker, R.L., Wangsa, D., Jauho, A., Meltzer, P.S., and Ried, T.

1999, Am J Pathol, 154, 525. 104. Sakakura, C., Hagiwara, A., Yasuoka, R., Fujita, Y., Nakanishi, M., Masuda, K., Kimura, A.,

Nakamura, Y., Inazawa, J., Abe, T., and Yamagishi, H. 2000, Int J Cancer, 89, 217. 105. Rangel, J., Torabian, S., Shaikh, L., Nosrati, M., Baehner, F.L., Haqq, C., Leong, S.P., Miller,

J.R., 3rd, Sagebiel, R.W., and Kashani-Sabet, M. 2006, J Clin Oncol, 24, 4565. 106. Bautista, S., Valles, H., Walker, R.L., Anzick, S., Zeillinger, R., Meltzer, P., and Theillet, C.

1998, Clin Cancer Res, 4, 2925. 107. Reiter, R., Wellstein, A., and Riegel, A.T. 2001, J Biol Chem, 276, 39736. 108. Glaeser, M., Floetotto, T., Hanstein, B., Beckmann, M.W., and Niederacher, D. 2001, Horm

Metab Res, 33, 121. 109. Hudelist, G., Czerwenka, K., Kubista, E., Marton, E., Pischinger, K., and Singer, C.F. 2003,

Breast Cancer Res Treat, 78, 193. 110. List, H.J., Reiter, R., Singh, B., Wellstein, A., and Riegel, A.T. 2001, Breast Cancer Res Treat,

68, 21. 111. Nessler-Menardi, C., Jotova, I., Culig, Z., Eder, I.E., Putz, T., Bartsch, G., and Klocker, H.

2000, Prostate, 45, 124. 112. Tanner, M.M., Grenman, S., Koul, A., Johannsson, O., Meltzer, P., Pejovic, T., Borg, A., and

Isola, J.J. 2000, Clin Cancer Res, 6, 1833. 113. Harigopal, M., Heymann, J., Ghosh, S., Anagnostou, V., Camp, R.L., and Rimm, D.L. 2008,

Breast Cancer Res Treat, 114. Zhao, C., Yasui, K., Lee, C.J., Kurioka, H., Hosokawa, Y., Oka, T., and Inazawa, J. 2003,

Cancer, 98, 18. 115. Han, X.Y., Zhang, X.M., Chen, Y., Yang, K.X., and Qie, M.R. 2007, Sichuan Da Xue Xue

Bao Yi Xue Ban, 38, 246. 116. Hirai, Y., Utsugi, K., Takeshima, N., Kawamata, Y., Furuta, R., Kitagawa, T., Kawaguchi, T.,

Hasumi, K., and Noda, T. 2004, Am J Obstet Gynecol, 191, 1173. 117. Sakaguchi, H., Fujimoto, J., Sun, W.S., and Tamaya, T. 2007, J Steroid Biochem Mol Biol,

104, 237. 118. Balmer, N.N., Richer, J.K., Spoelstra, N.S., Torkko, K.C., Lyle, P.L., and Singh, M. 2006,

Mod Pathol, 19, 1593.

1637 AIB1 is a Potential Therapeutical Target in Cancer Progression…

119. Han, X.Y., Chen, Y., Hou, M.M., Zhang, J., Yang, K.X., Chen, Y.Y., and Qie, M.R. 2008, Sichuan Da Xue Xue Bao Yi Xue Ban, 39, 619.

120. Tilli, M.T., Reiter, R., Oh, A.S., Henke, R.T., McDonnell, K., Gallicano, G.I., Furth, P.A., and Riegel, A.T. 2005, Mol Endocrinol, 19, 644.

121. Avivar, A., Garcia-Macias, M.C., Ascaso, E., Herrera, G., O’Connor, J.E., and de Mora, J.F. 2006, FEBS Lett, 580, 5222.

122. Kuang, S.Q., Liao, L., Zhang, H., Lee, A.V., O’Malley, B.W., and Xu, J. 2004, Cancer Res, 64, 1875.

123. Fereshteh, M.P., Tilli, M.T., Kim, S.E., Xu, J., O’Malley, B.W., Wellstein, A., Furth, P.A., and Riegel, A.T. 2008, Cancer Res, 68, 3697.

124. Kuang, S.Q., Liao, L., Wang, S., Medina, D., O’Malley, B.W., and Xu, J. 2005, Cancer Res, 65, 7993.

125. Chung, A.C., Zhou, S., Liao, L., Tien, J.C., Greenberg, N.M., and Xu, J. 2007, Cancer Res, 67, 5965.

126. Tien, J.C., Zhou, S., and Xu, J. 2009, Int J Biol Sci, 5, 256. 127. Ying, H., Willingham, M.C., and Cheng, S.Y. 2008, Oncogene, 27, 823. 128. Louie, M.C., Revenko, A.S., Zou, J.X., Yao, J., and Chen, H.W. 2006, Mol Cell Biol, 26, 3810. 129. Lathrop, A.E., and Loeb, L. 1916, J Cancer Res, 1, 1. 130. Kurebayashi, J., Otsuki, T., Kunisue, H., Tanaka, K., Yamamoto, S., and Sonoo, H. 2000, Clin

Cancer Res, 6, 512. 131. Rey, J.M., Pujol, P., Callier, P., Cavailles, V., Freiss, G., Maudelonde, T., and Brouillet, J.P.

2000, J Mol Endocrinol, 24, 433. 132. Azorsa, D.O., Cunliffe, H.E., and Meltzer, P.S. 2001, Breast Cancer Res Treat, 70, 89. 133. Shang, Y., Hu, X., DiRenzo, J., Lazar, M.A., and Brown, M. 2000, Cell, 103, 843. 134. Shao, W., Keeton, E.K., McDonnell, D.P., and Brown, M. 2004, Proc Natl Acad Sci U S A,

101, 11599. 135. Murphy, L.C., Simon, S.L., Parkes, A., Leygue, E., Dotzlaw, H., Snell, L., Troup, S., Adeyinka,

A., and Watson, P.H. 2000, Cancer Res, 60, 6266. 136. Reiter, R., Oh, A.S., Wellstein, A., and Riegel, A.T. 2004, Oncogene, 23, 403. 137. List, H.J., Lauritsen, K.J., Reiter, R., Powers, C., Wellstein, A., and Riegel, A.T. 2001, J Biol

Chem, 276, 23763. 138. Tikkanen, M.K., Carter, D.J., Harris, A.M., Le, H.M., Azorsa, D.O., Meltzer, P.S., and

Murdoch, F.E. 2000, Proc Natl Acad Sci U S A, 97, 12536. 139. Doisneau-Sixou, S.F., Sergio, C.M., Carroll, J.S., Hui, R., Musgrove, E.A., and Sutherland,

R.L. 2003, Endocr Relat Cancer, 10, 179. 140. Planas-Silva, M.D., Shang, Y., Donaher, J.L., Brown, M., and Weinberg, R.A. 2001, Cancer

Res, 61, 3858. 141. Bouras, T., Southey, M.C., and Venter, D.J. 2001, Cancer Res, 61, 903. 142. Zhou, H.J., Yan, J., Luo, W., Ayala, G., Lin, S.H., Erdem, H., Ittmann, M., Tsai, S.Y., and

Tsai, M.J. 2005, Cancer Res, 65, 7976. 143. Franke, T.F. 2008, Oncogene, 27, 6473. 144. Oh, A., List, H.J., Reiter, R., Mani, A., Zhang, Y., Gehan, E., Wellstein, A., and Riegel, A.T.

2004, Cancer Res, 64, 8299. 145. Holbro, T., Civenni, G., and Hynes, N.E. 2003, Exp Cell Res, 284, 99. 146. Thorat, M.A., Turbin, D., Morimiya, A., Leung, S., Zhang, Q., Jeng, M.H., Huntsman, D.G.,

Nakshatri, H., and Badve, S. 2008, Histopathology, 53, 634. 147. Amazit, L., Pasini, L., Szafran, A.T., Berno, V., Wu, R.C., Mielke, M., Jones, E.D., Mancini,

M.G., Hinojos, C.A., O’Malley, B.W., and Mancini, M.A. 2007, Mol Cell Biol, 27, 6913. 148. Oh, A.S., Lahusen, J.T., Chien, C.D., Fereshteh, M.P., Zhang, X., Dakshanamurthy, S., Xu, J.,

Kagan, B.L., Wellstein, A., and Riegel, A.T. 2008, Mol Cell Biol, 28, 6580. 149. Font de Mora, J., and Brown, M. 2000, Mol Cell Biol, 20, 5041. 150. Lahusen, T., Fereshteh, M., Oh, A., Wellstein, A., and Riegel, A.T. 2007, Cancer Res, 67, 7256. 151. Nahta, R., and Esteva, F.J. 2006, Breast Cancer Res, 8, 215.

164 M. Ferrero and J. Font de Mora

152. Osborne, C.K., Bardou, V., Hopp, T.A., Chamness, G.C., Hilsenbeck, S.G., Fuqua, S.A., Wong, J., Allred, D.C., Clark, G.M., and Schiff, R. 2003, J Natl Cancer Inst, 95, 353.

153. Perkins, N.D. 2007, Nat Rev Mol Cell Biol, 8, 49. 154. Marquez, D.C., Chen, H.W., Curran, E.M., Welshons, W.V., and Pietras, R.J. 2006, Mol Cell

Endocrinol, 246, 91. 155. Wu, R.C., Qin, J., Yi, P., Wong, J., Tsai, S.Y., Tsai, M.J., and O’Malley, B.W. 2004, Mol Cell,

15, 937. 156. Zheng, F.F., Wu, R.C., Smith, C.L., and O’Malley, B.W. 2005, Mol Cell Biol, 25, 8273. 157. Park, K.J., Krishnan, V., O’Malley, B.W., Yamamoto, Y., and Gaynor, R.B. 2005, Mol Cell,

18, 71. 158. Cao, Y., Bonizzi, G., Seagroves, T.N., Greten, F.R., Johnson, R., Schmidt, E.V., and Karin, M.

2001, Cell, 107, 763. 159. Ozes, O.N., Mayo, L.D., Gustin, J.A., Pfeffer, S.R., Pfeffer, L.M., and Donner, D.B. 1999,

Nature, 401, 82. 160. Romashkova, J.A., and Makarov, S.S. 1999, Nature, 401, 86. 161. Fang, Z.H., and Han, Z.C. 2006, Histol Histopathol, 21, 403. 162. Mussi, P., Yu, C., O’Malley, B.W., and Xu, J. 2006, Mol Endocrinol, 20, 3105. 163. Bai, J., Uehara, Y., and Montell, D.J. 2000, Cell, 103, 1047. 164. DePasquale, J.A. 1999, Histochem Cell Biol, 112, 341. 165. Yang, J., Mani, S.A., Donaher, J.L., Ramaswamy, S., Itzykson, R.A., Come, C., Savagner, P.,

Gitelman, I., Richardson, A., and Weinberg, R.A. 2004, Cell, 117, 927. 166. Kajiro, M., Hirota, R., Nakajima, Y., Kawanowa, K., So-Ma, K., Ito, I., Yamaguchi, Y., Ohie,

S.H., Kobayashi, Y., Seino, Y., Kawano, M., Kawabe, Y.I., Takei, H., Hayashi, S.I., Kurosumi, M., Murayama, A., Kimura, K., and Yanagisawa, J. 2009, Nat Cell Biol,

167. Wang, S., Yuan, Y., Liao, L., Kuang, S.Q., Tien, J.C., O’Malley, B.W., and Xu, J. 2009, Proc Natl Acad Sci U S A, 106, 151.

168. Qin, L., Liu, Z., Chen, H., and Xu, J. 2009, Cancer Res, 69, 3819. 169. Li, L.B., Louie, M.C., Chen, H.W., and Zou, J.X. 2008, Cancer Lett, 261, 64. 170. Yan, J., Erdem, H., Li, R., Cai, Y., Ayala, G., Ittmann, M., Yu-Lee, L.Y., Tsai, S.Y., and Tsai,

M.J. 2008, Cancer Res, 68, 5460. 171. Qin, L., Liao, L., Redmond, A., Young, L., Yuan, Y., Chen, H., O’Malley, B.W., and Xu, J.

2008, Mol Cell Biol, 28, 5937. 172. Hurst, H.C. 2001, Breast Cancer Res, 3, 395. 173. Sun, A., Bagella, L., Tutton, S., Romano, G., and Giordano, A. 2007, J Cell Biochem, 102, 1400. 174. Gillett, C., Fantl, V., Smith, R., Fisher, C., Bartek, J., Dickson, C., Barnes, D., and Peters, G.

1994, Cancer Res, 54, 1812. 175. Zhang, S.Y., Liu, S.C., Al-Saleem, L.F., Holloran, D., Babb, J., Guo, X., and Klein-Szanto,

A.J. 2000, Cancer Epidemiol Biomarkers Prev, 9, 395. 176. Planas-Silva, M.D., Donaher, J.L., and Weinberg, R.A. 1999, Cancer Res, 59, 4788. 177. Klein, E.A., and Assoian, R.K. 2008, J Cell Sci, 121, 3853. 178. Nakuci, E., Mahner, S., Direnzo, J., and ElShamy, W.M. 2006, Exp Cell Res, 312, 3120. 179. Arimura, A., vn Peer, M., Schroder, A.J., and Rothman, P.B. 2004, J Biol Chem, 279,

31105. 180. Zou, J.X., Zhong, Z., Shi, X.B., Tepper, C.G., deVere White, R.W., Kung, H.J., and Chen, H.

2006, Prostate, 66, 1474. 181. Samani, A.A., Yakar, S., LeRoith, D., and Brodt, P. 2007, Endocr Rev, 28, 20. 182. Torres-Arzayus, M.I., Yuan, J., DellaGatta, J.L., Lane, H., Kung, A.L., and Brown, M. 2006,

Cancer Res, 66, 11381. 183. Ayala, G., Yan, J., Li, R., Ding, Y., Thompson, T.C., Mims, M.P., Hayes, T.G., MacDonnell,

V., Lynch, R.G., Frolov, A., Miles, B.J., Wheeler, T.M., Harper, J.W., Tsai, M.J., Ittmann, M.M., and Kadmon, D. 2008, Clin Cancer Res, 14, 7511.

184. Clarke, R., Leonessa, F., Welch, J.N., and Skaar, T.C. 2001, Pharmacol Rev, 53, 25. 185. Osborne, C.K., and Schiff, R. 2003, Breast, 12, 362.

1657 AIB1 is a Potential Therapeutical Target in Cancer Progression…

186. Chen, Y.J., Lin, S.C., Kao, T., Chang, C.S., Hong, P.S., Shieh, T.M., and Chang, K.W. 2004, J Pathol, 204, 326.

187. Schiff, R., Massarweh, S., Shou, J., and Osborne, C.K. 2003, Clin Cancer Res, 9, 447S. 188. Kirkegaard, T., McGlynn, L.M., Campbell, F.M., Muller, S., Tovey, S.M., Dunne, B., Nielsen,

K.V., Cooke, T.G., and Bartlett, J.M. 2007, Clin Cancer Res, 13, 1405. 189. Hurtado, A., Holmes, K.A., Geistlinger, T.R., Hutcheson, I.R., Nicholson, R.I., Brown, M.,

Jiang, J., Howat, W.J., Ali, S., and Carroll, J.S. 2008, Nature, 456, 663. 190. Glaros, S., Atanaskova, N., Zhao, C., Skafar, D.F., and Reddy, K.B. 2006, Mol Endocrinol,

20, 996. 191. Shin, I., Miller, T., and Arteaga, C.L. 2006, Clin Cancer Res, 12, 1008s. 192. Iwase, H. 2006, Nippon Rinsho, 64, 555. 193. Girault, I., Lerebours, F., Amarir, S., Tozlu, S., Tubiana-Hulin, M., Lidereau, R., and Bieche,

I. 2003, Clin Cancer Res, 9, 1259. 194. Hammerich-Hille, S., Bardout, V.J., Hilsenbeck, S.G., Osborne, C.K., and Oesterreich, S.

2009, Breast Cancer Res Treat, 195. Hayashi, Y., Yamamoto, M., Ohmori, S., Kikumori, T., Imai, T., Funahashi, H., and Seo, H.

1999, Endocr J, 46, 279. 196. Rebbeck, T.R., Wang, Y., Kantoff, P.W., Krithivas, K., Neuhausen, S.L., Godwin, A.K., Daly,

M.B., Narod, S.A., Brunet, J.S., Vesprini, D., Garber, J.E., Lynch, H.T., Weber, B.L., and Brown, M. 2001, Cancer Res, 61, 5420.

197. Kadouri, L., Kote-Jarai, Z., Easton, D.F., Hubert, A., Hamoudi, R., Glaser, B., Abeliovich, D., Peretz, T., and Eeles, R.A. 2004, Int J Cancer, 108, 399.

198. Montgomery, K.G., Chang, J.H., Gertig, D.M., Dite, G.S., McCredie, M.R., Giles, G.G., Southey, M.C., Hopper, J.L., and Campbell, I.G. 2005, Breast Cancer Res, 7, R353.

199. Hughes, D.J., Ginolhac, S.M., Coupier, I., Barjhoux, L., Gaborieau, V., Bressac-de-Paillerets, B., Chompret, A., Bignon, Y.J., Uhrhammer, N., Lasset, C., Giraud, S., Sobol, H., Hardouin, A., Berthet, P., Peyrat, J.P., Fournier, J., Nogues, C., Lidereau, R., Muller, D., Fricker, J.P., Longy, M., Toulas, C., Guimbaud, R., Yannoukakos, D., Mazoyer, S., Lynch, H.T., Lenoir, G.M., Goldgar, D.E., Stoppa-Lyonnet, D., and Sinilnikova, O.M. 2005, Int J Cancer, 117, 230.

200. Yamashita, H., Nishio, M., Toyama, T., Sugiura, H., Kondo, N., Kobayashi, S., Fujii, Y., and Iwase, H. 2008, Endocr Relat Cancer, 15, 755.

201. Su, Q., Hu, S., Gao, H., Ma, R., Yang, Q., Pan, Z., Wang, T., and Li, F. 2008, Oncology, 75, 159. 202. Zhao, W., Zhang, Q., Kang, X., Jin, S., and Lou, C. 2009, Biochem Biophys Res Commun,

380, 699. 203. Hashimoto, Y., Naruyama, H., Ando, R., Okada, S., Tozawa, K., and Kohri, K. 2008,

Hinyokika Kiyo, 54, 57. 204. Chen, B., Wang, Y., Kane, S.E., and Chen, S. 2008, J Mol Endocrinol, 41, 367. 205. Iwase, H., Omoto, Y., Toyama, T., Yamashita, H., Hara, Y., Sugiura, H., and Zhang, Z. 2003,

Breast Cancer Res Treat, 80, 339. 206. Shiau, A.K., Barstad, D., Loria, P.M., Cheng, L., Kushner, P.J., Agard, D.A., and Greene,

G.L. 1998, Cell, 95, 927. 207. Gunther, J.R., Du, Y., Rhoden, E., Lewis, I., Revennaugh, B., Moore, T.W., Kim, S.H.,

Dingledine, R., Fu, H., and Katzenellenbogen, J.A. 2009, J Biomol Screen, 14, 181. 208. Shao, D., Berrodin, T.J., Manas, E., Hauze, D., Powers, R., Bapat, A., Gonder, D., Winneker,

R.C., and Frail, D.E. 2004, J Steroid Biochem Mol Biol, 88, 351. 209. Hossain, A., Kuo, M.T., and Saunders, G.F. 2006, Mol Cell Biol, 26, 8191. 210. Blenkiron, C., and Miska, E.A. 2007, Hum Mol Genet, 16 Spec No 1, R106. 211. Liang, J., Zhang, H., Zhang, Y., Zhang, Y., and Shang, Y. 2009, EMBO Rep, 10, 51. 212. Zou, J.X., Revenko, A.S., Li, L.B., Gemo, A.T., and Chen, H.W. 2007, Proc Natl Acad Sci

U S A, 104, 18067. 213. Yi, P., Wu, R.C., Sandquist, J., Wong, J., Tsai, S.Y., Tsai, M.J., Means, A.R., and O’Malley,

B.W. 2005, Mol Cell Biol, 25, 9687.

166 M. Ferrero and J. Font de Mora

214. Mani, A., Oh, A.S., Bowden, E.T., Lahusen, T., Lorick, K.L., Weissman, A.M., Schlegel, R., Wellstein, A., and Riegel, A.T. 2006, Cancer Res, 66, 8680.

215. Ferry, C., Gianni, M., Lalevee, S., Bruck, N., Plassat, J.L., Raska, I., Jr., Garattini, E., and Rochette-Egly, C. 2009, J Biol Chem,

216. Yeung, P.L., Zhang, A., and Chen, J.D. 2006, Biochem Biophys Res Commun, 348, 13. 217. Zhang, Y., Zhang, H., Liang, J., Yu, W., and Shang, Y. 2007, Embo J, 26, 2645. 218. Li, C., Liang, Y.Y., Feng, X.H., Tsai, S.Y., Tsai, M.J., and O’Malley, B.W. 2008, Mol Cell, 31, 835.

167M. Chatterjee and K. Kashfi (eds.), Cell Signaling & Molecular Targets in Cancer, DOI 10.1007/978-1-4614-0730-0_8, © Springer Science+Business Media, LLC 2012

Introduction

A decade ago, signal transducer and activator of transcription (STAT) proteins were discovered as latent cytoplasmic transcription factors [ 1 ] . Seven known mammalian STAT proteins – Stat1, 2, 3, 4, 5a, 5b, and 6 – are involved in cell proliferation, differentiation, and apoptosis [ 2– 12 ] . These proteins contain several domains: a tetramerization domain, a coil-coil domain, a DNA-binding domain, a linker domain, an Src-homology 2 (SH2) domain, a critical tyrosine residing near the C-terminal end (position 705 in Stat3), and a C-terminal transactivation domain [ 13 ] . STAT proteins are activated in response to the binding of a number of ligands to their cognate cell surface receptors, especially cytokines (e.g., IL-6) and growth factors (e.g., EGF). STAT proteins exist as monomers or N-terminal head-to-head dimers in the cytoplasm of non-stimulated cells [ 14 ] . Ligand binding to cytokine or growth factor surface receptors results in receptor dimerization and transphospho-rylation by receptor-intrinsic or receptor-associated tyrosine kinases. The kinases phosphorylate the cytoplasmic tails of the receptor to provide a docking site for the recruitment of monomeric STATs. STAT proteins are recruited to specifi c phospho-tyrosine residues within receptor complexes through their SH2 domains; they sub-sequently become phosphorylated on the tyrosine residue within their C-terminus, and dimerize through reciprocal interactions between the SH2 domain of one mono-mer and the phosphorylated tyrosine of the other. The activated dimers translocate to the nucleus, where they bind to DNA-response elements in the promoters of tar-get genes and activate specifi c gene expression programs (Fig. 8.1 ) [ 15– 17 ] . Previously reported X-ray crystal structures of Stat1 and Stat3 homodimers bound to DNA reveal many details involving dimerization and DNA binding [ 18, 19 ] .

N. Jing (*) Department of Medicine , Baylor College of Medicine , Houston , TX 77030, USA e-mail: njing@bcm.tmc.edu

Chapter 8 Rational Design of DNA Anticancer Agent That Targets Signal Transducer and Activator of Transcription 3 (Stat3) for Cancer Therapy

Naijie Jing

168 N. Jing

Stat3 was originally termed acute-phase response factor (APRF) because it was fi rst identifi ed as a DNA-binding activity within IL-6-stimulated hepatocytes, and was capable of selectively interacting with an enhancer element in the promoter of acute-phase response genes [ 12, 20, 21 ] . The protein derived from the livers of IL-6-treated mice was fi rst purifi ed to homogeneity, and its cDNA isolated and sequenced [ 22 ] . Receptors linked to Stat3 activation include: receptors for G-CSF (granulocyte colony-stimulating factor) and the IL-6 cytokine family members, as well as other type I and type II cytokine receptors; receptor tyrosine kinases; and G protein-cou-pled receptors [ 23 ] . In various in vitro systems, Stat3 activation downstream of these receptors has been demonstrated to infl uence multiple cell fate decisions, including proliferation [ 24 ] , differentiation [ 25– 27 ] , and apoptosis [ 5, 28 ] . Targeted disruption of the mouse Stat3 gene leads to embryonic lethality at 6.5–7.5 days [ 11 ] , indicating that Stat3 – which is essential to early embryonic development – is poten-tially involved in gastrulation or visceral endoderm function [ 2 ] . Moreover, the tis-sue-specifi c deletion of Stat3 has confi rmed in vitro results by demonstrating that Stat3 plays a crucial role in a variety of biological functions, including cell growth, the suppression and induction of apoptosis, and cell motility [ 2 ] .

Stat3 has been identifi ed as an important target for cancer therapy, since it par-ticipates in oncogenesis through the upregulation of genes encoding apoptosis inhibitors (Bcl-x

L , Bcl-2, Mcl-1, and survivin), cell-cycle regulators (cyclin D1 and

c- myc ), and inducers of angiogenesis (VEGF) [ 17 ] . Mounting evidence shows that Stat3 is constitutively activated in many human cancers [ 15– 17 ] , including: 82% of prostate cancers, 70% of breast cancers, more than 90% of head and neck cancers, and more than 50% of lung cancers [ 29– 32 ] . Recent studies have demonstrated that Stat3 is constitutively activated both in tumor cells and in immune cells in the tumor

Fig. 8.1 STAT signaling pathway

1698 GQ-ODN T40214, a Rational Designed Stat3 Inhibitor

microenvironment [ 33 ] . Constitutively activated Stat3 in tumor cells inhibits the expression of mediators necessary for immune activation against tumor cells and results in production of numerous mediators such as VEGF which inhibit dendritic cell function. In addition, activation of Stat3 in hematopoietic cells restrains natural tumor surveillance. Thus, targeting Stat3 is expected to decrease survival of tumor cells, inhibit tumor angiogenesis, and activate immune cells in the tumor stroma.

Developed Inhibitors of Stat3 Signaling

The design of Stat3 inhibitor is based on the mechanism of Stat3 activation. When stimulated by cytokines [ 34 ] , Janus kinases (Jak), growth factors (EGF, PDGF) or tyrosine kinases (Src) [ 35 ] , Stat3 is activated by phosphorylating the tyrosine resi-due Y705 for Stat3 dimerization. Phosphorylated Stat3 dimer translocates into the nucleus to bind with enhancer sequences of target genes. The crystal structure of p-Stat3 dimer with bound DNA duplex has been determined [ 18 ] , which makes it possible to discover Stat3 inhibitor by employing structure-based drug design tech-nology. Several strategies can be used to design a Stat3 inhibitor: (a) suppressing the expression of phosphorylated Stat3, (b) inhibiting upstream kinase activation such as Jak and Src to reduce the phosphorylation of Stat3, (c) blocking Stat3 dimeriza-tion, and (d) inhibiting the DNA elements to bind within Stat3 dimer. Currently, many inhibitors of Stat3 signaling have been developed. However, no anti-tumor drug directly targeting Stat3 has yet reached the clinic.

Organic Compounds

The following Stat3 inhibitors mainly target upstream regulators, such as Jak-Stat3 and Src/Stat3 signaling, to compete with associated receptor for Stat3 activation or to inhibit Stat3 dimerization: AG-490 is a potent inhibitor of protein tyrosine kinase that selectively inhibits Jak kinase, especially Jak2 kinase [ 36, 37 ] ; WP-1034 is a novel Jak-Stat inhibitor with a similar structure with AG-490 [ 38 ] ; and Cucurbitacin I (JSI-124), which was identifi ed as a novel Jak-Stat3 inhibitor, is a natural product, isolated from plants with the Cucurbitaceae and Cruciferae families, and has been used as a folk remedy in China and India for centuries [ 39 ] . Recently, Cryptotanshinone was demonstrated to inhibit constitutive Stat3 by blocking its dimerization and also to suppress JAK2 as a secondary effect [ 40 ] .

Peptide Inhibitors

PY*LKTK (Y* means phosphotyrosine) was exactly the same as the segment of monomer Stat3 starting from residue P704 to residue K709 to mimic the interaction between two Stat3 monomers [ 41 ] ; Y1068 ( 1063 LPVPEY*INQSVP 1074 ) inhibited

170 N. Jing

EGF-stimulated Stat3 activity and transforming growth factor (TGF)- a /EGFR-mediated autocrine growth when delivered into cancer cells [ 42 ] ; and 904 Y*LPQTV 909 was a Stat3 inhibitor by mapping gp130 residues starting from Y904 to V909 [ 43 ] .

DNA Inhibitors

Decoy oligonucleotide was composed of a 15-mer double-stranded oligonucleotide, and the sequences were close to the Stat3 response element within the c-fos pro-moter [ 44 ] ; Antisense oligos, which target Stat3 or a dominant-negative Stat3 (DN-Stat3) plasmid, reduce Stat3 protein level in cytoplasm [ 45– 47 ] .

Protein Inhibitors

PIAS are able to disrupt STAT DNA-binding activity by direct association with STAT proteins [ 48, 49 ] ; SOCS (suppressors of cytokine signaling) family, which were also referred to as JAB (Jak-binding protein) or SSI (Stat-induced Stat inhibi-tors) [ 50– 52 ] , and phosphatases T cell PTP (TC-PTP), PTP-1B, SHP-1, and SHP-2 have been characterized as another class of inhibitors to Jak-STAT signaling [ 53 ] . Receptor-related phosphatases consist of three major regions: phosphotyrosine-binding SH2 motifs, a phosphatase domain, and regulatory tyrosine residues which are responsible for specifi c phosphorylation.

G-Quartet Oligodeoxynucleotides (GQ-ODNs) as a Potential Anticancer Drug

G-quartet oligonucleotides (ODNs) were originally examined as modifi ed substrate drug candidates based on their ability to inhibit telomerase activity, c- myc transcrip-tion, HIV infection, and DNA topoisomerase I activity in cells [ 54, 55 ] . We suggested that this new class of drugs could be engineered to potently and selectively inhibit another key oncogenic protein – Stat3 [ 54 ] . GQ-ODN is composed of G-rich DNA sequences, which have been identifi ed, cloned, and characterized in the telomeres of many organisms (e.g., fungi, ciliates, vertebrates, and insects) [ 56 ] . G-quartet structures, which were initially observed within telomeres, can be formed by G-rich oligonucle-otides [ 57 ] . In addition to telomeric sequences [ 58– 60 ] , G-quartet structures have been shown in vitro in: fragile X syndrome nucleotide repeats [ 61 ] , HIV-1 RNA sequences [ 62, 63 ] , and the immunoglobulin switch region [ 64 ] . G-quartets emerge from the association of four G-bases into a cyclic Hoogsteen H-bonding arrangement. Each G-base makes two H-bonds with its neighbor G-base (N1 to O6 and N2 to N7) (Fig. 8.2 ). G-quartets stack on top of one another, creating tetrad-helical structures,

1718 GQ-ODN T40214, a Rational Designed Stat3 Inhibitor

and forming a family of structures that includes folded G-quartets produced by intramolecular interactions, as well as hairpin dimers and parallel-stranded tetramers resulting from intermolecular interactions. The formation of G-quartet structures depends on the DNA sequence, loop geometry, base composition of the nucleic acids, and the presence of metal ions [ 65– 68 ] . It has been observed that K + prefers to induce a folded G-quartet structure, while Na + preferentially forms a linear four-strand G-quartet structure [ 69 ] . The preference for inducing a folded G-quartet structure by metal ions has been proposed as K + > Rb + > Na + > Li + or Cs + [ 69, 70 ] . In general, G-quartet structures are very stable; however, their stability depends on the presence of monovalent cations and the concentration of G-rich oligonucleotides [ 71– 74 ] . Because of its optimal size, the interaction of potassium within a G-octamer greatly increases structural stability. Furthermore, the high intracellular K + concentration (140 mM) signifi cantly promotes formation of folded G-quartet structures within the cytoplasm, greatly increasing their biological activity [ 75 ] .

We, and others, have reported that G-rich ODNs – in our case, T30923 (also called T30695) and T30177 (also called AR177), which are both inhibitors of HIV-1 integrase – form an intramolecular G-quartet. These structures have been defi ned by nuclear magnetic resonance (NMR), circular dichroism, modeling, kinetics, and other biophysical methods [ 76– 78 ] . The fi ndings demonstrate that T30923 forms two kinds of G-quartet structures, those with unfolded and folded loop domains. Potassium ions induce a conformational transition from an unfolded G-quartet to a folded G-quartet in which K + ions are bound into the structure [ 75 ] . Only the structure with folded loop domains demonstrates pharmacologic activity. The principal diffi culty in developing GQ-ODN as a pharmacologic agent arises from the physical and structural properties of GQ-ODN. With a large molecular size, GQ-ODN cannot directly penetrate cell membranes. In order to address this issue, we have developed a novel delivery system for GQ-ODN that increases drug activity in cells and in vivo [ 79, 80 ] . This quartet struc-ture enables interaction with the molecular target and resists endonuclease digestion.

Fig. 8.2 H-bond formation of G-quartet bases

172 N. Jing

Rational Design of G-Rich ODNs That Target Stat3 Signaling

Structure-Based Drug Design

Computer-assisted rational drug design has been wildly used to search or screen a novel drug in many medicinal areas. The structure-based drug design is based on two critical conditions: (a) The molecular structure of the target molecule has been well determined or established, which contains a potential binding site to inhibit its activation. (b) The complex of target-molecular/inhibitor obtained from computa-tional docking is a reasonable starting point for predicting effects of designed inhib-itors. Establishing a structure–activity relationship (SAR) is a critical step to direct the search of a lead compound for drug development.

A panel of G-rich ODNs that are capable of forming G-quartet structures was designed as potential inhibitors of Stat3 candidates [ 79 ] . Each of the GQ-ODNs was randomly docked onto the known structure of the Stat3 dimer [ 18 ] 1,000 times using GRRAM docking program. H-bonds play a very important role in governing the interaction between proteins and DNA. The distribution of H-bonds that formed between Stat3 and each GQ-ODN demonstrated a potential binding site in Stat3 dimer for the GQ-ODN [ 79 ] . Analysis of the distribution can predict the ability of each GQ-ODN to inhibit Stat3 activation. Then electrophoretic mobility shift assay (EMSA) was employed to determine activity of the inhibition of Stat3 activation for each GQ-ODN. Combining the percentage of H-bonds of each GQ-ODN binding within the site, which is composed of residues 638–652 of Stat3 dimer, with its IC50 of the inhibition of Stat3 activation together, a linear structure-activity relationship (SAR) between Stat3 and GQ-ODNs was established (Fig. 8.3 a and Table 8.1 ) [ 79 ] . The SAR showed that T40214 with the highest possibility (40%) to interact with Stat3 dimer corresponds to the strongest activity to inhibit Stat3 activation (IC

50 = 5 m M). Thus, T40214 with sequence of (GGGC)

4 was selected as a lead com-

pound, which forms an intramolecular G-quartet structure with two G-quartets in the middle and a G-C-G-C loop on the top and the bottom determined by NMR (Fig. 8.3b ) [ 77, 81 ] .

GQ-ODN T40214 Selectively Inhibiting Stat3 Activation

Selectively targeting Stat3 is not only a key factor but also a challenge issue in the design of a potent and specifi c anti-cancer agent. Besides Stat3, other STAT family members have important roles in intracellular signaling. Stat1 acts in a pro- apoptotic and anti-proliferative manner and appears to be a tumor suppressor whose action is contrary to Stat3 [ 17 ] . Also, the INF- g activated Stat1 results in transcription of pro-infl ammatory cytokine and chemokine genes, which induce migration of effec-tive T cells to the tumor site and then penetration of the tumors [ 82 ] . Thus, selective targeting of Stat3, rather than Stat1, is a critical issue in the development of an effective

1738 GQ-ODN T40214, a Rational Designed Stat3 Inhibitor

Fig. 8.3 ( a ) Plot demonstrating a linear relationship of the percentage of GQ-ODN H-bonding localized in residues 638–652 of Stat3 dimer versus its IC50 against Stat3 (R 2 = 0.9) [ 79 ] . ( b ) Structure of T40214 [ 80 ]

Table 8.1 IC50s and binding possibility of the designed G-rich ODNs [ 79 ]

ÿ ÿ IC 50

( m M) % of H-bonds in the site of Stat3

T40214 GGGCGGGCGGGCGGGC 5.0 40 T40212 GGGCGGGTGGGCGGGT 35 30 T40215 (GGGGT)

4 49 28

T40217 GGGGTGGGTGGGTGGGTT 64 27 T40229 TAGGGTGGGTGGGTGGGTAT 41 29 T40230 GTGGGTGGGTGGGTGGGTTG 43 28 T40231 GGTGGGTGGGTGGG 10 37 T40233 GGGCGGGTGGGCGG 34 29

174 N. Jing

Stat3 inhibitor. However, selectively targeting Stat3 rather than Stat1 is diffi cult since (a) Stat3 and Stat1 have similar structures [ 18, 19 ] . Protein sequences demon-strate 51%, 60%, and 66% identity in the Stat1 and Stat3 full length, SH2 domain, and DNA-binding domain, respectively. (b) Both are phosphorylated on tyrosine residues, and both form dimers through SH2 domain interactions. (c) Stat3 and Stat1 can also form a heterodimer in activation. To confi rm whether the GQ-ODN selectively inhibits Stat3, T40214 was examined to inhibit the DNA-binding activity of IL-6-activated Stat3 and IFN- g -activated Stat1 via EMSA. T40214 strongly inhibited the DNA binding of Stat3 (IC

50 = 5 m M), while 50% inhibition of Stat1

DNA binding was not achieved under the same conditions, using concentrations of T40214 up to 142 m M (Fig. 8.4a ) [ 83 ] . Also, T40214 was demonstrated to not inhibit other Stats, e.g., Stat5 [ 84 ] .

The mechanism responsible for T40214 selectively targeting Stat3 was deter-mined by computational studies. First, GQ-ODN T40214 was randomly docked onto the dimer structures of both Stat3 and Stat1 (1,000 times), without setting any constraints, and the distributions of H-bonds formed between GQ-ODN and Stat3 dimers and between GQ-ODN and Stat1 dimers were analyzed. The histograms of H-bond distributions show clearly that the interaction between GQ-ODN T40214 and the Stat3 dimer was highly concentrated on the binding site composed of amino acids 638–652 (40%) – especially in the residues Q643, N646, and N647. However, specifi c binding interaction did not occur within the Stat1 dimer (Fig. 8.4b ) [ 83 ] . Then, a high-resolution GRAMM docking program was employed to predict how GQ-ODN selectively targets the Stat3 dimer. The lowest energy complexes obtained from the dockings show that in the Stat3 dimer, residue Q643 of one monomer repels N646 of another due to the presence of similarly charged polar side chains. This interaction opens a channel (~9 Å) in the SH2 domains. In contrast, in Stat1, K637 of one monomer interacts with S640 of another, which pulls two domains together and blocks GQ-ODN interaction (Fig. 8.4c ) [ 83, 85 ] . The docking results also demonstrate that residues in the loop domains of GQ-ODN form seven H-bonds with residues Q643 to N647 and tightly bind into the Stat3 site, thereby blocking Stat3 DNA binding and destabilizing dimer formation. In contrast, GQ-ODN can-not bind within the Stat1 dimer to block Stat1 DNA binding.

An Effective Drug Delivery System for GQ-ODNs

An effective intracellular delivery system is essential for successful development of DNA anti-cancer agent. The principal diffi culty of delivering GQ-ODNs into cells arises from the physical and structural properties of GQ-ODNs. GQ-ODN with a large molecular size cannot directly penetrate through cell membranes. Recently, we have developed an effective intracellular delivery system for GQ-ODNs (Fig. 8.5a ) [ 75, 86 ] . The important development in this system is that based upon the property of potassium-dependent formation of G-quartet structure. In solution, the complex of GQ-ODN/K + has a neutral surface charge and cannot effectively bind cationic vehicles. When heated, however, G-quartet oligos denature into random coils which permit the

1758 GQ-ODN T40214, a Rational Designed Stat3 Inhibitor

Fig. 8.4 GQ-ODN T40214 specifi cally targets p-Stat3 dimer. ( a ) Data from EMSA assays. ( b ) Histograms of the number of H-bonds versus amino acids of Stat1 ( top panel ) and Stat3 ( lower panel ). ( c ) Docking complexes of T40214/Stat1 ( left panel ) and T40214/Stat3 ( right panel ) [ 83 ]

176 N. Jing

electrostatic interactions necessary for forming the GQ-ODN/vehicle complexes. The T40214/PEI complex was formed by mixing the denatured T40214 (possessing negative charges) with PEI (polyethylenimine), which is positively charged. The positive charges on the surface of the T40214/PEI complexes enhance their cellular uptake. Formation of the active G-quartet structure depends on the presence of cat-ions, especially potassium. The intracellular potassium concentration of 140 mM (compared to the 4-mM extracellular concentration) is well above the 50-mM KCl concentration required for T40214 G-quartet formation. Thus, T40214 molecules maintain their unfolded structure before entering cells. Once delivered, T40214 forms a G-quartet structure in the high intracellular K + concentration to bind within p-Stat3 dimers, and penetrates into the nucleus through nuclear pores to block Stat3 transcription. PEI facilitates delivery of T40214 to target cells for endocytosis, but PEI itself does not enter cells due to its positive surface charges [ 86 ] .

Fig. 8.5 ( a ) A novel delivery system built for GQ-ODN T40214. ( b ) Non-denatured DNA gel demonstrating drug delivery of T40214 into cells. T40214/PEI (Lane 2) appears as two bands: The higher band corresponds to ODNs adhering on cell membranes (a large-sized molecule with slower migration), while the lower band corresponds to the ODNs released inside cells. T40214 in the absence of PEI (Lane 3) appears as a single, higher band, indicating that T40214 cannot penetrate cells directly [ 86 ]

1778 GQ-ODN T40214, a Rational Designed Stat3 Inhibitor

To determine whether T40214 was delivered into the cells and whether T40214 forms a G-quartet structure inside cells, the experiments were performed as described previously [ 86 ] . In the non-denatured polyacrylamide gel (Fig. 8.5b ), the free T40214 (Lane 1) corresponds to a G-quartet structure. T40214 with PEI (Lane 2) has two bands, indicating that a portion of the ODN adhered to cell membranes (the higher band), and a portion of ODNs entered into the cells (the lower band). Based on the same migration with free T40214, the GQ-ODN inside the cells formed the G-quartet structure. Analysis of the band intensities indicated that the ratio of deliv-ery of T40214 is about 72%. T40214 without PEI (Lane 3) has only a single higher band in the gel, demonstrating that T40214 did not directly penetrate into cells.

The Drug Activity of GQ-ODN Was Greatly Increased by the Effective Delivery

Drug Activity in Cancer Cells

Western blots (Fig. 8.6a ) showed that pre-incubation of cancer cells with the T40214/PEI complex (upper panel) completely inhibited IL-6-mediated activa-tion of Stat3 while Stat1 activation was minimally affected, confi rming the selec-tivity of T40214 for Stat3 within cells. Pre-incubation of cancer cells with T40214 only (no PEI) (lower panel) showed that neither Stat3 nor Stat1 activation was inhibited, confi rming that PEI is required for delivery of GQ-ODN into cells. To determine if GQ-ODN interferes with Stat3 activation and translocation into the nucleus, we examined levels of p-Stat3 within the nuclei of cells stimulated with IL-6 following GQ-ODN pre-treatment. The nuclear p-Stat3 level was reduced 50–70% when the T40214 concentration was increased from 3.5 to 142 m M (Lanes 4–7) (Fig. 8.6b ) [ 79 ] . Also, the result shows that T40214 only inhibits the activa-tion of phosphorylated Stat3 (p-Stat3) but not that of unphosphorylated Stat3 (total Stat3 or T-Stat3).

Drug Delivery and Activity In Vivo

5’-Fluorescently labeled T40214 (10 mg/kg) plus PEI (2.5 mg/kg) was adminis-tered via intraperitoneal (IP) injection in xenograft tumors of nude mice. After injections, tumors were harvested at 24, 48, and 72 h and examined by fl uorescence microscopy. At 48 and 72 h, the level of GQ-ODN in tumors was roughly 60% and 20%, respectively, of that at 24 h (Fig. 8.6c ) [ 83 ] . GQ-ODN is effectively delivered to and has prolonged presence within tumor cells. Then, T40214 with and without PEI was injected via IP (intraperitoneal) route into nude mice with prostate tumors every other day for 3 weeks. Compared with tumor growth in control and PEI-treated mice, tumor growth in T40214-treated mice was only minimally inhibited ( p = 0.021 to untreated tumors & p = 0.23 to PEI-treated tumors); however, tumor

178 N. Jing

Fig. 8.6 ( a ) EMSA of extracts of cancer cells stimulated with IL-6 (25 ng/ml) after pre-incubation of cells with T40214 complexed with ( top panel ) or without ( lower panel ) PEI. Extracts were incubated with antibodies against Stat1 (Ab1; lane 1) or Stat3 (Ab3; lane 2) to confi rm the compo-sition of the homodimer bands [ 79 ] . ( b ) Immunoblot of nuclear extracts of cancer cells pre-incu-bated with media, PEI, or T40214 demonstrated that T40214 suppresses the level of phosphorylated Stat3. Equal amount of total Stat3 protein was loaded in each lane as control [ 79 ] . ( c ) Fluorescent micrographs show the distribution of labeled T40214 in HNSCC tumors of nude mice after 24, 48, and 72 h of drug administration. The control panel indicates the tumor without drug injection [ 83 ] . ( d ) PEI as vehicle signifi cantly increases T40214 drug activity in vivo [ 86 ]

1798 GQ-ODN T40214, a Rational Designed Stat3 Inhibitor

growth was signifi cantly suppressed by the T40214/PEI complex ( p < 0.0005 and p < 0.004) (Fig. 8.6d ) [ 86 ] . Therefore, an effective delivery system signifi cantly increases T40214 drug activity and is a key factor for T40214 in clinical testing.

T40214 Suppresses the Growth of Prostate Tumor Xenografts in Nude Mice

Prostate Cancer Therapy

Prostate cancer is the most frequently diagnosed cancer among men in the United States and is second only to lung cancer as a cause of cancer death [ 87 ] . Prostate cancer initially occurs as an androgen-dependent tumor. Patients with metastatic disease respond initially to androgen-ablation therapy; however, when the disease recurs, it is often insensitive to hormonal manipulation [ 88, 89 ] . Salvage therapy for hormone refractory metastatic disease includes chemotherapeutic agents which can have undesirable side effects and produce relatively short survival periods. In fact, median survival is only 18.9 months even with the most active chemotherapeutic agents [ 90 ] . Therefore, novel therapies, including agents with different therapeutic mechanisms of action and novel molecular targets, are urgently needed to treat pros-tate cancer patients. Stat3 is constitutively activated in many human cancers, includ-ing 82% of prostate cancers [ 30 ] . Therefore, Stat3 signaling was proposed to strongly infl uence progression of prostate cancer, and targeting Stat3 with T40214 could produce a novel and effective treatment for prostate cancer. Approximately 2.5–4.0 million cancer cells in 200 m l of PBS were injected subcutaneously into the right fl ank of athymic nude mice. After tumors were established (50–150 mm 3 ), mice were randomly assigned to several groups: Group 1, untreated controls; Group 2 received treatment with PEI alone; Group 3 was treated with non-specifi c ODN/PEI (a control ODN); Group 4 was treated with T40214 without PEI; Group 5 was treated with paclitaxel, a chemotherapeutic agent, as positive control; and Groups 6 and 7 were treated with T40214/PEI at doses of 5 and 10 mg/kg, respectively. Each group was composed of fi ve mice. The nude mice received IP injection every other day for 24 days. Body weight and tumor size were measured every other day, and tumor size was calculated using the function (a × 0.5b 2 ), where a equals the length, and b equals the width of tumors. The results (Fig. 8.7 and Table 8.2 ) [ 86 ] demon-strated that GQ-ODN T40214 caused signifi cant suppression of tumor growth and increased survival time in a nude mouse xenograft model of prostate cancer.

Other Solid Tumor Therapies

Innovative treatment approaches, including new agents with different therapeutic mechanisms of action and novel molecular targets, are urgently needed for many human cancers (e.g., breast cancer, non-small cell lung cancer [NSCLC], squamous

180 N. Jing

Fig. 8.7 ( a ) Prostate tumors treated by paclitaxel and T40214 in 16 and 24 days. ( b ) Plot of tumor volume (mm 3 ) versus days of treatment. ( c ) The effects of the treatments on animal survival show that 50% of the mice remained alive in the untreated, placebo-treated, and ns-ODN-treated mice in 7, 12, and 10 days, respectively. Paclitaxel treatment extended the 50% survival point to 18 days. The 50% survival point for both T40214/PEI-treated mice was ³ 24 days with 100% of the mice in the 10-mg/kg group surviving to 24 days [ 86 ]

1818 GQ-ODN T40214, a Rational Designed Stat3 Inhibitor

Tabl

e 8.

2 In

viv

o ef

fect

s of

T40

214/

PEI

agai

nst P

C-3

xen

ogra

ft tu

mor

s in

nud

e m

ice

[ 86 ]

Gro

up

Dru

g do

se

No.

of

mic

e W

eigh

t of

mic

e (g

) T

umor

(m

m 3 )

Fo

ld o

f tu

mor

gr

owth

M

ean

tum

or

wei

ght (

g)

P va

lue

Star

t E

nd

Star

t E

nd

Star

t E

nd

Con

trol

U

ntre

ated

5

5 27

.2 ±

1.5

25

.2 ±

1.7

93

.1 ±

25

2,63

3 ±

657

41

.20

± 9

.30

1.37

± 0

.37

– PE

I al

one

3.75

mg/

kg

5 5

24.9

± 1

.7

23.7

± 1

.2

58.3

± 7

.9

1,92

4 ±

374

40

.85

± 7

.95

1.32

± 0

.58

– ns

-OD

N/P

EI

5 +

1.2

5 m

g/kg

5

5 27

.2 ±

1.5

22

.3 ±

1.6

67

.9 ±

12

2,36

2 ±

565

40

.79

± 9

.75

1.61

± 0

.38

– T

4021

4 10

mg/

kg

5 5

25.1

± 0

.5

22.2

± 1

.9

55.7

± 4

.9

1,32

7 ±

333

23

.82

± 5

.97

1.50

± 0

.40

– Pa

clita

xel

10 m

g/kg

5

5 18

.6 ±

1.0

20

.6 ±

1.0

70

.7 ±

7.3

67

2 ±

300

9.

50 ±

5.6

7 0.

47 ±

0.2

2 <

0.0

05

T40

214/

PEI

5 +

1.2

5 m

g/kg

5

5 25

.5 ±

0.7

26

.8 ±

1.5

72

.9 ±

8.3

32

9 ±

147

5.

15 ±

2.3

1 0.

38 ±

0.1

4 <

0.0

01

T40

214/

PEI

10 +

2.5

mg/

kg

5 5

25.3

± 1

.1

26.5

± 1

.6

91.0

± 1

6 55

± 3

8 0.

61 ±

0.4

1 0.

18 ±

0.1

0 <

0.0

005

182 N. Jing

cell carcinoma of head and neck [SCCHN], and other cancers). In recent years, mounting evidence has indicated that Stat3 is an important target for cancer therapy, since Stat3 participates in oncogenesis through the upregulation of genes encoding apoptosis inhibitors, cell-cycle regulators, and inducers of angiogenesis. Stat3 is constitutively activated in many human cancers – including SCCHN, NSCLC, breast, and other cancer cells. T40214 has also been demonstrated to signifi cantly suppress the growth in nude mice of other tumors, including breast cancer [ 79 ] , head and neck squamous cell carcinoma (HNSCC) [ 83 ] , and non-small cell lung cancer (NSCLC) [ 84 ] (Fig. 8.8 ). The in vivo results provided solid evidence that T40214 is a promising candidate of anti-cancer agent that targets Stat3 for treatment of human cancers.

The Mechanism of GQ-ODN T40214 as a Potent Anticancer Agent

The Mechanism of T40214 Suppression of Tumor Growth

The tumor tissues which were harvested from mice at the end of drug treatment periods were examined by western blot and TUNEL assays [ 86 ] . The results dem-onstrate that Stat3 proteins were constitutively phosphorylated in androgen-inde-pendent prostate tumors (PC-3) and that activation of p-Stat3 in the tumors was totally inhibited by the T40214/PEI complex (Fig. 8.9a ). In addition, delivery of T40214 completely inhibited the expression of p-Stat3 downstream proteins, includ-ing Bcl-2, VEGF, and cyclin D1, in the prostate tumors. Finally, TUNEL assays demonstrated signifi cant apoptosis in the T40214/PEI-treated tumor. The mean per-centage of apoptotic cells in placebo-treated tumors was 10% ± 5% and that in T40214-treated mice was 80% ± 5% [ 86 ] . Moreover, it has been demonstrated that GQ-ODN T40214 signifi cantly inhibited Stat3 activation, but did not inhibit the activation of Stat1 and Stat5 in tumors, showing T40214 selectively targets phos-phosrylated Stat3 in vivo as well [ 84 ] .

T40214 as an Anticancer Agent Targeting Stat3 Signaling for Cancer Therapy

Putting all together, we established a system that targets the Stat3 signaling pathway, via GQ-ODN T40214, for cancer therapy (Fig. 8.9b ). Monomers of Stat3 in the cytoplasm of cancer cells become activated through the stimulation by IL-6 or EGF. Stat3 is also recruited by intrinsic or receptor-associated tyrosine kinases, such as JAK or Src. Tyrosine phosphorylation of Stat3 induces the formation of active Stat3 dimers through the SH2 domains, and the activated Stat3 dimers translocate to the nucleus, where they bind to DNA-response elements in the promoters of target genes and activate specifi c gene expression programs [ 16– 18 ] . GQ-ODN T40214 is

1838 GQ-ODN T40214, a Rational Designed Stat3 Inhibitor

delivered into the cytoplasm by PEI. In cytoplasmic K + concentrations, T40214 forms G-quartet structures, binds to the SH2 domains of p-Stat3 dimers, and blocks DNA-binding activity. T40214 binding induces p-Stat3 dephosphory lation and may retard Stat3 rephosphorylation in cancer cells by inhibiting Stat3 recirculation.

Fig. 8.8 The photos of in vivo drug tests of T40214/PEI in NSCLC tumors (I) and in SCCHN tumors (II) [ 83, 84 ]

184 N. Jing

The inhibition of Stat3 activation disrupts the translation of Stat3-regulated genes, including those encoding anti-apoptotic proteins (Bcl-2, Bcl-x

L , Mcl-1, and sur-

vivin), cell-cycle regulators (cyclin D1 and c- myc ), and inducers of angiogenesis (VEGF) [ 84, 86 ] . Consequently, T40214 – with the inhibition of Stat3 activation – signifi cantly promotes apoptosis, reduces angiogenesis and cell proliferation, and strongly suppresses tumor growth.

Fig. 8.9 ( a ) Western blots were performed in prostate tumors that were harvested from the mice at the end period of drug treatments, including one sample of untreated tumors as a control and two samples of PEI-, ns-ODN (control ODN), and T40214-treated tumors, respectively [ 86 ] . ( b ) The pathway of inhibition of Stat3 by GQ-ODN T40214 in cancer therapy

1858 GQ-ODN T40214, a Rational Designed Stat3 Inhibitor

Toxicity of GQ-ODN T40214/PEI Complex

Toxicity of GQ-ODNs: G-Quartet ODNs Are Low-Toxicity Agents

Toxicity studies have been reported for AR177, an analogue of GQ-ODN T40214 [ 91 ] . GQ-ODN exhibited no genetic toxicity in three different mutagenic assays: Ames /Salmonella mutagenesis assay, CHO/HGPRT mammalian cell mutagenesis assay, and mouse micronucleus assay. Acute toxicity studies in mice showed that GQ-ODN had an LD50 (the lethal dose to half of the animals) of 1.5 g/kg body weight, which is more than 150-fold higher than our in vivo therapeutic dose. Also, the multiple-dose-toxicity studies in mice showed that GQ-ODN did not cause spe-cifi c mortality and changes in serum chemistry, hematology, and histology until doses reached 600 mg/kg, which are >60-fold that of therapeutic level. Clinical chemistry fi ndings included changes in liver function and decreased erythrocyte values at 250 and 600 mg/kg.

Toxicity of PEI

PEI (polyethylenimine, 25 K) as a DNA carrier has been widely used due to its high delivery effi ciency and low toxicity [ 92, 93 ] . The ratio of PEI to DNA is critical for complex formation. PEI as a DNA carrier has a positively charged molecular sur-face that improves binding with DNA oligos and increases delivery effi ciency since the positive charges enhance cellular uptake [ 94, 95 ] . PEI also protects DNA against nuclease cleavage; however, excessive PEI (or using it alone) could cause toxicity. The N/P ratio (nitrogen atoms of PEI to DNA phosphates) determines the positive net charge of the PEI/DNA complex, which dramatically infl uences the effi ciency of the DNA delivery system. Previous studies suggest that when an N/P ratio is lower than 3.0, PEI has the highest effi cacy and lowest toxicity in animal studies; decreasing the N/P ratio by decreasing the cationic charge density is benefi cial for the in vivo microenvironment [ 95 ] .

T40214/PEI Complex Shows No Toxicity

Based on the structure and sequence of T40214, the N/P ratio of T40214/PEI com-plex in our studies was adjusted to lower than 2.7. At this ratio, we did not fi nd any toxicity induced by T40214/PEI complex in normal epithelial cells and in normal tissues. TUNEL assay was used to determine the effect of T40214/PEI on apoptosis in normal epithelial cells compared to malignant epithelial cells. As shown in Fig. 8.10a , the cancer cells (HepG2) (lower panels) and normal epithelial cells (NRK-52E) (top panels) were pre-incubated with PEI alone (middle panels) or T40214/PEI complex (right panels) under the same conditions for 24 h. Apoptotic cells stained in dark brown in photomicrographs. Compared with control cells

186 N. Jing

Fig. 8.10 ( a ) TUNEL of T40214/PEI complex in cancer and normal cells. Apoptosis cells stained in dark brown. ( b ) Western blots showed that Stat3 was not constitutively phosphorylated in nor-mal tissues, and T40214 does not inhibit the unphosphorylated Stat3 (T-Stat3) in normal tissues. The control sample was harvested from a tumor in an untreated mouse. ( c ) TUNEL of T40214/PEI in NSCLC tumors and normal tissues, which were harvested from the tissues around the NSCLC tumors in mice

1878 GQ-ODN T40214, a Rational Designed Stat3 Inhibitor

(left panels), PEI did not induce apoptosis in cancer or normal epithelial cells (middle panels). In contrast, T40214 (right panels) signifi cantly increased apoptosis in cancer cells, where p-Stat3 is activated, but not in normal epithelial cells, demon-strating that T40214/PEI is not toxic to normal cells.

To determine whether T4021/PEI induces toxicity in normal animal tissues by inhibiting p-Stat3 activation, we harvested the normal tissues (e.g., kidney and liver) from the animals grown with prostate tumors (PC3): two samples from untreated and two samples from T40214/PEI-treated (10 + 2.5 mg/kg) nude mice. Western blots (Fig. 8.10b ) demonstrated no phosphorylated Stat3 (p-Stat3) in normal tissues. This may be a result of the rapid dephosphorylation of Stat3 in normal cells in con-trast to tumors cells [ 96 ] . T40214/PEI did not decrease expression of total Stat3 (T-Stat3) in normal tissues, consistent that T40214/PEI only reduced levels of phos-phorylated Stat3, but not total Stat3, in tumors (Fig. 8.9a ). Also, we performed TUNEL staining to determine if T40214/PEI induces apoptosis of normal tissues. The samples were harvested from NSCLC tumors (Fig. 8.10c , lower panels) and the normal tissues grown around the NSCLC tumors (Fig. 8.10 c upper panels) in nude mice xenografts. PEI alone did not induce apoptosis in either normal or tumor cells assessed by TUNEL staining; however, T40214/PEI signifi cantly promoted apopto-sis in tumor cells but not in normal cells. Thus, the T40214/PEI complex would be expected to demonstrate low toxicity in clinical trials.

Summary

Stat3: An Important Target in Cancer Therapy

Stat3 has been identifi ed as an important target for cancer therapy since Stat3, which is constitutively activated in many human cancers, participates in oncogenesis through the upregulation of genes encoding apoptosis inhibitors, cell-cycle regula-tors, and inducers of angiogenesis. Also, Stat3 is constitutively activated both in tumor cells and in immune cells in the tumor microenvironment. Constitutively activated Stat3 in tumor cells inhibits the expression of mediators necessary for immune activation against tumor cells and results in production of numerous media-tors such as VEGF which inhibit dendritic cell function. Therefore, targeting Stat3 can produce a novel and effective treatment for human cancers.

Potential Impact of T40214 on Cancer Therapy

We have laid the initial groundwork in the development of the G-quartet oligode-oxynucleotide (GQ-ODN) T40214 as a potent inhibitor of Stat3, which has several unique features. First, T40214 selectively targets phosphorylated Stat3 in vitro and

188 N. Jing

in vivo. The phosphorylated Stat3 participates in oncogenesis through the upregulation of genes encoding apoptosis inhibitors, cell-cycle regulators, and inducers of angio-genesis. Activation of Stat3 also has a role in protecting cancer cells from the immune system. Second, by inhibition of Stat3 activation, T40214 promotes apop-tosis, reduces angiogenesis and cell proliferation, and signifi cantly suppresses tumor growth in animal models, including prostate, breast, head and neck, and lung cancers. Third, T40124 has been showed to have a prolonged in vivo effect and signifi cantly increased the survival of mice with the androgen-independent prostate tumors. Finally, the animal studies showed that T40214 appears to be nontoxic with fewer side effects than chemotherapeutic agents that are now used to treat patients. Therefore, T40214 could provide a novel strategy for cancer therapy and is expected to have potential benefi ts for the patients with cancers in clinical treatments.

Acknowledgments Author greatly appreciates all the post doctors, staffs, and collaborators who made contributions to develop GQ-ODN T40214 as an anticancer agent. This project was mainly supported by grants DOD PC020407 and R01 CA104035.

References

1. Darnell JE. 1997, Science, 277, 1630–5. 2. Akira S. 2000, Oncogene, 19, 2607–11. 3. Bromberg JF, Horvath CM, Wen Z, Schreiber RD, Darnell JE. 1996, Proc Natl Acad Sci USA,

93, 7673–8. 4. Cressman DE, Greenbaum LE, DeAngelis RA, Ciliberto G, Furth EE, Poli V, Taub R. 1996,

Science, 274, 1379–83. 5. Fukada T, Hibi M, Yamanaka Y, Takahashi-Tezuka M, Fujitani Y, Yamaguchi T, Sugiyama K,

Yamanaka Y, Nakajima K, Hirano T. 1996, Immunity, 5, 449–60. 6. Hirano T, Ishihara K, Hibi M. 2000, Oncogene, 19, 2548–56. 7. Ihle JN. Cytokine receptor signalling. 1995, Nature, 377, 591–4. 8. Kaplan MH, Sun YL, Hoey T, Grusby MJ. 1996, Nature, 382, 174–7. 9. Smithgall TE, Briggs SD, Schreiner S, Lerner EC, Cheng H, Wilson MB. 2000, Oncogene,

19:2612–8. 10. Stephens JM, Morrison RF, Pilch PF. 1996, J Biol Chem. 271, 10441–4. 11. Takeda K, Noguchi K, Shi W, Tanaka T, Matsumoto M, Yoshida N, Kishimoto T, Akira S.

1997, Proc Natl Acad Sci USA. 94, 3801–4. 12. Zhong Z, Wen Z, Darnell JE. 1994, Science, 264, 95–8. 13. Zhang X, Blenis J, Li HC, Schindler C, Chen-Kiang S. 1995, Science, 267, 1990–4. 14. Braunstein J, Brutsaert S, Olson R, Schindler C. 2003, J Biol Chem. 278, 34133–40. 15. Bowman T, Garcia R, Turkson J, Jove R. 2000, Oncogene, 19, 2474–88. 16. Buettner R, Mora LB, Jove R. 2002, Clin Cancer Res. 8, 945–54. 17. Yu H, Jove R. 2004, Nat Rev Cancer, 4, 97–105. 18. Becker S, Groner B, Muller CW. 1998, Nature, 394, 145–51. 19. Chen X, Vinkemeier U, Zhao Y, Jeruzalmi D, Darnell JE, Jr., Kuriyan J. 1998, Cell, 93,

827–39. 20. Lutticken C, Wegenka UM, Yuan J, Buschmann J, Schindler C, Ziemiecki A, et al. 1994,

Science, 263, 89–92. 21. Wegenka UM, Lutticken C, Buschmann J, Yuan J, Lottspeich F, Muller-Esterl W, et al. 1994,

Mol Cell Biol. 14, 3186–96.

1898 GQ-ODN T40214, a Rational Designed Stat3 Inhibitor

22. Akira S, Nishio Y, Inoue M, Wang XJ, Wei S, Matsusaka T, et al. 1994, Cell, 77, 63–71. 23. Schindler C, Darnell JE. 1995, Annu Rev Biochem. 64, 621–51. 24. Fukada T, Ohtani T, Yoshida Y, Shirogane T, Nishida K, Nakajima K, et al. 1998, Embo J., 17,

6670–7. 25. Chakraborty A, Tweardy DJ. 1998, Leuk Lymphoma, 30, 433–42. 26. de Koning JP, Soede-Bobok AA, Ward AC, Schelen AM, Antonissen C, van Leeuwen D, et al.

2000, Oncogene, 19, 3290–8. 27. Shimozaki K, Nakajima K, Hirano T, Nagata S. 1997, J Biol Chem., 272, 25184–9. 28. Shirogane T, Fukada T, Muller JM, Shima DT, Hibi M, Hirano T. 1999, Immunity, 11,

709–19. 29. Dolled-Filhart M, Camp RL, Kowalski DP, Smith BL, Rimm DL. 2003, Clin Cancer Res. 9,

594–600. 30. Mora LB, Buettner R, Seigne J, Diaz J, Ahmad N, Garcia R, et al. 2002, Cancer Res. 62,

6659–66. 31. Nagpal JK, Mishra R, Das BR. 2002 Cancer, 94, 2393–400. 32. Song L, Turkson J, Karras JG, Jove R, Haura EB. 2003, Oncogene, 22, 4150–65. 33. Yu H, Kortylewski M, Pardoll D. 2007, Nat Rev Immunol., 7, 41–51. 34. Darnell JE, Jr., Kerr IM, Stark GR.1994 Science, 264, 1415–21. 35. Silvennoinen O, Schindler C, Schlessinger J, Levy DE. 1993, Science, 261, 1736–9. 36. Meydan N, Grunberger T, Dadi H, Shahar M, Arpaia E, Lapidot Z, et al. 1996, Nature, 379,

645–8. 37. Nielsen M, Kaltoft K, Nordahl M, Ropke C, Geisler C, Mustelin T, et al. 1997, Proc Natl Acad

Sci USA. 94, 6764–9. 38. Faderl S, Ferrajoli A, Harris D, Van Q, Priebe W, Estrov Z. 2005, Anticancer Res., 25,

1841–50. 39. Blaskovich MA, Sun J, Cantor A, Turkson J, Jove R, Sebti SM. 2003, Cancer Res., 63,

1270–9. 40. Shin DS, Kim HN, Shin KD, Yoon YJ, Kim SJ, Han DC, Kown BM. 2009, Cancer Res., 69,

193–202. 41. Turkson J, Ryan D, Kim JS, Zhang Y, Chen Z, Haura E, et al. 2001, J Biol Chem., 276,

45443–55. 42. Shao H, Cheng HY, Cook RG, Tweardy DJ. 2003, Cancer Res., 63, 3923–30. 43. Ren Z, Cabell LA, Schaefer TS, McMurray JS. 2003, Bioorg Med Chem Lett., 13, 633–6. 44. Leong PL, Andrews GA, Johnson DE, Dyer KF, Xi S, Mai JC, et al. 2003, Proc Natl Acad Sci

USA. 100, 4138–43. 45. Barton BE, Karras JG, Murphy TF, Barton A, Huang HF. 2004, Mol Cancer Ther. 3, 11–20. 46. Grandis JR, Drenning SD, Zeng Q, Watkins SC, Melhem MF, Endo S, et al. 2000, Proc Natl

Acad Sci USA. 97, 4227–32. 47. Karras JG, McKay RA, Lu T, Pych J, Frank DA, Rothstein TL, et al. 2000, Cell Immunol. 202,

124–35. 48. Chung CD, Liao J, Liu B, Rao X, Jay P, Berta P, et al. 1997, Science, 278, 1803–5. 49. Liu B, Liao J, Rao X, Kushner SA, Chung CD, Chang DD, et al. 1998, Proc Natl Acad Sci

USA. 95, 10626–31. 50. Endo TA, Masuhara M, Yokouchi M, Suzuki R, Sakamoto H, Mitsui K, et al. 1997, Nature,

387, 921–4. 51. Naka T, Narazaki M, Hirata M, Matsumoto T, Minamoto S, Aono A, et al. 1997, Nature, 387,

924–9. 52. Starr R, Willson TA, Viney EM, Murray LJ, Rayner JR, Jenkins BJ, et al. 1997, Nature, 387,

917–21. 53. Shuai K, Liu B. 2003, Nat Rev Immunol. 3, 900–11. 54. Jing N, Sha W, Li Y, Xiong W, Tweardy DJ. 2005, Curr Pharm Des. 11, 2841–54. 55. Jing N, Tweardy DJ. 2005, Anticancer Drugs. 16, 601–7. 56. Henderson E. 1995, Telomeres. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory

p. 11–34.

190 N. Jing

57. Gellert M, Lipsett MN, Davies DR. 1962, Proc Natl Acad Sci USA. 48, 2013–8. 58. Kang C, Zhang X, Ratliff R, Moyzis R, Rich A. 1992, Nature, 356, 126–31. 59. Smith FW, Feigon J. 1992, Nature, 356, 164–8. 60. Sundquist WI, Klug A. 1989, Nature, 342, 825–9. 61. Fry M, Loeb LA. 1994, Proc Natl Acad Sci USA. 91, 4950–4. 62. Awang G, Sen D. 1993, Biochemistry, 32, 11453–7. 63. Sundquist WI, Heaphy S. 1993, Proc Natl Acad Sci USA.90, 3393–7. 64. Sen D, Gilbert W. 1988, Nature, 334, 364–6. 65. Gilbert DE, Feigon J. 1999, Curr Opin Struct Biol. 9, 305–14. 66. Rhodes D, Giraldo R. 1995, Curr Opin Struct Biol. 5, 311–22. 67. Shafer RH, Smirnov I. 2000, Biopolymers, 56, 209–27. 68. Williamson JR. 1994, Annu Rev Biophys Biomol Struct. 23, 703–30. 69. Sen D, Gilbert W. 1990, Nature, 344, 410–4. 70. Jing N, Rando RF, Pommier Y, Hogan ME. 1997, Biochemistry, 36, 12498–505. 71. Guo Q, Lu M, Kallenbach NR. 1993, Biochemistry, 32, 3596–603. 72. Han H, Hurley LH. 2000, Trends Pharmacol Sci. 21, 136–42. 73. Mergny JL, Phan AT, Lacroix L. 1998, FEBS Lett. 435, 74–8. 74. Pilch DS, Plum GE, Breslauer KJ. 1995, Curr Opin Struct Biol. 5, 334–42. 75. Jing N, Xiong W, Guan Y, Pallansch L, Wang S. 2002, Biochemistry, 41, 5397–403. 76. Jing N, De Clercq E, Rando RF, Pallansch L, Lackman-Smith C, Lee S, et al. 2000, J Biol

Chem. 275, 3421–30. 77. Jing N, Hogan ME.1998, J Biol Chem. 273, 34992–9. 78. Jing N, Marchand C, Liu J, Mitra R, Hogan ME, Pommier Y. 2000, J Biol Chem. 27,

21460–7. 79. Jing N, Li Y, Xiong W, Sha W, Jing L, Tweardy DJ. 2004, Cancer Res. 64, 6603–9. 80. Jing N, Li Y, Xu X, Sha W, Li P, Feng L, et al. 2003, DNA Cell Biol. 22, 685–96. 81. Jing N, Gao X, Rando RF, Hogan ME. 1997, J Biomol Struct Dyn. 15, 573–85. 82. Neeson P, Paterson Y. 2006, Immunol Invest. 35, 359–94. 83. Jing N, Zhu Q, Yuan P, Li Y, Mao L, Tweardy DJ. 2006, Mol Cancer Ther. 5, 279–86. 84. Weerasinghe P, Garcia GE, Zhu Q, Yuan P, Feng L, Mao L, Jing N. 2007, Int J Oncol. 31,

129–36. 85. Zhu Q, Jing N. 2007, J Comput Aided Mol Des. 21, 641–8. 86. Weerasinghe P, Li Y, Guan Y, Zhang R, Tweardy DJ, Jing N. 2008, Prostate, 68, 1430–42. 87. Jemal A, Siegel R, Ward E, Murray T, Xu J, Thun MJ. 2007, Cancer J Clin. 57, 43–66. 88. Edwards J, Bartlett JM. 2005, BJU Int. 95, 1320–6. 89. Edwards J, Bartlett JM. 2005, BJU Int. 95, 1327–35. 90. Tannock IF, de Wit R, Berry WR, Horti J, Pluzanska A, Chi KN, 2004, N Engl J Med. 351,

1502–12. 91. Wallace TL, Gamba-Vitalo C, Loveday KS, Cossum PA. 2000, Toxicol Sci. 53, 63–70. 92. Lungwitz U, Breunig M, Blunk T, Gopferich A. 2005, Eur J Pharm Biopharm. 60, 247–66. 93. Neu M, Fischer D, Kissel T. 2005, J Gene Med. 7, 992–1009. 94. Boussif O, Lezoualc’h F, Zanta MA, Mergny MD, Scherman D, Demeneix B, et al. 1995, Proc

Natl Acad Sci USA. 92, 7297–301. 95. Fahrmeir J, Gunther M, Tietze N, Wagner E, Ogris M. 2007, J Control Release. 122, 236–45. 96. Darnell JF. 2005, Nat. Med. 11:595–596.

191M. Chatterjee and K. Kashfi (eds.), Cell Signaling & Molecular Targets in Cancer, DOI 10.1007/978-1-4614-0730-0_9, © Springer Science+Business Media, LLC 2012

Introduction

Eighty-fi ve percent of lung cancers are classifi ed as non-small cell lung cancers (NSCLC), of which there are two major subtypes: adenocarcinoma and squamous cell carcinoma. Adenocarcinomas arise in the glandular tissues of peripheral air-ways. Squamous cell carcinomas arise in the epithelial cells of the central airways and show a greater association with smoking than do adenocarcinomas [ 1 ] . Eighty-seven percent of lung cancers are attributable to smoking. Smoking-related lung cancers develop when tobacco pro-carcinogens (such as benzo[ a ]pyrene) become activated and form DNA adducts in lung epithelial cells. If these adducts are not repaired correctly, they can lead to DNA mutations that increase cancer risk.

It has been proposed that women may be more susceptible to the harmful effects of tobacco than are males. This is based on the fi ndings that female lung cancer patients have a higher level of smoking-induced DNA adducts [ 2, 3 ] and decreased DNA repair capacity [ 4 ] compared to male patients. However, inconsistent results have been obtained in epidemiological studies designed to test this hypothesis for-mally (reviewed in [ 5 ] ). Despite the debate that surrounds this issue, it is now well accepted that women are more susceptible to those lung cancers that arise in the absence of a smoking history: Females who are lifetime nonsmokers are three times more likely than their male counterparts to develop lung cancer [ 6 ] . This striking sex difference in lung cancer presentation provides a strong rationale for consider-ing the contribution of hormonal factors, such as estrogen, in the development and/or progression of lung cancer.

J.M. Siegfried (*) Co-Director, Thoracic Malignancies Program , Department of Pharmacology , University of Pittsburgh Cancer Institute , Pittsburgh , PA 15213 , USA e-mail: siegfriedjm@upmc.edu

Chapter 9 Estrogen Receptor Signaling in Lung Cancer

P.A. Hershberger and J.M. Siegfried

192 P.A. Hershberger and J.M. Siegfried

Estrogen Receptors Mediating Estrogen Action

The cellular response to estrogens is mediated by estrogen receptors ER a and ER b , which belong to the nuclear steroid hormone receptor superfamily. These receptor proteins function as sequence-specifi c, ligand-dependent, transcription factors and regulate the expression of genes implicated in cell-cycle control, signal transduc-tion, and cell survival (as an example, see [ 7 ] ). Analogous to other nuclear hormone receptors, the ER a protein contains a number of functional domains including (1) a sequence located near the NH

2 -terminus that functions as a ligand-independent

transcriptional activation domain termed AF-1, (2) a central DNA-binding domain, and (3) a COOH-terminal domain that is responsible for ligand binding. The COOH terminus also contains a second transcriptional activation function, termed AF-2, which is responsible for ligand-dependent activation of the receptor (Fig. 9.1 ). A second high-affi nity estrogen receptor, termed ER b , was cloned independently by two laboratories in 1996 [ 8, 9 ] . Although the structure of the ER b protein is similar to ER a , the AF-1 domain of ER b is shorter and has a lower transcriptional activa-tion capacity than the corresponding domain in ER a [ 10 ] .

Both ER a and ER b bind with high affi nity to the natural ligand 17 b -estradiol (E2). According to a classical model for estrogen induction of gene expression, the ligand-bound transcription factors are released from inhibitory heat shock proteins and recruited to chromatin through an interaction with specifi c DNA elements termed estrogen-response elements (EREs) located in the promoters of estrogen-responsive genes (Fig. 9.2 ). When bound by an agonist such as E2, the AF-2 domains of the receptors undergo a conformational change that creates a surface favorable for interaction with coactivator proteins such as AIB1, SRC-1, and GRIP1/TIF2 [ 11, 12 ] . The coactivators facilitate chromatin unwinding and the recruitment of the basal transcription machinery to the promoter, leading to an increase in gene transcription. The receptors may also be indirectly recruited to genomic regions through a tethering mechanism involving interactions with other transcription factors such as AP-1 and Sp1 [ 13, 14 ] . For a more detailed mechanis-tic description of estrogen-regulated transcription, readers are referred to the recent work of Kininis et al. [ 15 ] .

Fig. 9.1 Structure of ER a . The functional domains which are described in the text above are indicated. The designations ( A – F) refer to structural domains that are characteristic of nuclear hormone receptors. The percentage of sequence identity between ER a and ER b is shown for the transactivation and DNA-binding domains

1939 Estrogen Receptor Signaling in Lung Cancer

Due to the ability of estrogens to promote breast cancer growth, pharmacologic agents aimed at inhibiting estrogen signaling have been developed. These agents fall into two classes: (1) Antiestrogens which inhibit E2 from binding to its receptor, and (2) aromatase inhibitors which suppress endogenous estrogen biosynthesis. Clinically utilized antiestrogens include the selective estrogen response modifi ers (SERMs) tamoxifen and raloxifene, and the pure ER antagonist, ICI 182,780 (ful-vestrant). The mechanisms of action of these agents are described in more detail in the paragraphs immediately below. Clinically utilized aromatase inhibitors include letrozole, anastrazole, and exemestane. These agents are described in more detail later in this chapter.

SERMs bind to the ER and regulate its function in a tissue-selective manner. For example, tamoxifen functions as an ER antagonist in breast cancer but as an ER agonist in the uterus. Therefore, while tamoxifen is an effective agent for the pre-vention and treatment of hormone-responsive breast cancers, it increases the risk of developing endometrial cancer [ 16 ] . The work by Shang and Brown demonstrates that the tissue specifi city of SERMs is controlled, at least in part, by the cellular balance in ER coactivator and corepressor expression [ 17 ] . In breast cancer cells that lack expression of the coactivator SRC-1, tamoxifen mediates the preferential recruitment of corepressor proteins NCoR and SMRT to the promoters of E2-regulated genes. No gene induction is observed. In contrast, tamoxifen stimu-lates coactivator recruitment and induces the expression of E2-regulated genes in endometrial cells that endogenously express SRC-1. In preliminary studies, we

Fig. 9.2 Schematic representation of the mechanism by which the ER activates transcription. Upon ligand binding, the ER is released from an inhibitory association with heat shock protein 90 (hsp90). The receptor dimerizes and binds to EREs located in the promoters of estrogen-respon-sive genes. When bound by an agonist, the receptor recruits coregulatory proteins belonging to the p160 and p300 families. These proteins facilitate chromatin unwinding, interact with the basal transcription machinery and increase gene transcription

194 P.A. Hershberger and J.M. Siegfried

observed that tamoxifen increased the growth of human lung tumors (Stabile and Siegfried, unpublished observations). Therefore, the use of tamoxifen in lung can-cer has not been widely pursued by us due to concerns about its potential agonist actions.

Fulvestrant is an analogue of estrogen that functions as a pure receptor antagonist [ 18 ] . When bound to ER a , fulvestrant disrupts nuclear localization of the receptor and promotes receptor degradation [ 19, 20 ] . In preclinical studies, fulvestrant was demonstrated to block E2 regulation of gene expression and the growth of estrogen-sensitive breast tumors in vitro and in vivo [ 21, 22 ] . The mechanism by which fulvestrant inhibits ER b signaling may be distinctive. Studies indicate that ER b is stabilized in vitro and in vivo and retains its mobility in the presence of fulvestrant [ 23– 25 ] . Nonetheless, we and others have observed that in tumor cells that express ER b , fulvestrant decreases the activation of a synthetic promoter construct that contains an ERE [ 26, 27 ] and decreases cell proliferation [ 26, 28, 29 ] .

Lung: An Estrogen-Responsive Tissue

Reproductive organs and bone are classically recognized as being estrogen-respon-sive. To identify other organs that respond to estrogen exposure in vivo, Ciana et al. developed transgenic mice in which an ERE-luciferase reporter construct was expressed in 26 different tissues [ 30 ] . Estrogen-responsive tissues were identifi ed by treating ovarectomized female transgenic mice with vehicle (controls) or a single subcutaneous injection of 50 m g/kg 17 b -estradiol. Tissues were harvested after 16 h and analyzed for luciferase activity ex vivo. The lungs displayed 15-fold induction of reporter gene activity upon estradiol exposure, which was greater the effect observed in tissues that are considered to be hormone responsive including the bone, uterus, and mammary gland. Using a different ERE-luciferase reporter transgenic mouse model, Lemmen et al. showed that 17 b -estradiol also signifi cantly induced luciferase activity in the lungs of male mice [ 31 ] . Based on the induction of a tran-scriptional response at a classical ERE, the lungs of both male and female mice can be classifi ed as estrogen-responsive tissues.

Consistent with the notion that estrogen signaling through ER b plays an impor-tant role in normal lung development; targeted inactivation of ER b results in lung abnormalities. At 3 months of age, the number of alveoli per fi eld is signifi cantly decreased in lungs from female ER b −/− mice compared to WT controls (309 versus 433, respectively). ER b −/− females also display altered surfactant homeostasis [ 32 ] . By 5 months of age, both male and female ER b -defi cient mice exhibit signs of signifi cant lung dysfunction (abnormal extracellular matrix deposition and alveolar collapse), which leads to systemic hypoxia [ 33 ] . It is intriguing that this phenotype occurs in both adult female and male mice, which are predicted to differ in circulat-ing estrogen levels. This may suggest that the regulation of extracellular matrix activity by ER b occurs in a ligand-independent manner or that estrogens are pro-duced and act locally to regulate lung biology in both male and female mice.

1959 Estrogen Receptor Signaling in Lung Cancer

Effects of Endogenous and Exogenous Estrogens (Hormone Replacement Therapy) on Lung Cancer Risk and Lung Cancer Outcomes

It is well established that estrogens are required for mammary gland development, but that aberrant estrogen signaling leads to breast cancer. Perhaps an analogous situation exists in the lung, where estrogens are required for the development and maintenance of normal tissue architecture, while excessive signaling increases the risk of developing cancer. Epidemiologic studies have been conducted to explore both the relationship between estrogen exposure and risk of developing lung cancer and the relationship between estrogen exposure and survival following a lung cancer diagnosis. If estrogen plays a role in lung cancer initiation and/or promotes the growth of established tumors, it is predicted that lung cancer risk would increase and/or that survival would decrease with increased exposure to estrogens.

Three recent reports are consistent with a detrimental effect of endogenous estro-gens on lung cancer outcomes. In an analysis of the SEER database, we found that women diagnosed with either squamous cell carcinoma or bronchiolalveolar carci-noma who were between 55 and 59 years old (and were presumed to be postmeno-pausal) had signifi cantly better survival than women who were 40–49 years old (and were presumed to be premenopausal) [ 34 ] . More specifi cally, we determined that 5-year adjusted survival rates were 19% for premenopausal women with squamous cell carcinoma versus 23% for postmenopausal women ( p = 0.03) and 40% for pre-menopausal women with bronchiolalveolar carcinoma versus 54% for postmeno-pausal women ( p = 0.04). No age-related survival differences were observed in males. In a retrospective analysis of SWOG clinical trials, Albain et al. identifi ed a survival benefi t for women diagnosed with advanced non-small cell lung cancer (NSCLC) who were treated with a platinum-containing regimen compared to com-parably treated men (11 months versus 8 months) [ 35 ] . However, the survival advan-tage was observed only in women who were age 60 or older. In a third study, Ross et al . quantifi ed free estradiol concentrations in blood samples collected from males enrolled in phase III clinical trials in advanced NSCLC [ 36 ] . It was discovered that men with high free estradiol levels had signifi cantly poorer survival than men with lower estradiol levels.

With regard to exogenous estrogens (i.e., hormone replacement therapy (HRT)), epidemiologic studies have not shown a consistent association between estrogen use and lung cancer risk (reviewed in [ 37 ] ). However, in two of three recent studies, an association was established between HRT use and poor survival following a lung cancer diagnosis [ 38– 40 ] . Ganti et al . conducted a retrospective chart review of approximately 500 women diagnosed with lung cancer between 1994 and 1999 at a community-based hospital. HRT was defi ned as the use of estrogen plus progestin or estrogen only for at least 6 weeks of continuous use prior to the diagnosis of lung cancer. These investigators found that women with lung cancer who used HRT were signifi cantly younger (63 years old) than women with lung cancer who never used

196 P.A. Hershberger and J.M. Siegfried

HRT (68 years old). Furthermore, women who were diagnosed with lung cancer and used HRT had signifi cantly worse overall survival (39 months) compared to women who did not use HRT (79 months).

Ayeni et al also conducted a retrospective chart review of nearly 400 women diagnosed with lung cancer between 1999 and 2003 in Ontario to test the hypothesis that HRT use impacted lung cancer survival. These investigators found no effect of HRT on overall survival, with reported median survivals of 13 months in the non-HRT group and 14 months in the HRT group. Of note, the cohort analyzed by Ayeni reported greater HRT use and included a greater percentage of cases of advanced NSCLC than the population studied by Ganti. The dramatic difference in overall survival between the non-HRT populations in the two studies (79 months versus 13 months) provides evidence of non-equivalence in the population of patients analyzed.

Potential confounders of the above-described studies included the fact that the precise duration of HRT use was not specifi ed, nor was a distinction made between the use of estrogen only versus the use of estrogen plus progestin. Both of these limitations were overcome in the study by Chlebowski et al., in which lung cancer outcomes were assessed in a secondary analysis of the Womens’ Health Initiative (WHI) randomized clinical trial [ 40 ] . In the WHI trial, more than 16,000 post-menopausal women were randomized to receive placebo or daily HRT (comprised of 0.625 mg estrogen plus 2.5 mg medroxyprogesterone acetate) for a period of 5.6 years. Factors known to infl uence lung cancer outcomes such as smoking history and age were balanced between the two groups. The investigators found a trend toward more NSCLC diagnoses in the HRT group compared to the placebo group, although this did not reach statistical signifi cance. Although lung cancer risk may not have increased, the HRT group experienced a signifi cantly greater likelihood of dying from NSCLC than did the placebo group (46% mortality versus 27%, respectively). These data support the conclusion that HRT use (as defi ned above) for a period of greater than 5 years signifi cantly increases a woman’s chance of dying from lung cancer. This conclusion is consistent with the hypoth-esis that HRT provides a tumor growth advantage in lung cancer, as it does in breast cancer.

Preclinical Studies Indicating that Estrogen Supports the Development or Growth of NSCLC

To evaluate the role of estrogen in lung cancer further, the effects of E2 have been studied using preclinical models. In an animal model in which lung adenocarcino-mas were induced by K-ras activation and p53 deletion, E2 promoted tumor pro-gression: Compared to untreated controls, E2 administration doubled the number of tumor foci evident on the lung surface in both males and ovariectomized females [ 41 ] . In established lung cancer cell lines, E2 signifi cantly increased cell proliferation in vitro and in vivo, increased gene expression, and promoted VEGF secretion, and induced rapid phosphorylation/activation of p44/p42 mitogen activated

1979 Estrogen Receptor Signaling in Lung Cancer

protein kinase (MAPK) [ 26, 42– 45 ] . The induction of pro-proliferative/pro-survival responses by E2 provides an explanation for the poorer clinical outcomes observed in NSCLC patients who are either predicted or documented to have high estrogen levels.

Given the ability of estrogens to increase gene expression in and stimulate the growth of NSCLC cells, preclinical investigations into the potential use of antiestro-gens in lung cancer therapy have been initiated by us and others. To date, most efforts have focused on use of the pure ER antagonist, fulvestrant. Fulvestrant sig-nifi cantly inhibits E2-mediated stimulation of gene expression (measured by ERE-luciferase reporter assays), MAPK activation (measured by immunofl uorescence), and proliferation of NSCLC cells in vitro [ 26, 44 ] . Fulvestrant also signifi cantly inhibits the growth of 201 T, H23, and A549 lung tumor xenografts [ 26, 44, 46 ] , providing strong rationale for the evaluation of this antiestrogen in lung cancer therapy.

Evaluation of the Functionality of the Classical Genomic Estrogen-Signaling Pathway in NSCLC Cells

According to a classical model for estrogen regulation of gene expression, tran-scription is increased when ligand-bound ERs are recruited to chromatin through an interaction with EREs, which are located in the promoters of estrogen-responsive genes. To evaluate the functionality of this pathway in NSCLC cell lines in a facile manner, we have transfected cells that express endogenous ERs with an ERE-tk-luciferase reporter construct. Following transfection, the cells received vehicle (controls) or were treated with increasing concentrations of E2. Luciferase reporter gene activity, which serves as a measure of ER-mediated transcription, was quanti-fi ed the next day. In H23 and 201 T cells, nanomolar concentrations of E2 stimulate reporter gene activity approximately twofold [ 26, 27 ] . Indicative of involvement of the ER, E2-mediated activation of reporter gene expression in these cells was sig-nifi cantly blocked by fulvestrant.

Membrane-Initiated Steroid Signaling (MISS) in Lung Epithelial Cells and NSCLC

Steroid hormones, including estrogen, rapidly activate second messenger–signaling pathways, leading to intracellular increases in cAMP, calcium fl uxes, and activation of PI3K and MAPK. This process, which is initiated at the plasma membrane, leads to changes in protein structure/function and gene transcription and is imperative in eliciting full responses to estrogen. For example, pharmacologic inhibition of PI3K or MAPK prevents 17 b -estradiol from stimulating the proliferation of endothelial cells [ 47 ] . The identity of the estrogen-binding protein responsible for plasma

198 P.A. Hershberger and J.M. Siegfried

membrane signaling has been the subject of much discussion, and it has been hypothesized that alternative receptors (other than the classical nuclear ER) are responsible. However, elegant studies by Pedram et al. have shown that, in breast cancer cells, the membrane-signaling protein is similar to or the same as the nuclear ER a [ 47 ] . In these studies, E2-binding proteins were purifi ed from the nucleus and plasma membrane fractions of MCF-7 cells and identifi ed by mass spectrometry. The plasma membrane–associated protein had a molecular weight of 67 kDa and had a sequence corresponding to the nuclear ER a protein. Consistent with a com-mon identifi cation for the membrane receptor and the nuclear receptor, transfection of siRNA directed against classical ER a in MCF-7 cells eliminates membrane-initiated estrogen signaling [ 47 ] .

Studies by a number of different investigators show that 17 b -estradiol initiates membrane signaling in NSCLC cells, as evidenced by rapid increases in phospho-rylation of p42/p44 MAPK and/or Akt [ 27, 44, 45, 48 ] . Plasma membrane fractions from NSCLC cells contain estradiol-binding activity, and isolated caveolae from NSCLC cells contain proteins that react with antibodies specifi c for nuclear ER a and ER b [ 44 ] . These data support the hypothesis that a subset of the classical ER pool associates with the plasma membrane and triggers membrane signaling in NSCLC cells, as it does in breast cancer cells.

Estrogen Receptors and Mitochondria

It has long been known that estrogens increase mitochondrial function. In recent years, interest in understanding the mechanistic basis for estrogen action at the mitochondria has re-emerged and resulted in the conduct of a series of elegant studies which show that: (a) nuclear ER a activates transcription of nuclear respi-ratory factor-1 (NRF-1) in breast cancer cells [ 49 ] , (b) ER b modulates mitochon-drial sensitivity to oxidative stressors in HT-22 hippocampal cells [ 50 ] , and (c) ER a and ER b bind to human mitochondrial DNA EREs and may thus regulate the expression of genes encoded by the mitochondrial genome [ 51 ] . For a com-prehensive consideration of this topic area, readers are directed to two recent reviews [ 52, 53 ] .

The Nuclear Respiratory Factor-1 (NRF-1) gene encodes a transcription factor that activates the expression of genes required for mitochondrial DNA transcription and replication [ 54 ] . Mattingly et al. demonstrated that NRF-1 mRNA expression is increased by E2 treatment both in MCF-7 breast cancer cells via an ER a dependent mechanism and in H1793 lung cancer cells by an ER b -dependent mechanism [ 49 ] . NRF-1 induction by E2 was attributed to direct binding of the ligand-activated nuclear ER to the NRF-1 promoter based on the results of chromatin-immunopre-cipitation studies and transient transfection assays which employed a NRF-1 pro-moter-reporter plasmid. E2 treatment of MCF-7 cells also led to (1) an increase in the expression of the NRF-1 target gene, TFAM; (2) the subsequent transcription

1999 Estrogen Receptor Signaling in Lung Cancer

of TFAM-regulated mitochondrial DNA encoded genes; and (3) increased mitochondrial biogenesis. Based on this evidence, the authors conclude that E2 stimulates mitochondrial function/biogenesis through a genomic pathway that is initiated by the binding of nuclear ERs to the NRF-1 promoter.

The observation that ER b localizes to the mitochondria in multiple cell types (including but not limited to neurons, breast cancer cells, skeletal muscle cells, and human lens cells) is consistent with a local role for this protein in the direct regula-tion of mitochondrial function [ 55– 58 ] . Mitochondrial ER (mtER) is absent in endothelial cells isolated from ER a /ER b knockout mice, indicating that the mtER is derived from the same gene that encodes the nuclear ER [ 59 ] . In MCF-7 cells, E2 treatment caused a dose- and time-dependent increase in both the amount of ER b associated with the mitochondria and the abundance of mRNAs transcribed from genes encoded by mitochondrial DNA [ 56 ] . The concordance of these events raises the possibility that mitochondrial localized ER b directly affects transcription of the mitochondrial genome. Human mitochondrial DNA contains putative EREs (mtEREs). When oligonucleotides containing mtERE sites were used in electropho-retic mobility assays, mitochondrial extracts prepared from MCF-7 cells (that con-tained both ER a and ER b ) displayed specifi c binding [ 51 ] . Protein binding to the mtEREs was increased in a dose- and time-dependent manner by E2 and decreased by ER b -specifi c (but not ER a -specifi c) antibodies. These data support a model in which E2 enhances mitochondrial function by a direct mechanism involving the binding of ER b in the mitochondria to EREs within mtDNA.

ER b specifi c siRNA depletes the mitochondrial pool of estrogen receptors in transformed HT-22 hippocampal cells. Interestingly, HT-22 cells with engineered loss of ER b are relatively refractory to cell death induced by mitochondrial stressors [ 50 ] . Compared to WT controls, ER b knock-down cells also displayed reduced superoxide production after oxidative insult, had reduced resting mitochondrial membrane potential, and displayed increased resistance to hydrogen peroxide-induced membrane depolarization. Based on these fi ndings, the authors conclude that ER b is a factor that renders mitochondria/cells vulnerable to oxidative stress. Because E2-treated WT HT-22 cells have a phenotype similar to ER b knock-down cells, the authors surmise that estrogen signaling through ER b nullifi es the ability of ER b to promote mitochondrial vulnerability. According to such a model, an increase in estrogen signaling through ER b in the lung would be expected to promote lung cancer development or progression by reducing cellular susceptibility to oxidative insults. Conversely, it is predicted that lung cancer cells would become more suscep-tible to stress/apoptosis inducing agents under conditions of estrogen defi ciency.

Although mitochondrial localization of ER b in NSCLC cell lines has been reported [ 49 ] , the majority of primary NSCLC specimens analyzed to date display primarily a nuclear pool of receptors (see section immediately below). Given this discrepancy, it is too early to comment on the contribution of mitochondrial ER b to the development or progression of NSCLC. Studies are required to determine whether ER b is expressed in the mitochondria of primary lung cancer cells and whether estradiol regulates the function of ER b from this subcellular location.

200 P.A. Hershberger and J.M. Siegfried

Estrogen Receptors Expressed in NSCLC Cells and Human Primary Lung Tumors

As evidence accumulates indicating that estrogen promotes lung cancer growth, interest in identifying the receptor that is responsible has increased. Our initial approach to identify the biologically relevant receptor(s) involved assessing the expression of ER a and ER b mRNA and protein in NSCLC cell lines. In the mRNA analysis of our cell lines, we found that ER a transcripts were detected but were comprised of mostly alternatively spliced variants [ 26 ] . Consistent with this obser-vation, we were unable to detect the predicted full-length 66-kD ER a protein in whole-cell extracts prepared from NSCLC cell lines despite the use of several dif-ferent antibodies [ 26, 27, 42 ] . However, we did observe immunoreactive bands of » 42 kD and » 54 kD using antibodies against the hinge region and COOH termi-nus of ER a , respectively. Although we cannot exclude the possibility that these smaller proteins represent variant forms of ER a , they do not share common epitopes or subcellular localization and may represent non-specifi c cross-reactive bands [ 27 ] . In contrast to ER a , ER b transcripts and a full-length protein are consistently detected in the cell lines we have analyzed to date (including but not limited to 201 T, A549, H23, and 128.88 T). We conclude from our studies that ER b is the primary estrogen receptor expressed in NSCLC cells.

In a complementary approach, investigators have sought to identify the biologi-cally relevant receptor in lung cancer by using immunohistochemistry (IHC) to establish the relationship between ER expression in lung tumor tissue and disease outcomes. In 4 recent studies that utilized different ER b antibodies and distinctive scoring criteria to establish a NSCLC case as receptor positive, 45–69% of speci-mens were characterized as expressing a nuclear pool of ER b proteins [ 60– 63 ] . In each of these, high nuclear ER b was found to be a favorable prognostic indicator, although this was observed only in males in two of the studies [ 60– 63 ] . We recently completed an immunohistochemical analysis of approximately 160 NSCLC cases in which the relationship between ER b expression in different cellular compart-ments and disease outcome was analyzed. In contrast to other studies, we found that the cytoplasmic form of ER b was a negative prognostic factor for overall survival in both men and women, while nuclear ER b levels did not correlate with survival (unpublished observations). Our fi nding may indicate that induction of non-genomic signaling is the more important biological function of ER b . We also found that expression of progesterone receptor was protective (unpublished observation). Possibly, the interplay of both receptors is important in outcome.

The analysis of ER a -staining patterns in NSCLC has proven to be diffi cult. Nuclear ER a immunostaining is either never, or only rarely, detected in primary lung tumors [ 60– 63 ] . ER a is detected in the cytoplasm of some NSCLC cases, but the percentage of positive specimens varies considerably between studies (from approximately 3% [ 60 ] to 73% [ 62 ] ). Even within the same study, the ability to detect a cytoplasmic pool of ER a was found to depend upon the antibody employed: An immunoreactive pool of receptors was detected when an antibody specifi c for a

2019 Estrogen Receptor Signaling in Lung Cancer

COOH-terminal epitope of ER a was used, but not when an antibody specifi c for an NH

2 -terminal epitope was used [ 62 ] . This discrepancy may indicate that the

COOH-terminal antibody reacts non-specifi cally or that the immunoreactive pro-tein that is detected in the cytoplasm of lung tumors represents an ER a variant lacking the NH

2 -terminus. In studies where the prognostic signifi cance of ER a

expression was reported, it had either no correlation with survival [ 63 ] or corre-lated with poor prognosis [ 62 ] .

Using Subtype Selective Ligands to Assess the Relative Contributions of ER b and ER a in NSCLC Cell Lines

The sequences of ER a and ER b show only moderate conservation (approximately 53%) within the ligand-binding domain (Fig. 9.1 ). This has permitted the develop-ment of subtype-selective ligands which have been extensively used to distinguish ER a and ER b functions in cells/tissues that may express both receptors. Ligands that are commonly employed include the ER b subtype-selective agonists genistein (GEN) and 2,3-bis(4-hydroxyphenyl)propionitrile (DPN) and the ER a -selective agonist 4,4 ¢ ,4²-(4-propyl-[1 H]-pyrazole-1,3,5-triyl)trisphenol (PPT). GEN has a 26-fold binding affi nity preference for ER b versus ER a [ 64 ] . DPN has a 70-fold binding affi nity preference for ER b versus ER a [ 65 ] . PPT has a >400-fold binding affi nity preference for ER a versus ER b [ 66 ] .

As indicated above, E2 induces a variety of responses in NSCLC cells including cell proliferation, modulation of gene expression, and rapid MAPK activation. Because a majority of primary lung cancers express only ER b , we sought to deter-mine whether ER b was suffi cient to generate these responses. To do this, we deter-mined the effects of the ER b -selective agonists GEN and DPN and the ER a -selective agonist PPT in 201 T cells that endogenously express ER b but not ER a [ 27 ] . GEN, but not PPT, mediated a signifi cant 1.5-fold increase in reporter activity in cells transiently transfected with ERE-tk-luciferase, demonstrating that endogenous lev-els of ER b (but not those of ER a ) are suffi cient for transcription. We also studied membrane-initiated estrogen signaling in 201 T cells using MAPK phosphorylation as a read-out. PPT and DPN induced activation of MAPK with similar kinetics. Phosphorylation of MAPK was maximal within 5 min and returned to near-baseline levels within 30 min of treatment. However, only DPN mediated a statistically sig-nifi cant increase in 201 T cell growth in vitro and in vivo. We interpreted these results as evidence that endogenous levels of ER b are suffi cient to generate genomic and non-genomic responses to estrogen in NSCLC cells, and that activation of both pathways is necessary for increased proliferation.

We were unable to make any conclusions regarding the role of ER a in mediating estrogenic responses in lung cancer because our cell lines do not endogenously express full-length ER a protein. However, others have assessed the ability of endog-enous ER a and ER b to increase the proliferation of NSCLC cells by transiently transfecting siRNA duplexes targeting each receptor into H23 cells that express

202 P.A. Hershberger and J.M. Siegfried

both ER a and ER b [ 46 ] . siRNA-mediated suppression of mRNA corresponding to either receptor resulted in approximately 20% inhibition of in vitro growth. This result suggests that ER a and ER b may contribute equally to the growth of lung cancer cells that express both receptors.

E2 Cooperates with Growth Factor Receptor Signaling to Increase the Growth of NSCLC Cells

The epidermal growth factor receptor (EGFR) is a receptor tyrosine kinase that signals from the plasma membrane to regulate a variety of biological responses including proliferation, differentiation, migration, and apoptosis. The EGFR is rec-ognized as a major therapeutic target in lung cancer, and a variety of agents to inhibit its activity have been developed. Most notable among these are the small molecule tyrosine kinase inhibitors gefi tinib (Iressa) and erlotinib (Tarceva) and the EGFR blocking antibody, cetuximab (Erbitux). Currently, erlotinib is FDA-approved for use in patients with metastatic or locally advanced NSCLC who have failed at least one previous round of chemotherapy.

Upon ligand binding, the EGFR dimerizes and undergoes autophosphorylation at tyrosine residues within its intracellular domain. These phosphotyrosines serve as binding sites for adapter molecules, which mediate the recruitment and activation of intracellular-signaling cascades. For example, phosphorylated EGFR binds to Grb2:SOS, which activates the p21Ras pathway leading to MAPK activation. Once activated, MAPK can translocate to the nucleus where it phosphorylates/activates nuclear transcription factors, including the ER. Phosphorylation of Ser118 in the A/B domain of ER a by MAPK leads to activation of the nuclear receptor [ 67 ] , and provides a mechanism by which signaling through the EGFR can increase the activ-ity of the steroid receptor-signaling pathway (Fig. 9.3 ).

A reciprocal pathway for cross-talk between the ER and EGFR also exists, in which estrogen activation of the ER leads to enhanced signaling through EGFR. Evidence supportive of this mechanism includes the fi ndings that EGF-induced DNA synthesis and transcription are absent in reproductive organs from ER a knock-out mice [ 68 ] , and that the ER antagonist, fulvestrant, blocks the ability of EGF to stimulate the proliferation of MCF-7 breast cancer cells [ 69 ] . Available data indi-cate that E2 mediates EGF signaling by activating cell surface-associated matrix metalloproteinases (MMP-2 and MMP-9) via a Src-dependent process. The protei-nases then stimulate the release of EGFR ligands from the surface of the MCF-7 cells [ 70 ] .

Because E2 and EGF stimulate the proliferation of NSCLC cells and the poten-tial for cross-talk between the ER and EGFR pathways exists, Stabile et al. and Pietras et al independently launched a series of studies to explore the effect of com-bined targeting of the ER and EGFR pathways in NSCLC cells. Several observa-tions were reported that provide provocative evidence for receptor cross-talk: (1) E2 induced rapid activation of MAPK in NSCLC cells in vitro, which was blocked by

2039 Estrogen Receptor Signaling in Lung Cancer

the EGFR blocking antibody M225 [ 45 ] , (2) the ER and the EGFR co-localized in caveolae purifi ed from NSCLC cells [ 46 ] , and (3) combination of E2 with EGF resulted in a greater than additive increase in MAPK activation in two different NSCLC cell lines.

Stabile and Pietras then explored the therapeutic value of co-targeting the ER and EGFR pathways in NSCLC models. The combined use of fulvestrant plus the EGFR tyrosine kinase inhibitor (TKI) gefi tinib resulted in greater growth inhibition than the TKI alone in 4 different NSCLC cell lines in vitro. In corresponding in vivo models, the growth of A549 human lung tumor xenografts was maximally sup-pressed by combination of fulvestrant with erlotinib [ 46 ] , while the growth of 201 T human lung tumor xenografts was maximally inhibited by the combination of ful-vestrant with gefi tinib [ 45 ] . When compared with either single agent, the increased effi cacy of the fulvestrant plus gefi tinib combination in the 201 T xenograft model was associated with an increase in tumor cell apoptosis and a decrease in the prolif-eration marker, Ki67.

Based on these compelling preclinical fi ndings, a pilot clinical trial of gefi tinib plus fulvestrant in the treatment of postmenopausal women with advanced NSCLC was conducted [ 71 ] . Twenty-two women (median age 66 year old) with pathologi-cally confi rmed advanced NSCLC were enrolled in the study, 14 of whom had

Fig. 9.3 Cross-regulation between the ER and EGFR signaling pathways. E2 binding to ERs localized at the plasma membrane leads to the activation of matrix metalloproteinases (MMPs). MMPs catalyze the release of EGFR ligands (such as HB-EGF) from the cell surface. The free ligands bind to the EGFR and trigger the activation of downstream signaling pathways. ERK trans-locates to the nucleus upon its activation, where it can phosphorylate and activate the ER in a ligand-independent manner. Available data indicates that the plasma membrane ER and the nuclear ER are encoded by the same gene

204 P.A. Hershberger and J.M. Siegfried

received at least 1 prior chemotherapy regimen. Eighteen women received gefi tinib (250 mg orally once daily) plus fulvestrant (250 mg IM, on day 1 of each 28 day cycle). The remaining four women received gefi tinib as above, but the fulvestrant dosing was modifi ed to reduce the time required to achieve steady-state plasma concentrations. To do this, fulvestrant was administered at a loading dose of 500 mg IM on day 1, followed by 250 mg IM on days 15 and 29, and then administered every 28 days thereafter. Overall, the therapy was well tolerated. In 20 patients eval-uable for response, three partial responses were observed. The median progression-free survival for the population was 12 weeks, the median overall survival was 38.5 weeks, and the 1-year survival was 41%.

The safety of the combination supported our subsequent design of a randomized phase II clinical trial in which the effi cacy of erlotinib (i.e., objective tumor response) is being compared with erlotinib plus fulvestrant in patients with advanced NSCLC. This trial (ClinicalTrials.gov identifi er NCT00100854) is currently open and accru-ing patients. The combination of fulvestrant plus erlotinib is also being evaluated in a separate Phase II trial led by Dr. Bazhenova at the University of California, San Diego (ClinicalTrials.gov identifi er NCT00592007). This latter trial is designed to determine whether the addition of fulvestrant to erlotinib extends progression free survival in patients with advanced NSCLC. According to the design of this study, a patient must have a tumor that expresses the ER and have stable disease while on erlotinib monotherapy for a period of at least 2 months in order to be eligible to receive fulvestrant. Progression-free survival for the combination will be compared to historical controls of erlotinib monotherapy. Interestingly, a recent case report suggests that the combination of an EGFR TKI with hormone therapy will have effi cacy in NSCLC [ 72 ] . A 57-year-old female with advanced NSCLC who was previously treated with cisplatin and vinrelobine presented with skin metastasis of lung adenocarcinoma. The skin lesions were positive for expression of both EGFR and ER. The patient received gefi tinib which resulted in partial healing of the skin lesions and disease stabilization. Approximately 8 months later the aromatase inhibitor, letrozole, was added to her therapy. There was complete resolution of cutaneous lesions after 3 months of therapy with letrozole and gefi tinib. At the time at which the case report was published (nearly 2 years after initiation of combina-tion therapy), the patient showed no clinical or radiologic disease progression.

Aromatase

Aromatase is a cytochrome P450 enzyme that catalyzes the synthesis of estrogens from androgens. Aromatase is over-expressed in breast cancers, where it supports the growth of estrogen-responsive tumors [ 73– 75 ] . Steroidal (exemestane) and non-steroidal (anastrazole or letrozole) inhibitors have been developed to circumvent the action of aromatase. The superior effi cacy (i.e., disease free survival) of these agents over tamoxifen in the treatment of postmenopausal women with estrogen receptor–positive breast cancer was established in multiple, large clinical trials (reviewed

2059 Estrogen Receptor Signaling in Lung Cancer

recently in [ 76, 77 ] ). Consequently, treatment recommendations for adjuvant therapy of postmenopausal breast cancer patients with receptor-positive disease now include an aromatase inhibitor as part of initial treatment or following a course of treatment with tamoxifen.

The observation that aromatase is expressed in human lung tissue [ 78, 79 ] raises the possibility that local tissue production of estrogen contributes to lung cancer growth, as it does in breast cancer, and that aromatase inhibitors may be useful in lung cancer therapy. To determine whether aromatase is expressed and active in NSCLC cells, Weinberg et al. quantifi ed aromatase transcripts, protein, and activity in a panel of human NSCLC cell lines [ 80 ] . The authors observed that a majority of the lines expressed aromatase, and that protein expression level correlated with enzymatic activity. For example, A549 cells that expressed aromatase were capable of synthesizing estradiol from testosterone in vitro. Moreover, when A549 cells were implanted into ovariectomized mice, daily administration of the aromatase substrate androstenedione resulted in a signifi cant increase in tumor growth com-pared to vehicle controls [ 81 ] . The stimulatory effect of androstenedione on the growth of aromatase-positive lung tumor xenografts was signifi cantly inhibited by either the non-steroidal aromatase inhibitor, anastrazole [ 80 ] or the steroidal aro-matase inhibitor, exemestane [ 82 ] . Together, these preclinical results support the notion that aromatase-positive NSCLC cells locally synthesize pro-proliferative estrogens from circulating androgen precursors and that blockade of estrogen pro-duction is a useful strategy to suppress tumor growth.

To establish the clinical relevance of aromatase expression in lung cancer, Weinberg et al. subjected 53 primary NSCLC specimens to immunhistochemical staining with an aromatase-specifi c antibody. When a cut-off of 15% cells with specifi c staining was used as the defi nition of a positive case, 86% of primary NSCLC cases were determined to express aromatase [ 80 ] . Staining was observed in the tumor epithelial cells themselves, and no signifi cant differences in expression were observed between adenocarcinomas and squamous cell carcinomas or between males and females. The aromatase enzyme detected by immunohistochemistry is likely to represent functional protein because archival tumor specimens displayed in vitro enzymatic activity. In a separate study that utilized 59 primary NSCLC specimens, Niikawa et al. found that a positive correlation exists between lung tumor expression of aromatase and intratumoral estradiol levels measured by liquid chromatography/electrospray tandem mass spectrometry [ 83 ] . These authors also observed that intratumoral concentrations of estradiol were positively associated with tumor size and Ki-67 labeling index only if the lung tumor cells expressed either ER a or ER b , consistent with the hypothesis that the locally produced estro-gens support tumor growth via an ER-dependent pathway.

Based on the observed expression of aromatase in clinical lung cancer specimens and the signifi cant antitumor activity of aromatase inhibitors in preclinical xeno-graft models, clinical trials of aromatase inhibitors in lung cancer have been designed by us. While results from these trials will not be available for several years, results from a randomized trial of exemestane after 2–3 years of tamoxifen therapy in post-menopausal women with primary breast cancer provide provocative evidence of a

206 P.A. Hershberger and J.M. Siegfried

benefi cial effect of aromatase inhibitors in lung cancer therapy [ 84 ] . In the exemestane treatment arm, 4/2,362 women (0.17%) developed primary lung cancer versus 12/2,380 women (0.5%) in the tamoxifen treatment arm.

Summary and Future Directions

Preclinical studies from multiple laboratories provide consistent evidence that pro-liferative estrogen receptor (ER)–signaling pathways exist in NSCLC cell lines and that suppression of these pathways (via the use of ER antagonists or aromatase inhibitors) suppresses lung tumor growth in vitro and in vivo. It is also clear from preclinical studies that cross-regulation between the ER pathway and EGFR path-way occurs and results in enhanced growth. These latter fi ndings provided rationale for the design and conduct of clinical trials combining an EGFR TKI plus fulves-trant in NSCLC patients. Results from these ongoing trials, and planned trials of novel regimens containing aromatase inhibitors, will be important in establishing the extent to which modulation of estrogen signaling provides therapeutic benefi t in both males and females with lung cancer.

Alternative approaches to suppressing estrogen signaling in lung cancer may fol-low the identifi cation of the receptor that is responsible. Although most studies to date point to a prominent role for ER b , ER a and potential variants are observed in some cell lines and primary lung tumors. Additional experiments are warranted to establish the relative contribution of ER a and ER b in mediating genomic, non-genomic, and proliferative responses to estrogen in NSCLC cells that may express both receptors. As this fi eld evolves, consideration should also be given to the poten-tial impact of non-classical estrogen receptors, such as GPR30, on the response of NSCLC cells to estrogen and antiestrogens.

Summarized within this chapter are preclinical studies which demonstrate that ERs can signal from multiple locations within the cell, including the nucleus, plasma membrane, and mitochondria. Ongoing efforts in our laboratories are aimed at elu-cidating how these pathways are interconnected in lung cancer cells and whether each must be properly engaged in order to support cell proliferation and survival.

References

1. Muscat JE, Wynder EL. Lung cancer pathology in smokers, ex-smokers and never smokers. Cancer Lett 1995;88(1):1–5.

2. Ryberg D, Hewer A, Phillips DH, Haugen A. Different susceptibility to smoking-induced DNA damage among male and female lung cancer patients. Cancer Res 1994;54(22):5801–3.

3. Mollerup S, Ryberg D, Hewer A, Phillips DH, Haugen A. Sex differences in lung CYP1A1 expression and DNA adduct levels among lung cancer patients. Cancer Res 1999;59(14): 3317–20.

4. Wei Q, Cheng L, Amos CI , et al. Repair of tobacco carcinogen-induced DNA adducts and lung cancer risk: a molecular epidemiologic study. J Natl Cancer Inst 2000;92(21):1764–72.

2079 Estrogen Receptor Signaling in Lung Cancer

5. Patel JD, Bach PB, Kris MG. Lung cancer in US women: a contemporary epidemic. JAMA 2004;291(14):1763–8.

6. Parkin DM, Bray F, Ferlay J, Pisani P. Global cancer statistics, 2002. CA Cancer J Clin 2005;55(2):74–108.

7. Frasor J, Danes JM, Komm B, Chang KCN, Lyttle CR, Katzenellenbogen BS. Profi ling of Estrogen-Up- and Down-Regulated Gene Expression in Human Breast Cancer Cells: Insights into Gene Networks and Pathways Underlying Estrogenic Control of Proliferation and Cell Phenotype. Endocrinology 2003;144:4562–74.

8. Kuiper GG, Enmark E, Pelto-Huikko M, Nilsson S, Gustafsson JA. Cloning of a novel receptor expressed in rat prostate and ovary. Proc Natl Acad Sci USA 1996;93(12):5925–30.

9. Mosselman S, Polman J, Dijkema R. ER beta: identifi cation and characterization of a novel human estrogen receptor. FEBS Lett 1996;392(1):49–53.

10. Delaunay F, Pettersson K, Tujague M, Gustafsson JA. Functional differences between the amino-terminal domains of estrogen receptors alpha and beta. Mol Pharmacol 2000;58(3):584–90.

11. Brzozowski AM, Pike AC, Dauter Z , et al. Molecular basis of agonism and antagonism in the oestrogen receptor. Nature 1997;389(6652):753–8.

12. Shiau AK, Barstad D, Loria PM , et al. The structural basis of estrogen receptor/coactivator recognition and the antagonism of this interaction by tamoxifen. Cell 1998;95(7):927–37.

13. Kushner PJ, Agard, D.A., Greene, G.L., Scanlan, T.S., Shiau, A.K., Uht, R.M., Webb, P. Estrogen receptor pathways to AP-1. Journal Steroid Biochemistry Molecular Biology 2000;74:311–7.

14. Safe S, Kim K. Non-classical genomic estrogen receptor (ER)/specifi city protein and ER/activating protein-1 signaling pathways. J Mol Endocrinol 2008;41(5):263–75.

15. Kininis M, Chen BS, Diehl AG , et al. Genomic analyses of transcription factor binding, his-tone acetylation, and gene expression reveal mechanistically distinct classes of estrogen-regu-lated promoters. Mol Cell Biol 2007;27(14):5090–104.

16. Fisher B, Costantino JP, Wickerham DL , et al. Tamoxifen for prevention of breast cancer: report of the National Surgical Adjuvant Breast and Bowel Project P-1 Study. J Natl Cancer Inst 1998;90(18):1371–88.

17. Shang Y, Brown, M. Molecular Determinants for the Tissue Specifi city of SERMs. Science 2002;295:2465–8.

18. Osborne CK, Wakeling A, Nicholson RI. Fulvestrant: an oestrogen receptor antagonist with a novel mechanism of action. Br J Cancer 2004;90 Suppl 1:S2-6.

19. Dauvois S, Danielian PS, White R, Parker MG. Antiestrogen ICI 164,384 reduces cellular estrogen receptor content by increasing its turnover. Proc Natl Acad Sci USA 1992;89(9): 4037–41.

20. Dauvois S, White R, Parker MG. The antiestrogen ICI 182780 disrupts estrogen receptor nucleocytoplasmic shuttling. J Cell Sci 1993;106 ( Pt 4):1377–88.

21. DeFriend DJ, Anderson E, Bell J , et al. Effects of 4-hydroxytamoxifen and a novel pure antioestrogen (ICI 182780) on the clonogenic growth of human breast cancer cells in vitro. Br J Cancer 1994;70(2):204–11.

22. Osborne CK, Coronado-Heinsohn EB, Hilsenbeck SG , et al. Comparison of the effects of a pure steroidal antiestrogen with those of tamoxifen in a model of human breast cancer. J Natl Cancer Inst 1995;87(10):746–50.

23. Van Den Bemd GJ, Kuiper GG, Pols HA, Van Leeuwen JP. Distinct effects on the conforma-tion of estrogen receptor alpha and beta by both the antiestrogens ICI 164,384 and ICI 182,780 leading to opposite effects on receptor stability. Biochem Biophys Res Commun 1999;261(1):1–5.

24. Peekhaus NT, Chang T, Hayes EC , et al. Distinct effects of the antiestrogen Faslodex on the stability of estrogen receptors-alpha and -beta in the breast cancer cell line MCF-7. J Mol Endocrinol 2004;32(3):987–95.

25. Damdimopoulos AE, Spyrou G, Gustafsson JA. Ligands differentially modify the nuclear mobility of estrogen receptors alpha and beta. Endocrinology 2008;149(1):339–45.

208 P.A. Hershberger and J.M. Siegfried

26. Stabile LP, Gaither Davis AL, Gubish CT, Hopkins TM, Luketich JD, Christie N, Finkelstein S, and Siegfried JM. Human Non-Small Cell Lung Tumors and Cells Derived from Normal Lung Express Both Estrogen Receptor a and b and Show Biological Responses to Estrogen. Cancer Research 2002;62:2141–50.

27. Hershberger PA, Stabile LP, Kanterewicz B , et al. Estrogen receptor beta (ERbeta) subtype-specifi c ligands increase transcription, p44/p42 mitogen activated protein kinase (MAPK) activa-tion and growth in human non-small cell lung cancer cells. J Steroid Biochem Mol Biol 2009.

28. Lau KM, LaSpina M, Long J, Ho SM. Expression of estrogen receptor (ER)-alpha and ER-beta in normal and malignant prostatic epithelial cells: regulation by methylation and involvement in growth regulation. Cancer Res 2000;60(12):3175–82.

29. Belcher SM, Ma X, Le HH. Blockade of estrogen receptor signaling inhibits growth and migration of medulloblastoma. Endocrinology 2009;150(3):1112–21.

30. Ciana P, DiLuccio G, Belcredito S, Pollio G, Vegeto E, Tatangelo L, Tiveron C, Maggi A. Engineering of a Mouse for the in Vivo Profi ling of Estrogen Receptor Activity. Molecular Endocrinology 2001;15:1104–13.

31. Lemmen JG, Arends RJ, van Boxtel AL, van der Saag PT, van der Burg B. Tissue- and time-dependent estrogen receptor activation in estrogen reporter mice. J Mol Endocrinol 2004;32(3):689–701.

32. Patrone C, Cassel TN, Pettersson K, Piao Y-S, Cheng G, Ciana P, Maggi A, Warner M, Gustafsson J-A, Nord M. Regulation of Postnatal Lung Development and Homeostasis by Estrogen Receptor b . Molecular and Cellular Biology 2003;23:8542–52.

33. Morani A, Barros RP, Imamov O , et al. Lung dysfunction causes systemic hypoxia in estrogen receptor beta knockout (ERbeta−/−) mice. Proc Natl Acad Sci USA 2006;103(18):7165–9.

34. Oton AB BC, Cai C, Owonikoko T, Gooding W, Siegfried J, Ramalingam R. Comparison of survival for non-small cell lung cancer between premenopausal and postmenopausal women: An analysis of the National Surveillance, Epidemiology and End Results (SEER) Database. Journal of Clinical Oncology, ASCO Annual Meeting Proceedings 2006;24(18 S):7038.

35. Albain KS UJ, Gotay CC, Davies AM, Edelman M, Herbst RS, Kelly K, Williamson S, Wozniak AJ, Gandara DR. Toxicity and survival by sex in patients with advanced non-small cell lung carcinoma on modern Southwest Oncology Group (SWOG) trials. Journal of Clinical Oncology ASCO Annual Meeting Proceedings 2007;25(18 S):7549.

36. Ross H OF, Bandstra B, Sandalic L, Bianco J, Bonomi P, Singer JW. Serum-free estradiol (E2) levels are prognostic in men with chemotherapy-naive advanced non-small cell lung cancer and performance status (PS) 2. Journal of Clinical Oncology ASCO Annual Meeting Proceedings 2007;25(18 S):7683.

37. La Vecchia C. Hormone replacement therapy in menopause and lung cancer: an update. Eur J Cancer Prev 2006;15(3):189–90.

38. Ganti AK, Sahmoun AE, Panwalkar AW, Tendulkar KK, Potti A. Hormone replacement ther-apy is associated with decreased survival in women with lung cancer. J Clin Oncol 2006;24(1):59–63.

39. Ayeni O, Robinson A. Hormone replacement therapy and outcomes for women with non-small-cell lung cancer: can an association be confi rmed? Curr Oncol 2009;16(3):21–5.

40. Chlebowski R.T. SA, Wakelee H., Anderson G.L., Stefanick M.L., Manson J.E., Chien J.W., Chen C., Wactawski-Wende J., Gass M. Non-small cell lung cancer and estrogen plus proges-tin use in postmenopausal women in the Women’s Health Initiative randomized clinical trial. J Clin Oncol 2009;27:18 s.

41. Hammoud Z, Tan B, Badve S, Bigsby RM. Estrogen promotes tumor progression in a geneti-cally defi ned mouse model of lung adenocarcinoma. Endocr Relat Cancer 2008;15(2):475–83.

42. Hershberger PA, Vasquez AC, Kanterewicz B, Land S, Siegfried JM, Nichols M. Regulation of endogenous gene expression in human non-small cell lung cancer cells by estrogen receptor ligands. Cancer Res 2005;65(4):1598–605.

43. Jarzynka MJ, Guo P, Bar-Joseph I, Hu B, Cheng SY. Estradiol and nicotine exposure enhances A549 bronchioloalveolar carcinoma xenograft growth in mice through the stimulation of angiogenesis. Int J Oncol 2006;28(2):337–44.

2099 Estrogen Receptor Signaling in Lung Cancer

44. Pietras RJ, Marquez DC, Chen HW, Tsai E, Weinberg O, Fishbein M. Estrogen and growth factor receptor interactions in human breast and non-small cell lung cancer cells. Steroids 2005;70(5–7):372–81.

45. Stabile LP, Lyker JS, Gubish CT, Zhang W, Grandis JR, Siegfried JM. Combined Targeting of the Estrogen Receptor and the Epidermal Growth Factor Receptor in Non-Small Cell Lung Cancer Shows Enhanced Anti-Proliferative Effects. Cancer Research 2005;65(4):1459–70.

46. Marquez-Garban DC, Chen HW, Fishbein MC, Goodglick L, Pietras RJ. Estrogen receptor signaling pathways in human non-small cell lung cancer. Steroids 2007;72(2):135–43.

47. Pedram A, Razandi M, Levin ER. Nature of functional estrogen receptors at the plasma mem-brane. Mol Endocrinol 2006;20(9):1996–2009.

48. Zhang G, Liu X, Farkas AM , et al. Estrogen receptor beta functions through nongenomic mechanisms in lung cancer cells. Mol Endocrinol 2009;23(2):146–56.

49. Mattingly KA, Ivanova MM, Riggs KA, Wickramasinghe NS, Barch MJ, Klinge CM. Estradiol stimulates transcription of nuclear respiratory factor-1 and increases mitochondrial biogenesis. Mol Endocrinol 2008;22(3):609–22.

50. Yang SH, Sarkar SN, Liu R , et al. Estrogen receptor beta as a mitochondrial vulnerability factor. J Biol Chem 2009;284(14):9540–8.

51. Chen JQ, Eshete M, Alworth WL, Yager JD. Binding of MCF-7 cell mitochondrial proteins and recombinant human estrogen receptors alpha and beta to human mitochondrial DNA estro-gen response elements. J Cell Biochem 2004;93(2):358–73.

52. Klinge CM. Estrogenic control of mitochondrial function and biogenesis. J Cell Biochem 2008;105(6):1342–51.

53. Simpkins JW, Yang SH, Sarkar SN, Pearce V. Estrogen actions on mitochondria--physiologi-cal and pathological implications. Mol Cell Endocrinol 2008;290(1–2):51–9.

54. Virbasius CA, Virbasius JV, Scarpulla RC. NRF-1, an activator involved in nuclear-mitochon-drial interactions, utilizes a new DNA-binding domain conserved in a family of developmental regulators. Genes Dev 1993;7(12A):2431–45.

55. Yang SH, Liu R, Perez EJ , et al. Mitochondrial localization of estrogen receptor beta. Proc Natl Acad Sci USA 2004;101(12):4130–5.

56. Chen JQ, Delannoy M, Cooke C, Yager JD. Mitochondrial localization of ERalpha and ERbeta in human MCF7 cells. Am J Physiol Endocrinol Metab 2004;286(6):E1011-22.

57. Milanesi L, Vasconsuelo A, de Boland AR, Boland R. Expression and subcellular distribution of native estrogen receptor beta in murine C2C12 cells and skeletal muscle tissue. Steroids 2009;74(6):489–97.

58. Cammarata PR, Chu S, Moor A, Wang Z, Yang SH, Simpkins JW. Subcellular distribution of native estrogen receptor alpha and beta subtypes in cultured human lens epithelial cells. Exp Eye Res 2004;78(4):861–71.

59. Pedram A, Razandi M, Wallace DC, Levin ER. Functional estrogen receptors in the mitochon-dria of breast cancer cells. Mol Biol Cell 2006;17(5):2125–37.

60. Wu CT, Chang YL, Shih JY, Lee YC. The signifi cance of estrogen receptor beta in 301 surgi-cally treated non-small cell lung cancers. J Thorac Cardiovasc Surg 2005;130(4):979–86.

61. Schwartz AG, Prysak GM, Murphy V , et al. Nuclear estrogen receptor beta in lung cancer: expression and survival differences by sex. Clin Cancer Res 2005;11(20):7280–7.

62. Kawai H, Ishii A, Washiya K , et al. Estrogen receptor alpha and beta are prognostic factors in non-small cell lung cancer. Clin Cancer Res 2005;11(14):5084–9.

63. Skov BG, Fischer BM, Pappot H. Oestrogen receptor beta over expression in males with non-small cell lung cancer is associated with better survival. Lung Cancer 2007.

64. Escande A, Pillon A, Servant N , et al. Evaluation of ligand selectivity using reporter cell lines stably expressing estrogen receptor alpha or beta. Biochem Pharmacol 2006;71(10):1459–69.

65. Meyers MJ, Sun J, Carlson KE, Marriner GA, Katzenellenbogen BS, Katzenellenbogen JA. Estrogen receptor-beta potency-selective ligands: structure-activity relationship studies of diarylpropionitriles and their acetylene and polar analogues. J Med Chem 2001;44(24):4230–51.

210 P.A. Hershberger and J.M. Siegfried

66. Stauffer SR, Coletta CJ, Tedesco R, Nishiguchi G, Carlson K, Sun J, Katzenellenbogen BS, Katzenellenbogen JA. Pyrazole ligands: structure-affi nity/activity relationships and estrogen receptor-alpha-selective agonists. J Medicinal Chemistry 2000;43(26):4934–47.

67. Kato S, Endoh H, Masuhiro Y , et al. Activation of the estrogen receptor through phosphoryla-tion by mitogen-activated protein kinase. Science 1995;270(5241):1491–4.

68. Curtis SW, Washburn T, Sewall C , et al. Physiological coupling of growth factor and steroid receptor signaling pathways: estrogen receptor knockout mice lack estrogen-like response to epidermal growth factor. Proc Natl Acad Sci USA 1996;93(22):12626–30.

69. Migliaccio A, Di Domenico M, Castoria G , et al. Steroid receptor regulation of epidermal growth factor signaling through Src in breast and prostate cancer cells: steroid antagonist action. Cancer Res 2005;65(22):10585–93.

70. Razandi M, Pedram A, Park ST, Levin ER. Proximal events in signaling by plasma membrane estrogen receptors. J Biol Chem 2003;278(4):2701–12.

71. Traynor AM, Schiller JH, Stabile LP , et al. Pilot study of gefi tinib and fulvestrant in the treat-ment of post-menopausal women with advanced non-small cell lung cancer. Lung Cancer 2009;64(1):51–9.

72. Giovannini M, Belli C, Villa E, Gregorc V. Estrogen receptor (ER) and epidermal growth factor receptor (EGFR) as targets for dual lung cancer therapy: not just a case? J Thorac Oncol 2008;3(6):684–5.

73. Miller WR, Hawkins RA, Forrest AP. Signifi cance of aromatase activity in human breast cancer. Cancer Res 1982;42(8 Suppl):3365 s-8 s.

74. Bulun SE, Simpson ER. Breast cancer and expression of aromatase in breast adipose tissue. Trends Endocrinol Metab 1994;5(3):113–20.

75. Yue W, Wang J, Savinov A, Brodie A. Effect of aromatase inhibitors on growth of mammary tumors in a nude mouse model. Cancer Res 1995;55(14):3073–7.

76. Buzdar AU, Coombes RC, Goss PE, Winer EP. Summary of aromatase inhibitor clinical trials in postmenopausal women with early breast cancer. Cancer 2008;112(3 Suppl):700–9.

77. Eisen A, Trudeau M, Shelley W, Messersmith H, Pritchard KI. Aromatase inhibitors in adju-vant therapy for hormone receptor positive breast cancer: a systematic review. Cancer Treat Rev 2008;34(2):157–74.

78. Price T, Aitken J, Simpson ER. Relative expression of aromatase cytochrome P450 in human fetal tissues as determined by competitive polymerase chain reaction amplifi cation. J Clin Endocrinol Metab 1992;74(4):879–83.

79. Pezzi V, Mathis JM, Rainey WE, Carr BR. Profi ling transcript levels for steroidogenic enzymes in fetal tissues. J Steroid Biochem Mol Biol 2003;87(2–3):181–9.

80. Weinberg OK, Marquez-Garban DC, Fishbein MC , et al. Aromatase inhibitors in human lung cancer therapy. Cancer Res 2005;65(24):11287–91.

81. Mah V, Seligson DB, Li A , et al. Aromatase expression predicts survival in women with early-stage non small cell lung cancer. Cancer Res 2007;67(21):10484–90.

82. Marquez-Garban DC, Chen HW, Goodglick L, Fishbein MC, Pietras RJ. Targeting aromatase and estrogen signaling in human non-small cell lung cancer. Ann N Y Acad Sci 2009;1155:194–205.

83. Niikawa H, Suzuki T, Miki Y , et al. Intratumoral estrogens and estrogen receptors in human non-small cell lung carcinoma. Clin Cancer Res 2008;14(14):4417–26.

84. Coombes RC, Hall E, Gibson LJ , et al. A randomized trial of exemestane after two to three years of tamoxifen therapy in postmenopausal women with primary breast cancer. N Engl J Med 2004;350(11):1081–92.

211M. Chatterjee and K. Kashfi (eds.), Cell Signaling & Molecular Targets in Cancer, DOI 10.1007/978-1-4614-0730-0_10, © Springer Science+Business Media, LLC 2012

Introduction

Extensive reviews in the current literature indicate that tumor growth and metastasis are dependent on reciprocal communication between cancer cells and cells of the tumor microenvironment. However, the recognition that the tumor microenviron-ment is enriched not only in activated stromal cells but also in tumor and stromal cell-derived microparticles (MPs) with biological function has added a new level of complexity to the tumor stroma. Previously regarded as passive components of the cell environment, accumulating evidence defi nitively demonstrate that shed MPs from tumor cells and stromal cells engage in cell–cell communication, playing mul-tiple roles in various facets of tumor biology including tumor growth, angiogenesis, and metastasis, as well as cancer-associated thrombosis [ 1– 5 ] .

Subcellular procoagulant particles were fi rst described by Wolf in 1967 [ 6 ] , who found that minute particles in normal human plasma and serum, which he termed “platelet dust,” were responsible for the platelet-related coagulant activity of whole plasma and serum. In 1971, Crawford [ 7 ] extended these observations and concluded that these microparticles were formed by in vivo fracture of membrane buds from extended platelet pseudopods. Many studies have now reported the in vitro release of vesicles from apoptotic or activated cells and their presence in human plasma. The membrane vesicles that cells release are heterogeneous in size and have been desig-nated as exosomes when they constitute smaller vesicles (40–100 m m) originating from the endoplasmic membrane, microparticles (MP), or microvesicles (0.1–1 m m) derived from the plasma membrane and apoptotic bodies (>1.5 m m) containing nuclear material [ 8– 10 ] . Apoptotic or activated cells release MPs which expose the anionic phospholipid phosphatidylserine (PS) and express membrane antigens that

P. P. Goh (*) Vascular Immunology Unit, Department of Pathology , Sydney Medical School, University of Sydney , Sydney, NSW 2006, Australia e-mail: paulineg@med.usyd.edu.au

Chapter 10 Microparticle Dissemination of Biological Activities: Implications for Cancer Biology

Pauline P. Goh

212 P.P. Goh

refl ect their cellular origin [ 11, 12 ] The most abundant MPs in the blood arise from platelets, although MPs in the periphery can also arise from lymphocytes, mono-cytes, and endothelial cells. While MPs are present in peripheral blood of healthy individuals, elevated numbers of circulating procoagulant MPs derived from leuko-cytes, platelets, and endothelial cells have been described in various pathological states. These conditions include cancer, acute coronary syndromes, antiphospholipid antibody syndrome, sickle cell disease, sepsis, and diabetes [ 8, 11, 13 ] .

MPs secreted by tumor cells and vascular cells in both solid tumors and hemato-logical malignancies have been reported to circulate at high levels in venous blood of cancer patients, and in some studies, have been shown to correlate with disease activity [ 14– 18 ] . There is still a paucity of experimental and clinical data relating to the contribution of MPs to various aspects of tumor biology. The available litera-ture, however, has provided some valuable insights into the repertoire of potential roles that circulating or blood-borne MPs can assume. Some tumor MPs expressing FasL appear to participate in immune escape [ 18, 19 ] . Furthermore, the high levels of tissue factor (TF)-expressing MPs demonstrated in cancer patients, and their positive correlation with coagulation activation markers, suggest that TF + MP may contribute to hypercoagulability in cancer patients [ 17, 20– 22 ] . Some researchers have also postulated that elevated levels of circulating tumor – as well as platelet-derived MPs which correlate with disease activity – may serve as useful predictors of cancer metastasis [ 14, 18, 23 ] .

This chapter will fi rstly provide an overview of how MPs are generated, what stimuli (both in vitro and in vivo) trigger vesiculation, and what are the current tech-nologies used for measuring MPs. Next, the focus will be on how MPs derived from cancer cells or platelets mediate tumor growth, angiogenesis, and metastasis. Finally, the potential role of tissue factor-positive MPs in facilitating cancer-associated thrombosis will be examined.

Cell-Derived Microparticles

Mechanism of MP Generation, Release, and Action

Resting mammalian cells are characterized by membrane phospholipid asymmetry, with the cytoplasmic leafl et predominantly formed by phosphatidylserine (PS) and phosphatidylethanolamine (PE), whereas the external leafl et is composed of phos-phatidylcholine and sphingomyelin [ 24 ] . The transbilayer lipid distribution is under the control of three major enzymes: an inward-directed pump, termed fl ippase with specifi city for PS and PE, an outward-directed pump referred as fl oppase, and a lipid scramblase promoting nonspecifi c, bidirectional redistribution across the bilayer [ 25, 26 ] . A signifi cant and sustained increase of cytosolic Ca 2+ accompany-ing cell stimulation may lead to the loss of phospholipid asymmetry, exposure of PS

21310 Microparticles and Cancer Biology

on the outer cell surface, and cell membrane vesiculation [ 25, 26 ] . Furthermore, since MPs generated from apoptotic endothelial cells (ECs) have been shown to have higher levels of PS on their surface compared with MPs generated from acti-vated ECs, it has been suggested that there are distinct mechanisms for the forma-tion of MPs in apoptotic and activated cells [ 27 ] . To date, the exact mechanisms governing MP formation are not completely understood. An earlier study, however, showed that fl uvastatin signifi cantly suppressed the generation of MPs from TNF- a -stimulated human coronary artery ECs (HCAECs), as well as TNF- a -induced Rho activation. In addition, a Rho-kinase inhibitor was shown to produce a similar suppression of MP release, implicating this kinase in the formation of MPs [ 28 ] .

Stimuli Triggering MP Generation

Data from in vitro studies have shown that MPs are shed from the surface of cells following exposure to a variety of chemical stimuli such as cytokines, thrombin, and endotoxin, or physical stimuli such as shear stress or hypoxia [ 10 ] . Depending on the stimuli used to generate them, MPs may differ in their content of exposed mem-brane anionic phospholipids and therefore their procoagulant potential [ 29 ] . In gen-eral, microparticle release, occurring minutes after addition of agonist, is dependent on the increase in cytosolic calcium [ 30 ] .

Platelets are activated by thrombin, calcium ionophore A23187, ADP plus colla-gen, the terminal complement complex C5b-9, or shear stress [ 10 ] . Monocytes, EC, hepatocytes, and arterial smooth muscle cells release MPs upon activation by bacterial lipopolysaccharides (LPS) and cytokines such as tumor necrosis factor- a or interleu-kin-1 b [ 10 ] . In an earlier study, the C5b-9 complex was reported to induce vesicula-tion of HUVEC plasma membrane and express binding sites for factor Va, perhaps contributing to fi brin deposition associated with immune endothelial injury [ 31 ] .

Similarly, in response to apoptotic signals or cellular activation that may accom-pany infl ammatory or hypercoagulable states present in malignancy, tumor cells and the cells which constitute the tumor microenvironment release MPs. Presently, the different endogenous agonists or stimuli which trigger cell vesiculation in vivo have not been thoroughly investigated. Of signifi cance to cancer biology are observations that many of the stimuli or agonists demonstrated to trigger cell vesiculation in vitro are either hemostatic proteins expressed by tumor cells for activation of the coagula-tion system or physical stimuli like hypoxia which promote tumor angiogenesis critical for tumor growth and metastasis.

Hemostatic factors : Tumor cells can express procoagulant proteins such as tissue factor (TF), the primary initiator of blood coagulation, which result in thrombin generation and ultimately clot formation [ 32 ] . Tumor cells also express fi brinolysis proteins like urokinase-type plasminogen (uPA) and tissue-type plasminogen acti-vators and their inhibitors, plasminogen activator inhibitors 1 and 2 (PAI-1 and PAI-2) [ 32, 33 ] . Increased production of PAI-1 resulting in a defect in the generation of

214 P.P. Goh

normal plasma fi brinolytic activity may represent another mechanism for the development of venous thromboembolism (VTE) in patients with solid tumors [ 34 ] .

In an in vitro study, PAI-1 has been shown to rapidly and dose-dependently pro-mote formation of procoagulant endothelial MP (EMP) from EC. Interestingly, PAI-1 knockout mice showed a signifi cantly decreased numbers of EMP than wild-type mice. Moreover, PAI-1-defi cient mice responded to an infusion of PAI-1 with a more pronounced rise in the number of MP, and the number of MP stained with Annexin V, evidence for the expression of anionic phospholipid. Increased proco-agulant potential was indicated by accelerated thrombin formation by ECs [ 35 ] .

Platelet activation factors : By the release of soluble factors, such as adenosine diphosphate (ADP), or by thrombin generation via activation of the coagulation cascade, tumor cells also induce platelet activation and aggregation [ 36, 37 ] .

Infl ammatory cytokines : Tumor cells synthesize and release a variety of pro-infl am-matory cytokines like TNF- a and IL-1 b . In response to the tumor insult, normal infl ammatory host tissue also engages in cytokine overproduction [ 32, 37 ] . In addi-tion to inducing TF expression in tumor-associated macrophages and ECs, TNF- a and IL-1 b also stimulate ECs to increase the production of the fi brinolytic inhibitor PAI-1 [ 32 ] .

Hypoxia : Clinical investigations carried out over the last two decades have clearly demonstrated that the prevalence of hypoxic tissue is a characteristic pathophysio-logical property of locally advanced solid tumors, promoting tumor progression and resistance to therapy [ 38 ] . It is now well established that hypoxia is a key regulator of tumor angiogenesis, a process crucial to tumor growth and metastasis. In response to hypoxia, cancer cells and normal cells have been reported to secrete vascular endothelial growth factor (VEGF), a key angiogenic factor [ 39 ] .

Recently, Wysoczynski and Ratjczak [ 40 ] reported that human and murine lung cancer cells treated with non-apoptotic doses of either hypoxia (1% O

2 ) or g -irradia-

tion (1,000 cGy) secreted up to 4 times more MPs compared to controls. These tumor-derived MPs (TMPs) activated and chemoattracted stroma fi broblasts and ECs. Signifi cantly, these TMPs also induce expression of angiopoietic factors like interleukin-8 (IL-8), VEGF, and matrix metalloproteinase-9 (MMP-9) in these cells.

Other studies have highlighted the ability of chemotherapy and procedures adopted for blood storage and processing to induce cell vesiculation. Since chemo-therapy and blood transfusion form part of the treatment modalities for cancer patients, these in vitro data, though preliminary, merit our attention.

Effect of cisplatin on cell vesiculation : Cisplatin-based chemotherapy has been reported to predispose cancer patients to thromboembolic events [ 41 ] . A recent study demon-strated that cisplatin dose- and time-dependently increased the formation of procoagu-lant EMPs from human umbilical vein endothelial cells (HUVECs) and human pulmonary microvesicular ECs. Blocking of phospholipids by Annexin V markedly diminished EMP-associated procoagulant activity which is TF independent [ 42 ] .

Effect of blood product storage and processing on cell vesiculation : Of signifi cance to hematologists/oncologists are preliminary results reported by Gelderman’s lab [ 43 ]

21510 Microparticles and Cancer Biology

which indicated that apheresis platelet units (APU) analyzed on day 6 of the platelet storage period contained signifi cantly elevated counts of MPs derived from plate-lets, WBC, RBC, and ECs when compared to plasma from healthy volunteers. Importantly, overnight incubation of APU MPs with cultured ECs induced a signifi -cant increase in cell apoptosis and endothelial expression of CD154 (ICAM-1) and CD142 (TF), markers of infl ammation and coagulation, respectively. The potential impact of collection, processing, and storage steps on MP generation in blood and blood products has been reviewed by Simak and Gelderman [ 44 ] .

Measurement of MP

Microplate affi nity assays and fl ow cytometry : In general, most investigators use either microplate affi nity assays or fl ow cytometry assays for MP analysis [ 45 ] . Both types of assays depend on the antigenic composition of MPs and allow them to be enumerated according to their cellular origin. There are two types of microplate affi nity assays. One frequently used assay, the enzyme-linked immunosorbent assay (ELISA) can be designed using antibodies to MP antigens for capture, detection, or both, whereas the other assays use Annexin V in the presence of Ca 2+ to capture or detect PS + MP [ 44 ] .

Conventional fl ow cytometry (FACS) is the most commonly used method for analyzing the number, size, and properties of MPs. By defi nition, MPs are small structures (0.1–1 m m) which display characteristic forward and side scatter patterns. As in the case of FACS analysis of cells, antibodies to cell surface molecules allow the identifi cation of specifi c MP subpopulations. While ELISAs can assess the total amount of MP-related material in a specimen, they cannot provide information on the number or size of MPs.

A critical review of the technical aspects of MP assays has been published recently [ 46 ] . MP analysis can be impacted not only by the type of assay but also by the manner in which blood is collected and processed, including sampling site, nee-dle diameter, centrifugation, and freeze-thaw methods [ 44 ] . At present, MP analysis is constrained by the lack of standardized MP assays, a challenge now being addressed by the Working Group on Vascular Biology of the Scientifi c and Standardization Committee of the International Society on Thrombosis and Hemostasis.

Proteomic analysis of proteins in MPs : Because of their critical pathophysiological role, the characterization of which cellular proteins are represented in MP is pivotal to the understanding of their function. Proteomics has been regarded by many researchers as the technology of choice for this kind of research, and some investi-gations into the microparticle proteome have appeared in the literature [ 47 ] . The current view is that protein-based microarray technologies using 2-dimensional electrophoresis (2-DE) and mass spectrometry represent an advancement in high-throughput analysis compared to standard ELISA techniques.

216 P.P. Goh

Role of Cell-Derived MPS in Tumor Growth, Angiogenesis, and Metastasis

Tumor Progression and Metastasis

Cancer metastasis, a hallmark of cancer, is a highly coordinated and dynamic multistep process and is recognized as the product of an evolving and extensive cross talk between genetically abnormal cells and stromal cells within the tumor microenvironment [ 48 ] . Briefl y, the metastatic cascade begins with tumor invasion enabling cancer cells to break free from the primary tumor, intravasation into the blood circulation, survival of cells in the circulation, arrest in a new organ, extrava-sation into the surrounding tissue, initiation and maintenance of growth in meta-static foci, and vascularization of the metastatic tumor [ 49 ] .

A great deal of experimental evidence has provided support for the observation that cancer cells can alter their adjacent stroma to form a permissive and supportive environment for tumor progression by producing a range of stroma-modulating growth factors and proteolytic enzymes [ 50 ] . These stromal modulators disrupt nor-mal tissue homeostasis and act in a paracrine manner to induce angiogenesis and infl ammation, as well as activate stromal fi broblasts and other stromal cells in the tumor microenvironment. Thus, the reactive tumor stroma is characterized by the presence of proliferating ECs, resulting in a high number of leaky tumor vessels, increased numbers of infl ammatory cells, fragments of extracellular matrix (ECM) molecules, active proteases, and activated fi broblasts called myofi broblasts [ 50 ] .

It is now widely appreciated that cancer cells constitutively shed membrane ves-icles into the extracellular environment both in vitro and in vivo [ 51 ] . By actively shedding MPs which can modify the phenotype as well as infl uence diverse biologi-cal functions of a range of target cells that constitute the tumor stroma, cancer cells have developed an additional strategy to support its growth and progression. In a reciprocal fashion, MPs derived from activated stromal cells are able to modify the phenotype of tumor cells, increasing their invasiveness and metastatic potential.

Tumor Cell-Derived MPs (TMPs) and Tumor Growth, Angiogenesis, and Metastasis

Of signifi cance to tumor biology is the demonstration that tumor cell lines with highly metastatic potential release a greater amount of microparticles (TMPs) than cells with low metastatic ability [ 52 ] . Phenotypic characterization of TMPs has indicated that several, but not all, determinants expressed by tumor cells are present on TMPs. Furthermore, their level of expression on TMPs does not always correlate with that on tumor cells [ 53 ] .

As summarized in Fig. 10.1 and reviewed in the subsequent sections, TMPs assume many roles in tumor biology. Since TMPs are rich in matrix-degrading pro-teinase activities, they may play critical roles in ECM digestion, facilitating invasion

21710 Microparticles and Cancer Biology

of tumor cells during metastasis and migration of endothelial cells during angiogenesis. TMPs can also mediate tumor angiogenesis by transferring proangiogenic mRNA and proteins to ECs. Furthermore, their ability to induce apoptosis, or inhibit prolif-eration of immune cells, forms part of their arsenal to escape immune surveillance. Finally, signaling through chemokine receptors acquired from TMPs also enhances chemotactic and invasive responses of target cells, with ultimate homing to specifi c metastatic niches.

TMPs and Tumor Invasion and Metastasis

In many pathological situations, cells cause excessive degradation of their own matrix. One of the most striking examples of unbridled attack upon the ECM is seen in the process of tumor invasion and metastasis, where cells of the primary tumor acquire an invasive phenotype. Invasion of the ECM by primary tumor cells during metastasis requires the concerted effort of ECM-degrading proteinases produced by many tumors with a migratory and invasive phenotype [ 54 ] .

Research data accumulated over the last decade have shown that TMPs released from cultured cancer cell lines are enriched in proteolytic enzymes like matrix metal-loproteinases (MMPs) which are free or complexed with their tissue inhibitors (TIMPs), zymogen pro-MMPs, membrane-type MMPs (MT-MMP), and urokinase-type

PrimaryTumor

Cell

TMP

TMP

TMPTMP

Trafficking toMetastatic foci

ECMdegradation

TMP-InducedAngiogenesis

ImmuneEscape

MMPs, TIMP1, uPA,MT-1 MMP

CXCR4

β1 integrin, VEGF, HGF, angiogenin,EGFRIL-6, IL-8, MMPS, CD147

FasL, TGF-β, HLA 1

CXCL12

CCR6

CCL20

Fig. 10.1 Schematic diagram of some phenotypes of tumor cell–derived microparticles impli-cated in tumor growth, angiogenesis, and metastasis

218 P.P. Goh

plasminogen activator (uPA) [ 55– 60 ] . MMPs degrade basement membrane collagens, whereas uPA catalyzes the conversion of plasminogen to plasmin, a broad-spectrum serine protease that degrades numerous components of the ECM including fi brin, laminin, fi bronectin, and vitronectin [ 57 ] . That cellular membrane vesicle shedding may represent a possible pathway of MMP enzyme release was suggested by early electron microscopic observations of invasive carcinoma tissue that showed destruc-tion of connective stroma by membrane vesicles close to the invading epithelial cells [ 61 ] . Phenotyping of TMPs shed by human HT1080 fi brosarcoma cells indi-cate that they are rich in zymogen (pro-MMP-2 and pro-MMP-9) and active forms of MMP-2 and MMP-9, as well as MMP-9–TIMP 1 and uPA–uPA receptor com-plexes [ 56 ] . Interestingly, the TMPs also exhibited a strong plasminogen-dependent fi brinolytic activity due to TMP-associated uPA. Furthermore, addition of exoge-nous plasminogen resulted in activation of TMP-associated pro-MMPs to active MMPs, indicating a role for the urokinase–plasmin system in MMP-2 and MMP-9 activation. Based on these observations, the authors postulated that TMPs may pro-vide a large membrane surface for the activation of membrane-associated protei-nases involved in ECM degradation and tissue invasion [ 56 ] .

In ovarian cancer, malignant ovarian ascites-derived membrane vesicles from stages III and IV ascites also contain activated MMP-2, MMP-9, and uPA and are potent inducers of proteinase-dependent invasion in cultured malignant ovarian epi-thelium [ 57 ] . Furthermore, TMPs shed by 8701-BC breast carcinoma cells were found to be densely packed with the b 1 integrin subunit [ 55 ] . Since integrins are the major class of receptors that regulate cell adhesion to ECM macromolecules [ 62, 63 ] , the researchers hypothesized that compacting of integrins on the membranes of shed TMPs may facilitate the binding of these TMPs to ECM components, thus permitting proteolytic enzymes to act focally on their substrates [ 55 ] .

TMPs and Tumor-Induced Angiogenesis

During adulthood, most blood vessels remain quiescent, and angiogenesis or the formation of new blood vessels from preexisting ones occurs only under tight regu-lation in the cycling ovary, in the placenta during pregnancy, and during wound healing [ 64– 66 ] . However, in response to a hypoxic tumor microenvironment, the balance between angiogenesis stimulators and inhibitors is tilted, resulting in an angiogenic switch with resultant dysregulated tumor neovascularization [ 67 ] .

Pioneering work by Folkman in the early 1970s showing that tumors cannot grow beyond a critical size or metastasize to another organ without blood vessels has led to the recognition that tumor growth and metastasis are angiogenesis depen-dent [ 68 ] . Thus, as a primary tumor grows, it needs to develop a blood supply that can support its metabolic needs, as well as provide an escape route by which tumor cells can leave the primary tumor mass and enter the body’s circulatory blood sys-tem to metastasize to secondary sites. Furthermore, once the metastatic cell has reached its target organ, angiogenesis is again required for the metastases to grow [ 69– 71 ] .

21910 Microparticles and Cancer Biology

Angiogenesis consists of several processes like vascular basement membrane degradation, endothelial cell migration and proliferation, capillary tube formation, and fi nally, differentiation into mature vessels. All these processes are mediated by angiogenic growth factors and their receptors, proteolytic enzymes, as well as by cell adhesion molecules [ 72, 73 ] .

As depicted in Fig. 10.1 , TMPs from many cultured tumor cells with the ability to induce an invasive and angiogenic phenotype in stromal cells express proangiogenic molecules like VEGF, angiogenin, interleukin-6 (IL-6), interleukin-8 (IL-8), hepato-cyte growth factor (HGF), MMP-2, MMP-9, membrane type 1 MMP (MT1-MMP), CD147/extracellular matrix metalloproteinase inducer (CD 147/EMMPRIN), epi-dermal growth factor receptor (EGFR), or tissue factor (TF). Human ovarian carci-noma cell-derived TMPs expressing MMP-2, MMP-9, and VEGF have been reported to stimulate the motility, invasiveness, and proliferation of HUVEC in vitro [ 59 ] . Glioblastoma tumor cell–derived TMPs, with the ability to stimulate tubule forma-tion and initiate angiogenesis in brain ECs, are enriched in the angiogenic proteins VEGF, angiogenin, IL-6, and IL-8 [ 60 ] , all of which have been implicated in glioma angiogenesis and increased malignancy [ 74– 76 ] . Additionally, IL-8 has been shown to directly enhance HUVEC proliferation, survival, and MMP-2 and MMP-9 expres-sion in CXCR1- and CXCR2-expressing EC, and to regulate angiogenesis [ 77 ] . Furthermore, these glioma TMPs stimulated proliferation of a human glioma cell line, perhaps via IL-6-mediated glial tumor cell growth by an auto/paracrine mecha-nism. In gliomas, IL-6 has been reported to promote tumor growth [ 78 ] , with the level of IL-6 gene expression shown to increase with the grade of malignancy [ 76 ] .

Angiogenesis shares many functional similarities with tumor invasion, including the requirement for expression of the invasive phenotype and associated proteolytic activity. Hence, many studies have provided compelling evidence for the involve-ment of MMPs in tumor-induced angiogenesis, with several MMPs exerting both positive and negative effects. MMPs act as proangiogenic factors by degrading the ECM, and providing a pathway for invading ECs , and by releasing ECM-bound growth factors and cytokines [ 54 ] . Thus, MMP-9, through its release of ECM-associated proangiogenic factors like VEGF, has been identifi ed as a major con-tributor and a crucial factor triggering activation of quiescent vasculature during the tumor-induced angiogenic switch [ 79 ] . Although the proangiogenic role of MMP-9 in tumor angiogenesis has been defi nitively established, it became evident that this MMP as well as other MMPs could also inhibit angiogenesis. This contrasting func-tion of MMPs is based on the ability of MMPs to generate endogenous molecules with strong antiangiogenic activity derived from either ECM proteins (e.g., tumsta-tin, endostatin) or non-matrix-derived extracellular molecules (e.g., angiostatin from plasminogen). Based on these considerations, MMP inhibition may result in the stimulation, rather than inhibition, of angiogenesis [ 80 ] .

In addition to MMPs, MT1-MMP was detected on malignant ovarian ascites-derived membrane particles [ 57 ] . Overexpression of MT1-MMP in melanoma cells has been observed to increase tumor vascularization and tumor growth [ 81 ] . Furthermore, MT1-MMP has been reported to contribute to tumor angiogenesis via direct stimulation of VEGF secretion [ 81, 82 ] .

220 P.P. Goh

Recent studies have demonstrated that TMPs may induce proangiogenic activities in stromal cells by a CD147-mediated mechanism [ 53, 83– 85 ] . CD 147/EMMPRIN or basigin, a member of the immunoglobulin superfamily, is a plasma membrane glycoprotein enriched on the surface of many malignant tumor cells [ 86, 87 ] . Cumulative data from several studies have demonstrated that CD147/EMMPRIN could play a crucial role in tumor angiogenesis by regulating expression of VEGF and MMPs in stromal cells [ 86, 88, 89 ] . Thus, some researchers have shown that CD147/EMMPRIN can interact with fi broblasts and stimulate their production of MMP-1, MMP-2, MMP-3, and membrane type 1 MMP (MT1-MMP) [ 90, 91 ] . Furthermore, CD147 is also known to upregulate the production of MMPs in both tumor and endothelial cells [ 92 ] .

Analogous studies have provided evidence that microvesicular release of CD147/EMMPRIN from tumor cells may also play a role in tumor–stromal interactions through upregulation of fi broblast or endothelial cell MMP production. Thus, CD147/EMMPRIN released from the surface of NCI-H460 lung carcinoma cells via microparticle shedding was reported to stimulate MMP-1 transcription in fi bro-blasts and hence facilitate tumor invasion and metastasis [ 83 ] . Similarly, CD147/EMMPRIN-positive TMPs obtained from PC3, a prostate carcinoma cell line with high metastatic potential, were shown to induce the activation of fi broblasts. Activated fi broblasts displayed extracellular signal-regulated kinase 1/2 (ERK 1/2) phosphorylation, MMP-9 upregulation, increased motility, and resistance to apop-tosis. Subsequently, these activated fi broblasts, in turn, shed CX3CL1/fractalkine-positive ligand microparticles that were able to promote chemotaxis of highly metastatic PC3 cells, dependent partially on expression of the chemokine receptor CX3CR1 by PC3 cells [ 93 ] . Additional evidence presented by Millimaggi’s team [ 84 ] also implicated CD147/EMMPRIN-positive TMP shed by ovarian cancer cell lines in mediating in vitro angiogenesis, attributed in part to transcriptional upregu-lation of endothelial cell MMPs. Importantly, there was a direct correlation between CD147/EMMPRIN expression on TMPs and the ability of these TMPs to enhance EC invasiveness. To validate their initial observations, these researchers prepared a CD147 transfectant using the noninvasive CABA 1 human ovarian cell line that had nondetectable CD147 expression. As expected, these CD147-positive TMPs shed by the CD147 transfectant exhibited a greater capacity to induce both migration of HUVECs and the transcription of MT1-MMP, MMP-1, and MMP-2 mRNA com-pared with microparticles generated from vector-transfected cells. Moreover, TMPs derived from OVCAR3 cells with silenced CD147 expression were less effective at inducing migration and upregulating MT1-MMP, MMP-1, and MMP-2 mRNA in HUVECs compared with untreated control cell-derived TMPs [ 84 ] . Because stromal cells are the major source of MMPs in most of the human cancers analyzed to date, CD147/EMMPRIN is deemed to be a critical determinant of cancer growth and dis-semination [ 88, 92, 94, 95 ] .

The functional repertoire of TMPs has recently been expanded with exciting new in vitro and in vivo data highlighting the pivotal role that microvesicular transfer of cell surface receptors like TF and EGFR may play in tumor-associated angiogene-sis. A recent study by Yu’s lab [ 96 ] demonstrated that transfer of TF from TMPs

22110 Microparticles and Cancer Biology

derived from A431 human squamous carcinoma cells to TF-negative mouse brain EC in vitro initiated angiogenesis. Moreover, host blood vessels in A431 xenografts in SCID mice were positive for both human TF and EC markers (CD105 or endo-glin), suggesting that the intercellular transfer of TF also occurred in vivo. TF is frequently overexpressed in human tumors [ 97 ] . Although implicated in various aspects of tumorigenesis, the precise mechanisms of TF involvement in tumor growth, angiogenesis, and metastasis still require additional fundamental studies [ 98, 99 ] .

Based on insights gained from a series of elegant studies, Al-Nedawi and coworkers [ 100 ] hypothesized that one source of EGFR expression by tumor-asso-ciated ECs may be through the transfer of TMPs from adjacent cancer cells harbor-ing this oncogenic receptor. These researchers demonstrated that this form of EGFR acquisition triggered activation of the autocrine VEGF/VEGFR-2 pathway in a manner dependent on phosphatidylserine (PS)-mediated microparticle exchange between tumor and ECs. As depicted in Fig. 10.2 , uptake of intact and functional EGFR from TMPs derived from A431 human squamous cell carcinoma triggered phosphorylation of MAPK (Erk1/2) in ECs. This was accompanied by the onset of endothelial VEGF expression, followed by autocrine activation of its key signaling receptor VEGFR2. These effects were obliterated by preincubation of TMPs with PS blocking agents Annexin V and Diannexin or with an irreversible EGFR inhibi-tor CI-1033. These fi ndings were corroborated by an in vivo study where A431 human tumor xenografts in mice were found to stain positively for EGFR and phos-pho-EGFR with Diannexin treatment noted to inhibit growth and angiogenesis of A431 tumors. Collectively, these new data concur with earlier studies investigating molecular profi les of tumor-associated endothelium which indicated that one dis-tinguishing feature of tumor EC is their propensity to express the EGF receptor (EGFR) [ 101 ] . Moreover, activation of EGFR on ECs of tumor blood vessels appears to play a crucial role in tumor progression inasmuch as pharmacological

TMP

TMP-Inducedangiogenesis

EGFR

HUVEC

EGFR

Activates MAPK & AktpathwaysTriggers endogenous expression of VEGF

Stimulates VEGFR2

A431cancer

cell

Transfers intact & functionalEGFR mediated by PS

Fig. 10.2 Microvesicular transfer of oncogenic receptor EGFR from A431-derived microparticles mediates induction of the angiogenic phenotype in endothelial cells

222 P.P. Goh

suppression of this signaling cascade in experimental tumors was shown to inhibit the growth of primary lesions and, more importantly, to reduce the frequency of metastasis [ 102– 104 ] . In a similar context, results obtained using an in vivo trans-plantation mouse model showed that angiogenesis and more specifi cally, persistent expression of VEGFR2 are prerequisites for tumor invasion and malignancy [ 50 ] . This fi nding has been substantiated by other data indicating that intraperitoneal injection of an anti-VEGFR2 antibody (DC-101) into mice after transplantation of both well-differentiated, as well as highly malignant, metastasizing keratinocytes resulted in inhibition of both angiogenesis and tumor invasion. Also noteworthy from the same study is the observation that VEGFR2 blockade precipitated a phe-notypic shift from a highly malignant to a premalignant, noninvasive tumor pheno-type [ 105, 106 ] .

TMPs and Immune Escape

Patients with advanced malignancies have progressively impaired immune responses, indicating that tumor cells have developed various mechanisms to sub-vert the immune system [ 107 ] . Upregulation of Fas ligand (FasL/CD95L) expres-sion on various tumors including melanoma, lymphoma, esophageal carcinoma, gastric carcinoma, colon carcinoma, and breast carcinoma appears to represent one such mechanism [ 108 ] . FasL is a transmembrane protein belonging to the tumor necrosis factor (TNF) superfamily that can trigger apoptotic cell death following ligation to its receptor Fas (CD95/APO-1) [ 109 ] . FasL confers immune privilege on tumors by inducing apoptosis of infi ltrating lymphocytes that express Fas [ 110 ] . Accumulating evidence suggests that, in addition to local defense, FasL overexpres-sion may also play an important role in tumor progression and in the establishment of tumor metastases. Hence, FasL expression was found to be higher in metastatic tumors than in primary ones. In breast and cervical tumors, high FasL expression was signifi cantly associated with lymph node metastases [ 111, 112 ] , whereas stron-ger FasL expression was found in liver metastases of colon cancer relative to the primary tumor [ 113 ] .

Previous studies have documented that alterations in expression and function of the TcR 2 -associated signal transduction z chain may be responsible for defi cient immune responsiveness of T cells in patients with cancer [ 114 ] . Signifi cantly, tumor cell expression of FasL has been found to correlate with loss of CD3 z chain expres-sion by tumor infi ltrating lymphocytes (TILs) [ 110 ] . It is well documented that the CD3 z chain, by transducing activation signals from the antigen-binding T cell receptor to the T cell nucleus, is crucial for T cell receptor signaling. Therefore, FasL expressed on tumors may contribute to the functional abnormalities frequently found in lymphocytes isolated from the tumor microenvironment.

Like the parent tumor cells from which they were derived, FasL-expressing TMPs shed by human colorectal and melanoma cancer cells [ 115, 116 ] , or isolated from sera of patients with human colorectal or oral squamous cancer cells [ 19, 115 ] , were capable of inducing apoptosis of T lymphocytes. Furthermore, ovarian cancer

22310 Microparticles and Cancer Biology

cell-derived FasL-positive TMPs also exhibited dose-dependent suppression of T cell receptor/CD3 z expression [ 117 ] . These researchers also reported a strong correlation between the decrease in z expression and the level of FasL expression in TMPs. In this instance, the suppression of CD3 z by TMPs appeared to be linked to the induction of apoptosis and caspase-3 within T cells [ 117 ] . Taken together, these results showed that, in addition to apoptosis of TILs, FasL expressed by TMPs may also contribute to the functional abnormalities seen in patients with advanced malignancies.

Another mechanism which tumors may develop to evade immune surveillance appears to be the inhibition of lymphocyte proliferation by shed TMPs. The obser-vation that anti-TGF- b antibodies could completely neutralize the inhibition of lym-phocyte proliferation by TMPs from human breast carcinoma cells led Dolo’s group [ 118 ] to conclude that TGF- b + TMP may play a role in the escape of breast carci-noma cell from immune response. Their results concur with earlier experimental data highlighting the role of TGF- b in suppression of T cell-mediated antitumor immunity [ 119 ] . Many tumors including breast cancer, colorectal cancer, hepatocel-lular carcinoma, and malignant melanoma overexpress TGF- b [ 120– 123 ] . Compelling evidence indicate that TGF- b does not inhibit tumor growth but damp-ens the immune response toward the tumor via its potent effects on tumor infi ltrating immune cells. Hence, T cell-specifi c blockade of TGF- b signaling has been shown to induce an enhanced antitumor immune response, with consequent eradication of tumors in mice challenged with live tumor cells [ 124 ] . Similarly, treatment with anti-TGF- b antibodies has been reported to suppress the development of primary tumors and metastasis in a human xenotransplant tumor model in nude mice [ 125 ] . Overall, these studies suggest that TGF- b has potent effects on the antitumor immune response by suppressing the effector response of tumor infi ltrating immune cells.

Vesicle shedding is now recognized as a mechanism for tumor cells to remove antigens that could elicit an immune response against them [ 126 ] . Indeed, the obser-vation that breast cancer- and colorectal cancer-derived TMPs carry both tumor- associated antigens and HLA class I molecules [ 55, 115 ] indicates that these structures could, in principle, present antigens to the immune system [ 118 ] , providing another mechanism for tumor cells to escape from immune surveillance. Supporting this concept are immunohistological and fl ow cytometric data featuring total or selective losses of HLA class I antigens in different human tumor samples [ 127 ] .

TMPs and Traffi cking to Metastatic Foci

Metastasis represents a highly organized, nonrandom, and organ-selective process [ 128 ] , sharing many similarities with leukocyte traffi cking, which is critically regu-lated by chemokines and their receptors [ 129 ] . Chemokines are a superfamily of small, cytokine-like proteins that induce, through their interaction with G-protein-coupled receptors, directional cell migration and homing to specifi c anatomical sites [ 130 ] . Tumor cells from both solid cancers and hematological malignancies have been reported to express a distinct, nonrandom pattern of functionally active

224 P.P. Goh

chemokine receptors [ 130 ] . Signaling through these chemokine receptors induced chemotactic and invasive responses, with ultimate homing to specifi c metastatic niches. Signifi cantly, organ-specifi c metastasis was governed, in part, by interac-tions between chemokine receptors on cancer cells and matching chemokines in target organs. As summarized in Fig. 10.3 , this observation has been demonstrated in numerous studies implicating various chemokine receptors, namely, CXCR4, CCR6, and CCR7, and their corresponding ligands, in the regulation of metastasis in malignant tumors [ 16, 131– 134 ] .

Previous data presented by Muller and coworkers [ 131 ] clearly showed that sig-naling through CXCR4 or CCR7 mediated actin polymerization, pseudopodia for-mation, and subsequently, chemotactic and invasive responses in breast cancer cells expressing high levels of functionally active CXCR4 and CCR7. Furthermore, neu-tralizing the interactions of CXCL12/CXCR4 in severe combined immunodefi cient (SCID) mice injected with CXCR4-positive, human breast carcinoma cells signifi -cantly impaired metastasis of breast cancer cells to CXCL12/SDF-1-rich regional lymph nodes and lungs, preferential sites for the metastasis of breast cancer tumors. Similar to breast cancer metastasis, CXCL12 found in the ascitic fl uid of patients with ovarian cancer may have a potential role in the spread of CXCR4-positive ovarian cancer cells to the peritoneum [ 135 ] . Other studies implicating the chemokine–chemokine receptor axis in metastasis have shown that CCR6 is signifi -cantly upregulated in primary colorectal cancers (CRC) and colorectal liver metas-tases (CRLM), with peak levels of its related ligand CCL20 in the liver attracting and arresting these CCR6-positive migrating CRC cells [ 132, 134 ] .

In hematological malignancies, functional CXCR4 expressed by acute myeloid leukemia (AML) cells has been shown to induce leukemia cell chemotaxis and migration beneath marrow stromal cells [ 136 ] . Interestingly, researchers from Lapidot’s lab [ 16 ] detected increased CXCR4 + MPs in the peripheral blood and bone marrow plasma samples of newly diagnosed adult AML patients. These CXCR4 + MPs exhibited a strong correlation with WBC counts, a commonly used prognostic

MainMetastatic foci

Bonemarrow

Regional lymph nodes,lungs, liver, & bone-marrow

Skin Liver Bonemarrow

Chemokine CXCL12 CXCL12 CCL21 CXCL12 CCL21 CCL27,28 CCL20 CX3CL1

Chemokine receptor

CXCR4 CXCR4 CCR7 CXCR4 CCR7 CCR10 CCL21 CX3CR1

Type ofCancer

AML Breast Melanoma CRC Prostate

Reference [16] [131] [131] [132] & [134]

[133]

Fig. 10.3 Selected chemokines expressed by different cancer cells and their corresponding chemokine ligands in preferred metastatic foci CRC (colorectal cancers)

22510 Microparticles and Cancer Biology

marker in AML patients. Also, the majority of these CXCR4 + MPs were CD45 + , suggestive of a leukocyte origin. Moreover, transfer of functionally active CXCR4 from these MPs to AML-derived HL-60 cells elicited enhanced cellular migration to CXCL12/SDF-1 in vitro and increased homing/retention to the CXCL12/SDF-1-rich bone marrow of irradiated NOD/SCID/ b 2 m null mice. The CXCR4 antagonist AMD3100 reduced these effects. Based on their results, the authors postulated that the CXCR4–CXCL12 axis may play a signifi cant role in traffi cking and tissue dis-semination of AML cells in vivo [ 16 ] .

On co-incubation with CCR6-expressing TMPs derived from pancreatic, col-orectal, and lung adenocarcinoma, approximately 20% of normal monocytes were reported to internalize these TMPs, concomitantly acquiring CCR6 and CD44v7/8, two antigenic determinants not expressed by monocytes [ 137 ] . Moreover, CCR6 was biologically active only in 6% of CCR6 + monocytes determined in the presence of its chemokine CCL20/MIP-3a. Upregulated expression of CD44v on monocytes cultured in vitro is associated with an increased binding of hyaluronan (HA) [ 138 ] . Hence, the transfer of CD44v to monocytes by TMP may enhance their ability to react with HA and other ECM molecules. The overall signifi cance of these fi ndings to tumor biology is presently unclear.

Platelet-Derived MP (PMP) and Tumor Growth, Angiogenesis, and Metastasis

Substantial experimental and clinical data have validated the view that platelets may aggravate tumor progression/metastasis and angiogenesis [ 139– 143 ] . Hence, induc-tion of thrombocytopenia has been observed to reduce experimental metastases, whereas platelet transfusions promote them [ 143 ] . Moreover, a high platelet count has been associated with poor survival in cancer patients suffering from malignant mesothelioma, gynecological malignancies, lung, renal, gastric, colorectal, or breast cancers [ 144 ] . Since the ability of cancer cells to aggregate platelets has been docu-mented to correlate with their metastatic potential [ 145 ] , tumor cell-induced platelet aggregation (TCIPA) has assumed increased signifi cance in tumor progression and metastasis. TCIPA, perceived as a critical mechanism enabling tumor cells to escape from immune surveillance, confers a number of advantages to the tumor cell, ensur-ing its survival in the vasculature, and, ultimately, successful migration to distant sites. For instance, when covered with a coat of platelets, tumor cells acquire the ability to evade the body’s immune system [ 146 ] . Furthermore, activated platelets expressing adhesion receptors facilitate the adhesion of tumor cells to the vascular endothelium during hematogenous metastasis [ 147 ] .

Like activated platelets, PMPs have been reported to express several platelet–endothelium attachment receptors like glycoprotein IIb/IIIa (CD41), Ib, and Ia IIa on their surface [ 148, 149 ] ,as well as harbor bioactive lipids like sphingosine-1-phosphate (S1P) and arachidonic acid (AA) [ 150 ] . In two similar studies investigat-ing PMP–tumor cell interactions (Fig. 10.4 ), PMPs derived from normal platelet concentrates were shown to transfer platelet-derived integrin CD41 to human lung

226 P.P. Goh

PMP-inducedinvasive, migratory

& angiogenic phenotype

PMP

CXCR4

CD 41

Upregulation of VEGF, IL-8, HGF gene expression

Transfer of intact & functional surface receptors CD 41 & CXCR4

Activation of MAPK p42/44 & Aktsignalling pathways

Stimulation of cyclin D2 and MT1-MMP mRNA

Lung orBreast

cancer cell

CD 62P

Increased production of MMPs

M =mucin

M

Fig. 10.4 Schematic representation of the induction of the invasive, migratory, and angiogenic phenotype in lung or breast cancer cells by platelet-derived microparticles (PMPs)

and breast cancer cells, thus enhancing their adhesion to endothelial cells. Furthermore, PMPs also stimulated the production of MMPs [ 151, 152 ] . The authors postulated that increased MMP activity and greater adhesiveness of these cancer cells could potentially promote transendothelial migration of cancer cells into the tissue during hematogenous metastasis. Furthermore, PMPs could act as signaling molecules, interacting directly with both breast and lung cancer cells via platelet-derived P-selectin/CD62P and mucins on target cancer cells to increase cell prolif-eration by promoting activation of MAPK p42/44 and AKT signaling pathways. More specifi cally, PMP may also facilitate tumor vascularization via upregulation of proangiogenic VEGF, IL-8, and HGF gene expression in lung cancer cells. Additionally, PMPs may also induce a more migratory and invasive phenotype in lung cancer cells by augmenting their expression of both cyclin D2 and MT1-MMP mRNA [ 151 ] .

Overexpression of cyclin D2 has been associated with increased invasiveness in vivo and progression of various tumors such as testicular germ tumors and gastric cancer cells [ 153, 154 ] . The MT-MMPs are highly expressed in almost all types of human cancers [ 155, 156 ] , with MT1-MMP localized predominantly to specialized membrane extensions; this localization appears to be essential for cancer cell inva-sion [ 156 ] . PMPs also strongly chemoattracted the highly metastatic human A549 lung cancer cell line and the murine Lewis lung carcinoma (LLC) cells. This phe-nomenon could be attributed to the presence of potent platelet-derived chemoattrac-tants like S1P and AA in PMPs [ 150, 157– 161 ] . The role of PMPs in mediating the increase in metastatic potential of murine LLC cells was confi rmed by in vivo evi-dence showing that mice injected with PMP-covered LLC cells developed signifi -cantly more metastatic foci and LLC cells in murine lungs and bone marrow cavities, respectively, compared to mice injected with control LLC cells without PMP [ 151 ] . Since PMPs have been documented to transfer platelet-derived CXCR4 onto the

22710 Microparticles and Cancer Biology

surface of target cells, [ 148, 162, 163 ] , these researchers surmised that LLC cells preincubated with PMPs may have acquired CXCR4 on their surface, enabling them to respond to the CXCL12/SDF-1-rich environment found in the murine lung and bone marrow. Similarly, PMPs were shown to increase CXCR4 expression in inva-sive breast cancer cells and their chemotaxis toward a CXCL12/SDF-1 gradient [ 152 ] . Like prostate cancer cell-derived MPs discussed earlier (Section 2.1), PMPs also induced marrow fi broblasts to secrete MMP-9. These experimental data show-ing the ability of PMPs to mediate tumor progression via enhancement of the in vitro invasive potential of metastatic lung and breast cancer cell lines warrant further evaluation due to the implications of platelet transfusions in cancer patients.

Tissue Factor-Positive Microparticles and Cancer-Associated Thrombosis

Cancer-Associated Thrombosis

Thromboembolism is a well-recognized complication in patients with solid tumors or hematological malignancies, contributing signifi cantly to their morbidity and mortality [ 1, 37, 164– 166 ] . Clinical manifestations vary from venous thromboem-bolism (VTE) to disseminated intravascular coagulation (DIC) and arterial embo-lism [ 164 ] . Furthermore, the risk of VTE is further accentuated in patients on cytotoxic chemotherapy. In addition, antiangiogenic therapies (e.g., thalidomide) as well as hormonal therapies (e.g., tamoxifen) have also been associated with an increased risk of thrombosis [ 167– 169 ] . Multimodal therapeutic approaches which combine chemotherapy and an angiogenesis inhibitor are also associated with an increased risk of VTE that may exceed the risk associated with the use of either modality [ 167, 170 ] . For instance, the incidence of deep vein thrombosis (DVT) has been reported to be about 1–3% for thalidomide alone and 10–30% when thalido-mide is used in combination with dexamethasone [ 171 ] .

Despite abundant experimental and clinical evidence in this rapidly expanding fi eld of cancer-associated thrombosis, the mechanisms for the production of the hypercoagulable state characteristic of cancer has remained speculative. To date, pos-sible underlying mechanisms postulated to contribute to the development of throm-bosis include pro-infl ammatory cytokines, circulating cell- or microparticle-bound tissue factor (TF), TF-independent procoagulant activity (including prothrombinase activity) and tumor-associated cysteine proteinase (cancer procoagulant) associated with cells and/or microparticles (MPs), and carcinoma-derived mucins [ 172 ] .

Tissue Factor in Cancer-Associated Thrombosis

Although abnormal coagulation profi les have been found in cancer patients, such abnormalities did not correlate with the development of thrombosis [ 173 ] .

228 P.P. Goh

Tissue factor (TF), the physiological initiator of blood coagulation, is overexpressed in tumor cells and cells resident in the tumor microenvironment and is thought to signifi cantly contribute to the hypercoagulable state in patients with malignancy [ 174 ] . Aberrant TF expression correlating with grade and tumor progression has been reported in association with solid tumors and hematological malignancies [ 98 ] . As reviewed by Lopez-Pedrera and coworkers [ 175 ] , hypercoagulability in patients with hematological malignancies could be attributed to the activation of TF, which may be derived from tumor cells or cells of the tumor microenvironment. In the early 1990s, it was established that monocytes from lymphoma patients are endowed with functional abnormalities with simultaneous expression of TF and antifi brinolytic activity [ 175 ] . Recent studies have further demonstrated that DIC in malignant lymphoma may be due to elevated cytokine expression by lymphoma cells stimulating the expression of TF in blood cells or surrounding tissue [ 175 ] . Overexpression of TF in AML cells, particularly in leukemic blasts from subtypes M3 and M5, may account for an increased risk of thrombohemorrhagic alterations in these patients [ 175 ] .

Studies Implicating Tissue Factor-Positive MPs in Cancer-Associated Thrombosis

TF is constitutively expressed in the adventitial and medial layers of the vessel wall. This has led to the suggestion that TF is part of a hemostatic envelope surrounding the vessel lumen which triggers blood coagulation only in the case of disrupted vascular integrity [ 176, 177 ] . Subsequent fi ndings indicate, however, that preformed TF can also be associated with blood cells and circulating microparticles [ 178 ] . Microparticles are considered to have pathophysiological importance in relation with the hemostatic system because like activated cells, chiefl y platelets, they expose procoagulant anionic phospholipids such as phosphatidylserine (PS). PS expressed on the microparticle membrane surface can provide the catalytic surface for the assembly and activation of the tenase and prothrombinase complexes [ 1 ] . TF anti-gen and TF activity associated with microparticles in plasma have been measured in patients with various types of cancer. Although measurement of TF activity is con-sidered more relevant, because TF activity more closely refl ects the ability of TF to initiate coagulation, many clinical studies have measured TF antigen.

TF antigen in clinical studies: Many researchers have evaluated the hypothesis that elevated numbers of TF-bearing MPs may contribute to cancer-associated thrombo-sis [ 4, 179, 180 ] . Furie and coworkers [ 179 ] have established that TF-bearing MPs are found in about one third of patients with advanced cancer, including patients with pancreatic carcinoma, ovarian carcinoma, colon cancer, and breast cancer. Whether TF associated with leukocyte (like monocyte) MPs or TF associated with tumor MPs is important in the hypercoagulable state associated with malignant dis-eases remains unknown [ 179 ] . Recently, TF-positive MPs have been demonstrated in the blood of cancer patients diagnosed with thrombotic syndromes [ 4, 17, 180– 184 ] .

22910 Microparticles and Cancer Biology

In colorectal cancer patients, the amount of plasma TF-positive MPs was signifi -cantly correlated with levels of plasma d -Dimer, a very sensitive marker of coagula-tion activation which strongly predicts venous thromboembolic events in cancer patients [ 20 ] . Interestingly, the increase in circulating TF-positive microparticles was attributed to MPs derived from platelets. The positive correlation between TF-positive MPs and d -Dimer levels has led Rauch [ 165 ] to the challenging assump-tion that TF-positive MPs, especially when derived from platelets, may have a role in the hypercoagulopathy of cancer patients.

TF procoagulant activity in clinical studies : The above data presented by Hron [ 20 ] concur with those of Tesselaar and coworkers [ 4 ] who reported that metastatic breast and pancreatic cancer patients, who presented with acute VTE, had higher numbers of circulating MPs (by a factor of 2–4), with greater than 90% of Annexin V + MP expressing the platelet antigen CD 61. These patients also exhibited higher levels of MP–TF activity compared to healthy subjects, cancer patients without VTE, and subjects with idiopathic VTE. In addition, MP–TF activity correlated with circulating MPs expressing the epithelial antigen MUC1. Metastatic breast and pancreatic cancer patients with elevated MP–TF activity and detectable MUC1 + -MP had a lower survival rate at follow-up than those with normal MP–TF activity and absence of MUC1 + -MP. Confocal immunofl uorescence microscopy studies of the co-expression of MUC1 and platelet antigen CD61 on MP also indicate that a small part of circu-lating MP seemed to result from fusion of cellular vesicles originating from malig-nant epithelial cells and platelets in patients with disseminated breast and pancreatic adenocarcinoma.

Recently, Langer and coworkers [ 185 ] in a small but related study demonstrated signifi cantly increased levels of TF-specifi c procoagulant activity (PCA) of plasma MPs in fi ve patients presenting with overt disseminated intravascular coagulation (DIC) due to non-small cell lung cancer ( n = 1), melanoma ( n = 1), prostate cancer ( n = 2), and acute promyelocytic leukemia ( n = 1). Clotting experiments on available tumor cell samples suggested that cancer cells were a potential source of circulating TF-positive MPs. Signifi cantly, follow-up plasma samples from two surviving patients revealed that the response of their malignancies to specifi c anticancer ther-apy was paralleled by resolution of overt DIC and a signifi cant decline in MP-associated TF PCA.

Although TF on circulating MPs have been implicated in the induction of a pro-thrombotic state in cancer patients, MPs have also been demonstrated to support the assembly of blood coagulation protein complexes in the absence of TF. In a recent study, ECs treated with cisplatin in vitro were shown to undergo apoptosis, con-comitantly releasing MPs that had TF-independent procoagulant activity that could be inhibited by neutralization of anionic phospholipids [ 42 ] .

TF in in vivo studies using mouse models: Using laser injury in a mouse model of thrombosis, Falati and coworkers [ 186 ] demonstrated that MPs expressing TF and PSGL-1 accumulate in the developing thrombus. Intriguingly, capture of TF + -MPs by activated platelets was mediated via its ligand PSGL-1 and P-selectin expressed on activated platelets in the platelet thrombus.

230 P.P. Goh

Tissue Factor-Positive MPs – Cellular Origin and Procoagulant Activity

In studies centered on the pathophysiology of tumor-associated hypercoagulability, two of the most intriguing questions which have fueled intense debate are as fol-lows: (a) What is the cellular origin of TF-positive MPs? (b) Do specifi c MPs express functionally active TF, that is, are TF-positive MPs procoagulant, able to mediate coagulation, and participate in thrombus formation?

Cellular origin of TF-positive MPs : The elevated number of TF-positive MP and the MP-bound TF activity found in colorectal, breast, and pancreatic cancer patients were found to be mainly derived from platelets [ 4, 20 ] . As noted by Hron [ 20 ] , the increased level of platelet-derived TF-positive MPs may stem from TF originally synthesized by other cells and subsequently transferred to activated platelets, which then shed TF-positive MPs into the blood of cancer patients. This possibility is sup-ported by previous studies which indicated that TF-positive MPs obtained from monocytic cells expressing P-selectin ligands (either CD15 or PSGL-1) have the propensity to adhere and bind to P-selectin on activated platelets, concomitantly transferring TF [ 187, 188 ] . Thus, TF present on activated platelets might be acquired from other primary cell sources by fusion of MPs with the platelet surface mem-brane and possibly, be released as TF-positive platelet MPs upon vesiculation in response to further platelet activation. On the other hand, platelets themselves have been demonstrated to store small amounts of TF in a -granules and to release TF-positive MPs, which can increase the blood TF activity [ 189 ] .

It is now widely appreciated that constitutive microvesicle shedding is a common feature of cancerous cells [ 51, 190 ] . Many studies have described shedding of pro-coagulant microvesicular structures from tumor cells. As early as 1985, membrane vesicles were found in certain types of leukemia, including acute promyelocytic leukemia, acute myelogenous leukemia, and acute monocytic leukemia [ 190 ] . These vesicles shared antigens with leukemic cells. Some of these vesicles expressed pro-coagulant activity, but it was not possible to correlate procoagulant activity of these vesicles with the clinical coagulation disorders in these patients.

To date, there are very few clinical studies which focus specifi cally on tumor cell-derived MP which express TF. Recently, Langer’s lab [ 185 ] showed that cancer cells were a potential source of TF-positive MPs. Due to the small number of patients evaluated, the results, albeit signifi cant, need to be confi rmed. In a recent case study of lung cancer-associated Trousseau’s syndrome, tumor cells were pro-posed as the main source of TF-positive MPs [ 17 ] . Colorectal carcinoma, gastric carcinoma, melanoma, and squamous cell carcinoma cell lines also shed procoagu-lant TF-positive MPs, with TF activity shown to correlate with intracellular TF mRNA levels [ 191 ] . Other studies have indicated that TF shed from human glio-blastoma cells was able to induce coagulation, platelet aggregation, and thrombus formation [ 192 ] . Also noteworthy is the report that in vitro-generated TF expressing MPs from human pancreatic cancer cells when injected into an orthotopic murine model of pancreatic cancer were capable of activating coagulation in vivo as shown by the presence of TF-dependent procoagulant activity and thrombin–antithrombin complex in cell-free murine plasma [ 182 ] .

23110 Microparticles and Cancer Biology

Procoagulant activity of TF-positive MPs : It is not yet known whether TF on MPs is constitutively active or needs to be decrypted from an inactive form or location for binding to FVII/FVIIa to initiate coagulation. A few studies support the notion that TF on MPs originally have a rather low procoagulant activity that becomes markedly increased when MPs interact with platelets [ 187, 188, 193 ] . In addition, the monocyte-derived MPs bind to activated platelets in an interaction mediated by platelet P-selectin and microparticle P-selectin glycoprotein ligand (PSGL-1) or CD15 (an epitope also found on PSGL-1) [ 187, 188 ] . Further support for the involvement of the PSGL-1/P-selectin ligand-receptor mechanism in facilitating binding of TF-positive MPs to activated platelets stems from recent data published by Furie and Furie [ 194 ] . Fluorescently labeled mouse MPs derived from WEHI cells, a monocytoid cell line, were infused into a recipient wild type or P-selectin-null mouse. Microparticles localized within the developing thrombus of the wild-type mouse, but not the P-selectin-null mouse, indicating that one pathway for the initiation of blood coagulation in vivo involves the accumulation of tissue factor- and PSGL-1-containing microparticles in the platelet-rich thrombus expressing P-selectin [ 194 ] .

Protein Disulfi de Isomerase – Potential Modulator of TF Activity

Cryptic and coagulant TF : It is now well documented that TF on unperturbed cells are encrypted and reside in a cryptic confi guration requiring activation to initiate coagulation [ 195 ] . As shown in Fig 10.5 , TF activation may be regulated at multiple levels, including increase in cytosolic calcium, rapid feedback inhibition by TF pathway inhibitor, and exposure of PS on the outer leafl et of the plasma membrane of activated/apoptotic cells and microparticles. Coagulant activity of TF may also be attenuated by TF dimerization and/or compartmentalization in lipid rafts such as caveolae [ 195 ] . Activated platelets may also promote TF activity in monocyte

Fig. 10.5 Modulators of tissue factor procoagulant activity (TF PCA)

232 P.P. Goh

membranes in a process entailing transfer of TF to activated platelets [ 193 ] . In addition to cellular surfaces, TF present on monocyte-derived microvesicles has also been shown to require activation that is dependent on fusion of microvesicles with activated platelets [ 188 ] .

Modulation of TF activity by protein disulfi de isomerase : Novel and exciting new data from Ahamed’s lab [ 196 ] indicate that the oxidoreductase protein disulfi de isomerase (PDI) may have a role in the modulation of TF procoagulant activity. Their fi ndings suggest that active coagulant and inactive encryptic TF may, in fact, be two structural entities, with decryption and subsequent procoagulant activity involving formation of an allosteric surface-accessible, extracellular disulfi de bond (Cys186-Cys209) (Fig. 10.6 ). The redox state of the bond appears to be controlled by the oxidoreductase PDI with TF coagulant activity suppressed during association of cell surface PDI with inactive TF via a mixed disulfi de bond. They further showed that PDI suppressed TF coagulant activity in a nitric oxide (NO)-dependent path-way. Cryptic, but not coagulant, TF is S-nitrosylated. S-Nitrosylation of TF result-ing from reaction of nitric oxide (NO) with the unpaired TF cysteine thiol therefore appears to play a role in maintaining the cofactor in an encrypted state. Denitrosylation of TF leads to cleavage of the disulfi de bond holding the TF–PDI complex together, with formation of the TF allosteric disulfi de bond and coagulant TF [ 196 ] .

Cellular sources of PDI: Although primarily an endoplasmic reticulum resident protein, PDI has been demonstrated on the surface of numerous cell types including endothelial cells and activated platelets [ 197, 198 ] . In addition to the archetypal PDI, a novel PDI named endothelial PDI (EndoPDI) because of its high expression in endothelial cells has been identifi ed by Sullivan’s group [ 199 ] . Signifi cantly, EndoPDI expression is rare in normal tissues but was present in the endothelium of tumors, and in other hypoxic lesions such as atherosclerotic plaques. In addition, other researchers have shown that upon activation, platelets secrete up to 20% of total platelet PDI. These researches also proposed that upregulation of TF activity in association with activated platelets may depend on secreted PDI [ 200 ] . Interestingly, data from Claudio’s lab showed PDI to be the most signifi cantly upregulated gene (MGC3178) in 100% of the myeloma cell lines tested [ 201 ] .

Fig. 10.6 TF disulfi de bond redox status and protein disulfi de isomerase (PDI) regulate TF activity

23310 Microparticles and Cancer Biology

Microparticle-associated PDI : Activation of platelets with calcium ionophore A23187 has been shown to induce release of PDI-positive vesicles [ 200 ] . Recently, Raturi and coworkers [ 202 ] detected increased levels of PDI-containing platelet MPs (PMPs) from patients with Type II diabetes (T2D). These PMP membranes demonstrated 50- to 100-fold higher specifi c procoagulant activity compared to activated platelets [ 203 ] . PDI precursors were also found to be associated with pro-coagulant MPs released from TNF-activated HUVEC [ 204 ] . In a recent study, Versteeg and Ruf [ 205 ] showed that purifi ed PDI can enhance TF procoagulant activity on microvesicles shed from HUVECs.

TF and PDI in thrombus formation using mouse models : Following laser-induced arteriolar injury, extracellular PDI [ 206 ] and both PDI and TF [ 207 ] were demon-strated to stimulate fi brin generation and thrombus formation in mice models.

As shown in Fig. 10.7 , PDI has been reported to catalyze oxidation, reduction, and isomerization of disulfi de bonds [ 208 ] . The active site of PDI contains a reactive dithiol/disulfi de in a CysXXCys motif that has redox potential. PDI-catalyzed dis-ulfi de formation occurs when oxidizing equivalents are transferred from the disul-fi de of the oxidized PDI active site to the reduced substrate (e.g., TF), forming reduced PDI. Conversely, the reduction of a substrate disulfi de oxidizes the PDI active site. Disulfi de isomerization or rearrangement of incorrect disulfi des, which requires PDI in the sulfhydryl or reduced form, does not result in any net oxidation of PDI [ 208 ] .

As depicted in Fig. 10.8 , the reaction that PDI catalyzes (oxidation, reduction, or isomerization) will depend on the equilibrium position of the overall reaction and the redox state of the PDI active site. The reduced active-site cysteines of PDI can react with cellular glutathione disulfi de (GSSG) to form oxidized PDI and two mol-ecules of reduced glutathione (GSH) [ 208 ] .

Fig. 10.7 The multifaceted roles of PDI [ 208 ]

234 P.P. Goh

Proposed Model for Promotion of Thrombus Development by TF-Expressing MP and Platelet-Derived PDI

The current scientifi c evidence gleaned from in vitro studies using cancer cell lines and in vivo studies using mouse models, as well as clinical data obtained from patients with clinically overt thrombotic syndromes, support a role for TF-positive MPs and activated platelets in promoting TF procoagulant activity, fi brin genera-tion, and thrombus formation. Moreover, binding of TF-MPs to activated platelets was mediated by platelet P-selectin and microparticle PSGL-1. Activated platelets have been shown to enhance the procoagulant activity of TF-positive MP. How acti-vated platelets facilitate this process is presently unknown. The seminal study by Ahamed’s group [ 196 ] has provided valuable insights into how PDI, perhaps derived from activated platelets and/or their shed microparticles, may promote TF-mediated blood coagulation, fi brin formation, and thrombus development (Fig . 10.9 ).

In concluding, we would like to propose a model implicating monocyte-derived or tumor cell-derived TF-positive MP and PDI expressed on activated platelets or their shed MPs in cancer-associated thrombosis. Therefore, we postulate that cryp-tic noncoagulant TF-positive MPs derived from activated leukocytes (like mono-cytes) or tumor cells are zoom in to activated PDI-positive platelets or PDI-positive platelet MPs in the developing thrombus. Accumulation of TF-MPs in the thrombus is facilitated by P-selectin expressed on activated platelets/platelet MP which cap-ture these TF-positive MPs via its ligand PSGL-1 expressed on leukocyte MP or tumor mucins expressed on tumor cells. P-selectin, an integral membrane protein receptor that binds monocytes and neutrophils, is expressed on activated platelets and activated endothelium. P-selectin mediates adhesion to glycoproteins like mucins with carbohydrate structures containing sialyl-Lewis X [ 209 ] . The epithelial mucin MUC1, overexpressed on the cell surface of many epithelial malignancies as well as on some B cell lymphomas and multiple myelomas [ 210 ] , present ligands for adhesion receptors, such as the selectins, which promote the ability of tumor cells to interact with host platelets and endothelial cells [ 209 ] .

The work of del Conde [ 188 ] has shown that TF present on monocyte-derived microvesicles is poorly coagulant, and fusion of microvesicles with activated plate-lets is required for TF activity. We also hypothesize that once incorporated into the platelet, platelet-PDI catalyzes the conversion of TF into its procoagulant form which contains the Cys 186–Cys 209 disulfi de bond, critical for coagulation.

Fig. 10.8 PDI and cellular glutathione/glutathione disulfi de [ 208 ]

23510 Microparticles and Cancer Biology

As documented in the existing literature, blood glutathione redox status may modulate PDI function [ 208 ] . In studies involving mouse models and cancer patients, the glutathione redox status (glutathione/glutathione disulfi de or GSH/GSSG) has been observed to decrease in blood of Ehrlich ascites tumor-bearing mice, as well as in patients with breast or colon cancers [ 211 ] . This effect is mainly due to an increase in GSSG levels attributed to an increase in peroxide production by the tumor, resulting in GSH oxidation. On account of elevated oxidative stress in cancer, culminating in a reduced GSH/GSSG ratio [ 211 ] , we surmise that platelet-PDI would probably have oxidase activity and be capable of catalyzing the forma-tion of procoagulant TF. The latter is characterized by the presence of the disulfi de (Cys 186–Cys 209) bond. Even though blood coagulation is initiated by TF, PS on activated platelets and platelet MPs may propagate the coagulation process by pro-viding a surface for assembly and activation of the prothrombinase and/or tenase complexes in TF-mediated fi brin generation and thrombus development.

Conclusion and Future Perspectives

The present review of the available literature, albeit not comprehensive, has lend credence to the view that cancer cells as well as their shed microparticles can modify the adjacent matrix and stroma cells to create a permissive and supportive

PDIoxidase

sulfhydrylCryptic TF

disulfideProcoagulant TF

PDIreductase

SH SH S

S SH SH

2GSH

MP

MP

MP

Monocyte

CancerCell

activatedplatelet

P-selectin

P-selectin

PDI ox

PDI ox

TF

PSGL-1

TFMucin

GSH/GSSGon account ofelevated oxidativestress in cancer,platelet PDIprobably hasoxidase activity

GSSG

−S

-S

Fig. 10.9 A hypothetical model depicting potential roles for TF-positive microparticles and plate-let-derived PDI in thrombus development

236 P.P. Goh

environment for tumor growth, angiogenesis, invasion, and metastasis. Armed with proteolytic MMPs and uPA, TMPs degrade the ECM, as well as induce the invasive phenotype in stromal cells. By stimulating MMP expression in fi broblasts, CD147/EMMPRIN-positive TMPs mediate a novel form of tumor-fi broblast cross talk enabling cancer cells to harness the support of fi broblasts, thus facilitating tumor invasion and metastasis. Although it is clear that CD147/EMMPRIN can infl uence MMP production in stromal fi broblasts, many aspects of the phenomenon, for example, the identity of the CD147/EMMPRIN receptor on fi broblasts, remain to be elucidated. The expression of the b 1 integrin subunit and proteolytic MMPs on membrane MPs have led some researchers to postulate that they may promote TMP adhesion to matrix components and local degradation of ECM, respectively. Additional investigations are needed, however, to establish which integrin dimers are clustered on membrane microvesicles and also identify their possible interac-tion with MMP-9 [ 55 ] .

Over the last 10 years, accumulating evidence has established TMPs as carriers of proangiogenic factors, with the propensity to induce the invasive and angiogenic phenotype in endothelial cells. In two independent studies, microvesicular transfer of surface receptors TF or oncogenic receptor EGFR from A431 human squamous carcinoma cell-derived MPs has been reported to induce the angiogenic phenotype in endothelial cells. Of relevance are novel fi ndings presented by [ 212 ] which implied that oncogenic changes may impact the level of tumor cell-derived TF and thereby affect cancer coagulopathy, angiogenesis, and other vascular effects associ-ated with cancer. Supporting this notion is the observation that TF upregulation in cancer cells parallels their expression of several mutant oncogenes, including K-ras, EGFR, EGFRvIII, and HER2 [ 213 ] .

To escape from immune surveillance and engage in successful hematogeneous metastasis, tumor cells have developed different mechanisms like shedding of FasL, HLA class I antigens, or TGF- b -positive TMPs to counter the host immune response. To date, the functional repertoire of MPs also includes microvesicular transfer of functional CXCR4 from MPs isolated from AML patient plasma or PMPs from activated normal platelets to cancer cells, enhancing their migration and homing to CXCL12/SDF-1-rich niches in vitro and in vivo. Furthermore, the preliminary fi nd-ings that PMPs have the ability to enhance the invasive and metastatic potential of breast cancer cells warrant further clinical evaluation, since platelet transfusions form part of the treatment modalities undertaken by many cancer patients.

Thrombosis is one of the major complications of malignant disease, but the underlying molecular and cellular basis remains elusive. Exploration of a potential role of MPs in cancer-associated thrombosis showed that increased numbers and thrombogenic activity of TF-expressing MPs are present in a spectrum of cancer patients known to have a high incidence of thromboembolic complications. Furthermore, the positive correlation of these TF-expressing MPs with coagulation activation markers like d -Dimer,indicate an important role for TF-expressing MPs in the pathogenesis of cancer-associated thrombosis. Before TF-positive MP can be considered as a biomarker for VTE, methodological issues regarding isolation, quantifi cation, and antigenic characterization of TF-positive MPs need to be

23710 Microparticles and Cancer Biology

addressed in order to obtain a reliable method for determining the cellular source of MP in vivo. Also, standardization of preanalytical procedures and development of more sensitive technologies are needed to improve our current understanding of the role of circulating TF-positive MPs in thrombosis. Similarly, fi ndings derived from studies regarding issues concerning methodologies and standardization of TF-positive MPs will also have application in studies investigating the role of MPs in tumor growth, angiogenesis, and metastasis.

In view of the pathophysiological implications of MPs in cancer, and to pave the way for novel and benefi cial therapeutic interventions and strategies targeting cel-lular microparticles implicated in tumor growth and metastasis, as well as cancer-associated thrombosis, more intense and focused multidisciplinary research efforts are urgently needed to:

(a) Standardize preanalytical procedures and assay methods and to develop more sensitive and high throughput technologies

(b) Unravel the mechanisms of MP production and action (c) Characterize the cellular proteins and lipids represented in MP that is so pivotal

to the understanding of their function (d) Compare the protein and lipid composition of MPs formed by exposure of cells

to different agonists/stimuli and those formed in vivo in different cancers at dif-ferent stages of disease as well as pre- and post-cancer therapy

(e) To elucidate mechanisms (like MP-cell fusion or ligand–receptor interactions) by which MP interact with their target cells

References

1. Furie, B., and Furie, B. C. 2006 Blood Cells Mol Dis 36, 177 2. Ratajczak, J., Wysoczynski, M., Hayek, F., Janowska-Wieczorek, A., and Ratajczak, M. Z.

2006 Leukemia 20, 1487 3. Amin, C., Mackman, N., and Key, N. S. 2008 Pathophysiol Haemost Thromb 36, 177 4. Tesselaar, M. E., Romijn, F. P., Van Der Linden, I. K., Prins, F. A., Bertina, R. M., and Osanto, S.

2007 J Thromb Haemost 5, 520 5. Castellana, D., Kunzelmann, C., and Freyssinet, J. M. 2009 Hamostaseologie 29, 51 6. Wolf, P. 1967 Br J Haematol 13, 269 7. Crawford, N. 1971 Br J Haematol 21, 53 8. Hugel, B., Martinez, M. C., Kunzelmann, C., and Freyssinet, J. M. 2005 Physiology (Bethesda)

20, 22 9. Thery, C., Zitvogel, L., and Amigorena, S. 2002 Nat Rev Immunol 2, 569 10. VanWijk, M. J., VanBavel, E., Sturk, A., and Nieuwland, R. 2003 Cardiovasc Res 59, 277 11. Morel, O., Toti, F., Hugel, B., Bakouboula, B., Camoin-Jau, L., Dignat-George, F., and

Freyssinet, J.-M. 2006 Arterioscler Thromb Vasc Biol 26, 2594 12. Burnier, L., Fontana, P., Kwak, B., and Angelillo-Scherrer, A. 2009 Thromb Haemost. 101, 439 13. Freyssinet, J. M. 2003 J Thromb Haemost 1, 1655 14. Kim, H. K., Song, K. S., Park, Y. S., Kang, Y. H., Lee, Y. J., Lee, K. R., Kim, H. K., Ryu, K. W.,

Bae, J. M., and Kim, S. 2003 Eur J Cancer 39, 184 15. Savasan, S., Buyukavci, M., Buck, S., and Ravindranath, Y. 2004 J Clin Pathol 57, 651

238 P.P. Goh

16. Kalinkovich, A., Tavor, S., Avigdor, A., Kahn, J., Brill, A., Petit, I., Goichberg, P., Tesio, M., Netzer, N., Naparstek, E., Hardan, I., Nagler, A., Resnick, I., Tsimanis, A., and Lapidot, T. 2006 Cancer Res 66, 11013

17. Del Conde, I., Bharwani, L. D., Dietzen, D. J., Pendurthi, U., Thiagarajan, P., and Lopez, J. A. 2007 Journal of Thrombosis and Haemostasis 5, 70

18. Bergmann, C., Strauss, L., Wieckowski, E., Czystowska, M., Albers, A., Wang, Y., Zeidler, R., Lang, S., and Whiteside, T. L. 2009 Head Neck 31, 371

19. Kim, J. W., Wieckowski, E., Taylor, D. D., Reichert, T. E., Watkins, S., and Whiteside, T. L. 2005 Clin Cancer Res 11, 1010

20. Hron, G., Kollars, M., Weber, H., Sagaster, V., Quehenberger, P., Eichinger, S., Kyrle, P. A., and Weltermann, A. 2007 Thromb Haemost 97, 119

21. Amabile, N., Guerin, A. P., Leroyer, A., Mallat, Z., Nguyen, C., Boddaert, J., London, G. M., Tedgui, A., and Boulanger, C. M. 2005 J. Am. Soc. Nephrol. 16, 3381

22. Haubold, K., Rink, M., Spath, B., Friedrich, M., Chun, F. K., Marx, G., Amirkhosravi, A., Francis, J. L., Bokemeyer, C., Eifrig, B., and Langer, F. 2009 Thromb Haemost 101, 1147

23. Kim, H. K., Song, K. S., Park, Y. S., Kang, Y. H., Lee, Y. J., Lee, K. R., Ryu, K. W., Bae, J. M., and Kim, S. 2003 Eur J Cancer 39, 184

24. Zwaal, R. F. A., and Schroit, A. J. 1997 Blood 89, 1121 25. Bevers, E. M., Comfurius, P., Dekkers, D. W. C., and Zwaal, R. F. A. 1999 Biochimica et

Biophysica Acta (BBA) - Molecular and Cell Biology of Lipids 1439, 317 26. Bevers, E. M., Comfurius, P., and Zwaal, R. F. A. 2003 Membrane phospholipid asymmetry:

biochemical and pathophysiological perspectives. in Advances in Molecular and Cell Biology E. E. Bittar (Ed.), Elsevier, 387

27. Jimenez, J., Jy W, Mauro LM, Soderland, C., Horstmann, L., and Ahn, Y. 2003 109, 175 28. Tramontano, A. F., O’Leary, J., Black, A. D., Muniyappa, R., Cutaia, M. V., and El-Sherif, N.

2004 Biochemical and Biophysical Research Communications 320, 34 29. Perez-Pujol, S., Marker, P. P., and Key, N. S. 2007 Cytometry Part A 71A, 38 30. Wiedmer, T., Shattil, S. J., Cunningham, M., and Sims, P. J. 1990 Biochemistry 29, 623 31. Hamilton, K. K., Hattori, R., Esmon, C. T., and Sims, P. J. 1990 J. Biol. Chem. 265, 3809 32. Falanga, A., Panova-Noeva, M., and Russo, L. 2009 Best Practice & Research Clinical

Haematology 22, 49 33. Kwaan, H. C., and Keer, H. N. 1990 Semin Thromb Hemost 16, 230 34. Rickles, F. R., and Falanga, A. 2001 Thromb Res 102, V215 35. Brodsky, S. V., Malinowski, K., Golightly, M., Jesty, J., and Goligorsky, M. S. 2002 Circulation

106, 2372 36. Varon, D., and Brill, A. 2001 Haemostasis 31 Suppl 1, 64 37. Prandoni, P., Falanga, A., and Piccioli, A. 2005 The Lancet Oncology 6, 401 38. Vaupel, P., and Mayer, A. 2007 Cancer and Metastasis Reviews 26, 225 39. Harris, A. L. 2002 Nat Rev Cancer 2, 38 40. Wysoczynski, M., and Ratajczak, M. Z. 2009 Int J Cancer 125, 1595 41. Grenader, T., Shavit, L., Ospovat, I., Gutfeld, O., and Peretz, T. 2006 Mt Sinai J Med 73, 810 42. Lechner, D., and Weltermann, A. 2008 Semin Thromb Hemost 34, 199 43. Gelderman, M. P., Carter, L. B., and Simak, J. 2004 ASH Annual Meeting Abstracts 104, 3635 44. Simak, J., and Gelderman, M. P. 2006 Transfus Med Rev 20, 1 45. Jy, W., Horstman, L. L., Jimenez, J. J., Ahn, Y. S., Biro, E., Nieuwland, R., Sturk, A., Dignat-

George, F., Sabatier, F., Camoin-Jau, L., Sampol, J., Hugel, B., Zobairi, F., Freyssinet, J. M., Nomura, S., Shet, A. S., Key, N. S., and Hebbel, R. P. 2004 J Thromb Haemost 2, 1842

46. Horstman, L. L., Jy, W., Jimenez, J. J., Bidot, C., and Ahn, Y. S. 2004 Keio J Med 53, 210 47. Pula, G., Perera, S., Prokopi, M., Sidibe, A., Boulanger, C., and Mayr, M. 2008 PROTEOMICS -

CLINICAL APPLICATIONS 2, 882 48. Liotta, L. A., and Kohn, E. C. 2001 Nature 411, 375 49. Chambers, A. F., Groom, A. C., and MacDonald, I. C. 2002 Nat Rev Cancer 2, 563 50. Mueller, M. M., and Fusenig, N. E. 2004 Nat Rev Cancer 4, 839

23910 Microparticles and Cancer Biology

51. Taylor, D., and Black, P. 1986 Shedding of plasma membrane fragments. Neoplastic and developmental importance. in Developmental Biology, M.S.Steinberg (Ed.), Plenum Press, New York, 33

52. Barz, D., Goppelt, M., Szamel, M., Schirrmacher, V., and Resch, K. 1985 Biochim Biophys Acta 814, 77

53. Baj-Krzyworzeka, M., Szatanek, R., Weglarczyk, K., Baran, J., Urbanowicz, B., Branski, P., Ratajczak, M. Z., and Zembala, M. 2006 Cancer Immunol Immunother 55, 808

54. Deryugina, E. I., and Quigley, J. P. 2006 Cancer Metastasis Rev 25, 9 55. Dolo, V., Ginestra, A., Cassara, D., Violini, S., Lucania, G., Torrisi, M. R., Nagase, H.,

Canevari, S., Pavan, A., and Vittorelli, M. L. 1998 Cancer Res 58, 4468 56. Ginestra, A., Monea, S., Seghezzi, G., Dolo, V., Nagase, H., Mignatti, P., and Vittorelli, M. L.

1997 J Biol Chem 272, 17216 57. Graves, L. E., Ariztia, E. V., Navari, J. R., Matzel, H. J., Stack, M. S., and Fishman, D. A.

2004 Cancer Res 64, 7045 58. Taraboletti, G., D’Ascenzo, S., Borsotti, P., Giavazzi, R., Pavan, A., and Dolo, V. 2002 Am J

Pathol 160, 673 59. Taraboletti, G., D’Ascenzo, S., Giusti, I., Marchetti, D., Borsotti, P., Millimaggi, D., Giavazzi, R.,

Pavan, A., and Dolo, V. 2006 Neoplasia 8, 96 60. Skog, J., Wurdinger, T., van Rijn, S., Meijer, D. H., Gainche, L., Sena-Esteves, M., Curry, W.

T., Jr., Carter, B. S., Krichevsky, A. M., and Breakefi eld, X. O. 2008 Nat Cell Biol 10, 1470 61. Tarin, D. 1972 Epithelial-Mesenchymal Interactions in Carcinogenesis Academic Press,

London 62. Hood, J. D., and Cheresh, D. A. 2002 Nat Rev Cancer 2, 91 63. Ahmed, N., Riley, C., Rice, G., and Quinn, M. 2005 Clin Exp Metastasis 22, 391 64. Augustin, H. G. 2000 Baillieres Best Pract.Res. Clin. Obstet. Gynaecol. 14, 867 65. Reynolds, L. P., Grazul-Bilska, A. T., and Redmer, D. A. 2002 Intl. J. Exptl. Pathol 83, 151 66. Arnold, F., and West, D. C. 1991 Pharmacology & Therapeutics 52, 407 67. Carmeliet, P. 2003 Nat. Med. 9, 653 68. Folkman, J. 2002 Semin Oncol 29, 15 69. Folkman, J. 1995 Nature Med. 1, 27 70. Folkman, J. 1995 N. Engl. J. Med. 333, 1757 71. Folkman, J. 1971 N Engl J Med 285, 1182 72. Papetti, M., and Herman, I.M. 2002 Am J Physiol Cell Physiol 282, 947 73. Carmeliet, P., and Jain, R. K. 2000 Nature 407, 249 74. Brat, D. J., Bellail, A. C., and Van Meir, E. G. 2005 Neuro-oncology 7, 122 75. Eberle, K., Oberpichler, A., Trantakis, C., Krupp, W., Knupfer, M., Tschesche, H., and Seifert, V.

2000 Anticancer Res 20, 1679 76. Rolhion, C., Penault-Llorca, F., Kemeny, J.-L., Lemaire, J.-J., Jullien, C., Labit-Bouvier, C.,

Finat-Duclos, F., and Verrelle, P. 2001 Journal of Neurosurgery 94, 97 77. Li, A., Dubey, S., Varney, M. L., Dave, B. J., and Singh, R. K. 2003 J Immunol 170, 3369 78. Goswami, S., and Gupta, A. 1998 Journal of Neurochemistry 71, 1837 79. Bergers, G., Brekken, R., McMahon, G., Vu, T., Itoh, T., Tamaki, K., Tanzawa, K., Thorpe, P.,

Itohara, S., Z. &, W., and Hanahan, D. 2000 Nature Cell Biology, 2, 737 80. Folkman, J. 2008 Angiostatin and Endostatin: Angiogenesis Inhibitors in Blood and Stroma.

in Angiogenesis: An Integrative Approach from Science to Medicine, W.D. Figg and J. Folkman (Eds.), Springer US., 129

81. Sounni, N. E., Devy, L., Hajitou, A., Frankenne, F., Munaut, C., Gilles, C., Deroanne, C., Thompson, E. W., Foidart, J. M., and Noel, A. 2002 FASEB J. 16, 555

82. Deryugina, E. I., Soroceanu, L., and Strongin, A. Y. 2002 Cancer Res 62, 580 83. Sidhu, S. S., Mengistab, A. T., Tauscher, A. N., LaVail, J., and Basbaum, C. 2004 Oncogene

23, 956 84. Millimaggi, D., Mari, M., D’Ascenzo, S., Carosa, E., Jannini, E. A., Zucker, S., Carta, G.,

Pavan, A., and Dolo, V. 2007 Neoplasia 9, 349

240 P.P. Goh

85. Castellana, D., Zobairi, F., Martinez, M. C., Panaro, M. A., Mitolo, V., Freyssinet, J.-M., and Kunzelmann, C. 2009 Cancer Res 69, 785

86. Biswas, C., Zhang, Y., DeCastro, R., Guo, H., Nakamura, T., Kataoka, H., and Nabeshima, K. 1995 Cancer Res 55, 434–439

87. Toole, B. 2003 Curr Top Dev Biol 54, 371–389 88. Tang, Y., Nakada, M. T., Kesavan, P., McCabe, F., Millar, H., Rafferty, P., Bugelski, P., and

Yan, L. 2005 Cancer Res 65, 3193 89. Tang, Y., Kesavan, P., Nakada, M. T., and Yan, L. 2004 Mol Cancer Res 2, 73 90. Sun, J., and ME, H. 2001 Cancer Res 61, 2276–2281 91. Guo, H., Zucker, S., Gordon, M. K., Toole, B. P., and Biswas, C. 1997 J Biol Chem 272, 24 92. Caudroy, S., Polette, M. N.-R., B., Cao, J., Toole, B. P., Zucker, S., and Birembaut, P. 2002

Clin Exp Metastasis 19, 697 93. Kanekura, T., and Chen, X. 2010 J Dermatol Sci 57, 149 94. Stetler-Stevenson, W. G., Aznavoorian, S., and Liotta, L. A. 1993 Annu Rev Cell Biol 9, 541 95. Stetler-Stevenson, W. G. 2001 Surg Oncol Clin N Am 10, 383 96. Yu, J., May, L., Milsom, C., Anderson, G. M., Weitz, J. I., Luyendyk, J. P., Broze, G.,

Mackman, N., and Rak, J. 2008 Arterioscler Thromb Vasc Biol 28, 1975 97. Forster, Y., Meye, A., Albrecht, S., and Schwenzer, B. 2006 Clin Chim Acta 364, 12 98. Rak, J., Milsom, C., Magnus, N., and Yu, J. 2009 Best Pract Res Clin Haematol 22, 71 99. Schaffner, F., and Ruf, W. 2009 Arterioscler Thromb Vasc Biol, Aug 6. [Epub ahead of print] 100. Al-Nedawi, K., Meehan, B., Kerbel, R. S., Allison, A. C., and Rak, J. 2009 Proc Natl Acad

Sci USA 106, 3794 101. Amin, D. N., Hida, K., Bielenberg, D. R., and Klagsbrun, M. 2006 Cancer Res 66, 2173 102. Baker, C. H., Kedar, D., McCarty, M. F., Tsan, R., Weber, K. L., Bucana, C. D., and Fidler, I. J.

2002 Am J Pathol 161, 929 103. Yokoi, K., Thaker, P. H., Yazici, S., Rebhun, R. R., Nam, D. H., He, J., Kim, S. J., Abbruzzese,

J. L., Hamilton, S. R., and Fidler, I. J. 2005 Cancer Res 65, 3716 104. Cheng, H., Langley, R. R., Wu, Q., Wu, W., Feng, J., Tsan, R., Fan, D., and Fidler, I. J. 2005

Neoplasia 7, 1065 105. Vosseler, S., Mirancea, N., Bohlen, P., Mueller, M. M., and Fusenig, N. E. 2005 Cancer Res

65, 1294 106. Skobe, M., Rockwell, P., Goldstein, N., Vosseler, S., and Fusenig, N. E. 1997 Nature Med. 3, 1222 107. Hellstrom, K. E., and, and Hellstrom, I. 1991 Principles of tumor immunity: tumor antigens.

in Biologic Therapy of Cancer V. T. DeVita, S. Hellman, and Rosenberg, S. A. (Eds.), Lippincott, New York, 35

108. Kim, R., Emi, M., Tanabe, K., Uchida, Y., and Toge, T. 2004 Cancer 100, 2281 109. Maher, S., Toomey, D., Condron, C., and Bouchier-Hayes, D. 2002 Immunol Cell Biol 80, 131 110. Rabinowich, H., Reichert, T. E., Kashii, Y., Gastman, B. R., Bell, M. C., and Whiteside, T. L.

1998 J Clin Invest 101, 2579 111. Mottolese, M., Buglioni, S., Bracalenti, C., Cardarell, M. A., i, Ciabocco, L., Giannarelli, D.,

Botti, C., Natali, P. G., Concetti, A., and Venanzi, F. M. 2000 International Journal of Cancer 89, 127

112. Chopin, D., Barei-Moniri, R., Maille, P., Le Frere-Belda, M.-A., Muscatelli-Groux, B., Merendino, N., Lecerf, L., Stoppacciaro, A., and Velotti, F. 2003 Am J Pathol 162, 1139

113. Mann, B., Gratchev, A., Bohm, C., Hanski, M. L., Foss, H. D., Demel, G., Trojanek, B., Schmidt-Wolf, I., Stein, H., Riecken, E. O., Buhr, H. J., and Hanski, C. 1999 Br J Cancer 79, 1262

114. Lai, P., Rabinowich, H., Crowley-Nowick, P. A., Bell, M. C., Mantovani, G., and Whiteside, T. L. 1996 Clin Cancer Res 2, 161

115. Huber, V., Fais, S., Iero, M., Lugini, L., Canese, P., Squarcina, P., Zaccheddu, A., Colone, M., Arancia, G., Gentile, M., Seregni, E., Valenti, R., Ballabio, G., Belli, F., Leo, E., Parmiani, G., and Rivoltini, L. 2005 Gastroenterology 128, 1796

24110 Microparticles and Cancer Biology

116. Andreola, G., Rivoltini, L., Castelli, C., Huber, V., Perego, P., Deho, P., Squarcina, P., Accornero, P., Lozupone, F., Lugini, L., Stringaro, A., Molinari, A., Arancia, G., Gentile, M., Parmiani, G., and Fais, S. 2002 J Exp Med 195, 1303

117. Taylor, D. D., Gercel-Taylor, C., Lyons, K. S., Stanson, J., and Whiteside, T. L. 2003 Clin Cancer Res 9, 5113

118. Dolo, V., Pizzurro, P., Ginestra, A., and Vittorelli, M. L. 1995 J Submicrosc Cytol Pathol 27, 535 119. Becker, C., Fantini, M. C., and Neurath, M. F. 2006 Cytokine & Growth Factor Reviews 17, 97 120. Reiss, M., and Barcellos-Hoff, M. H. 1997 Breast Cancer Research and Treatment 45, 81 121. Friedman, E., Gold, L. I., Klimstra, D., Zeng, Z. S., Winawer, S., and Cohen, A. 1995 Cancer

Epidemiol Biomarkers Prev 4, 549 122. Matsuzaki, K., Date, M., Furukawa, F., Tahashi, Y., Matsushita, M., Sakitani, K., Yamashiki,

N., Seki, T., Saito, H., Nishizawa, M., Fujisawa, J., and Inoue, K. 2000 Cancer Res 60, 1394 123. Reed, J. A., McNutt, N. S., Prieto, V. G., and Albino, A. P. 1994 Am J Pathol 145, 97 124. Gorelik, L., and Flavell, R. A. 2001 Nat Med 7, 1118 125. Hoefer, M., and Anderer, F. A. 1995 Cancer Immunology, Immunotherapy 41, 302 126. Whiteside, T. L. 2005 Br J Cancer 92, 209 127. Garcia-Lora, A., Algarra, I., and Garrido, F. 2003 Journal of Cellular Physiology 195, 346 128. Nicolson, G. L. 1993 Cancer and Metastasis Reviews 12, 325 129. Baggiolini, M. 1998 Nature 392, 565 130. Balkwill, F. 2004 Nat Rev Cancer 4, 540 131. Muller, A., Homey, B., Soto, H., Ge, N., Catron, D., Buchanan, M. E., McClanahan, T.,

Murphy, E., Yuan, W., Wagner, S. N., Barrera, J. L., Mohar, A., Verastegui, E., and Zlotnik, A. 2001 Nature 410, 50

132. Rubie, C., Oliveira-Frick, V., Rau, B., Schilling, M., and Wagner, M. 2006 J Clin Oncol 24, 5173 133. Shulby, S. A., Dolloff, N. G., Stearns, M. E., Meucci, O., and Fatatis, A. 2004 Cancer Res 64,

4693 134. Ghadjar, P., Rubie, C., Aebersold, D. M., and Keilholz, U. 2009 Int J Cancer 125, 741 135. Scotton, C. J., Wilson, J. L., Milliken, D., Stamp, G., and Balkwill, F. R. 2001 Cancer Res 61,

4961 136. Burger, J., A., and Bürkle, A. 2007 British Journal of Haematology 137, 288 137. Baj-Krzyworzeka, M., Szatanek, R., Weglarczyk, K., Baran, J., and Zembala, M. 2007

Immunol Lett 113, 76 138. Levesque, M. C., and Haynes, B. F. 1996 J Immunol 156, 1557 139. Honn, K. V., Tang, D. G., and Crissman, J. D. 1992 Cancer Metastasis Rev 11, 325 140. Honn, K. V., Tang, D. G., and Chen, Y. Q. 1992 Semin Thromb Hemost 18, 392 141. Taucher S, Salat A, G. M., Kwasny W, Mlineritsch B, Menzel R, Schmid M, Smola MG,

Stierer M, Tausch C, Galid A, Steger G, e. a., and . 2003 Thromb Haemost 89, 1098 –1106 142. McCarty, O. J. T., Mousa, S. A., Bray, P. F., and Konstantopoulos, K. 2000 Blood 96, 1789 143. Nash, G., Turner, L., Scully, M., and Kakkar, A. 2002 Lancet Oncol. 3, 425 144. Jurasz, P., Alonso-Escolano, D., and Radomski, M. W. 2004 Br J Pharmacol 143, 819 145. Radomski, M. W., Jenkins, D. C., Holmes, L., and Moncada, S. 1991 Cancer Res 51, 6073 146. Philippe, C., Philippe, B., Fouqeray, B., Perez, J., Lebret, M., and Baud, L. 1993 Am. J.

Pathol. 143, 1713–1723 147. Konstantopoulos, K., and Thomas, S. N. 2009 Annual Review of Biomedical Engineering 11, 177 148. Janowska-Wieczorek, A., Majka, M., Kijowski, J., Baj-Krzyworzeka, M., Reca, R., Turner,

A. R., Ratajczak, J., Kowalska, M. A., and Ratajczak, M. Z. 2001 Blood 98, 3143–3149. 149. Baj-Krzyworzeka M, Majka M, Pratico D, Ratajczak J, Vilaire G, Kijowski J, Reca R,

Janowska-Wieczorek A, and MZ., R. 2002 Exp Hematol 30, 450 –459 150. English, D., Garcia, J. G. N., and Brindley, D. N. 2001 Cardiovasc Res 49, 588 151. Janowska-Wieczorek, A., Marcin, W., Jacek, K., Leah, M.-C., Bogdan, M., Janina, R., and

Mariusz, Z. R. 2005 International Journal of Cancer 113, 752 152. Janowska-Wieczorek, A., Marquez-Curtis, L., Wysoczynski, M., and Ratajczak, M. 2006

Transfusion. 46, 1199

242 P.P. Goh

153. Houldsworth, J., Reuter, V., Bosl, G. J., and Chaganti, R. S. 1997 Cell Growth Differ 8, 293 154. Takano, Y., Kato, Y., Masuda, M., Ohshima, Y., and Okayasu, I. 1999 The Journal of Pathology

189, 194 155. Seiki, M., Koshikawa, N., and Yana, I. 2003 Cancer Metastasis Rev 22, 129 156. Zucker, S., Pei, D., Cao, J., and Lopez-Otin, C. 2003 Membrane type-matrix metalloprotei-

nases (MT-MMP). in Current topics in developmental biology: Cell surface proteases (Zucker S, and WT, C. eds.), Academic Press, New York. pp 1

157. English, D., Welch, Z., Kovala, A. T., Harvey, K., Volpert, O. V., Brindley, D. N., and Garcia, J. G. 2000 Faseb J 14, 2255

158. Barry OP, Pratico D, Lawson JA, and GA., F. 1997 J Clin Invest 99, 2118 –2127 159. Barry, O. P., Pratico, D., Lawson, J. A., and FitzGerald, G. A. 1997 J Clin Invest 99, 2118 160. Barry, O. P., Kazanietz, M. G., Pratico, D., and FitzGerald, G. A. 1999 J Biol Chem 274,

7545 161. Kim, C. W., Lee, H. M., Lee, T. H., Kang, C., Kleinman, H. K., and Gho, Y. S. 2002 Cancer

Res 62, 6312 162. Baj-Krzyworzeka, M., Majka, M., Pratico, D., Ratajczak, J., Vilaire, G., Kijowski, J., Reca, R.,

Janowska-Wieczorek, A., and Ratajczak, M. Z. 2002 Experimental Hematology 30, 450 163. Rozmyslowicz, T., Majka, M., Kijowski, J., Murphy, S. L., Conover, D. O., Poncz, M.,

Ratajczak, J., Gaulton, G. N., and Ratajczak, M. Z. 2003 AIDS 17, 33 164. Prandoni, P., Falanga, A., and Piccioli, A. 2007 Thrombosis Research 120, S137–S140 165. Rauch, U., and Antoniak, S. 2007 Thromb Haemost 97, 9 166. Falanga, A., Barbui, T., and Rickles, F. R. 2008 Semin Thromb Hemost 34, 204 167. Zangari, M., Anaissie, E., Barlogie, B., Badros, A., Desikan, R., Gopal, A. V., Morris, C.,

Toor, A., Siegel, E., Fink, L., and Tricot, G. 2001 Blood 98, 1614 168. Zangari, M., Elice, F., Fink, L., and Tricot, G. 2007 Expert Rev Anticancer Ther 7, 307 169. Pritchard, K. I., Paterson, A. H., Paul, N. A., Zee, B., Fine, S., and Pater, J. 1996 J Clin Oncol

14, 2731 170. Haddad, T. C., and Greeno, E. W. 2006 Thromb Res 118, 555 171. Petropoulou, A. D., Gerotziafas, G. T., Samama, M. M., Hatmi, M., Rendu, F., and Elalamy, I.

2008 Thrombosis Research 121, 493 172. Varki, A. 2007 Blood 110, 1723 173. Falanga, A. 2005 Semin Thromb Hemost 31, 104 174. Rickles, F. R., and Brenner, B. 2008 Semin Thromb Hemost 34, 143 175. Lopez-Pedrera, C., Barbarroja, N., Dorado, G., Siendones, E., and Velasco, F. 2006 Leukemia

20, 1331 176. Drake, T. A., Morrissey, J. H., and Edgington, T. S. 1989 Am. J. Pathol. 134, 1087 177. Mackman, N. 2004 Arterioscler. Thromb. Vasc. Biol. 24, 1015 178. Giesen, P. L., Rauch, U., Bohrmann, B., Kling, D., Roque, M., Fallon, J. T., Badimon, J. J.,

Himber, J., Riederer, M. A., and Nemerson, Y. 1999 Proc Natl Acad Sci USA 96, 2311 179. Furie, B., Zwicker, J., LaRocca, T., Kos, C., Bauer, B., and Furie, B. C. 2005 Haematologica

reports 1, 5 180. Zwicker, J. I. 2008 Semin Thromb Hemost 34, 195 181. Tilley, R. E., Holscher, T., Belani, R., Nieva, J., and Mackman, N. 2008 Thromb Res 122, 604 182. Davila, M., Amirkhosravi, A., Coll, E., Desai, H., Robles, L., Colon, J., Baker, C. H., and

Francis, J. L. 2008 J Thromb Haemost 6, 1517 183. Lechner, D., and Weltermann, A. 2008 Thrombosis Research 122, S47–S54 184. Khorana, A. A., Francis, C. W., Menzies, K. E., Wang, J. G., Hyrien, O., Hathcock, J.,

Mackman, N., and Taubman, M. B. 2008 J Thromb Haemost 6, 1983 185. Langer, F., Spath, B., Haubold, K., Holstein, K., Marx, G., Wierecky, J., Brummendorf, T. H.,

Dierlamm, J., Bokemeyer, C., and Eifrig, B. 2008 Ann Hematol 87, 451 186. Falati, S., Liu, Q., Gross, P., Merrill-Skoloff, G., Chou, J., Vandendries, E., Celi, A., Croce, K.,

Furie, B. C., and Furie, B. 2003 J Exp Med 197, 1585 187. Rauch, U., Bonderman, D., Bohrmann, B., Badimon, J. J., Himber, J., Riederer, M. A., and

Nemerson, Y. 2000 Blood 96, 170

24310 Microparticles and Cancer Biology

188. del Conde, I., Shrimpton, C. N., Thiagarajan, P., and Lopez, J. A. 2005 Blood 106, 1604 189. Muller, I., Klocke, A., Alex, M., Kotzsch, M., Luther, T., Morgenstern, E., Zieseniss, S.,

Zahler, S., Preissner, K., and Engelmann, B. 2003 Faseb J 17, 476 190. Carr, J. M., Dvorak, A. M., and Dvorak, H. F. 1985 Cancer Res 45, 5944 191. Yu, J. L., and Rak, J. W. 2004 Journal of Thrombosis and Haemostasis 2, 2065 192. Bastida, E., Ordinas, A., Escolar, G., and Jamieson, G. A. 1984 Blood 64, 177 193. Osterud, B. 2003 Dis Mon 49, 7 194. Furie, B., and Furie, B. C. 2004 Trends in Molecular Medicine 10, 171 195. Bach, R. R. 2006 Arterioscler. Thromb. Vasc. Biol. 26, 456 196. Ahamed, J., Versteeg, H. H., Kerver, M., Chen, V. M., Mueller, B. M., Hogg, P. J., and Ruf,

W. 2006 Proc Natl Acad Sci USA 103, 13932 197. Graven, K. K., Molvar, C., Roncarati, J. S., Klahn, B. D., Lowrey, S., and Farber, H. W. 2002

Am J Physiol Lung Cell Mol Physiol 282, L996 198. Essex, D. W., Chen, K., and Swiatkowska, M. 1995 Blood 86, 2168 199. Sullivan, D. C., Huminiecki, L., Moore, J. W., Boyle, J. J., Poulsom, R., Creamer, D., Barker, J.,

and Bicknell, R. 2003 J. Biol. Chem. 278, 47079 200. Chen, K., Detwiler, T. C., and Essex, D. W. 1995 Br J Haematol 90, 425 201. Claudio, J. O., Masih-Khan, E., Tang, H., Goncalves, J., Voralia, M., Li, Z. H., Nadeem, V.,

Cukerman, E., Francisco-Pabalan, O., Liew, C. C., Woodgett, J. R., and Stewart, A. K. 2002 Blood 100, 2175

202. Raturi, A., Miersch, S., Hudson, J. W., and Mutus, B. 2008 Biochim Biophys Acta 1778, 2790

203. Sinauridze, E. I., Kireev, D. A., Popenko, N. Y., Pichugin, A. V., Panteleev, M. A., Krymskaya, O. V., and Ataullakhanov, F. I. 2007 Thromb Haemost 97, 425

204. Banfi , C., Brioschi, M., Wait, R., Begum, S., Gianazza, E., Pirillo, A., Mussoni, L., and Tremoli, E. 2005 PROTEOMICS 5, 4443

205. Versteeg, H. H., and Ruf, W. 2007 J. Biol. Chem. 282, 25416 206. Cho, J., Furie, B. C., Coughlin, S. R., and Furie, B. 2008 J Clin Invest 118, 1123 207. Reinhardt, C., von Bruhl, M. L., Manukyan, D., Grahl, L., Lorenz, M., Altmann, B., Dlugai,

S., Hess, S., Konrad, I., Orschiedt, L., Mackman, N., Ruddock, L., Massberg, S., and Engelmann, B. 2008 J Clin Invest 118, 1110

208. Wilkinson, B., and Gilbert, H. F. 2004 Biochimica et Biophysica Acta (BBA) - Proteins & Proteomics 1699, 35

209. Stone, J. P., and Wagner, D. D. 1993 J Clin Invest 92, 804 210. Brossart, P., Schneider, A., Dill, P., Schammann, T., Grunebach, F., Wirths, S., Kanz, L.,

Buhring, H.-J., and Brugger, W. 2001 Cancer Res 61, 6846 211. Navarro, J., Obrador, E., Carretero, J., Petschen, I., Avino, J., Perez, P., and Estrela, J. M. 1999

Free Radic Biol Med 26, 410 212. Yu, J. L., May, L., Lhotak, V., Shahrzad, S., Shirasawa, S., Weitz, J. I., Coomber, B. L.,

Mackman, N., and Rak, J. W. 2005 Blood 105, 1734 213. Rak, J., Milsom, C., and Yu, J. 2008 Curr Opin Hematol 15, 522

245M. Chatterjee and K. Kashfi (eds.), Cell Signaling & Molecular Targets in Cancer, DOI 10.1007/978-1-4614-0730-0_11, © Springer Science+Business Media, LLC 2012

Introduction

The protein kinase D (PKD) family of serine/threonine kinases consists of three isoenzymes, PKD1/PKC m , PKD2, and PKD3/PKC n [ 1– 4 ] . Due to similarities in some domain structures, PKD was originally classifi ed as a member of the protein kinase C (PKC) family [ 2 ] . With the description of the relations of kinases in the whole human kinome, it became clear that PKD represents an own group more closely related to the calcium/calmodulin-regulated (Cam) kinases [ 5 ] . Like protein kinase C, PKD enzymes are phorbol ester- and diacylglycerol (DAG)-responsive kinases and are further regulated by phosphorylation events to gain full activity [ 6 ] . Activating phosphorylations are mediated by members of the novel PKC (nPKC) group and tyrosine kinases such as Src and Abl, all of which have been implicated in various functions in cancer before (Fig. 11.1 ). In additional to the regulation of PKD kinase activity, epigenetic regulation of PKD1 occurs in multiple cancers at the transcriptional levels through methylation of a CpG island in its promoter [ 7, 8 ] .

PKD molecules consist of N-terminal regulatory and C-terminal kinase domains (Fig. 11.1 ). The regulatory region comprises the CRD domain (two cysteine-rich C1 domains C1a and C1b), an acidic region (AR), and the pleckstrin homology (PH) domain. The deletion of either of these regions or domains leads to increased PKD1 activity, suggesting that the N-terminal region is negative-regulatory for the kinase domain [ 9, 10 ] . As a potential autoinhibitory mechanism, it was suggested that the regulatory domain folds back on the kinase domain. Activation of the kinase may occur through binding to DAG and subsequent phosphorylation of PKD at tyrosine residues in its PH domain and/or at the activation loop serines in the kinase domain [ 11, 12 ] . The C1 domains localize the kinase to the plasma membrane in response to

P. Storz (*) Department for Cancer Biology , Mayo Clinic , Jacksonville , FL 32224, USA e-mail: storz.peter@mayo.edu

Chapter 11 Protein Kinase D Signaling in Cancer

Peter Storz

246 P. Storz

the generation of DAG or treatment with phorbol esters or to the mitochondria in response to oxidative stress [ 13, 14 ] . Both C1 domains have distinct functional roles in targeting and maintaining PKD1 at the plasma membrane. C1a achieves fast maximal and reversible translocation, while C1b translocates the enzyme partially, but persistently. Further, persistent localization requires the binding of the C1b domain to G a

q protein [ 15 ] . C1a is also required for PKD1 localization to the golgi apparatus

[ 16, 17 ] and C1b for nuclear import [ 18 ] . While the function of the AR is unknown, the PH domain does not bind any particular phosphoinositide with high specifi city but serves as a protein–protein interface by binding to upstream kinases such as PKC h [ 19 ] and the G-protein b g -subunit [ 20 ] , but also is required for nuclear export [ 18 ] .

PKD1 has multiple functions within cells ranging from regulating golgi organiza-tion and vesicle transport, cell proliferation and cell survival, to mitochondrial signaling to the nucleus (for reviews, see [ 21, 22 ] ). Recently, a role in regulating the actin cytoskeleton was added to this list, since it was shown that PKD1 interacts with F-actin structures [ 23 ] , is regulated by RhoGTPases and kinases that are involved in regulating cell migration and adhesion [ 24 ] , and once active, inhibits F-actin reorga-nization at the lamellipodium [ 25 ] . While some of these functions are mediated redundantly by all three enzymes, others are specifi cally regulated by individual PKD isoforms. For example, in oxidative stress signaling in tumor cells, PKD1 and PKD2 may have overlapping roles, but PKD3 may have functions distinct from PKD1/2.

Fig. 11.1 Domain structure and phosphorylation-dependent regulation of PKD. Shown are the domain structure of PKD1, the activity-related phosphorylation sites, the respective function of their phosphorylation, and the involved upstream kinases. PKD can be divided into a catalytic domain and a regulatory region that consists of multiple lipid and protein binding domains as well as regions of unknown function such as AR ( C1 C1 domains C1a and C1b, AR acidic region, PH pleckstrin homology domain, kinase kinase domain, PDZ PDZ protein binding motif). PKD1 phosphorylation occurs by upstream kinases or by auto-/transphosphorylation. Activity-relevant phosphorylation sites are included in the PKD1 domain structure, and kinases regulating these are indicated (proteins that interact directly with PKD1 are labeled blue ). CQND labels the caspase cleavage site

24711 Protein Kinase D Signaling in Cancer

With the identifi cation of LXRXXS (with X as any amino acid, L, leucine, R, arginine, and S, serine) as the PKD minimal substrate phosphorylation motif [ 26 ] and the subsequent generation of a substrate-specifi c antibody [ 27 ] , optimal condi-tions were provided for discovering PKD1 substrates. This led to the description of an increasing wealth of PKD1 substrates and further defi ned the role of PKD in vari-ous processes in cancer (Fig. 11.2 ). The functions of PKD enzymes in cancer range from tumor-promoting events including increased proliferation and survival signal-ing to tumor cell progression, including the regulation of cell motility and angiogen-esis (reviewed in [ 22 ] ). However, with respect to cell signaling and function in tumor biology, PKD3 seems to be very distinct in its functions from the two other PKDs. For example, PKD3 rather seems to increase cell migration and invasion of some tumors [ 28– 30 ] , while PKD1 and PKD2 exhibit an inhibitory role on cell migration [ 25, 31 ] . Currently, a major focus in the fi eld is to further determine the exact functions of each PKD family member.

Fig. 11.2 Upstream signaling events leading to PKD activation. Due to different localization within cells, the activation mechanisms for PKD vary with the upstream stimuli. Generally, PKD1 is localized to membranes by binding to DAG (diacylglycerol) and then activated by phosphoryla-tions. Shown are three variant mechanisms that have been described as leading to PKD1 activity ( yellow , lipid-generating protein; blue , protein directly interacting with PKD1; green , PKD; phos-phorylations occurring in the respective signaling pathway are indicated). ( a ) In order to facilitate vesicle transport to the plasma membrane, PKD1 may be constitutively active at the golgi compart-ment. This is mediated by binding of PKD1 to DAG and G b g , anchoring the protein to the golgi, as well as PKC h -mediated activation loop phosphorylation at S738 and S742 (for human PKD1). ( b ) PKD1 is activated by a similar mechanism at the plasma membrane that uses PKC e and may require binding to G a . Active PKD1 is then released into the cytosol or translocates to the nucleus. ( c ) Tyrosine phosphorylations of PKD1 are mediated by Abl (Y463 in human PKD1) and Src (Y463 in human PKD1) and induce mitochondrial localization and interaction with PKC d . The generation of DAG is important for PKD1 and PKC d localization to the mitochondria

248 P. Storz

Activation of PKD

Upstream Activators for PKD

Upstream activators for PKD in cancer cells include tumor-promoting phorbol esters (e.g., PdBu), growth factor receptors (GF-Rs), heterotrimeric G-protein-coupled receptors (GPC-Rs), RhoGTPases, inducers of reactive oxygen species (ROS), as well as inducers of apoptosis (e.g., chemotherapeutics).

Activation of PKD by phorbol esters – Phorbol esters are natural products from plants and were initially characterized as potent tumor promoters in mouse skin. Phorbol esters exert divergent cellular responses, and multiple effectors are account-able for the various responses in cells and animal models for cancer [ 32 ] . Phorbol esters bind to C1 domains of DAG receptors and mimic DAG action by affecting cell proliferation, differentiation, survival, and transformation (for a review on this topic: [ 33 ] ). Besides protein kinase C as one of the primary targets, PKD is also a high-affi nity receptor for phorbol ester [ 32 ] , and PKD activation by phorbol esters has been demonstrated for multiple tumor cell lines [ 34 ] . Phorbol ester binding of PKD1 occurs via C1b and localizes the kinase to the plasma membrane, where it is further activated [ 35 ] .

Activation of PKD by growth factor receptors – Protein kinase D is activated down-stream of growth factors such as platelet-derived growth factor (PDGF), epidermal growth factor (EGF), and vascular endothelial growth factor (VEGF) [ 36, 37 ] . For example in NIH-3T3 cells, the activation of PKD1 through PDGF is mediated by phos-pholipase C g (PLC g ) and PKC, but not PI 3-kinase (PI3K) [ 37 ] . EGF-mediated activa-tion of PKD1 was shown in A431 cells [ 38 ] ; however in other cell systems, PKD1 is not activated by EGF. Moreover, PDGF-mediated activation of PKD1 leads to a modu-lation of EGF signaling through direct phosphorylation of the EGF receptor [ 39 ] . The activation of PKD by growth factors seems to be cell-type specifi c and only occurs when the respective growth factor receptor is expressed in very high copy numbers such as PDGF-R in NIH-3T3 or EGF-R in A431 cells and may also be linked to inte-grin signaling. The regulation of PKD by VEGF occurs in endothelial cells and was shown to contribute to multiple aspects involved in angiogenesis (see chapter below).

Activation of PKD by G proteins – PKD is activated by a variety of heterotrimeric guanine nucleotide-binding regulatory protein (G-protein)-coupled receptors includ-ing receptors for mitogenic peptides such as bombesin, vasopressin, endothelin, and bradykinin, or receptors for lysophosphatidic acid (LPA) [ 36 ] . Heterotrimeric G proteins are composed of a -, b -, and g -subunits, and G-protein a -subunits are clas-sifi ed into four subgroups, G a

s , G a

i , G a

q , and G a

12 /G a

13 . It was shown for PKD1

and PKD3 that activity is increased by G-protein a -subunits of the G a 12

/G a 13

, G a q ,

and G a i subgroups [ 14, 40– 43 ] . For example, G a

q and, to some extent, G a

i contrib-

ute to LPA- and angiotensin-mediated activation of PKD1 [ 44 ] . In addition to its regulation by a -subunits, G-protein b g -subunits also contribute to PKD localization and activation [ 20 ] .

24911 Protein Kinase D Signaling in Cancer

Dependent on the stimulus and a -subunit involved, G-protein-coupled receptors activate PKD1 via DAG generation through phospholipase C b or g enzymes (PLC b , PLC g ) or phospholipase D (PLD) [ 45, 46 ] . For example, G a

q stimulates DAG for-

mation through PLC b . Lysophosphatidic acid (LPA)-mediated activation of PKD1 occurs through PLD-mediated generation of phosphatidic acid (PA) and subsequent formation of DAG [ 46 ] . One functional consequence of PKD activation by LPA is the activation of the transcription factor NF- k B, and it was recently shown that PKD2 mediates LPA-induced interleukin 8 expression via NF- k B [ 47 ] . As another example, the peptide gastrin has been implicated in the development of colorectal cancers that express CCK

B /gastrin receptors and is involved in a wide range of func-

tions including neoplastic transformation [ 48 ] . PKD2 is activated by the CCK B /

gastrin receptor involving a heterotrimeric G a q protein as well as PLC [ 49 ] .

Activation by RhoGTPases – PKD isoenzymes are also activated by small RhoGTPases including RhoA, Rac, and Cdc42. For example, it was shown that ectopic expression of constitutively active RhoA mainly activates PKD1, and con-stitutively active Rac activates PKD3 [ 14, 40– 43 ] . RhoA has a major role in regulat-ing responses that lead to cytoskeletal reorganization involved in the formation of actin stress fi bers, focal adhesions, and regulation of cell motility [ 50 ] , and it was shown that PKD1 regulates some of the RhoA-mediated cytoskeletal changes [ 14, 24, 25 ] . There is also a crosstalk between heterotrimeric G proteins and RhoGTPases. For example, members of the G a

12 family mediate activation of RhoA via guanine

nucleotide exchange factors that link the a -subunits to RhoA [ 51, 52 ] . Further, interactions of G a

q and G a

12/13 with the RhoGTPase Rac lead to the activation of

PKD3 in bombesin receptor signaling [ 42, 43 ] .

Activation of PKD by oxidative stress – Due to altered or increased metabolism or mitochondrial dysfunction, tumor cells often show increased levels of reactive oxy-gen species (ROS). ROS can have multiple functions in cancer including the regula-tion of cell proliferation, survival, motility, and angiogenesis (reviewed in [ 53, 54 ] ). Protein kinase D1 is a sensor for oxidative stress in tumor cells [ 55 ] . The elevation of cellular ROS through treatment with hydrogen peroxide or increase of intracel-lular oxidative stress levels through L - S,R -buthionine sulfoximine (BSO)-mediated pharmacological depletion of the ROS scavenger glutathione (GSH) leads to tyrosine phosphorylation-mediated activation of PKD [ 12, 38, 56, 57 ] . Further, PKD1 activity is increased by a variety of agents such as rotenone that induce the mitochondrial generation of superoxide [ 58 ] . Dependent on the cellular system, growth factor receptors also elevate intracellular superoxide levels through NADPH oxidase or the mitochondria [ 54 ] . NADPH oxidase is activated via the small GTPase Rac-1 [ 59 ] , which was described as a regulator of PKD3 [ 42, 60 ] . Moreover, pro-duction of ROS by neutrophils and macrophages as a mechanism to kill tumor cells is well established [ 54 ] . In these cells, a rapid burst of superoxide formation primar-ily mediated by NAPDH oxidase leads to subsequent production of hydrogen per-oxide [ 61, 62 ] . However, the activation of PKD enzymes through NADPH oxidase-mediated ROS has not been described so far.

250 P. Storz

Activation of PKD by cleavage – In response to apoptotic stimuli, PKD1 can be activated by cleavage through caspases. Caspase cleavage sites are located in the regulatory region of the enzyme located between the acidic region and the pleck-strin homology domain [ 63 ] . Caspase-mediated cleavage of PKD1 was described after treatment of cells with chemotherapeutically used genotoxic agents including 1- b - D -arabinofuranosylcytosine (ara-C), etoposide, cisplatin, and doxorubicin, and upon activation of death receptors [ 63– 65 ] . Caspase-mediated cleavage generates an unregulated kinase fragment that sensitizes cells to apoptotic cell death, but is not apoptotic per se [ 64 ] .

Signaling Mechanisms Regulating PKD Activity

Protein kinase D activity is regulated by the binding to lipid or protein cofactors, regulating its membrane localization, and by covalent modifi cations through phos-phorylation by upstream kinases [ 66 ] . The activation mechanisms as well as the activating and interacting proteins slightly vary between the intracellular localiza-tion of PKD (Fig. 11.2 ).

Membrane targeting as an initial activation step – An initial step in PKD activation is the translocation of the enzyme from the cytosol to intracellular membranes. This can occur either through binding to DAG via its CRD domain or through binding to G-protein a - or b g -subunits. The CRD domain of PKD includes two C1 domains, C1a and C1b, which both have slightly different specifi cities to DAG [ 35 ] . Dependent on the PKD-activating pathway, DAG is either directly generated through PLC b or PLC g enzymes, or indirectly formed via PA generated by PLD1. The later activation mechanism has been implicated in oxidative stress-mediated activation of PKD1 at the mitochondria, as well as LPA-mediated activation of PKD1 [ 13, 46 ] . All other PKD-activating pathways described so far seem to utilize PLC g or PLC b to gener-ate DAG.

Regulation of PKD by activation loop phosphorylation – The function of DAG binding of PKD is to release the inhibitory regulatory domain from the kinase domain and to bring the enzyme to intracellular membranes and into proximity to its upstream activators, allowing activation by phosphorylation. PKD enzymes are direct targets for the nPKC isoforms PKC e , PKC d , PKC q , and PKC h , which are also located to cellular membranes upon binding to DAG [ 11, 19, 56, 67– 71 ] . Additionally, PKD and nPKC enzymes seem to form complexes. For example, PKC h binds directly to the PH domain of PKD1 [ 19 ] , and PKC d binds with its C2 domain to the N-terminus of PKD1 through a phosphorylated tyrosine residue [ 69 ] . With recent work, it becomes evident that different stimuli utilize different nPKC isoforms to activate PKD at the membranes of various intracellular compartments. Activation of PKD by nPKCs occurs through phosphorylation of the activation loop serines S738 and S742 (in human PKD1) [ 72 ] . The phosphorylated residues in the activation loop most likely fork an ionic bridge with amino-acid residues in the

25111 Protein Kinase D Signaling in Cancer

catalytic loop, thereby stabilizing the active catalytic structure of the enzyme [ 66, 73 ] . Phosphorylation of the activation loop serines has been shown to be an absolute requirement for the kinase to achieve full catalytic competence.

Regulation of PKD by tyrosine phosphorylations – Tyrosine phosphorylation of PKD was described in response to increased oxidative stress [ 12, 38 ] , expression of BCR–Abl [ 74 ] , or activation of the RhoGTPase RhoA [ 24 ] , and does not occur in response to GPC-R activation [ 38 ] . For oxidative stress, a sequential order of activa-tion steps has been described initiated by DAG, which contributes to PKD1 local-ization to the mitochondria [ 13 ] .

A key kinase in this activation is Src, which can be activated by hydrogen perox-ide through direct oxidation or through reversible oxidation and inactivation of its negative-regulatory phosphatases [ 75, 76 ] . In response to ROS, Src initiates the phosphorylation of PKD1 at several sites including Y95 and Y463 [ 12, 69 ] . While Y95 is directly phosphorylated by Src [ 69 ] , Y463 phosphorylation is a consequence of Src-mediated activation of Abl [ 38 ] . The phosphorylation of PKD1 at this residue is directly mediated by Abl [ 12 ] and leads to a conformational change and to mito-chondrial localization [ 13, 38 ] . The phosphorylation of PKD1 at Y95 facilitates binding of PKC d through its C2 domain and subsequent phosphorylation of the activation loop of PKD1, leading to full activity [ 56, 57, 69 ] .

This PKD1 activation pathway originally was described in cervix carcinoma cells, but meanwhile has been shown to be active in a multitude of tumor cell lines including breast cancer and pancreatic cancer cells. It is required for PKD1 and PKD2 activation by oxidative stress. PKD3 lacks a residue homologue to Y95 and is not activated via this mechanism [ 69 ] . Tyrosine phosphorylation-mediated PKD1 activation induces activation of the transcription factor nuclear factor k -B (NF- k B) and increases cell survival [ 38 ] . In BCR–Abl positive myeloid leukemia cells, PKD2 can be activated by its phosphorylation at a tyrosine residue homologue to Y463 but does not need the activation loop phosphorylations to mediate the activation of NF- k B [ 74 ] .

Regulation of PKD by phosphorylation and protein interactions – Additional in vivo phosphorylation sites in PKD1 leading to its regulation by facilitating the binding of regulatory proteins were described [ 77– 80 ] . These include residues S203, S208, S219, and S223 whose phosphorylation regulates binding of PKD1 to 14-3-3, a mechanism that decreases the activity of the kinase [ 78 ] . Although it was suggested that phospho-rylation of these residues may occur through auto- or transphosphorylation, the amino acids surrounding these serines are not generating PKD phosphorylation motifs.

Another in vitro PKD autophosphorylation site is serine residue 910 (in human PKD1) [ 79 ] . The amino acids surrounding S910 also do not represent an ideal phos-phorylation motif for the kinase, and the role of PKD phosphorylation at S910 in vivo is not well understood. Furthermore, it is unclear if the phosphorylation of this site is a consequence of PKD1 activation, since it was shown that it occurs independent or prior to PKD1 activation loop phosphorylation, suggesting that in vivo, also other kinases may be involved in the phosphorylation of this residue [ 57, 81 ] . For example, in response to PLD1 activation, DAG generation from PA

252 P. Storz

induces PKD1 autophosphorylation at S910, and this occurs prior to PKC-mediated activation loop phosphorylation [ 46 ] . S910 is localized within a PDZ (Postsynaptic density-95/Disks large/Zonula occludens-1-binding motif) protein binding motif [ 80 ] . PKD1 controls the fi ssion of golgi transport carriers specifi cally destined to the cell surface [ 17 ] . As an example for such mechanism, PKD1 and PKD2 regulate neurotensin secretion in pancreatic cancer cells [ 82 ] . It was shown that phosphory-lation of S910 leads to a release of a PDZ-binding protein from the PDZ motif, resulting in the release of vesicles from the trans -golgi network [ 80 ] . Phosphorylation of PKD1 at S910 is also necessary for the recycling of a

v b

3 -integrin [ 83 ] . Moreover,

it was shown that death-associated protein kinase (DAPK) leads to S910 but not activation loop phosphorylation of PKD1 and contributes to ROS-mediated activa-tion of JNK [ 84 ] . Since PKD1 inhibits JNK activity [ 70 ] , DAPK-mediated phos-phorylation of PKD at S910 may also lead to a modulation of PDZ motif/PDZ binding protein interactions. Taken together, it is very likely that S910 phosphoryla-tion represents a yet not well-defi ned additional regulation mechanism for PKD.

Role of PKD in Tumor Cell Proliferation

Highly proliferative cancers such as mouse skin carcinomas show increased PKD expression. Moreover, increased levels of PKD1 in mouse keratinocytes were cor-related with increased DNA synthesis and proliferation [ 85 ] . Furthermore, expres-sion of PKD1 in human pancreatic ductal adenocarcinoma (PDAC) cell lines leads to enhanced proliferation and signifi cant increases in telomerase activity [ 86 ] . Similarly, stable expression of PKD2 increases the proliferation of cell lines of human carcinoid tumors, rare neuroendocrine cancers with a predilection for the gastrointestinal tract [ 87, 88 ] . In androgen-dependent prostate cancer cells, a forced expression of PKD3 promoted S-phase entry. Further, depletion of these cells from PKD3 led to G0–G1 phase arrest and inhibition of androgen-independent cell pro-liferation [ 28 ] .

Proliferative signaling by PKD seems to be mediated in response to triggering of growth factor receptors (GFRs) or G-protein-coupled receptors (GPCRs) [ 89 ] . For example, neuropeptides such as neurotensin (NT) and bombesin-like peptides act as autocrine or paracrine growth factors and potent cellular mitogens for a variety human cancers [ 90, 91 ] . Neuropeptides signal through G a

q subunits of G-protein-

coupled receptors. All three PKD isoforms, PKD1, PKD2, and PKD3, have been shown to be activated and redistributed within cells by GPCRs. For example, PKD1 is shuttled to the nucleus after its activation [ 18, 92 ] , and similar redistribution was shown for PKD2 and PKD3 in epithelial cell lines [ 60 ] . However, the cellular tar-gets for active, nuclear PKD in response to these signals is so far unknown. One possibility is that nuclear PKD targets histone deacetylases (HDACs) to modulate gene expression. Histone-dependent packaging of genomic DNA into chromatin is a fundamental mechanism to regulate gene expression. Histone acetyltransferases

25311 Protein Kinase D Signaling in Cancer

(HATs) mediate relaxation of nucleosomal structures through acetylation of histones, allowing transcriptional activators to access genes and activate gene tran-scription. Conversely, histone deacetylases condense the chromatin through deacetylation of histones, leading to transcriptional repression [ 93 ] . PKD phospho-rylates the class II histone deacetylases HDAC5 and HDAC7 directly [ 94, 95 ] . PKD isoenzymes seem to have redundant roles in regulating HDACs [ 96 ] . Signaling through G-protein-coupled receptors induces the phosphorylation of HDAC5 at two serine residues, S259 and S498, of which all three PKD isoforms catalyze the phos-phorylation of S498 [ 97 ] . Direct phosphorylation of HDAC5 through PKD drives its nuclear export [ 95 ] . A-kinase anchoring protein (AKAP)-Lbc coordinates activa-tion and movement of signaling proteins and couples activation of PKD1 with the phosphorylation-dependent nuclear export of HDAC5 [ 98 ] .

Neurotensin is a gut peptide with an important role in gastrointestinal cell motil-ity and stimulates growth of normal gut mucosa. Additionally, NT also stimulates proliferation of NT receptor-positive cancers, including prostate, pancreatic, and colon cancer. Neurotensin and EGF induce synergistic stimulation of DNA synthe-sis in PDAC cells lines [ 91 ] . This is mediated by an increase in the duration of Erk1/2 signaling [ 99 ] . Both PKD1 and PKD2 have been shown to increase the dura-tion of Erk signaling and potentiate DNA synthesis [ 100, 101 ] . Further, expression of constitutively active PKD1 leads to an activation of Raf-1 and subsequent activa-tion of Erk1/2 [ 102 ] . PKD1-mediated regulation of the MAPK pathway also enhanced the transcriptional activity of SRE (serum response element)-driven genes through the Elk-1 ternary complex factor [ 102 ] . Similarly, PKD3 contributes to prostate cancer cell proliferation through regulation of Erk1/2 activity [ 28 ] .

The expression of constitutively active Ras mutants has been identifi ed as an early event in multiple cancers. For example, in pancreatic cancer, K-ras-activating muta-tions have been detected in over 95% of all cases [ 103 ] . Ras activates cell prolifera-tion via the Raf1-Erk1/2 signaling cascade. As a potential mechanism, PKD regulates the Ras effector RIN1 (Ras and Rab interactor 1) through phosphorylation [ 104 ] . RIN1 competes with Raf1 for binding to Ras, whereby RIN1 seems to be a negative regulator of Ras signaling. For example, RIN1 effi ciently blocks Ras-mediated trans-formation. Upon phosphorylation of RIN1 by PKD at S351, RIN binds to 14-3-3 proteins and loses its affi nity to Ras and membrane localization [ 104 ] .

Another potential mechanism of how PKD may contribute to increased cell pro-liferation is through regulation of sphingosine kinase 2 (SPHK2). PKD1 phospho-rylates SPHK2 at its nuclear export sequence and induces its nuclear export. SPHK2 in the nucleus inhibits DNA synthesis under stress conditions [ 105, 106 ] . After its nuclear export, SPHK2 is active and generates the second messenger sphingosine 1-phosphate [ 107 ] . Sphingosine 1-phosphate is a bioactive lipid that regulates cell proliferation, cell survival, cell differentiation, and cell motility, dependent on its locus of generation [ 108 ] . Some of these processes are mediated by sphingosine 1-phosphate-specifi c G-protein-coupled receptors [ 108 ] . Expression of SPHK enhanced tumor cell proliferation and promoted G1/S transition, protected cells from apoptosis, and induced tumor formation in mice [ 109– 112 ] .

254 P. Storz

Role of PKD in Tumor Cell Survival Signaling

PKD1 promotes cell survival in cancer cells in response to different inducers of cell death. For example, PKD1 activation occurs after DNA damage by genotoxic stress and is critically involved in survival signaling [ 113 ] . Further, in PDAC (pancreatic ductal adenocarcinoma) cell lines, the increased expression of PKD1 correlates with their resistance to CD95-mediated apoptosis [ 86 ] . Loss of growth control and resis-tance to apoptosis are major mechanisms that drive the progression of pancreatic tumors. PKD1 may protect pancreatic cancer cells by upregulating anti-apoptotic proteins such as c-FLIP

L and survivin [ 86 ] . PKD1 also blocks TNF a -mediated

apoptosis since it upregulates NF- k B-dependent protective genes such as TRAF-1 (TNF receptor-associated protein 1) or cIAP2 (inhibitor of apoptosis protein 2) [ 114 ] . Furthermore, PKD1 protects from ROS-mediated cell death in multiple can-cer cell types through upregulation of antioxidant and anti-apoptotic genes, includ-ing SOD2 (encoding MnSOD) and A20 [ 58, 115 ] . This is mediated through a mitochondria-to-nucleus signaling pathway involving the activation of PKD1 through PLD1, Src, and PKC d that leads to the induction of NF- k B through its canonical activation pathway (IKK a /IKK b /NEMO complex) [ 38 ] . Tyrosine phos-phorylation-mediated activation of PKD also occurs in chronic myelogenous leuke-mia (CML). CML is characterized by the expression of the BCR–Abl fusion protein (detected in 95% of all CML patients). The BCR–Abl oncogene renders the Abl kinase constitutively active and induces cell proliferation, transformation, and resis-tance to apoptosis in myeloid leukemia cells. In CML cell lines, PKD2 is tyrosine-phosphorylated by BCR–Abl at a residue homologue to the Abl site in PKD1 for ROS signaling. Furthermore, similar to PKD1, tyrosine phosphorylation of PKD2 by BCR–Abl leads to its activation and subsequent induction of NF- k B [ 74 ] .

The seine/threonine kinase Akt is a key effector of PI3K-mediated survival sig-naling [ 116, 117 ] . Although it was shown that PKD1 signaling to NF- k B is uncou-pled from the PI3K–Akt signaling pathway [ 38 ] , in prostate cancer ectopical expression of PKD3 increased Akt activity, and this required PI3K and p38 kinase [ 28 ] . Akt targets multiple pro-apoptotic substrates such as Bad and FOXO3a with the net effect to protect tumor cells from cell death [ 118– 120 ] . This suggests that the PKD3 isoform may protect tumor cells from cell death via Akt.

Besides actively inducing cell survival pathways, PKD1 also inhibits pro-apop-totic signaling through c-Jun N-terminal kinases (JNKs). JNK contributes to cell death by negatively regulating Bcl-2 [ 121 ] . Inhibition of PKD leads to increased activity of JNK and its target, the transcription factor c-Jun [ 122 ] . Resistance from cell death requires nPKC/PKD1 and Erk1/2 activation to switch off pro-apoptotic JNK/c-Jun signaling [ 122 ] . For example, PKC h -mediated activation of PKD1 led to an increase of Erk1/2 activity and induction of the serum response element. At the same time, PKD1 activation reduced JNK activity, suggesting that PKD1 in this pathway switches from apoptotic JNK signaling to proliferative signaling [ 70 ] . Similar inhibitory effects of PKD1 on JNK activity were obtained when PKC e was activated via PDK-1 (phosphoinositide-dependent kinase-1) [ 68 ] . It is unclear if

25511 Protein Kinase D Signaling in Cancer

PKD1 negatively regulates JNK by direct phosphorylation; however, it was demonstrated that activation loop phosphorylation of PKD1 leads to a complex formation with JNK [ 123 ] . PKD1 may also modulate upstream activators for JNK. For example, in some cell types PKD1 has been implicated in the attenuation of EGF-induced activation of JNK [ 39 ] . PKD1 directly phosphorylates the EGF receptor at threonine residues T654 ad T669, which reduces the signaling capacity of EGF-R toward JNK. Interestingly, in lung and pancreatic cell lines, where the EGF–JNK pathway has also been implicated in sustaining the cancerous pheno-types, EGF-stimulated JNK activity is uncoupled from PKD1 suppression [ 124 ] . Further, PKD1 also phosphorylates the JNK target c-Jun directly in vitro at serine residue S58 and suppresses its phosphorylation by JNK at S63 and S73 [ 123, 125 ] . The function of this phosphorylation is not further characterized, but it may be speculated that it leads to an inhibition of c-Jun function.

In some cell systems, PKD signaling toward JNK may also be inactivated to promote cell death. For example, in endothelial cells in response to some apoptotic stimuli, PKD1 interacts with the JNK upstream kinase ASK1 (apoptosis signal-regulated kinase 1). This association is mediated through the PH domain of PKD1 and the C-terminal region of ASK1 but also involves the binding of 14-3-3 proteins to PKD1 [ 126 ] . Since the binding of 14-3-3 to PKD1 has been shown to be a nega-tive-regulatory event [ 78 ] , it is very likely that such signaling negatively regulates PKD1 but also increases ASK1 activity, leading to JNK activation and promoting apoptosis in endothelial cells. As another example, death-associated protein kinase (DAPK) is a cell death–promoting S/T kinase that is activated by ROS and induces JNK signaling. PKD1 is a target for DAPK, and both interact in response to ROS. DAPK leads to phosphorylation of PKD1 at S910 and contributes to ROS-mediated activation of JNK [ 84 ] . It is unclear if this S910 phosphorylation represents PKD1 activation or, since DAPK does not induce PKD1 activation loop phosphorylation, leads to a modulation of PDZ protein/PDZ binding protein interactions and inacti-vation of PKD1 toward JNK.

However, proteolytic cleavage of PKD1 may lead to an increased sensitivity of cancer cells to apoptotic stimuli. PKD1 is cleaved and activated by caspase-3 in the apoptotic response of cancer cells to genotoxic agents including 1- b - D -arabinofurano-sylcytosine, etoposide, cisplatin, or doxorubicin, and to inducers of cell death such as TNF a [ 63– 65 ] . Such cleavage is blocked in cells that express anti-apoptotic proteins such as Bcl-XL. In apoptotic signaling, PKD1 cleavage is associated with the genera-tion of a constitutively active (unregulated) catalytic fragment. Cells stably expressing this kinase fragment are sensitized to genotoxic stress-induced apoptosis [ 64 ] .

Functions of PKD in Chemoresistance

RNA interference (RNAi) screens of human kinase RNAi libraries identifi ed PKD as a regulator of chemoresistance and a survival kinase [ 127 ] . Mechanisms of how PKD mediates chemoresistance however remain unclear. Recent data suggest the

256 P. Storz

contribution of PKD to several signaling events that previously have been shown to mediate chemoresistance of tumor cells.

ROS in tumor cells can contribute to the oncogenic phenotype. However exuberant high levels also can lead to increased macromolecule damage that eventually kills tumor cells, a mechanism that is used by multiple chemotherapeutics (reviewed in [ 54 ] ). Tumor cells have developed multiple protective mechanisms, which are acti-vated in response to such threats, and their activation results in the upregulation of survival and repair of genes [ 128, 129 ] . For example, the activation of the transcrip-tion factors FOXO3a and NF- k B has been linked to upregulation of antioxidant genes such as SOD and catalase in response to ROS or radiation [ 58, 128, 130– 134 ] . PKD1 is a sensor for oxidative stress that relays an increase in cellular ROS to the NF- k B-mediated expression of antioxidant genes. In pancreatic cancer, which is known for its increased ROS levels in tumor cells, NF- k B has been shown to medi-ate tumor cell survival and to induce resistance to chemotherapeutic agents [ 135, 136 ] . Further, it was recently shown that metallothionein 2A (MT 2A) interacts with the kinase domain of PKD1 in prostate cancer [ 137 ] . Metallothioneins are small-molecular-weight trace metal scavenging proteins that also bind to p50 NF- k B [ 138 ] . Like NF- k B, metallothioneins are known to cause resistance to chemother-apy in several cancers including PC [ 139 ] .

Hsp27 is a ubiquitous expressed member of the small heat shock protein family, with major roles in regulating apoptosis, actin reorganization processes, and cell migration. Like NF- k B, Hsp27 has been implicated in chemoresistance of pancre-atic cancer cells [ 140 ] . Hsp27 is a PKD1 substrate, and PKD1 phosphorylates Hsp27 at S82 [ 27 ] . Of note, Hsp27 is also in vitro phosphorylated at S82 by MAPKAPK [ 141 ] , but PKD1 is the relevant physiological kinase for this site in response to oxi-dative stress [ 27 ] . Phosphorylation of Hsp27 at this site has previously been demon-strated in response to inducers of stresses, including infl ammatory cytokines, osmotic stress, ROS, and heat shock [ 141, 142 ] . In Panc-1 cells, neurotensin-induced PKD1 and PKD2 activity also mediated the phosphorylation of Hsp27 at S82 [ 143 ] . Unphosphorylated Hsp27 forms large multimers, and its phosphorylation at Ser 82 in particular promotes their dissociation [ 142 ] . Phosphorylation of Hsp27 modu-lates its oligomerization and chaperone function, resulting in the protection of tumor cells from injury due to stress [ 144 ] . Therefore, PKD-mediated phosphorylation of S82 may protect tumor cells from cellular stresses and thus contribute to chemore-sistance in cancer.

Role of PKD in Tumor Cell Migration and Invasion

The roles of the PKD isoforms in processes regulating tumor cell migration and invasion are still ill-defi ned. Moreover, converse results were obtained regarding the function of PKD1 in regulating cell migration in epithelial or endothelial cells. It is also unclear if different PKD isoforms may have opposing effects on cell motil-ity. Most studies were performed with PKD1, and an emerging picture for this

25711 Protein Kinase D Signaling in Cancer

kinase is that it may inhibit the migration and invasion of epithelial cancer cells at multiple levels.

Role of PKD in cell–cell and cell–matrix aggregation – Recent data suggest that PKD1 may be crucial for cell–cell adhesion and linking adhesion complexes to the actin cytoskeleton [ 24, 145, 146 ] . The formation of E-cadherin/ b -catenin complexes at the cell junctions plays an important role in maintaining cell integrity, polarity, and morphogenesis [ 145 ] , and an aberrant expression or localization of the compo-nents of this complex has been associated with cancer progression and metastasis. Phosphorylation of E-cadherin or b -catenin results in increased stabilization of the cadherin–catenin complex and increases cell–cell adhesion in adherens junctions [ 147, 148 ] . In prostate cancer cells, PKD1 is localized to such cell junctions, where it phosphorylates E-cadherin [ 149 ] . This was associated with increased cell aggre-gation and decreased motility [ 150 ] . Furthermore, downregulation of E-cadherin or PKD1 increased cell migration and invasion [ 151 ] . b -catenin is essential for E-cadherin-mediated cell adhesions in epithelial cells and also acts as a key cofactor for transcriptional activity. PKD1 interacts with b -catenin and phosphorylates it at two threonine residues [ 152 ] . Blunting mutations of these residues abolished its interaction with a -catenin and resulted in increased nuclear localization of b -catenin, where it shows transcriptional activity. Expression of active PKD1 in prostate can-cer cells stabilizes its interaction with E-cadherin and represses b -catenin-induced transcriptional activity [ 152 ] . Moreover, the activation of PKD1 with bryostatin 1, a natural macrocyclic lactone with antineoplastic properties in many tumors, induces a co-localization of the cytoplasmatic pool of b -catenin with PKD1 and proteins involved in vesicular traffi cking [ 145 ] .

PKD1 was also linked to an integrin-mediated cell adhesion to extracellular matrix. Such cell–matrix interactions are important for many cellular processes, including the maintenance of tissue integrity and tumor cell metastasis. Cell adhesion to collagen confers motility and invasive properties in vitro as well as the metastatic potential of tumor cells in vivo [ 153 ] . It was shown that cis -polyunsaturated fatty acids or arachidonic acid enhances b

1 -integrin-mediated adhesion of human breast

carcinoma cells to type IV collagen by activating PKD1 and its upstream kinase PKC e [ 154 ]. PKD1 also associates with the b

3 of the a

v b

3 -integrin and promotes

a v b

3 -integrin recycling. Furthermore, incorporation of a

v b

3 -integrin in newly forming

focal adhesions requires its association with active PKD1 [ 155 ] .

PKD functions at the leading edge of migrating cells – Cancer cell migration toward a chemotactic stimulus requires rapid actin severing, branching, and polymerization at the leading edge to mediate membrane protrusion [ 156, 157 ] . This is concerted by a complex interplay of proteins such as Wiskott–Aldrich syndrome protein (WASp), Arp2/3 complex, capping proteins, Lin-11/Isl-1/Mec-3 kinases (LIMK), slingshot (SSH) phosphatases, ADF (actin depolymerizing factor)/cofi lin, and profi lin [ 156 ] . In cervix carcinoma, pancreatic cancer, and breast cancer cells, PKD1 is recruited to sites of such actin reorganization at the leading edge, where it negatively regulates directed cell migration [ 23, 25 ] . Stimulus-induced lamellipodium protrusion and

258 P. Storz

directed cell migration is initiated by actin severing through ADF/cofi lin. ADF/cofi lin is negatively regulated by phosphorylation through LIMK, and this is reversed by the phosphatase slingshot (SSH) [ 158 ] . Slingshot activity is regulated through two kinases, PAK4 (p21-activated kinase) and PKD1 [ 25, 159 ] . While PAK4 phos-phorylates slingshot at the N-terminus [ 159 ] , PKD1 phosphorylates the slingshot isoform SSH1L at a serine residue located within its actin binding motif, releasing it from F-actin through facilitating the binding of 14-3-3 [ 25 ] . Binding to 14-3-3 proteins sequesters SSH1L in the cytoplasm, rendering it inactive toward cofi lin [ 160 ] . This results in enhanced phospho-cofi lin levels in invasive tumor cells cor-relating with decreased formation of free actin fi lament barbed ends and effective inhibition of directed cell migration [ 25 ] . A similar mechanism was confi rmed for PKD2 [ 31 ] . PKD1 also interacts with and phosphorylates the Ena/VASP protein family member EVL-1 in its EVH2 domain. Since EVL-1 is also localized at the leading edge of migrating cells, this may have a role in fi lopodia formation or the regulation of lamellipodia and cell–cell contacts [ 161 ] . Moreover, cortactin, an actin binding protein that accumulates in lamellipodia and membrane ruffl es, recently has been characterized as an in vivo substrate for PKD1 [ 162 ] . However, PKD1-mediated phosphorylations did not affect cortactin localization, and the cellular function of this signaling event remains unknown.

PKD functions in cargo transport as a mechanism to impact migration – A subcellular pool of PKD is localized to the trans -golgi network (TGN) and regulates the fi ssion of transport carriers specifi cally destined to the plasma membrane [ 163, 164 ] (reviewed in [ 165 ] ), a process that also needs actin nucleation and reorganization. Therefore it is possible that PKD1 at the golgi has similar targets and functions as at the leading edge [ 158 ] . Further, an inactive PKD1 mutant inhibits golgi cargo transport from the TGN to the plasma membrane and the retrograde fl ow of surface markers and fi lamentous actin [ 166 ] .

Role of PKD in cell invasion – Recent data indicate that in some epithelial cancers, PKD1 expression and activity negatively regulate cell invasion [ 7 ] . For example, PKD1 expression is lost at the mRNA level in highly invasive breast cancer cell lines including MDA-MB-231 cells, whereas PKD1 is still expressed in low- or nonmotile cell lines such as MCF-7. The knockdown of PKD1 from such low-motile cells, however, increases their motility and invasion. Moreover, the reintro-duction of a constitutively active PKD1 in MDA-MB-231 cells completely abolishes the ability of these cells to invade [ 7 ] . As a potential mechanism for such effects on the invasive phenotype, it was shown that PKD1 negatively regulates the expression of multiple matrix metalloproteases (MMPs). These enzymes previously have been shown to be involved in the degradation of extracellular matrix. When ectopically expressed, PKD1 negatively regulates the expression of MMP-2, MMP-7, MMP-9, MMP-10, MMP-11, MMP-13, and MMP-14 [ 7 ] , all known to enhance the invasion of MDA-MB-231 cells in Matrigel [ 167– 169 ] . The mechanisms of how PKD1 regu-lates the expression of these molecules are unknown. However, HDACs have been shown to regulate the expression of MMPs. Since PKD is a negative regulator of multiple HDACs [ 94– 97 ] , it may be speculated that PKD1 regulates the expression

25911 Protein Kinase D Signaling in Cancer

of MMPs by inhibiting the function of HDACs. In contrast to downregulating the expression of multiple MMPs, PKD1 expression also increased the expression of MMP-3. This was observed in human fi broblasts and breast cancer cell lines [ 7, 170 ] . This is interesting since in breast cancer, MMP-3 expression was associated with benign early stage tumors and is frequently lost in advanced stage, aggressive cancers [ 171 ] . Therefore, it was speculated that loss of PKD1 expression and the resulting altered MMP expression may be linked to a switch driving the progression from benign to malignant tumors [ 7 ] . Notably, the increased expression of the PKD isoform PKD3 was linked to an increased invasiveness. Therefore, it may also be speculated that an isoform switch from PKD1 to PKD3 may promote tumor cell invasion. Finally, it was also shown that PKD forms complexes with cortactin and paxillin at sites of extracellular matrix degradation, but functions for this complex have not been assigned [ 172 ] .

Multiple myeloma is an incurable B-cell neoplasia characterized by accumula-tion of malignant plasma cells in the bone marrow after crossing of endothelial barriers. The growth factor IGF-1 acts as a chemotactic factor for multiple myeloma cells and promotes migration and tissue invasion. In later stages of the disease, these cells extravasate through blood vessels and are responsible for metastasis. In this context, IGF-1 promotes transmigration through vascular endothelial cells and bone marrow stromal cells. With an inhibitor study, PKD1 and ROCK (Rho-associated kinase) were identifi ed as mediators of such migration, indicating that PKD1 may have a converse function in tumor cells other than epithelial origin [ 173 ] .

Regulation of PKD Expression in Cancer

In normal tissues, PKD2 and PKD3 are expressed ubiquitously, whereas PKD1 expression seems to be restricted to immune cells, endothelial and epithelial cells. In tumor tissues, depending on the PKD isoenzyme, as well as the subtype and stage of the respective cancer, up- or downregulation of PKD expression has been described. While little is known for the two PKD isoforms, PKD2 and PKD3, recent data suggest that in epithelial cancers, PKD1 expression or activity may be needed at early stages of tumor formation but may be gradually lost with acquisition of increased cell motility at later more-aggressive stages.

Gastric cancer – In gastric cancer, the PKD1 promoter is epigenetically inactivated [ 8 ] . Analysis of paired clinical primary gastric cancer samples indicated that approx-imately 60% of the tumors showed a decrease in PKD1 expression as compared to normal tissue, and this downregulation was correlated with methylation of the PKD promoter [ 8 ] . Methylation is also observed when cells of normal appearing mucosal tissue age, predicting that PKD1 methylation may be one of the earliest events that predispose an individual to gastric cancer. Moreover, approximately 70% of exam-ined gastric cancer cell lines showed CpG hypermethylation of the PKD1 promoter region. In gastric cancer, PKD1 expression was further correlated with a negative regulation of motility and invasion, and the knockdown of PKD1 from gastric cancer cell lines increased cell invasion [ 8 ] .

260 P. Storz

Breast cancer – Human tissue samples from invasive breast cancer and normal breast tissue were evaluated for PKD expression. PKD1 was highly expressed in ductal epithelial cells of normal human breast tissue but was approx. 50% reduced in its expression in more than 95% of the analyzed samples of human invasive breast tumors. PKD2 and PKD3 showed no signifi cant differences in their expres-sion levels [ 7 ] . Furthermore, PKD1 is not expressed in invasive breast cancer cell lines, whereas noninvasive or low-invasive breast cancer cell lines express PKD1 [ 7 ] . For cell lines, it was shown that the decrease in PKD1 expression is probably mediated through DNA methylation [ 7 ] . Similarly as shown for gastric cancer, a decreased PKD1 expression or activity led to an increased motility and invasion of breast cancer cells [ 7 ] .

Prostate cancer – Prostate cancer is the second leading cause of death in men in the United States [ 174 ] . Progression of this cancer to androgen independence and chemoresistance are the main causes of death in patients [ 137 ] . PKD1 expression at transcription and translational levels is decreased in 100% of androgen-independent (AI) human prostate cancers [ 150 ] . Androgen-dependent (AD) prostate cancer cell lines show a 4- to 16-fold higher PKD1 expression as androgen-independent (AI) cell lines [ 175 ] . This suggests a potential role for a loss of PKD expression in pro-gression to a more-aggressive stage. PKD1 complexes with the androgen receptor and affects its transcriptional activity [ 176 ] . It was also shown that PKD1-mediated phosphorylation of Hsp27 at S82 is necessary for the repression of the transcrip-tional activity of the androgen receptor and androgen-dependent proliferation of prostate cancer cells [ 177 ] . Only little is known about the involved mechanism by which PKD1 is silenced in prostate cancer, but it may be speculated that a similar epigenetic silencing occurs than observed for gastric and breast cancer. In contrast to PKD1, PKD3 seems to be overexpressed in prostate cancer [ 28 ] and may contrib-ute to cancer progression [ 30 ] .

Other cancers – In contrast to gastric, breast, and prostate cancer, immunohistochem-ical analysis of pancreatic tumor tissue revealed marked overexpression of PKD1/2 in tumors [ 86 ] . Furthermore, a majority of human hyperproliferative skin disorders such as psoriasis and basal cell carcinomas (BCC) show signifi cantly elevated PKD1 protein levels when compared to normal epidermis [ 178 ] . PKD1 levels and activation status were also increased in a neoplastic mouse keratinocyte cell line [ 178 ] .

PKD as a Regulator of Angiogenesis

Angiogenesis, the formation of new blood capillaries, is an important component of tumor progression [ 179 ] . Vascular endothelial growth factor is essential for many angiogenic processes in normal and pathological conditions [ 180 ] . For example, the genetic inactivation of the VEGF receptor leads to a complete lack of development of blood vessels in the mouse embryo [ 181 ] , and inactivation of the VEGF receptor function dramatically impairs the proliferation of endothelial cells in vivo [ 182 ] .

26111 Protein Kinase D Signaling in Cancer

PKD is required for VEGF-induced angiogenesis, and PKC and PKD regulate endothelial function at multiple levels. PKC enzymes are involved in the monolayer integrity of the endothelium, and PKC d , for example, protects against barrier dys-function [ 183 ] . Further, PMA- and DAG-induced activation of PKC d and PKD leads to pulmonary microvascular hyperpermeability response across the endothe-lial monolayer [ 184 ] . PKD1 and PKD2 also are required for VEGF-mediated tubu-logenesis and endothelial cell migration [ 185 ] . This is in contrast to epithelial tumor cell migration, which is inhibited by PKD1 and PKD2. Finally, PKD is also rapidly activated in vascular smooth muscle cells by phorbol esters, angiotensin II, and PDGF, also with a potential function in cell proliferation [ 186 ] .

PKD activation by VEGF in endothelial cells is mediated through PKC a and PLC g [ 182 ] . In HUVECs (human umbilical vein endothelial cells), VEGF stimu-lates the tyrosine phosphorylation of PKD1 by the VEGF-R2 (KDR), and the knockdown of PKD1 or the expression of a kinase-inactive PKD1 or a mutant, which cannot be phosphorylated at Y463, inhibits VEGF-mediated cell prolifera-tion and migration [ 187 ] . In response to VEGF-mediated activation, PKD1 and PKD2 phosphorylate the small heat shock protein Hsp27 at S82. This is indepen-dent of the kinase MAPKAPK2, which also can mediate the phosphorylation of Hsp27 at this residue [ 185 ] . PKD and its target Hsp27 seem to play major roles in the angiogenic response to VEGF [ 185 ] .

Perspective

Since its fi rst description in 1994, protein kinase D was known to be expressed in a variety of different tumor cell lines. However, till date the roles of PKD isoforms in the different aspects of tumor formation, progression, and metastasis are still ill-defi ned. Most data available focus on the isoform PKD1 and suggest that PKD1 contributes to early events leading to epithelial tumor formation and growth but is also a negative regulator of cell invasion that facilitates metastatic progression. This suggests that PKD1 may act as a switch from an invasive phenotype to the prolif-erative phenotype. While recently the benzoxoloazepinolone CID755673 was extensively characterized as the fi rst PKD-specifi c inhibitor [ 30 ] , a screening for PKD activators to inhibit tumor cell invasion was not advanced so far. Only little is known for the role of the two other PKD isoforms, PKD2 and PKD3, in cancer, and it will be exciting to see if they have similar or converse functions in tumor progression.

Due to the fact that PKD1 may promote events leading to tumor formation and tumor growth, but also as a suppressor of metastasis, the treatment of cancer patients with compounds modulating PKD activity needs to be well judged. Patients with tumors at an early stage may be treated with PKD inhibitors, whereas an activation strategy for PKD1 may be more suitable to block metastasis in advanced tumors. An additional problem that may occur is that PKD isoform-specifi c activators or inhibi-tors may be needed.

262 P. Storz

Inhibition of PKD by a variety of inhibitors including the indolocarbazole Gö6976, staurosporine, and K252 was described; however, they all are rather unspe-cifi c. For example, Gö6976 inhibits PKD1 with an IC

50 of 20 nM [ 188 ] but is also a

potent inhibitor of cPKC enzymes. The use of such “nonspecifi c” inhibitors in the PKD literature led to a variety of contradictory results, also due to a lack of some studies to verify the obtained data with more-specifi c methods, such as a knock-down of PKD. Nevertheless, there are examples for the successful use of broad-spectrum agents as inhibitors of PKD-regulated signaling pathways in cancer cells (Fig. 11.3 ). For example, PKD1-mediated signaling to NF- k B, a key event in PKD1 survival signaling, can be blocked by antioxidants such as NAC or resveratrol ( trans -3,4 ¢ ,5-trihydroxystilbene). Resveratrol is a naturally occurring antioxidant that has been shown to function in the prevention of several human pathological processes including carcinogenesis [ 189– 193 ] . Resveratrol directly inhibits both PKD and its upstream activators nPKC and blocks NF- k B induction [ 57, 194– 197 ] .

In summary, it becomes clear that, to fully understand the functions of PKD enzymes and to further evaluate if they can serve as therapeutic targets for tumor therapy, more knowledge needs to be accumulated regarding their functions in all aspects of tumor biology.

Fig. 11.3 PKD1 substrates and their contribution to oncogenic signaling. A subset of so far char-acterized PKD1 substrates ( red ), some of the proteins involved in their signaling, as well as the known inducers of PKD1-mediated phosphorylation of these substrates are depicted ( PdBu phor-bol ester, GF-R growth factor receptor, GPC-R G-protein-coupled receptor). The NF- k B pathway is activated by PKD1 through a so far unidentifi ed substrate or mechanism. Further indicated is the potential role of the PKD1-phosphorylated substrates in tumorigenesis. A role for PKD in mediat-ing tumor cell survival and proliferation is well established; the role of PKD enzymes in cancer cell migration, however, varies with the isoform or cell type studied. Best studied in this context is PKD1 in epithelial cancers, where it may act as a molecular switch that alters the transition from a motile to a proliferative and stress-resistant phenotype

26311 Protein Kinase D Signaling in Cancer

Acknowledgments Research in the Storz laboratory is supported by grants from the Mayo Clinic SPORE for Pancreatic Cancer (P50 CA102701), the Mayo Clinic Breast Cancer SPORE (CA116201-03DR4), the NIH (GM86435 and CA135102), as well as a Bankhead–Coley grant (10BG11) from the Florida Department of Health.

References

1. Sturany, S., et al., Molecular cloning and characterization of the human protein kinase D2. A novel member of the protein kinase D family of serine threonine kinases. J Biol Chem, 2001. 276 (5): p. 3310–8.

2. Johannes, F.J., et al., PKCu is a novel, atypical member of the protein kinase C family. J Biol Chem, 1994. 269 (8): p. 6140–8.

3. Hayashi, A., et al., PKCnu, a new member of the protein kinase C family, composes a fourth subfamily with PKCmu. Biochim Biophys Acta, 1999. 1450 (1): p. 99–106.

4. Valverde, A.M., et al., Molecular cloning and characterization of protein kinase D: a target for diacylglycerol and phorbol esters with a distinctive catalytic domain. Proc Natl Acad Sci USA, 1994. 91 (18): p. 8572–6.

5. Manning, G., et al., The protein kinase complement of the human genome. Science, 2002. 298 (5600): p. 1912–34.

6. Dieterich, S., et al., In vitro activation and substrates of recombinant, baculovirus expressed human protein kinase C mu. FEBS Lett, 1996. 381 (3): p. 183–7.

7. Eiseler, T., et al., Protein kinase D1 regulates matrix metalloproteinase expression and inhib-its breast cancer cell invasion. Breast Cancer Res, 2009. 11 (1): p. R13.

8. Kim, M., et al., Epigenetic inactivation of protein kinase D1 in gastric cancer and its role in gastric cancer cell migration and invasion. Carcinogenesis, 2008. 29 (3): p. 629–37.

9. Iglesias, T. and E. Rozengurt, Protein kinase D activation by mutations within its pleckstrin homology domain. J Biol Chem, 1998. 273 (1): p. 410–6.

10. Iglesias, T. and E. Rozengurt, Protein kinase D activation by deletion of its cysteine-rich motifs. FEBS Lett, 1999. 454 (1–2): p. 53–6.

11. Waldron, R.T. and E. Rozengurt, Protein kinase C phosphorylates protein kinase D activation loop Ser744 and Ser748 and releases autoinhibition by the pleckstrin homology domain. J Biol Chem, 2003. 278 (1): p. 154–63.

12. Storz, P., et al., Tyrosine phosphorylation of protein kinase D in the pleckstrin homology domain leads to activation. J Biol Chem, 2003. 278 (20): p. 17969–76.

13. Cowell, C.F., et al., Mitochondrial diacylglycerol initiates protein-kinase D1-mediated ROS signaling. J Cell Sci, 2009. 122 (Pt 7): p. 919–28.

14. Yuan, J., L.W. Slice, and E. Rozengurt, Activation of protein kinase D by signaling through Rho and the alpha subunit of the heterotrimeric G protein G13. J Biol Chem, 2001. 276 (42): p. 38619–27.

15. Oancea, E., et al., Mechanism of persistent protein kinase D1 translocation and activation. Dev Cell, 2003. 4 (4): p. 561–74.

16. Baron, C.L. and V. Malhotra, Role of diacylglycerol in PKD recruitment to the TGN and protein transport to the plasma membrane. Science, 2002. 295 (5553): p. 325–8.

17. Maeda, Y., et al., Recruitment of protein kinase D to the trans-Golgi network via the fi rst cysteine-rich domain. Embo J, 2001. 20 (21): p. 5982–90.

18. Rey, O., et al., Regulated nucleocytoplasmic transport of protein kinase D in response to G protein-coupled receptor activation. J Biol Chem, 2001. 276 (52): p. 49228–35.

19. Waldron, R.T., T. Iglesias, and E. Rozengurt, The pleckstrin homology domain of protein kinase D interacts preferentially with the eta isoform of protein kinase C. J Biol Chem, 1999. 274 (14): p. 9224–30.

264 P. Storz

20. Jamora, C., et al., Gbetagamma-mediated regulation of Golgi organization is through the direct activation of protein kinase D. Cell, 1999. 98 (1): p. 59–68.

21. Van Lint, J., et al., Protein kinase D: an intracellular traffi c regulator on the move. Trends Cell Biol, 2002. 12 (4): p. 193–200.

22. Wang, Q.J., PKD at the crossroads of DAG and PKC signaling. Trends Pharmacol Sci, 2006. 27 (6): p. 317–23.

23. Eiseler, T., et al., PKD is recruited to sites of actin remodelling at the leading edge and nega-tively regulates cell migration. FEBS Lett, 2007. 581 (22): p. 4279–87.

24. Cowell, C.F., et al., Loss of cell-cell contacts induces NF-kappaB via RhoA-mediated activa-tion of protein kinase D1. J Cell Biochem, 2009. 106 (4): p. 714–28.

25. Eiseler, T., et al., Protein kinase D1 regulates cofi lin-mediated F-actin reorganization and cell motility through slingshot. Nat Cell Biol, 2009. 11 (5): p. 545–56.

26. Hutti, J.E., et al., A rapid method for determining protein kinase phosphorylation specifi city. Nat Methods, 2004. 1 (1): p. 27–9.

27. Doppler, H., et al., A phosphorylation state-specifi c antibody recognizes Hsp27, a novel sub-strate of protein kinase D. J Biol Chem, 2005. 280 (15): p. 15013–9.

28. Chen, J., et al., Protein kinase D3 (PKD3) contributes to prostate cancer cell growth and survival through a PKCepsilon/PKD3 pathway downstream of Akt and ERK 1/2. Cancer Res, 2008. 68 (10): p. 3844–53.

29. Chen, J., G. Lu, and Q.J. Wang, Protein kinase C-independent effects of protein kinase D3 in glucose transport in L6 myotubes. Mol Pharmacol, 2005. 67 (1): p. 152–62.

30. Sharlow, E.R., et al., Potent and selective disruption of protein kinase D functionality by a benzoxoloazepinolone. J Biol Chem, 2008. 283 (48): p. 33516–26.

31. Peterburs, P., et al., Protein kinase D regulates cell migration by direct phosphorylation of the cofi lin phosphatase slingshot 1 like. Cancer Res, 2009. 69 (14): p. 5634–8.

32. Wang, Q.J., et al., Ligand structure-activity requirements and phospholipid dependence for the binding of phorbol esters to protein kinase D. Mol Pharmacol, 2003. 64 (6): p. 1342–8.

33. Yang, C. and M.G. Kazanietz, Divergence and complexities in DAG signaling: looking beyond PKC. Trends Pharmacol Sci, 2003. 24 (11): p. 602–8.

34. Paolucci, L. and E. Rozengurt, Protein kinase D in small cell lung cancer cells: rapid activa-tion through protein kinase C. Cancer Res, 1999. 59 (3): p. 572–7.

35. Iglesias, T., S. Matthews, and E. Rozengurt, Dissimilar phorbol ester binding properties of the individual cysteine-rich motifs of protein kinase D. FEBS Lett, 1998. 437 (1–2): p. 19–23.

36. Zugaza, J.L., et al., Bombesin, vasopressin, endothelin, bradykinin, and platelet-derived growth factor rapidly activate protein kinase D through a protein kinase C-dependent signal transduction pathway. J Biol Chem, 1997. 272 (38): p. 23952–60.

37. Van Lint, J., et al., Platelet-derived growth factor stimulates protein kinase D through the activation of phospholipase Cgamma and protein kinase C. J Biol Chem, 1998. 273 (12): p. 7038–43.

38. Storz, P. and A. Toker, Protein kinase D mediates a stress-induced NF-kappaB activation and survival pathway. Embo J, 2003. 22 (1): p. 109–20.

39. Bagowski, C.P., et al., Cell-type specifi c phosphorylation of threonines T654 and T669 by PKD defi nes the signal capacity of the EGF receptor. Embo J, 1999. 18 (20): p. 5567–76.

40. Yuan, J., et al., Activation of protein kinase D by signaling through the alpha subunit of the heterotrimeric G protein G(q). J Biol Chem, 2000. 275 (3): p. 2157–64.

41. Yuan, J., et al., Cooperation of Gq, Gi, and G12/13 in protein kinase D activation and phos-phorylation induced by lysophosphatidic acid. J Biol Chem, 2003. 278 (7): p. 4882–91.

42. Yuan, J., O. Rey, and E. Rozengurt, Activation of protein kinase D3 by signaling through Rac and the alpha subunits of the heterotrimeric G proteins G12 and G13. Cell Signal, 2006. 18 (7): p. 1051–62.

43. Yuan, J., O. Rey, and E. Rozengurt, Protein kinase D3 activation and phosphorylation by signaling through G alpha q. Biochem Biophys Res Commun, 2005. 335 (2): p. 270–6.

26511 Protein Kinase D Signaling in Cancer

44. Chiu, T. and E. Rozengurt, PKD in intestinal epithelial cells: rapid activation by phorbol esters, LPA, and angiotensin through PKC. Am J Physiol Cell Physiol, 2001. 280 (4): p. C929-42.

45. Rey, O., et al., G protein-coupled receptor-mediated phosphorylation of the activation loop of protein kinase D: dependence on plasma membrane translocation and protein kinase Cepsilon. J Biol Chem, 2004. 279 (33): p. 34361–72.

46. Kam, Y. and J.H. Exton, Role of phospholipase D in the activation of protein kinase D by lysophosphatidic acid. Biochem Biophys Res Commun, 2004. 315 (1): p. 139–43.

47. Chiu, T.T., et al., Protein kinase D2 mediates lysophosphatidic acid-induced interleukin 8 production in nontransformed human colonic epithelial cells through NF-kappaB. Am J Physiol Cell Physiol, 2007. 292 (2): p. C767–77.

48. Rozengurt, E. and J.H. Walsh, Gastrin, CCK, signaling, and cancer. Annu Rev Physiol, 2001. 63 : p. 49–76.

49. Sturany, S., et al., Mechanism of activation of protein kinase D2(PKD2) by the CCK(B)/gas-trin receptor. J Biol Chem, 2002. 277 (33): p. 29431–6.

50. Hall, A., Rho GTPases and the actin cytoskeleton. Science, 1998. 279 (5350): p. 509–14. 51. Hart, M.J., et al., Direct stimulation of the guanine nucleotide exchange activity of p115

RhoGEF by Galpha13. Science, 1998. 280 (5372): p. 2112–4. 52. Kozasa, T., et al., p115 RhoGEF, a GTPase activating protein for Galpha12 and Galpha13.

Science, 1998. 280 (5372): p. 2109–11. 53. Halliwell, B., Oxidative stress and cancer: have we moved forward? Biochem J, 2007. 401 (1):

p. 1–11. 54. Storz, P., Reactive oxygen species in tumor progression. Front Biosci, 2005. 10 : p. 1881–96. 55. Storz, P., Reactive oxygen species-mediated mitochondria-to-nucleus signaling: a key to

aging and radical-caused diseases. Sci STKE, 2006. 2006 (332): p. re3. 56. Storz, P., H. Doppler, and A. Toker, Protein kinase Cdelta selectively regulates protein kinase

D-dependent activation of NF-kappaB in oxidative stress signaling. Mol Cell Biol, 2004. 24 (7): p. 2614–26.

57. Storz, P., H. Doppler, and A. Toker, Activation loop phosphorylation controls protein kinase D-dependent activation of nuclear factor kappaB. Mol Pharmacol, 2004. 66 (4): p. 870–9.

58. Storz, P., H. Doppler, and A. Toker, Protein kinase D mediates mitochondrion-to-nucleus signaling and detoxifi cation from mitochondrial reactive oxygen species. Mol Cell Biol, 2005. 25 (19): p. 8520–30.

59. Chiarugi, P. and T. Fiaschi, Redox signalling in anchorage-dependent cell growth. Cell Signal, 2007. 19 (4): p. 672–82.

60. Rey, O., et al., Protein kinase C nu/protein kinase D3 nuclear localization, catalytic activa-tion, and intracellular redistribution in response to G protein-coupled receptor agonists. J Biol Chem, 2003. 278 (26): p. 23773–85.

61. Babior, B.M., The respiratory burst oxidase. Curr Opin Hematol, 1995. 2 (1): p. 55–60. 62. Segal, A.W. and K.P. Shatwell, The NADPH oxidase of phagocytic leukocytes. Ann N Y Acad

Sci, 1997. 832 : p. 215–22. 63. Vantus, T., et al., Doxorubicin-induced activation of protein kinase D1 through caspase-me-

diated proteolytic cleavage: identifi cation of two cleavage sites by microsequencing. Cell Signal, 2004. 16 (6): p. 703–9.

64. Endo, K., et al., Proteolytic cleavage and activation of protein kinase C [micro] by caspase-3 in the apoptotic response of cells to 1-beta -D-arabinofuranosylcytosine and other genotoxic agents. J Biol Chem, 2000. 275 (24): p. 18476–81.

65. Haussermann, S., et al., Proteolytic cleavage of protein kinase Cmu upon induction of apop-tosis in U937 cells. FEBS Lett, 1999. 462 (3): p. 442–6.

66. Waldron, R.T., T. Iglesias, and E. Rozengurt, Phosphorylation-dependent protein kinase D activation. Electrophoresis, 1999. 20 (2): p. 382–90.

67. Yuan, J., et al., Protein kinase D is a downstream target of protein kinase Ctheta. Biochem Biophys Res Commun, 2002. 291 (3): p. 444–52.

266 P. Storz

68. Brandlin, I., et al., Protein kinase C(mu) regulation of the JNK pathway is triggered via phosphoinositide-dependent kinase 1 and protein kinase C(epsilon). J Biol Chem, 2002. 277 (47): p. 45451–7.

69. Doppler, H. and P. Storz, A novel tyrosine phosphorylation site in protein kinase D contrib-utes to oxidative stress-mediated activation. J Biol Chem, 2007. 282 (44): p. 31873–81.

70. Brandlin, I., et al., Protein kinase C (PKC)eta-mediated PKC mu activation modulates ERK and JNK signal pathways. J Biol Chem, 2002. 277 (8): p. 6490–6.

71. Tan, M., et al., Thrombin rapidly induces protein kinase D phosphorylation, and protein kinase C delta mediates the activation. J Biol Chem, 2003. 278 (5): p. 2824–8.

72. Iglesias, T., R.T. Waldron, and E. Rozengurt, Identifi cation of in vivo phosphorylation sites required for protein kinase D activation. J Biol Chem, 1998. 273 (42): p. 27662–7.

73. Johnson, L.N., M.E. Noble, and D.J. Owen, Active and inactive protein kinases: structural basis for regulation. Cell, 1996. 85 (2): p. 149–58.

74. Mihailovic, T., et al., Protein kinase D2 mediates activation of nuclear factor kappaB by Bcr-Abl in Bcr-Abl + human myeloid leukemia cells. Cancer Res, 2004. 64 (24): p. 8939–44.

75. Rhee, S.G., et al., Hydrogen peroxide: a key messenger that modulates protein phosphoryla-tion through cysteine oxidation. Sci STKE, 2000. 2000 (53): p. pe1.

76. Meng, T.C., T. Fukada, and N.K. Tonks, Reversible oxidation and inactivation of protein tyrosine phosphatases in vivo. Mol Cell, 2002. 9 (2): p. 387–99.

77. Vertommen, D., et al., Regulation of protein kinase D by multisite phosphorylation. Identifi cation of phosphorylation sites by mass spectrometry and characterization by site-di-rected mutagenesis. J Biol Chem, 2000. 275 (26): p. 19567–76.

78. Hausser, A., et al., Protein kinase C mu is negatively regulated by 14-3-3 signal transduction proteins. J Biol Chem, 1999. 274 (14): p. 9258–64.

79. Matthews, S.A., E. Rozengurt, and D. Cantrell, Characterization of serine 916 as an in vivo autophosphorylation site for protein kinase D/Protein kinase Cmu. J Biol Chem, 1999. 274 (37): p. 26543–9.

80. Sanchez-Ruiloba, L., et al., Protein kinase D intracellular localization and activity control kinase D-interacting substrate of 220-kDa traffi c through a postsynaptic density-95/discs large/zonula occludens-1-binding motif. J Biol Chem, 2006. 281 (27): p. 18888–900.

81. Rybin, V.O., J. Guo, and S.F. Steinberg, Protein kinase D1 autophosphorylation via distinct mechanisms at Ser744/Ser748 and Ser916. J Biol Chem, 2009. 284 (4): p. 2332–43.

82. Li, J., et al., PKD1, PKD2, and their substrate Kidins220 regulate neurotensin secretion in the BON human endocrine cell line. J Biol Chem, 2008. 283 (5): p. 2614–21.

83. White, D.P., P.T. Caswell, and J.C. Norman, alpha v beta3 and alpha5beta1 integrin recycling pathways dictate downstream Rho kinase signaling to regulate persistent cell migration. J Cell Biol, 2007. 177 (3): p. 515–25.

84. Eisenberg-Lerner, A. and A. Kimchi, DAP kinase regulates JNK signaling by binding and activating protein kinase D under oxidative stress. Cell Death Differ, 2007. 14 (11): p. 1908–15.

85. Rennecke, J., et al., Protein-kinase-Cmu expression correlates with enhanced keratinocyte proliferation in normal and neoplastic mouse epidermis and in cell culture. Int J Cancer, 1999. 80 (1): p. 98–103.

86. Trauzold, A., et al., PKCmu prevents CD95-mediated apoptosis and enhances proliferation in pancreatic tumour cells. Oncogene, 2003. 22 (55): p. 8939–47.

87. Woodside, K.J., C.M. Townsend, Jr., and B. Mark Evers, Current management of gastrointes-tinal carcinoid tumors. J Gastrointest Surg, 2004. 8 (6): p. 742–56.

88. Jackson, L.N., et al., Overexpression of wild-type PKD2 leads to increased proliferation and invasion of BON endocrine cells. Biochem Biophys Res Commun, 2006. 348 (3): p. 945–9.

89. Romero, D.G., et al., Angiotensin II-mediated protein kinase D activation stimulates aldoster-one and cortisol secretion in H295R human adrenocortical cells. Endocrinology, 2006. 147 (12): p. 6046–55.

90. Rozengurt, E., Early signals in the mitogenic response. Science, 1986. 234 (4773): p. 161–6.

26711 Protein Kinase D Signaling in Cancer

91. Guha, S., O. Rey, and E. Rozengurt, Neurotensin induces protein kinase C-dependent protein kinase D activation and DNA synthesis in human pancreatic carcinoma cell line PANC-1. Cancer Res, 2002. 62 (6): p. 1632–40.

92. Rey, O., et al., Rapid protein kinase D translocation in response to G protein-coupled recep-tor activation. Dependence on protein kinase C. J Biol Chem, 2001. 276 (35): p. 32616–26.

93. Haberland, M., R.L. Montgomery, and E.N. Olson, The many roles of histone deacetylases in development and physiology: implications for disease and therapy. Nat Rev Genet, 2009. 10 (1): p. 32–42.

94. Xu, X., et al., Angiotensin II stimulates protein kinase D-dependent histone deacetylase 5 phosphorylation and nuclear export leading to vascular smooth muscle cell hypertrophy. Arterioscler Thromb Vasc Biol, 2007. 27 (11): p. 2355–62.

95. Vega, R.B., et al., Protein kinases C and D mediate agonist-dependent cardiac hypertrophy through nuclear export of histone deacetylase 5. Mol Cell Biol, 2004. 24 (19): p. 8374–85.

96. Matthews, S.A., et al., Essential role for protein kinase D family kinases in the regulation of class II histone deacetylases in B lymphocytes. Mol Cell Biol, 2006. 26 (4): p. 1569–77.

97. Huynh, Q.K. and T.A. McKinsey, Protein kinase D directly phosphorylates histone deacetylase 5 via a random sequential kinetic mechanism. Arch Biochem Biophys, 2006. 450 (2): p. 141–8.

98. Carnegie, G.K., et al., AKAP-Lbc mobilizes a cardiac hypertrophy signaling pathway. Mol Cell, 2008. 32 (2): p. 169–79.

99. Kisfalvi, K., S. Guha, and E. Rozengurt, Neurotensin and EGF induce synergistic stimulation of DNA synthesis by increasing the duration of ERK signaling in ductal pancreatic cancer cells. J Cell Physiol, 2005. 202 (3): p. 880–90.

100. Sinnett-Smith, J., et al., Protein kinase D2 potentiates MEK/ERK/RSK signaling, c-Fos accu-mulation and DNA synthesis induced by bombesin in Swiss 3 T3 cells. J Cell Physiol, 2007. 211 (3): p. 781–90.

101. Sinnett-Smith, J., et al., Protein kinase D potentiates DNA synthesis induced by Gq-coupled receptors by increasing the duration of ERK signaling in Swiss 3 T3 cells. J Biol Chem, 2004. 279 (16): p. 16883–93.

102. Hausser, A., et al., Protein kinase C mu selectively activates the mitogen-activated protein kinase (MAPK) p42 pathway. FEBS Lett, 2001. 492 (1–2): p. 39–44.

103. Perez-Mancera, P.A. and D.A. Tuveson, Physiological analysis of oncogenic K-ras. Methods Enzymol, 2006. 407 : p. 676–90.

104. Wang, Y., et al., The RAS effector RIN1 directly competes with RAF and is regulated by 14-3-3 proteins. Mol Cell Biol, 2002. 22 (3): p. 916–26.

105. Okada, T., et al., Involvement of N-terminal-extended form of sphingosine kinase 2 in serum-dependent regulation of cell proliferation and apoptosis. J Biol Chem, 2005. 280 (43): p. 36318–25.

106. Igarashi, N., et al., Sphingosine kinase 2 is a nuclear protein and inhibits DNA synthesis. J Biol Chem, 2003. 278 (47): p. 46832–9.

107. Ding, G., et al., Protein kinase D-mediated phosphorylation and nuclear export of sphin-gosine kinase 2. J Biol Chem, 2007. 282 (37): p. 27493–502.

108. Spiegel, S. and S. Milstien, Sphingosine 1-phosphate, a key cell signaling molecule. J Biol Chem, 2002. 277 (29): p. 25851–4.

109. Nava, V.E., et al., Sphingosine kinase type 1 promotes estrogen-dependent tumorigenesis of breast cancer MCF-7 cells. Exp Cell Res, 2002. 281 (1): p. 115–27.

110. Olivera, A., et al., Sphingosine kinase expression increases intracellular sphingosine-1-phos-phate and promotes cell growth and survival. J Cell Biol, 1999. 147 (3): p. 545–58.

111. Olivera, A., et al., Sphingosine kinase type 1 induces G12/13-mediated stress fi ber formation, yet promotes growth and survival independent of G protein-coupled receptors. J Biol Chem, 2003. 278 (47): p. 46452–60.

112. Xia, P., et al., An oncogenic role of sphingosine kinase. Curr Biol, 2000. 10 (23): p. 1527–30. 113. Besirli, C.G. and E.M. Johnson, Jr., The activation loop phosphorylation of protein kinase D

is an early marker of neuronal DNA damage. J Neurochem, 2006. 99 (1): p. 218–25.

268 P. Storz

114. Johannes, F.J., et al., Protein kinase Cmu downregulation of tumor-necrosis-factor-induced apoptosis correlates with enhanced expression of nuclear-factor-kappaB-dependent protec-tive genes. Eur J Biochem, 1998. 257 (1): p. 47–54.

115. Storz, P., et al., Functional dichotomy of A20 in apoptotic and necrotic cell death. Biochem J, 2005. 387 (Pt 1): p. 47–55.

116. Toker, A., Protein kinases as mediators of phosphoinositide 3-kinase signaling. Mol Pharmacol, 2000. 57 (4): p. 652–8.

117. Toker, A. and M. Yoeli-Lerner, Akt signaling and cancer: surviving but not moving on. Cancer Res, 2006. 66 (8): p. 3963–6.

118. Brunet, A., et al., Akt promotes cell survival by phosphorylating and inhibiting a Forkhead transcription factor. Cell, 1999. 96 (6): p. 857–68.

119. Franke, T.F. and L.C. Cantley, Apoptosis. A Bad kinase makes good. Nature, 1997. 390 (6656): p. 116–7.

120. Datta, S.R., A. Brunet, and M.E. Greenberg, Cellular survival: a play in three Akts. Genes Dev, 1999. 13 (22): p. 2905–27.

121. Storz, P., Mitochondrial ROS--radical detoxifi cation, mediated by protein kinase D. Trends Cell Biol, 2007. 17 (1): p. 13–8.

122. Wang, Y., et al., Hepatocyte resistance to oxidative stress is dependent on protein kinase C-mediated down-regulation of c-Jun/AP-1. J Biol Chem, 2004. 279 (30): p. 31089–97.

123. Hurd, C., R.T. Waldron, and E. Rozengurt, Protein kinase D complexes with C-Jun N-terminal kinase via activation loop phosphorylation and phosphorylates the C-Jun N-terminus. Oncogene, 2002. 21 (14): p. 2154–60.

124. Hurd, C. and E. Rozengurt, Uncoupling of protein kinase D from suppression of EGF-dependent c-Jun phosphorylation in cancer cells. Biochem Biophys Res Commun, 2003. 302 (4): p. 800–4.

125. Waldron, R.T., et al., Identifi cation of a novel phosphorylation site in c-Jun directly targeted in vitro by protein kinase D. Biochem Biophys Res Commun, 2007. 356 (2): p. 361–7.

126. Zhang, W., et al., Protein kinase D specifi cally mediates apoptosis signal-regulating kinase 1-JNK signaling induced by H2O2 but not tumor necrosis factor. J Biol Chem, 2005. 280 (19): p. 19036–44.

127. MacKeigan, J.P., L.O. Murphy, and J. Blenis, Sensitized RNAi screen of human kinases and phosphatases identifi es new regulators of apoptosis and chemoresistance. Nat Cell Biol, 2005. 7 (6): p. 591–600.

128. Kops, G.J., et al., Forkhead transcription factor FOXO3a protects quiescent cells from oxida-tive stress. Nature, 2002. 419 (6904): p. 316–21.

129. Mercurio, F. and A.M. Manning, NF-kappaB as a primary regulator of the stress response. Oncogene, 1999. 18 (45): p. 6163–71.

130. Li, N. and M. Karin, Is NF-kappaB the sensor of oxidative stress? Faseb J, 1999. 13 (10): p. 1137–43.

131. Das, K.C., Y. Lewis-Molock, and C.W. White, Activation of NF-kappa B and elevation of MnSOD gene expression by thiol reducing agents in lung adenocarcinoma (A549) cells. Am J Physiol, 1995. 269 (5 Pt 1): p. L588-602.

132. Guo, G., et al., Manganese superoxide dismutase-mediated gene expression in radiation-in-duced adaptive responses. Mol Cell Biol, 2003. 23 (7): p. 2362–78.

133. Rojo, A.I., et al., Regulation of Cu/Zn-superoxide dismutase expression via the phosphati-dylinositol 3 kinase/Akt pathway and nuclear factor-kappaB. J Neurosci, 2004. 24 (33): p. 7324–34.

134. Olmos, Y., et al., Mutual dependence of Foxo3a and PGC-1alpha in the induction of oxidative stress genes. J Biol Chem, 2009. 284 (21): p. 14476–84.

135. Huang, Z., et al., Effects of 5-fl uouracil combined with sulfasalazine on human pancreatic carcinoma cell line BxPC-3 proliferation and apoptosis in vitro. Hepatobiliary Pancreat Dis Int, 2007. 6 (3): p. 312–20.

136. Sun, C., et al., Aurora kinase inhibition downregulates NF-kappaB and sensitises tumour cells to chemotherapeutic agents. Biochem Biophys Res Commun, 2007. 352 (1): p. 220–5.

26911 Protein Kinase D Signaling in Cancer

137. Rao, P.S., et al., Metallothionein 2A interacts with the kinase domain of PKCmu in prostate cancer. Biochem Biophys Res Commun, 2003. 310 (3): p. 1032–8.

138. Abdel-Mageed, A.B. and K.C. Agrawal, Activation of nuclear factor kappaB: potential role in metallothionein-mediated mitogenic response. Cancer Res, 1998. 58 (11): p. 2335–8.

139. Vasak, M. and D.W. Hasler, Metallothioneins: new functional and structural insights. Curr Opin Chem Biol, 2000. 4 (2): p. 177–83.

140. Mori-Iwamoto, S., et al., Proteomics fi nding heat shock protein 27 as a biomarker for resis-tance of pancreatic cancer cells to gemcitabine. Int J Oncol, 2007. 31 (6): p. 1345–50.

141. Landry, J., et al., Human HSP27 is phosphorylated at serines 78 and 82 by heat shock and mitogen-activated kinases that recognize the same amino acid motif as S6 kinase II. J Biol Chem, 1992. 267 (2): p. 794–803.

142. Lambert, H., et al., HSP27 multimerization mediated by phosphorylation-sensitive intermo-lecular interactions at the amino terminus. J Biol Chem, 1999. 274 (14): p. 9378–85.

143. Yuan, J. and E. Rozengurt, PKD, PKD2, and p38 MAPK mediate Hsp27 serine-82 phospho-rylation induced by neurotensin in pancreatic cancer PANC-1 cells. J Cell Biochem, 2008. 103 (2): p. 648–62.

144. Rogalla, T., et al., Regulation of Hsp27 oligomerization, chaperone function, and protective activity against oxidative stress/tumor necrosis factor alpha by phosphorylation. J Biol Chem, 1999. 274 (27): p. 18947–56.

145. Jaggi, M., et al., Bryostatin 1 modulates beta-catenin subcellular localization and transcrip-tion activity through protein kinase D1 activation. Mol Cancer Ther, 2008. 7 (9): p. 2703–12.

146. Medeiros, R.B., et al., Protein kinase D1 and the beta 1 integrin cytoplasmic domain control beta 1 integrin function via regulation of Rap1 activation. Immunity, 2005. 23 (2): p. 213–26.

147. Lickert, H., et al., Casein kinase II phosphorylation of E-cadherin increases E-cadherin/beta-catenin interaction and strengthens cell-cell adhesion. J Biol Chem, 2000. 275 (7): p. 5090–5.

148. Serres, M., et al., The disruption of adherens junctions is associated with a decrease of E-cadherin phosphorylation by protein kinase CK2. Exp Cell Res, 2000. 257 (2): p. 255–64.

149. Jaggi, M., et al., E-cadherin phosphorylation by protein kinase D1/protein kinase C{mu} is associated with altered cellular aggregation and motility in prostate cancer. Cancer Res, 2005. 65 (2): p. 483–92.

150. Jaggi, M., et al., Protein kinase C mu is down-regulated in androgen-independent prostate cancer. Biochem Biophys Res Commun, 2003. 307 (2): p. 254–60.

151. Syed, V., et al., Beta-catenin mediates alteration in cell proliferation, motility and invasion of prostate cancer cells by differential expression of E-cadherin and protein kinase D1. J Cell Biochem, 2008. 104 (1): p. 82–95.

152. Du, C., et al., Protein kinase D1-mediated phosphorylation and subcellular localization of beta-catenin. Cancer Res, 2009. 69 (3): p. 1117–24.

153. Vihinen, P., et al., Integrin alpha 2 beta 1 in tumorigenic human osteosarcoma cell lines regu-lates cell adhesion, migration, and invasion by interaction with type I collagen. Cell Growth Differ, 1996. 7 (4): p. 439–47.

154. Palmantier, R., et al., Cis-polyunsaturated fatty acids stimulate beta1 integrin-mediated adhe-sion of human breast carcinoma cells to type IV collagen by activating protein kinases C-epsilon and -mu. Cancer Res, 2001. 61 (6): p. 2445–52.

155. Woods, A.J., et al., PKD1/PKCmu promotes alphavbeta3 integrin recycling and delivery to nascent focal adhesions. Embo J, 2004. 23 (13): p. 2531–43.

156. Pollard, T.D. and G.G. Borisy, Cellular motility driven by assembly and disassembly of actin fi laments. Cell, 2003. 112 (4): p. 453–65.

157. Wang, W., R. Eddy, and J. Condeelis, The cofi lin pathway in breast cancer invasion and metastasis. Nat Rev Cancer, 2007. 7 (6): p. 429–40.

158. Storz, P., Protein kinase D1: a novel regulator of actin-driven directed cell migration. Cell Cycle, 2009. 8 (13): p. 1975–6.

159. Soosairajah, J., et al., Interplay between components of a novel LIM kinase-slingshot phos-phatase complex regulates cofi lin. Embo J, 2005. 24 (3): p. 473–86.

270 P. Storz

160. Nagata-Ohashi, K., et al., A pathway of neuregulin-induced activation of cofi lin-phosphatase Slingshot and cofi lin in lamellipodia. J Cell Biol, 2004. 165 (4): p. 465–71.

161. Janssens, K., et al., Characterization of EVL-I as a protein kinase D substrate. Cell Signal, 2009. 21 (2): p. 282–92.

162. De Kimpe, L., et al., Characterization of cortactin as an in vivo protein kinase D substrate: interdependence of sites and potentiation by Src. Cell Signal, 2009. 21 (2): p. 253–63.

163. Liljedahl, M., et al., Protein kinase D regulates the fi ssion of cell surface destined transport carriers from the trans-Golgi network. Cell, 2001. 104 (3): p. 409–20.

164. Hausser, A., et al., Protein kinase D regulates vesicular transport by phosphorylating and activating phosphatidylinositol-4 kinase IIIbeta at the Golgi complex. Nat Cell Biol, 2005. 7 (9): p. 880–6.

165. Ghanekar, Y. and M. Lowe, Protein kinase D: activation for Golgi carrier formation. Trends Cell Biol, 2005. 15 (10): p. 511–4.

166. Prigozhina, N.L. and C.M. Waterman-Storer, Protein kinase D-mediated anterograde mem-brane traffi cking is required for fi broblast motility. Curr Biol, 2004. 14 (2): p. 88–98.

167. Hegedus, L., et al., Additional MDA-MB-231 breast cancer cell matrix metalloproteinases promote invasiveness. J Cell Physiol, 2008. 216 (2): p. 480–5.

168. Hotary, K., et al., A cancer cell metalloprotease triad regulates the basement membrane transmigration program. Genes Dev, 2006. 20 (19): p. 2673–86.

169. Ramos-DeSimone, N., et al., Activation of matrix metalloproteinase-9 (MMP-9) via a con-verging plasmin/stromelysin-1 cascade enhances tumor cell invasion. J Biol Chem, 1999. 274 (19): p. 13066–76.

170. Reuben, P.M., Y. Sun, and H.S. Cheung, Basic calcium phosphate crystals activate p44/42 MAPK signal transduction pathway via protein kinase Cmicro in human fi broblasts. J Biol Chem, 2004. 279 (34): p. 35719–25.

171. Farina, A.R., et al., Inhibition of human MDA-MB-231 breast cancer cell invasion by matrix metalloproteinase 3 involves degradation of plasminogen. Eur J Biochem, 2002. 269 (18): p. 4476–83.

172. Bowden, E.T., et al., An invasion-related complex of cortactin, paxillin and PKCmu associ-ates with invadopodia at sites of extracellular matrix degradation. Oncogene, 1999. 18 (31): p. 4440–9.

173. Qiang, Y.W., et al., Insulin-like growth factor I induces migration and invasion of human multiple myeloma cells. Blood, 2004. 103 (1): p. 301–8.

174. Hellerstedt, B.A. and K.J. Pienta, The current state of hormonal therapy for prostate cancer. CA Cancer J Clin, 2002. 52 (3): p. 154–79.

175. Powell, C.T., et al., Persistent membrane translocation of protein kinase C alpha during 12-0-tetradecanoylphorbol-13-acetate-induced apoptosis of LNCaP human prostate cancer cells. Cell Growth Differ, 1996. 7 (4): p. 419–28.

176. Mak, P., et al., Protein kinase D1 (PKD1) infl uences androgen receptor (AR) function in pros-tate cancer cells. Biochem Biophys Res Commun, 2008. 373 (4): p. 618–23.

177. Hassan, S., et al., Heat shock protein 27 mediates repression of androgen receptor function by protein kinase D1 in prostate cancer cells. Oncogene, 2009. 28 (49): p. 4386–96.

178. Ristich, V.L., et al., Protein kinase D distribution in normal human epidermis, basal cell carcinoma and psoriasis. Br J Dermatol, 2006. 154 (4): p. 586–93.

179. Folkman, J., Angiogenesis in cancer, vascular, rheumatoid and other disease. Nat Med, 1995. 1 (1): p. 27–31.

180. Yancopoulos, G.D., et al., Vascular-specifi c growth factors and blood vessel formation. Nature, 2000. 407 (6801): p. 242–8.

181. Carmeliet, P., et al., Abnormal blood vessel development and lethality in embryos lacking a single VEGF allele. Nature, 1996. 380 (6573): p. 435–9.

182. Wong, C. and Z.G. Jin, Protein kinase C-dependent protein kinase D activation modulates ERK signal pathway and endothelial cell proliferation by vascular endothelial growth factor. J Biol Chem, 2005. 280 (39): p. 33262–9.

183. Harrington, E.O., et al., Role of protein kinase C isoforms in rat epididymal microvascular endothelial barrier function. Am J Respir Cell Mol Biol, 2003. 28 (5): p. 626–36.

27111 Protein Kinase D Signaling in Cancer

184. Tinsley, J.H., N.R. Teasdale, and S.Y. Yuan, Involvement of PKCdelta and PKD in pulmonary microvascular endothelial cell hyperpermeability. Am J Physiol Cell Physiol, 2004. 286 (1): p. C105-11.

185. Evans, I.M., G. Britton, and I.C. Zachary, Vascular endothelial growth factor induces heat shock protein (HSP) 27 serine 82 phosphorylation and endothelial tubulogenesis via protein kinase D and independent of p38 kinase. Cell Signal, 2008. 20 (7): p. 1375–84.

186. Abedi, H., E. Rozengurt, and I. Zachary, Rapid activation of the novel serine/threonine pro-tein kinase, protein kinase D by phorbol esters, angiotensin II and PDGF-BB in vascular smooth muscle cells. FEBS Lett, 1998. 427 (2): p. 209–12.

187. Qin, L., H. Zeng, and D. Zhao, Requirement of protein kinase D tyrosine phosphorylation for VEGF-A165-induced angiogenesis through its interaction and regulation of phospholipase Cgamma phosphorylation. J Biol Chem, 2006. 281 (43): p. 32550–8.

188. Gschwendt, M., et al., Inhibition of protein kinase C mu by various inhibitors. Differentiation from protein kinase c isoenzymes. FEBS Lett, 1996. 392 (2): p. 77–80.

189. Tinhofer, I., et al., Resveratrol, a tumor-suppressive compound from grapes, induces apopto-sis via a novel mitochondrial pathway controlled by Bcl-2. Faseb J, 2001. 15 (9): p. 1613–5.

190. Cal, C., et al., Resveratrol and cancer: chemoprevention, apoptosis, and chemo-immunosen-sitizing activities. Curr Med Chem Anticancer Agents, 2003. 3 (2): p. 77–93.

191. Udenigwe, C.C., et al., Potential of resveratrol in anticancer and anti-infl ammatory therapy. Nutr Rev, 2008. 66 (8): p. 445–54.

192. Kundu, J.K. and Y.J. Surh, Cancer chemopreventive and therapeutic potential of resveratrol: mechanistic perspectives. Cancer Lett, 2008. 269 (2): p. 243–61.

193. Goswami, S.K. and D.K. Das, Resveratrol and chemoprevention. Cancer Lett, 2009. 284 (1): p. 1–6.

194. Manna, S.K., A. Mukhopadhyay, and B.B. Aggarwal, Resveratrol suppresses TNF-induced activation of nuclear transcription factors NF-kappa B, activator protein-1, and apoptosis: potential role of reactive oxygen intermediates and lipid peroxidation. J Immunol, 2000. 164 (12): p. 6509–19.

195. Slater, S.J., et al., Inhibition of protein kinase C by resveratrol. Biochim Biophys Acta, 2003. 1637 (1): p. 59–69.

196. Haworth, R.S. and M. Avkiran, Inhibition of protein kinase D by resveratrol. Biochem Pharmacol, 2001. 62 (12): p. 1647–51.

197. Stewart, J.R., et al., Resveratrol preferentially inhibits protein kinase C-catalyzed phosphory-lation of a cofactor-independent, arginine-rich protein substrate by a novel mechanism. Biochemistry, 1999. 38 (40): p. 13244–51.

273M. Chatterjee and K. Kashfi (eds.), Cell Signaling & Molecular Targets in Cancer, DOI 10.1007/978-1-4614-0730-0_12, © Springer Science+Business Media, LLC 2012

Abbreviations

AA Amino acid AO Antioxidant DADs Dialkyl disulfi de ERK Extracellular signal-related kinase ET Electron transfer GSH Glutathione HO-1 Heme oxygenase IL Interleukin IOA Isoobtusilactone MARK Nitrogen-activated protein kinase OS Oxidative stress PAHs Polycyclic aromatic hydrocarbons PDT Photodynamic therapy ROS Reactive oxygen species SO Superoxide SOD Superoxide dismutase UV Ultraviolet

Introduction

Cell signaling has played an important role in the life sciences. Therefore, it is not surprising to fi nd extensive literature devoted to the cancer area. The present review presents an integrated approach to the topic involving electron transfer (ET),

P. Kovacic (*) Department of Chemistry , San Diego State University , San Diego , CA 92182-1030 , USA e-mail: pkovacic@sundown.sdsu.edu

Chapter 12 Cell Signaling and Cancer: Integrated, Fundamental Approach Involving Electron Transfer, Reactive Oxygen Species, and Antioxidants

Peter Kovacic and Ratnasamy Somanathan

274 P. Kovacic and R. Somanathan

reactive oxygen species (ROS), and antioxidants (AOs). Since carcinogenesis and cancer biochemistry involve a complex area, a broad, encompassing approach deal-ing with fundamental aspects should provide important insight. Our presentation includes both endogenous and exogenous agents, as well as participation of AOs as preventive agents and chemotherapeutics as curatives. It should be emphasized that our mechanistic approach is just one aspect of a multifaceted subject. Our objective does not include other modes of action. Some original references can be found in cited reviews and books.

Tenets of OS Theory

Of the numerous theories that have been advanced, oxidative stress (OS) is the most comprehensive, and has stood the test of time. It can rationalize and correlate most aspects associated with carcinogenesis [ 1, 2 ] : (1) generation of ROS from the main classes of carcinogens, in addition to miscellaneous ones; (2) activated oxygen as a universal factor in oncology, (3) DNA cleavage and base oxidation, (4) association with the three major stages of carcinogenesis, (5) relationship to mutagenesis, (6) oncogene activation, (7) tobacco effect, (8) dietary impact, (9) aging factor, (10) association with illness, such as infl ammation, (11) correlation with certain heredi-tary illnesses, (12) estrogen involvement, (13) probability of second cancers, (14) Haddow paradox, (15) benefi cial infl uence of AOs, and (16) application to a wide range of other physiologically active substances.

ET and OS have been implicated in the actions of drugs and toxins, such as, carcinogens [ 2 ] , anti-infective agents [ 3 ] , anticancer drugs [ 4 ] , reproductive toxins [ 5 ] , nephrotoxins [ 6 ] , hepatotoxins [ 7 ] , nerve toxins [ 8 ] , cardiovascular toxins [ 9 ] , mitochondrial toxins [ 10 ] , abused drugs [ 11 ] , ototoxins [ 12 ] , immune system toxins [ 13 ] , and various others, in addition to human illnesses [ 14 ] . The preponderance of bioactive substances or their metabolites incorporate ET functionalities, which, we believe, play important roles in physiological responses [ 1 ] . These main groups include quinones (or phenolic precursors), metal complexes (or complexors), aro-matic nitro compounds (or reduced derivatives), and conjugated imines (or iminium species). In vivo redox cycling with oxygen can occur, giving rise to OS through generation of ROS, as discussed in the Metabolism section. In some cases, ET results in interference with normal electron transport chains, e.g., respiration. Alternatively, ROS can arise in some instances by non-ET avenues.

Generally, active entities possessing ET groups display reduction potentials in the physiologically responsive range, i.e., more positive than −0.5 V. However, a correlation between reduction potential and activity is not always observed since important roles are played by other factors, such as, solubility, metabolism, diffu-sion, adsorption, site binding, cell permeability, and stereochemistry. Reduction potential is infl uenced by various factors including conformation which can differ in vitro vs. in vivo. Hence, electrochemistry, which has enjoyed relatively little

27512 Cell Signaling and Cancer: Integrated, Fundamental Approach…

attention, can provide valuable insight into the mode of action. Our theoretical framework incorporates several features common to most carcinogens:

1. Binding to DNA by alkylation or complexation 2. Existence of an ET entity present in the parent carcinogen or frequently in a

metabolite 3. Formation of ROS usually by ET involving oxygen 4. ROS generation in close proximity to DNA giving rise to mutation, apparently

by strand cleavage and base oxidation

There is a plethora of experimental evidence supporting the OS theoretical frame-work, including generation of the common ROS, lipoperoxidation, degradation prod-ucts of oxidation, depletion of AOs, effect of exogenous AOs, DNA oxidation and cleavage products, as well as electrochemical data. This comprehensive, unifying mechanism is in keeping with the frequent observations that many ET substances display a variety of activities, e.g., multiple drug properties, as well as toxic effects. Although our focus is on this theory, it should be emphasized that bioactivity is quite complicated. Other well-supported, general proposals include the action of onco-genes. Evidence indicates that OS plays a role in a number of the alternative hypoth-eses. The most likely scenario is complementarity entailing a multifaceted approach.

Chronology

The fundamental framework of the OS theory was laid down by four groups in the 1950s [ 1 ] . It is remarkable that the essential features still provide a useful base even though the experimental, supporting evidence at the time was quite limited. The unifying theme is in marked contrast to the approach, still prevalent, that each type of cancer has a different cause. Several corollaries were advanced, including protec-tion by antioxidants and application to anticancer agents and aging. Though little attention was paid to the theory in the ensuing 10–15 years, a surge of activity began in the 1970s. Despite the mounting volume of research, the OS theory was largely ignored by most oncologists until recent years.

Stages in Carcinogenesis

Carcinogenesis is a complex process characterized by three major stages: initiation, promotion, and progression [ 1 ] . Complete carcinogens are both initiators and pro-moters, whereas incomplete carcinogens require promoters to produce malignant transformations. Most carcinogens must be converted metabolically into an active form, i.e., transformation from a pro-carcinogen into an ultimate carcinogen. Our review is primarily concerned with initiation, the fi rst stage, which is the most stud-ied and best understood. Interaction of the ultimate carcinogen with DNA results in

276 P. Kovacic and R. Somanathan

irreversible alterations, i.e., mutations. Many investigators have pointed out an unmistakable correlation between carcinogenesis and mutagenesis, indicating that the former entails a type of mutation. Extensive evidence is documented which indicates that ROS species are pervasive mutagens. Numerous antecedent studies have demonstrated that ROS participate in all three stages. In addition to the modes addressed in this review, ROS can also interfere with cell signaling by altering protein kinase cascades and transcription factors, ultimately leading to tumor development [ 13 ] .

Promotion, which follows initiation, is a multistage, often reversible, process of gene activation. There is convincing evidence that cellular oxidation states, i.e., the relative levels of ROS, AO defense entities, and radical scavengers, can promote initiated cells to neoplastic growth. Investigations dealing with involvement of ROS have continued into more recent years. One of the most powerful tumor promoters is phorbol myristate acetate. It is well established that its activation is accompanied by appearance of ROS, including superoxide (SO) and hydrogen peroxide, as well as hydroxyl radicals and lipid peroxidation. Phagocytic stimulation also plays a role.

It is not surprising that cancer cells, which display no specialized function within the body, appear to represent a simpler type. Reversion to unicellular behavior and to a fetal phenotype have been discussed. Another major difference with normal cells concerns telomerase. Cellular immortality, a hallmark of cancer, involves this enzyme at various stages along the continuum of multistage carcinogenesis. The catalyst rebuilds telomeres, the termini on chromosomes. Telomerase may have potential as an early biomarker or, perhaps, as a player in the control of cancer.

Cell Signaling

Cell signaling is known to be importantly involved in various aspects of biological function, including normal processes, therapeutic drug action, and toxicology. More than 10 years ago, ROS attracted attention in relation to cell signaling. Since then several books [ 15, 16 ] and a book chapter [ 17 ] have addressed this aspect. A recent review has provided further insight [ 18 ] . Evidence has accumulated that ROS, such as hydrogen peroxide, SO, and the hydroxyl radical, are important chemical media-tors that regulate the transduction of signals by modulating protein activity via redox chemistry. Authors have proposed that ROS have been conserved throughout evolu-tion as universal second messengers. Nearly every step in signal transfer is sensitive to ROS, which can function as second messengers in the activation of transcription factors. Various types of radiation, which are generators of ROS, also infl uence cell communication. Since the messengers must possess appreciable lifetimes in order to migrate, a certain degree of stability is required. For example, the hydroxyl radi-cal would not be a messenger due to its extremely high reactivity with its resultant very short time of existence, although it would generate messenger radicals. Likely candidates include superoxide and resonance-stabilized peroxyl radicals. Others would be stable ROS arising from AOs, such as vitamin C, vitamin E, and fl a-vonoids. Members can be envisioned from the reactive nitrogen species (RNS)

27712 Cell Signaling and Cancer: Integrated, Fundamental Approach…

category. NO is a well-known radical that plays an important role in cell signaling. In relation to theory, a puzzling aspect is its relatively short life time. Perhaps more stable complexes are involved. Other nitrogen radicals can play a role. Important candidates comprise small proteins possessing redox groups.

In effect, cell signaling can be regarded as proceeding via a long redox chain in which the standard parameters of initiation, propagation, and termination pertain, involving omnipresent conduit species with unshared electrons. A series of relay stations may be operative. Based on the redox chain framework, the second mes-senger might be superoxide formed by a redox process involving oxygen and a second messenger electron from an ET functionality in the receptor site. At the termination of the initial journey, radical character would be transmitted to a site, mobile or stationary. For example, a redox amino acid (AA) side chain acting as a relay (transfer station), that could then pass on (initiate) radical character to a third messenger. These types of interactions, widespread in AA chemistry, usually involv-ing electron and/or hydrogen abstraction to generate radical species, are treated in a review [ 19 ] . The numerous redox moieties in anchored proteins might fall in the relay category. There has been dramatic increase in attention devoted to free-radical species in cell signaling, although the bulk of the signal transduction literature pays no attention to this aspect.

Certain second messengers, most notably calcium ions and phosphoinositides, are also charged [ 20 ] . Therefore, electrostatic interactions may play a role in their biological activities.

Integrated Approach

Endogenous Agents

More recent years have shown an escalation in research dealing with an integrated approach to cancer in relation to ROS, OS, AOs, receptors, and cell signaling. Various other aspects of oncology are also addressed. There are articles that deal generally with the integrated approach of the present review [ 21– 26 ] . There are many reports that address more specifi c aspects as presented in the ensuing material.

ROS generation is a tightly controlled process that plays a central role in cell signaling [ 27 ] . Regulated changes in intracellular ROS levels can induce signaling events that control cellular functions, such as proliferation and apoptosis that are involved in carcinogenesis. The review summarizes ROS-mediated cell signaling and its relation to cancer induction. Special attention is given to redox-active iron in relation to ROS-mediated signaling in cancer development. Elucidation of molecu-lar mechanisms that govern ROS-mediated regulation of cell signaling may lead to therapeutic strategies for cancer treatment and prevention.

When redox homeostasis is disturbed, OS may contribute to disease develop-ment, including cancer [ 28 ] . The review focuses on the role of key transcription

278 P. Kovacic and R. Somanathan

factors and signal-transduction pathways in affecting cell survival, as well as the redox systems that regulate functions. How redox systems contribute to the development of cancer is discussed, including strategies for treatment.

Nox and Duox enzymes generate ROS as part of normal and abnormal processes in vivo, including signal transduction [ 29 ] . The most common conditions associated with Nox-derived ROS are chronic diseases that commonly occur late in life, such as cancer. The pathological role of Nox enzymes might be understood in terms of negative pleiotropy, involving genes that are benefi cial early in life, but have harm-ful effects later. Another report also deals with the Nox category [ 30 ] .

When cells are stimulated by ROS, cell-signaling cascades are activated [ 31 ] . The cellular redox potential is an important determinant of cell function, and inter-ruption of redox balance may have adverse effects. AOs may intercept critical ROS involved in signaling, and thus both protect against and foster pathogenesis. Further study is needed to unravel the role of ROS in redox regulation, and the potential outcome of AO use on cellular responses. Gamma-glutamyltransferase (GGT) plays an important role in the homeostasis of GSH [ 32 ] . Expression of GGT is upregu-lated after OS. In a study of signal transduction effects, OS-induced activation of GGT was found to involve Eas and several downstream signaling pathways in rat colon carcinoma cells. Glucose deprivation-induced cell death is associated with apoptosis which is characterized by membrane blebbing in human breast cancer cells [ 33 ] . Results suggest that the alteration of phosphorylation/dephosphorylation by paxillin may be related to events mediated by OS and the stress-activated protein kinase signaling pathway. Overexpression of catalase, but not Mn SOD, inhibited glucose deprivation-induced cytotoxicity and c-Jun-N-terminal kinase activation in human adrenocarcinoma cells [ 34 ] . Hydrogen peroxide, rather than superoxide, acts as a second messenger of metabolic OS in activation of certain signal transduction pathways.

Production of ROS by oncogenic Ras is thought to be crucial, but little is known about the signaling mechanism involved [ 35 ] . Overexpression of a leukotriene receptor caused increased ROS production. An associated cascade appears to be involved. In a study of signaling mechanism by ROS in tumor progression, ROS, as a signaling messenger, oxidizes critical target molecules, such as PKC and protein tyrosine phosphates [ 36 ] . Two of the downstream entities regulated by ROS are MAPK and PAK. MAPK cascades comprise a major signal pathway for metastasis, which are mediated by PKC. Hydrogen peroxide plays a role in upregulation via an AO-response element. Understanding the critical role of ROS-triggered signaling transduction, transcriptional activation and regulation of gene ROS in tumor pro-gression is helpful. Redox modifi cation of proteins permits regulation of signaling pathways as in cancer cells [ 37 ] . ROS can modify signaling proteins through thiol oxidation and nitrosylation. These modifi cations modulate protein activity and are important in signaling events, especially those pertaining to cell death or survival.

NF-kB has been implicated in various events leading to cancer promotion and this family also regulates the expression of many genes [ 38 ] . The review summarizes features of regulation, including signaling pathways by kinases. Focus is also on the role of NF-kB in cell survival and OS. There are related reports [ 39, 40 ] .

27912 Cell Signaling and Cancer: Integrated, Fundamental Approach…

Identifying target proteins undergoing redox modifi cations is key to understanding how oxidants mediate pathological processes, such as tumor promotion [ 41 ] . These proteins may also be targets for chemopreventive AOs which can block signaling induced by oxidants. PKS is a logical candidate for redox modifi cation by ROS and AOs that may play a role in cancer-promoting and anticancer activity, respectively. PKCs contain structural features readily susceptible to oxidative modifi cation, namely thiol residues. Mitochondria play roles in many cellular functions, including energy production and cell signaling [ 42 ] . The report addresses the role of mito-chondrial proteins in signaling pathways, such as those dealing with OS and apop-tosis. These proteins are modifi ed through redox processes in various age-related diseases, e.g., cancer and Parkinson’s disease. There are related reviews that deal with ROS, cell signaling, and mitochondria [ 43– 45 ] .

A review discusses interplay between integrin-mediated ROS production and matrix metalloprotein expression in relation to cancer cell invasion and metastasis [ 46 ] . Increased levels of ROS from mitochondria have been observed in many cancer cells [ 47 ] . ROS derived from a novel protein (Romo 1) are indispensable for cancer cell proliferation and many play an important role in redox signaling in cancer cells. A comprehensive review addresses redox-dependent regulation of cell signaling through Cys oxidation in protein tyrosine phosphatase [ 48, 49 ] .

ROS can stimulate cancer cell growth by regulating AMPK and COX-2 [ 50 ] . There is a correlation between H. pylori infection and gastric carcinogenesis [ 51– 53 ] . Signal transduction is involved, as well as cell proliferation, apoptosis and production of ROS. As is well characterized, ROS are associated with tumor formation, with involvement as the second messenger in signaling cascades [ 54 ] . The study observed increased ROS formation in cancer cells in comparison with normal ones.

Kupffer cells appear to play a central role in the hepatic response to carcinogenic agents [ 55 ] . Activation results in the release of cytokines and/or ROS that induce hepatocyte cell proliferation. ROS and RNS are mediators of cell signaling in pul-monary epithelial cells by asbestos, silica airborne particulates, diesel exhaust, ozone, and cigarette smoke [ 56 ] . Targeting of MARK and related signaling cas-cades may be critical to the prevention of lung cancer and control of a number of lung diseases.

Interleukin (IL) plays an important role in modulating expression of various growth and angiogenic factors in tumor cells [ 57 ] . Exogenous hydrogen peroxide enhanced IL secretion and thiol prevented IL-induced ROS production. Various sig-naling pathways are involved in IL-induced secretion which enhance endothelial cell proliferation. The signaling adapter p62 is induced by Ras with increased levels in human tumors [ 58 ] . Its defi ciency produces increased ROS which accounts for enhanced cell death. High levels of ROS are spontaneously produced by ovarian and prostate cancer cells [ 59 ] , and the elevated levels were inhibited by NADPH oxidase inhibitor and mitochondrial ET chain inhibition.

Evidence indicates that ROS play an important role in inducing angiogenesis and tumor growth. JNK was found to potentiate tumor necrosis factor (TNF)-stimulated necrosis [ 60 ] . Data indicate that JNK can shift the balance of TNF-stimulated cell

280 P. Kovacic and R. Somanathan

death from apoptosis to necrosis. TNF is an important regulator of immune responses, including signal pathways. ROS are generated in response to inhibition of protein phosphatase 2A (PP2A) in leukemia cells [ 61 ] .

A differential role is indicated for ROS in apoptosis caused by PP2A inhibition. ROS generated by tumor promoter TPA play an important role in mediating cell signaling for regulation of gene expression [ 62 ] . Scavengers of ROS, such as SOD, catalase and thiol, suppressed TPA-triggered migration of human hepatoma cells. TPA can induce gene expression in a ROS-dependent manner. ROS produced by NADPH mediate the antiapoptotic effect of growth factors [ 63 ] . Results suggest a novel signaling pathway in which NADPH oxidase activation results in inhibition of protein tyrosine phosphatases, leading to enhanced phosphorylation of kinases and suppression of apoptosis.

Bile refl ux contributes to esophagal injury and neoplasia, in which COX-2 is involved [ 64 ] . Bile acids stimulated COX-2 expression and induced phosphoryla-tion. ROS-mediated activation of signaling pathways occurred. Hypoxia is closely related to pathophysiological conditions, such as cancer, in which ROS have been implicated [ 65 ] . In this connection, the role of ROS in cell signaling was investi-gated. A novel role was found for adenosine monophosphate-activated protein kinase (AMPK) and the upstream signaling components. Regulation of hypoxia-inducible factor is under the control of c-Jun N-terminal kinase and Janus kinase 2 pathways. Thus, AMPK is a key determinant of HIF-1 functions in response to ROS. Bilirubin produces major biological effects, such as eliciting cell toxicity and inhibiting proliferation in cancer cells [ 66 ] . It induces OS by promoting an increase in ROS. The ROS increase activated the AO cell response through a master redox regulator in eukaryotic cells. The activation was followed by concomitant activation of transcriptional factor and upregulation of tumor suppressor. Blocking ROS gen-eration with N-acetylcysteine pretreatment avoided the adverse effects. In a related study, bile acids initiated signaling pathways via COX-2 induction with participa-tion of ROS [ 67 ] . Understanding is increased of the mechanisms by which bile acids promote development of esophageal adenocarcinoma. Tumor suppressor gene PTEN functions as a lipid phosphatase, thereby regulating certain signaling path-ways [ 64 ] . OS regulates accumulation of PTEN which reduces tumor progression and protects cells upon oxidative damage. TNF a induces autophagy which requires ROS production with participation in the apoptotic signaling pathway [ 68 ] . NF-kB activation mediates the repression of autophagy in response to TNF a .

Investigations address the role of NOX in cancer. A review addresses involve-ment of ROS and NOX in tumor angiogenesis through the regulation of different biological systems [ 69 ] . Signaling pathways infl uenced by ROS and NOX involve proliferation and angiogenesis. ROS targets regulating proliferation include phos-phatases, AP1 and NF-kB, as well as cell cycle targets. There is a mediating role for NOX redox signaling for Ras oncogene-induced changes [ 70 ] . Hypoxia-inducible factor-1 (HIF-1) represents the key mediator of hypoxia response [ 71 ] . HIF-1 over-expression is linked to tumor initiation and progression. Elevated ROS, observed in the tumors, have been implicated in HIF-1 signaling.

28112 Cell Signaling and Cancer: Integrated, Fundamental Approach…

Various reports deal with the effects of photodynamic therapy (PDT). The procedure entails binding of a photosensitizer to the target tumor tissue, which upon light exposure generates ROS including singlet oxygen [ 72 ] : cancer cells reacted to PDT by covalent cross-linking of signal transducer and activator of transcriptor 3 (STAT3). Multiple signaling cascades are activated in cancer cells exposed to PDT [ 73 ] . These signals are transduced into cell death responses involving ROS. The killing can be direct by induction of apoptotic, as well non-apoptotic, pathways. A study deals with mitogen-activated protein kinase (MARK) signaling after PDT [ 74 ] . Both extracellular signal-related kinase (ERK) and p38 were activated. There was photo-chemically induction of ERK phosphorylation. Also, with PDT treated cancer cells, signaling pathways and mechanisms were characterized that lead to up-regulation of the AO enzyme heme oxygenase (HO-1) [ 75 ] . The p38MARK and P13K signaling cascade is required for HO-1 induction. Stimulation of HO-1 expression is a cyto-protective mechanism governed by the signaling pathways.

Several investigations dealt with the role of thiols. ROS are able to modify sig-naling proteins through thiol oxidation [ 76 ] . Protein thiol modifi cations can control signal transduction effectors that include protein kinases, phosphatases and tran-scription factors. Related studies involve redox regulation of thiol dependent signal-ing pathways in cancer [ 77, 78 ] .

MEK inhibitors markedly enhanced the effi cacy of histone deacetylase inhibitors to induce generation of ROS and apoptosis in certain tumor cells. [ 79 ] . Results sug-gest that ROS induced by luteolin, a fl avonoid, play a pivotal role in suppression of NF-kB and potentiation pf JNK in sensitization of cancer cells to TNF-induced apoptosis [ 80 ] . ROS promote squamous cell carcinoma by the ability to modulate intracellular signaling and to affect gene expression [ 81 ] . Both ROS and RNS acti-vated NF-kB.

Cancer may be regarded as the end result of defects in cellular signaling processes that play a key role. A report identifi es signal transduction molecules as targets for cancer prevention [ 82 ] .

The fusion gene BCR-ABL is known to activate several signaling pathways that promote cell proliferation in chronic myeloid leukemia [ 83 ] .

Exogenous Agents

The integrated approach is also applicable to a wide variety of exogenous agents.

Metals and Particulates

This class is known for toxicity and carcinogenesis as shown in the various reviews cited in the Introduction. The theme of ET-OS-ROS has enjoyed widespread mecha-nistic support. With regard to electrochemistry, the reduction potentials of heavier metals are generally in the range amenable to ET in biosystems. Metal ions infl uence

282 P. Kovacic and R. Somanathan

a variety of signaling processes [ 84 ] . Examples of metals relevant to the present approach are presented.

Numerous metals are reported as carcinogens [ 85 ] . Underlying mechanisms have been reviewed including involvement of free radicals and signaling pathways. The following articles deal with participation of ROS and signal transduction for a num-ber of carcinogenic metal compounds, including those of As [ 86– 89 ] , Cr [ 90– 92 ] , Ca [ 93, 94 ] , Cd [ 95, 96 ] , Se [ 95 ] and Ni [ 90 ] .

In relation to carcinogenesis, an important role of free radicals from fi bers is discussed, as well as modulation of genes and transcription factors caused by OS [ 97 ] . Cell signaling pathways elicited by asbestos are addressed involving stimula-tion of signaling by ROS generated via phagocytosis or redox reactions on the min-eral surface [ 98 ] . Metals also play important roles in the physiological effects of particulate matter, such as asbestos and silica as discussed in the reviews on carcino-genesis and toxicity in the Introduction. Inhalation of silica is associated with vari-ous pathologies, including cancer, infl ammation, and autoimmune disorders [ 99 ] . Several rationales have been developed in relation to toxicity, e.g., production of ROS, either directly or indirectly, triggering cell signaling pathways that initiate cytokine release and apoptosis. These processes are described as a function of receptor-mediated signaling. With murine macrophages, RNS are also generated in the initial respiratory burst. Similar results were obtained in another study in rela-tion to ROS and signaling pathways [ 100 ] .

Ultraviolet (UV) Radiation

Increased UV irradiation resulting from thinner ozone layers results in enhanced rate of skin cancer [ 101 ] . An essential signal pathway entails activation of several growth factor receptors, including that for tyrosine phosphorylation. The radiation can generate hydroxyl radicals by hemolytic cleavage with subsequent attack of DNA, and dimerization of pyrimidine bases resulting in DNA damage [ 1 ] . Protection is provided by various skin and exogeneous AOs. UV radiation is responsible for many skin pathologies, including cancer, infl ammation and photoaging [ 102 ] . These effects are associated with activation of many signal transduction pathways, e.g., MAPK and NF-kB, and also with alteration of gene expression. UV exposure also activates various receptors through the production of ROS. The role of a protoonco-gene is treated.

Hydrogen Peroxide

Cervical cancer, a common one among females, is associated with ROS and infl am-mation [ 103, 104 ] . ROS in turn affects the expression of pro- and anti- apoptotic proteins. Apoptosis by H

2 O

2 is triggered via the mitochondrial pathway involving

upregulation and downregulation of various signal pathways. An overview deals with hydrogen peroxide production and signaling actions in relation to cancer [ 105 ] .

28312 Cell Signaling and Cancer: Integrated, Fundamental Approach…

Alcohol

Alcohol metabolism in the liver can lead to cirrhosis, the common precursor of hepatic cancer [ 106 ] . The metabolism generates acetaldehyde and ROS that react readily with numerous cell targets, including components of cell signaling pathways and DNA. In the process, glutathione (GSH) is depleted. Induction of cytochrome P450 causes further free radical production. Involvement of OS has led to renewed interest in the use of AOs for prevention. The topic has been addressed in detail in a recent review [ 107 ] .

Ginkgo Biloba

Ginkgolide B, the major active component of Ginkgo biloba extracts, can both stim-ulate and inhibit apoptotic signaling in cancer cells [ 108 ] . The agent can increase the level of ROS, leading to elevations of Ca and NO and to signaling events. A model was produced for the induced cell signaling cascade in the tumor cells.

Curcumin

A report shows gene upregulation by curcumin in colon cancer cells [ 109 ] . There is involvement of GSH and sulfhydryl enzymes associated with signal transduction in mediating the effect. The gene upregulation was attenuated by GSH or N-acetylcysteine. Curcumin increased ROS, decreased GSH, and activated sulfhy-dryl enzymes involved in signal transduction linked to gene expression. The fi nd-ings suggest that a regulatory thiol redox-sensitive signaling cascade exists leading to induction of gene expression.

Endosulfan

The organochlorine insecticide is a potential carcinogen in humans, which alters MAK kinase signaling pathways and may affect cell growth and differentiation in human keratinocytes [ 110 ] . The toxicant induces ROS generation leading to sus-tained kinase phosphorylation.

Benzene

The pollutant is a leukemogen that forms metabolites capable of generating ROS [ 111 ] . Active metabolites are benzoquinone and hydroquinone which can undergo redox cycling. The toxicity may be mediated through alterations by ROS on the c-MYB signaling pathway.

284 P. Kovacic and R. Somanathan

Polycyclic Aromatic Hydrocarbons (PAHs)

PAHs are known mammary carcinogens that can mimic growth factor signaling and increase cell proliferation [ 112 ] . Quinones are metabolites that are associated with production of ROS, such as superoxide and hydrogen peroxide. Data indicate that the quinones, through the generation of ROS, activate the epidermal growth factor receptor (EGFR) leading to cell proliferation. The signaling mechanism of EGFR involves generation of hydrogen peroxide. ROS signaling often results in phospho-rylation and activation of growth factor receptor pathways.

Estrogen Quinone

The highly redox active catechol quinone metabolites affect estrogen-sensitive genes where large amounts of ROS are generated causing DNA damage [ 113 ] . A major pathway is the hormonal one by which estrogen stimulates cell prolifera-tion through receptor-mediated signaling, thus resulting in an increased risk of genomic mutations during DNA replication. Extranuclear estrogen signaling path-ways also appear to be involved.

Antioxidants

There is a large body of evidence that supports participation of ROS in the action of carcinogens [ 1 ] . Hence, it is reasonable to consider AOs as preventive agents which also appears plausible based on numerous literature reports [ 2 ] . Herein are provided additional examples, including involvement of cell signaling.

OS is increasingly associated with pathogenesis of various disorders, including cancer [ 114 ] . Fruits and vegetables have the capacity to reduce the incidence of cancer, apparently through the AO properties of constituents. However, reports sug-gest that the chemopreventive effects may also be ascribed to their ability to modu-late components of cell signaling pathways. Focus is on signal transduction mechanisms and prevention of gap junction intercellular communication. Apple peels are known to inhibit tumor cells proliferation [ 115 ] . Peel extract may prevent carcinogenesis and associated cell signaling, suggesting that the favorable effects may operate through the AO properties by blocking ROS-mediated cell signaling activation. Carnosol, a phytopolyphenol in rosemary, functions as an AO and as a chemopreventive agent against cancer [ 116 ] . The compound scavenged free radi-cals and protected DNA against oxidative attack. Carnosol inhibited NF-kB activa-tion and exhibited various infl uences on cell signaling. Oxidative stress and infl ammation are features of smoking-related disorders, such as cancer [ 117 ] . Flavonoids may be suitable prophylactic agents due to their AO properties. Thus, OS from smoking could be attenuated by the AO compounds, perhaps linked to a genetic polymorphism and modulation of complex cell signaling cascades.

28512 Cell Signaling and Cancer: Integrated, Fundamental Approach…

Blackberries are a rich source of fl avonoids which can inhibit carcinogenesis [ 118 ] . The extract is an effective scavenger of free radicals and inhibitor of 8-OH-dG for-mation. The chemopreventive effects may function through the AO properties by blocking ROS-mediated protein kinase activation. There are related reports involv-ing fl avonoids [ 103, 119– 121 ] . Other compounds in the category are the following: tocotrienol [ 122 ] and general [ 123– 130 ] . Various thiol containing AOs also play roles in prevention of toxicity. An important in vivo member is GSH which targets harmful ROS [ 131 ] . Links between the favorable AO properties of GSH and dis-eases, such as cancer, neurodegeneration, cystic fi brosis, HIV and aging have been demonstrated. Expression of enzymes involved in GSH homeostasis infl uences sus-ceptibility and progression of these conditions. The review provides an overview of the importance of GSH. N-acetylcysteine (NAC) decreases glioma cell proliferation [ 132 ] , as well as intracellular oxidants was observed. NAC also lowers Akt activity, signal-regulated kinase 1/2 are the redox-sensitive transcriptor factor NF-kB, with relationship to protein kinase C activity. There is a related study involving NAC [ 133 ] .

Superoxide, produced in proper amounts, is a normal and useful metabolite, serving important roles, e.g., as a signaling agent [ 134 ] . However, in excess, the radical anion can initiate harmful oxidation of lipids, protein, and DNA, leading to cell death. The role of SOD is to help correct this imbalance in superoxide.

Numerous studies in animals and humans demonstrate the chemopreventive effects of Se, presumably acting as an AO [ 135 ] . Evidence indicates that the methy-lated metabolite plays an important role. A mechanism is proposed entailing Se catalysis of reversible Cys/disulfi de transformations that occur in a number of redox-regulated proteins, including transcription factors. Thioredoxin reductase is a sele-noprotein that exhibits increased activity with Se supplementation. Enhanced levels of the enzyme could have benefi cial effects in lowering OS and in regulating cell signal pathways. There is another relevant report on benefi cial effects of Se [ 136 ] .

Chemotherapeutic Agents and Preventions

Because of the serious and resistant nature of the cancer problem, much research has been devoted to curative agents, including the following examples. These sub-stances can also be included into the mechanistic framework of ET-ROS-OS. One should distinguish between agents that prevent cancer and those that destroy malig-nant cells.

Aminofl avone

Aminofl avone, a novel anticancer agent, induces DNA-protein cross-links, phos-phorylation, aryl hydrocarbon receptor signaling, and apoptosis [ 137 ] . The drug caused oxidative DNA damage. The AO N-acetyl-L-cysteine attenuated the

286 P. Kovacic and R. Somanathan

cytotoxic effects. Caspase activation was brought about. Inhibition of cancer cells apparently entails ROS production, oxidative DNA damage and apoptosis.

Curcumin

Curcumin exhibits anticancer activity and triggers tumor cell apoptosis which is associated with ROS production and OS [ 138– 140 ] . Mitochondrial respiration and redox tone are pivotal determinants in the apoptosis signaling.

Radiation

Exposure of tumor cells to ionizing radiation causes DNA damage and ROS genera-tion [ 141 ] . Radiation induces ROS-dependent activation of tyrosine kinases leading to activation of multiple downstream signaling pathways. There are other related investigations [ 142, 143 ] .

Nitric Oxide

Nitric oxide generates a state of OS which affects several redox-sensitive signaling pathways, leading to the elimination of neoplastic cells via apoptosis [ 144 ] . The gas generates ROS and modulates several signaling cascades [ 78, 145 ] . Insight into mechanisms involved in ROS signaling may offer novel avenues to facilitate discov-ery of cancer-specifi c therapies [ 125 ] .

Resveratrol

Resveratrol possesses therapeutic effects for various cancers [ 146 ] . The mode of action entails the ability to control intracellular signaling cascades of protein kinase responsible for inducing apoptosis, as well as induction of ROS.

Polyphenols

Although polyphenols are reported to prevent cancer via AO action (see AO sec-tion), they are also reported to be chemotherapeutic agents [ 147 ] . The anti-tumor effects are mediated, at least in part, by protein kinases and downstream pathways of signal transduction. Apoptosis induction involves ROS, particularly hydrogen peroxide, and inactivation of the telomerase enzyme. ROS modulate the activity of regulating kinases and transcription factors.

Epigallocatechin-3-gallate, a tea phenol, suppresses cancer cell proliferation, induces apoptosis, may increase the effi cacy of chemotherapy and is involved with

28712 Cell Signaling and Cancer: Integrated, Fundamental Approach…

several signaling pathways [ 148 ] . The drug may exert cell cytotoxicity through modulating AMPK followed by decrease in COX-2 expression. ROS are an upstream signal of AMPK. As discussed elsewhere in this review, polyphenols can generate ET quinones under the appropriate conditions. A related study also involves tea polyphenols [ 149 ] . Action of classical AOs as pro-oxidants, including mechanism, has been addressed [ 107 ] .

Formaldehyde

Formaldehyde releasing prodrugs diminish the level of GSH resulting in increase of ROS followed by signaling events that lead to cancer cell death [ 150 ] . Thiols, such as GSH and N-acetlycysteine, protected cancer cells from death induced by formal-dehyde-releasing prodrugs.

Isoobtusilactone (IOA)

IOA exhibited effective cell growth inhibition by inducing cancer cells to undergo phase arrest and apoptosis [ 151 ] . Generation of ROS is a critical mediator of cell growth inhibition. Enhancement of ROS activated apoptosis signal-regulating kinase, which in turn resulted in activation of other cell signaling events. AOs sig-nifi cantly decreased apoptosis. IOA enhanced phosphorylation, triggered the mito-chondrial apoptotic pathway, and induced mitochondrial membrane potential loss.

Genipin

This aglycon of geniposide, induces apoptotic cell death in human hepatoma cells [ 152 ] . Apparently, the mode of action entails activation of the mitochondrial path-way via NADPH oxidase generated ROS and JNK dependent cell signaling.

Decursin

Decursin, an herbal pyranocoumarin, exerts a long-lasting inhibition of androgen receptor-mediated signaling which is crucial for prostate cancer development [ 153 ] . Also, there is growth arrest, apoptotic effects, and generation of ROS.

Quinoline Quinone

A quinolinequinone induced growth arrest and apoptosis of renal carcinoma cells [ 154 ] . Apoptosis occurred via dephosphorylation of kinases. Various signaling events were associated with ROS formation. Thiol AO opposed apoptosis. The quinone functionality is a well-known generator of ROS by ET.

288 P. Kovacic and R. Somanathan

Acacetin

Acacetin induces apoptosis in human breast cancer and also causes growth inhibition [ 155 ] . There was activation of caspase-7 and enhanced ROS production which was reduced by thiol AO. Induction of signaling pathways occurred. The compound is a fl avonoid which is commonly regarded as an AO. However, under the appropriate conditions, pro-oxidant effects can occur, e.g., by oxidation to quinone [ 106, 107 ] .

Berberine

Berberine displays multiple activities, including promotion of apoptosis and anti-cancer effect [ 156 ] . The drug may play a role in an apoptotic cascade in cancer cells by activation of the JNK/p38 pathway and by induction of ROS production. Phosphorylation may be involved. The alkaloid is a conjugated iminium species and a catechol ether which can serve as precursor to ET o-quinone.

PAC-1 and UCS1025A

Several recent anticancer agents, PAC-1 and UCS 1025A have attracted attention due to considerable potential based on new approaches [ 84 ] . PAC-1 activates pro-caspase-3 to caspase-3, resulting in induction of apoptosis in tumor cells. UCS1025A is an inhibitor of the enzyme telomerase, present in cancer cells, which is crucially involved in tumor cell immortality. The agents possess chelating sites for metal binding, which has not been appreciated. Complexes of heavier metals are well known ET functionalities that can generate ROS. The literature addresses involve-ment of signal transduction for the agents.

Selenium

The anticancer effect of Se is mediated by AMPK via a signaling pathway involving COX-2 [ 157 ] . ROS play a role as an AMPK activation signal in Se-treated cells. Evidence shows that Se can act both as an AO and a pro-oxidant [ 107 ] .

Earlier, it was proposed that ROS are importantly involved in the action of che-motherapeutic drugs, analogous to the mode of action of phagocytes against foreign cells [ 3, 4 ] .

Dialkyl Disulfi de (DADS)

An early event in treatment of neuroblastoma cells with DADS is an increase in ROS resulting in oxidation of lipid and protein [ 158 ] . The treatment induces JNK activation by phosphorylation. There is a pivotal role for ROS in apoptosis. DADS may be useful as an antiproliferative agent in cancer therapy.

28912 Cell Signaling and Cancer: Integrated, Fundamental Approach…

Onion

This vegetable reduces the incidence of cancer in several tissues and exerts an anticarcinogenic effect in multiple organs of animals [ 159 ] . The chemopreventive effects have been ascribed to various mechanisms: enhancement of the activity of MFOs, induction of phase II enzymes, increased synthesis of the AO GSH, and induction of cell cycle arrest and apoptosis.

SOD

Mn SOD and Cu Zn SOD are AOs that are tumor suppressive [ 160 ] . Data indicate that these AOs are regulated by the protein kinase C/ERK1/2 signaling pathway.

Phytochemicals

Many chemopreventive and chemoprotective phytochemicals enhance cellular AO capacity through activation of Nrf2 therapy-blocking carcinogenesis [ 161 ] . The transcription factor may activate gene encoding detoxifying and AO enzymes. Components of the cell signaling pathways include NF-kB and activator protein 1 (AP-1) which have been implicated in carcinogenesis, including an infl ammatory component.

References

1. Kovacic P, Jacintho JD. Mechanisms of carcinogenesis: focus on oxidative stress and electron transfer. Curr Med Chem 2001; 8: 773–796.

2. Kovacic P, Somanathan R. Mechanism of tumorigenesis: focus on oxidative stress, electron transfer and antioxidants. In: Wong DK, ed., Tumorigenesis Research Advances, Hauppauge, New York: Nova Science Publishers; 2007: 23–65.

3. Kovacic P, Becvar LE. Mode of action of anti-infective agents: emphasis on oxidative stress and electron transfer. Curr Pharmaceut Des. 2000; 6:143–167.

4. Kovacic P, Osuna JA. Mechanisms of anticancer agents: emphasis on oxidative stress and electron transfer. Curr Pharmaceut Des. 2000; 6:277–309.

5. Kovacic P, Jacintho JD. Reproductive toxins: pervasive theme of oxidative stress and electron transfer. Curr Med Chem. 2001: 8: 863–892.

6. Kovacic P, Sacman A, Wu-Weis M. Nephrotoxins: widespread role of oxidative stress and electron transfer. Curr Med Chem. 2002; 9: 823–892.

7. Poli G, Cheeseman KH, Dianzani MU, Slater TF. Free radicals in the Pathogénesis of Liver Injury, NY: Pergmon Press: 1989.

8. Kovacic P, Somanathan R. Neurotoxicity: The broad framework of electron transfer, oxida-tive stress and protection by antioxidants. Curr Med Chem-CNS Agents , 2005: 5: 249–258.

9. Kovacic P, Thurn LA. Cardiovascular toxicity from the perspective of oxidative stress, elec-tron transfer, and prevention by antioxidants. Curr Vasc Pharmacol. 2005: 3: 107–118.

10. Kovacic P, Pozos RS, Somanathan R, Shangari N, O’Brien PJ. Mechanism of mitochondrial uncouplers, inhibitors, and toxins: focus on electron transfer, free radicala, and structure-activity relationships. Curr Med Chem. 2005: 12; 2601–2623.

290 P. Kovacic and R. Somanathan

11. Kovacic P, Cooksy AL. Unifying mechanism for toxicity and addiction by abused drugs: electron transfer and reactive oxygen species. Med Hypotheses 2005; 64: 357–366.

12. Kovacic P, Somanathan R. Ototoxicity and noise trauma: electron transfer, reactive oxygen species, cell siganaling, electrical effects and protection by antioxidants; practical medical aspects. Med Hypotheses 2008; 70: 914–923.

13. Kovacic P, Somanathan R. Integrated approach to immunotoxicity: electron transfer, reactive oxygen species, antioxidants, cell signaling and receptors. J Recept Signal Transduct. 2008; 28: 323–346.

14. Halliwell B, Gutteridge JMC. Free Radicals in Biology and Medicine, NY: Oxford University Press; 1999.

15. Forman HG, Cadenas E. Oxidative Stress and Signal Transduction. Chapman and Hall, New York, 1997, pp. 1–475.

16. Hancock GT. Cell Signaling. Oxford University Press, New York, 2005, 1–296. 17. Demple B. Oxidative stress and signal transduction. In: Handbook of Cell Signaling, Bradshaw

RA, Dennis EA, Eds., Academic Press, Boston. 2004, 78, 293–307. 18. Kovacic P, Pozos RS. Cell signaling (mechanism and reproductive toxicity): redox chains,

electrons, relays, conduit, electrochemistry, and other medical implications. Birth Defect Res. Part C 2006, 78, 333–344.

19. Kovacic P. Protein electron transfer (mechanism and reproductive toxicity); iminium, hydro-gen bonding, homoconjugation, amino acid side chains, and cell signaling. Birth Defects Res. Part C 2007.

20. Cevc G. Membrane electrostatics. Biochim Biophys Acta 1990, 1031–3, 311–382. 21. Clerkin JS, Naughton R, Quiney C, Cotter TG. Mechanisms of ROS modulated cell survival

during carcinogenesis. Cancer Lett. 2008; 266: 30–36. 22. Kim E-H, Na H-K, Kim D-H, Park S-A, Kim H-N, Song N-Y, Surh Y-J. 15-Deoxy- D 12,14-

prostaglandin J2 induces COX-2 expression through Akt-driven AP-1 activation in human breast cancer cells: a potential role of ROS. Carcinogenesis 2008; 29: 688–695.

23. Klaunig JE, Kamendulis LM. The role of oxidative stress in carcinogenesis. Annu Rev Pharmacol Toxicol. 2004; 44: 239–267.

24. Maher P, Schubert D. Signaling by reactive oxygen species in the nervous system. Cell Mol Life Sci. 2000; 57: 1287–1305.

25. Matés JM, Segura JA, Alonso FJ, Mrquez J. Intracellular redox status and oxidative stress: implications for cell proliferation, apoptosis, and carcinogenesis. Arch. Toxicol. 2008; 82: 273–299.

26. Waris G, Ahsan H. Reactive oxygen species: role in the development of cancer and various chronic conditions. J Carcinogen. 2006; 5:14.

27. Galaris D, Skiada V, Barbouti A. Redox signaling and cancer : the roll of “labile” iron. Cancer Lett. 2008; 266: 21–29.

28. Trachootham D, Ogasawara MA, Nilsa RD, Huang P. Redox regulation of cell survival. Antioxid Redox Signal 2008; 10: 1343–1374.

29. Lambeth JD. Mox enzymes, ROS, and chronic disease: an example of antagonistic pleiotropy. Free Rad Biol Med. 2007; 43: 332–347.

30. Arnold RS, He J, Remo A, Ritsick D, Yin-Goen Q, Lambeth J. D, Datta MW, Young AN, Petros JA. Nox1 expression determines cellular reactive oxygen and modulates c-fos-induced growth factor, interleukin-8, and Cav-1. Am J Pathol. 2007; 171: 2021–2032.

31. Martin KR, Barrett JC. Reactive oxygen species as double-edged swords in cellular pro-cesses: low-dose cell signaling versus high-dose toxicity. Hum Exp Toxicol. 2002; 21: 71–75.

32. Pandur S, Pankiv S, Johannessen M, Moens U, Huseby NE. Gamma-glutamyltransferase is upregulated after oxidative stress through the Ras signal transduction pathway in rat colon carcinoma cells. Free Rad Res. 2007; 41: 1376–1384.

33. Song SH, Lee KH, Kang MS, Lee YJ.. Role of paxillin in metabolic oxidative stress-induced cytoskeletal reorganization: involvement of SAPK signal transduction pathway and PTO-OEST expression. Free Rad Biol Med. 2000; 29: 61–70.

29112 Cell Signaling and Cancer: Integrated, Fundamental Approach…

34. Song JJ, Lee YJ. Catalase, but not MnSOD, inhibits glucose deprivation-activated ASK1-MEK-MAPK signal transduction pathway and prevents relocalization of Daxx: hydrogen peroxide as a messenger of metabolic oxidative stress. J Cell Biochem. 2003; 90: 304–314.

35. Choi J-A, Kim E-Y, Song H, Kim C, Kim J-H.. Reactive oxygen species are generated through a BLT2-linked cascade in Ras-transformed cells. Free Rad Biol Med. 2008; 44: 624–634.

36. Wu W-S. The signal mechanism of ROS in tumor progression. Cancer Metastasis Rev. 2006; 25: 695–705.

37. Englnad K, Cotter TG. Direct oxidative modifi cations of signaling proteins in mammalian cells and their effects on apoptosis. Redox Rep. 2005; 10: 237–245.

38. Holmes-McNary M. Nuclear factor kappa B signaling in catabolic disorders. Curr. Opin Clin Metab Care 2002; 5: 255–263.

39. Janssen-Heininger YMW, Macara I, Mossman BT. Cooperativity between oxidants and tumor necrosis factor in the activation of nuclear factor (NF)-kB. Requirement of Ras/mitogen-acti-vated protein kinase in the activation of NF-kB by oxidants. Am J Respir Cell Mol Biol. 1999; 20: 942–952.

40. Wang Y, Huang X, Cang H, Gao F, Yamamoto T, Osaki T, Yi J.. The endogenous reactive species promote NF-kB activation by targeting on activation of NF-kB-inducing kinase in oral squamous carcinoma cells. Free Rad Res. 2007; 41: 963–971.

41. Gopalakrishna R, Jaken S. Protein kinase C signaling and oxidative stress. Free Rad Biol Med. 2000; 28: 1349–1361.

42. Gibson BW. The human mitochondrial proteome: oxidative stress, protein modifi cations and oxidative phosphorylation. Int Biochem Cell Biol. 2005; 37: 927–934.

43. Herrera B, Álvarez AM, Sánxhez A, Fernández M, Roncero C, Benito M, Fabregat I.. Reactive oxygen species (ROS) mediates the mitochondrial-dependent apoptosis induced by trans-forming growth factor b in fetal hepatocytes. FASEB J. 2001;15: 741–751.

44. Lluis JM, Buricchi F, Chiarugi P, Morales A, Fernandez-Checa JC. Dual role of mitochon-drial reactive oxygen species in hypoxia signaling: activation of nuclear factor-kB via c-SRC-and oxidant-dependent cell death. Cancer Res. 2007; 67: 7368–7377.

45. Thannickal VJ, Fanburg BL. Reactive oxygen species in cell signaling. Am J Physiol Lung Cell Mol Physiol. 2000; 279: L1005-L1028.

46. Svineng G, Ravuri C, Rikardsen O, Huseby N-K, Winberg J-O. The role of reactive oxygen species in integrin and matrix metalloproteinase expression and function. Connect Tissue Res. 2008; 49: 197–202.

47. Na A. R, Chung Y. M, Lee S. B, Park S. H, Lee M-S, Yoo Y. D. A critical role of Romo1-derived ROS in cell proliferation. Biochem Biophy Res Commun. 2008; 369: 672–678.

48. Meng T-C, Chen Y-Y. Insights into cysteine oxidation of protein tyrosine phosphatases that involves regulation of signal transduction and development of human diseases. Protein Oxid Dis. 2008; 55–71.

49. Meng T-C, Lou Y-W, Chen Y-Y, Hsu S-F, Huang Y-F. Cys-oxidation of protein tyrosine phos-phatases; its role in regulation of signal transduction and its involvement in human cancer. J Cancer Mol. 2006; 2: 9–16.

50. Park I-J, Hwang J-T, Kim Y. M, Ha J, Park O. J. Differential modulation of AMPK signaling pathways by low or high levels of exogenous reactive oxygen species in colon cancer cells. Ann New York Acad Sci. 2006; 1091(Part B): 102–109.

51. Cho S. O, Kim K. H, Yoon J-H, Kim H. Signaling for integrin a 5/ b 1 expression in Heliobacter pylori-infected gastric epithelial AGS cells. Ann New York Acad Sci. 2006; 1090: 298–304.

52. Handa O, Naito Y, Yoshikawa T. CagA protein of Helicobacter pylori; a hijacker of gastric epithelial cell signaling. Biochem Pharmacol. 2007; 73: 1697–1702.

53. Kim MH, Yoo H. S, Kim M. Y, Jang H. J, Baek M. K, Kim H. R, Kim K. K, Shin B. A, Ahn B. W, Jung Y. D. Helicobacter pylori stimulate urokinase plasminogen activator receptor expression and cell invasiveness through reactive oxygen species and NF-kB signaling in human gastric carcinoma cells. Int J Mol Med. 2007; 19: 689–697.

54. Kumar B, Koul S, Khandrika L, Meacham R. B, Koul H. K. Oxidative stress is inherent in pros-tate cancer cells and is required for aggressive phenotype. Cancer Res. 2008; 68: 1777–1785.

292 P. Kovacic and R. Somanathan

55. Roberts R. A, Ganey P. E, Ju C, Kamendulis I, Rusyn I, Klaunig J. E. Role of the Kupffer cell in mediating hepatic toxicity and carcinogenesis. Toxicol Sci. 2007; 96: 2–15.

56. Mossman B. T, Lounsbury K. M, Reddy S. P. Oxidants and signaling by mitogen-activated protein kinase in lung epithelium. Am J Respir Cell Biol. 2006; 34: 666–669.

57. Sawai H, Funahashi H, Okada Y, Matsu Y, Sakamoto M, Yamamoto M, Takeyama H, Manabe T. Imterleukin-1 a enhances IL-secretion through p38 mitogen-activated protein kinase and reactive oxygen species signaling in human pancreatic cancer cells. Med Sci Moni. 2005; 11: BR343-BR350.

58. Duran A, Linares JF, Galvez AS, Wikenheiser K, Flores JM, Diaz-Meco MT, Moscat J. The signaling adaptor p62 is an important NF-kB mediator in tumorigenesis. Cancer Cell 2008; 13: 343–354.

59. Xia C, Meng Q, Liu L-Z, Rojanasakul Y, Wang X-R, Jiang B-H. Reactive oxygen species regulate angiogenesis and tumor growth through vascular endothelial growth factor. Cancer Res. 2007; 67: 10823–10830.

60. Ventura J-J, Cogswell P, Flavell RA, Baldwin AS. JNK potentiates TNF-stimulated necrosis by increasing the production of cytotoxic reactive oxygen species. Genes Develop. 2004; 18: 2905–2915.

61. Boudreau RT, Conrad DM, Hoskin DW. Differential involvement of reactive oxygen species in apoptosis caused by the inhibition of protein phosphatase 2A in Jurkat and CCRF-CEM human T-leukemia cells. Exp Mol Pathol. 2007; 83: 347–356.

62. Wu W-S, Tsai RK, Chang CH, Wang S, Wu J-R, Chang Y-X. Reactive oxygen species medi-ated sustained activation of protein kinase C a and extracellular signal-regulated kinase for migration of human hepotoma cell Hepg2. Mol Cancer Res. 2006; 4: 747–758.

63. Lee JK, Edderkaoui M, Truong P, Ohno I, Jang K-T, Berti A, Pandol SJ, Gukovskaya AS. NADPH oxidase promotes pancreatic cancer cell survival via JAK2 dephosphorylation by tyrosine phosphatases. Gastroenterology 2007; 133: 1637–1648.

64. Song S, Guha S, Liu K, Buttar N, Bresalier RS. COX-2 induction by unconjugated bile acids involves reactive oxygen species-mediated signaling pathways in Barrett’s oesophagus and oesophagaeal adenocarcinoma. Gut 2007; 56: 1512–1527.

65. Jung S-N, Yang WK, Kim J, Kim HS, Kim EJ, Yun H, Park H, Kim SO, Choe W, Kang I, Ha J. Reactive oxygen species stabilize hypoxia-inducible factor-1 alpha protein and stimulate transcriptional activity via AMP-activated protein kinase in DU145 human prostate cancer cells. Carcinogenesis 2008; 29: 713–721.

66. Cesaratto L, Calligaris SD, Vascotto C, Deganuto M, Bellarosa C, Quadrifoglio F, Ostrow JD, Tiribelli C, Tell G. Bilirubin-induced cell toxicity involves PTEN activation through an APE1/ref-1-dependent pathway. J Mol Med. 2007; 85: 1099–1112.

67. Chang C-J, Mulholland DJ, Valamehr B, Mosessian S, Sellers WR, Wu H. PTEN nuclear localization is regulated by oxidative stress and mediates p53-dependent tumor suppression. Mol Cell Biol. 2008; 28: 3281–3289.

68. Djavaheri-Mergny M, Amelotti M, Mathieu J, Besancon F, Bauvy C, Codogno P. Regulation of autophagy by NFkB transcription factor and reactive oxygen species. Autophagy 2007; 3: 390–392.

69. Blanchetot C, Boonstra J. The ROS-NOX connection in cancer and angiogenesis. Crit Rev Eukary Gene Expr. 2008; 18: 34–45.

70. Shinohara M, Shang W-H, Kubodera M, Harada S, Mitsushita J, Kato M, Miyazaki H, Sumimoto H, Kamata T. Nox1 redox signaling mediates oncogenic Ras-induced disruption of stress fi bers and focal adhesions by down-regulating Rho. J Biol Biochem. 2007; 282: 17640–17648.

71. Galanis A, Pappa A, Giannakakis A, Lantis E, Dangaj D, Sandaltzopoulos R. Reactive oxy-gen species and HIF-1 signaling in cancer. Cancer Lett. 2008; 266: 12–20.

72. Henderson BW, Daroqui C, Tracy E, Vaughan LA, Loewen GM, Cooper MT, Baumann H. Cross-linking of signal transducer and activator of transcription 3-A molecular marker for photodynamic reaction in cells and tumors. Clin Cancer Res. 2007; 13: 3156–3163.

29312 Cell Signaling and Cancer: Integrated, Fundamental Approach…

73. Buytaert E, Dewaele M, Agostinis P. Molecular effectors of multiple cell death pathways initiated by photodynamic therapy. Biochim Biophys Acta, Review on Cancer 2007; 1776: 86–107.

74. Weyergang A, Kaalhus O, Berg K. Photodynamic therapy with an endocytically located pho-tosensitizer cause a rapid activation of the mitogen-activated protein kinase extracellular sig-nal-regulated kinase, p38, and c-Jun NH2 terminal kinase with opposing effects on cell survival. Mol Cancer Therapeut. 2008; 7: 1740–1750.

75. Kocanova S, Buytaert E, Matroule J-Y, Piette J, Golab J, de Witte P, Agostine P. Induction of heme-oxygenase 1 requires the p38MAPK and PI3K pathways and suppresses apoptotic cell death following hypericin-mediated photodynamic therapy. Apoptosis 2007; 12: 731–741.

76. Cross JV, Templeton DJ. Regulation of signal transduction through protein cysteine oxida-tion. Antioxid Redox Signal. 2006; 8: 1819–1827.

77. Davis W, Ronai Z, Tew KD. Cellular thiols and reactive oxygen species in drug-induced apoptosis. J Pharmcol Exp Therapeut. 2001; 296: 1–6.

78. Giles GI. The redox regulation of thiol dependent signaling pathways in cancer. Curr Pharm Des. 2006; 12: 4427–4443.

79. Ozaki K-I. Targeted molecular strategies for cancer therapy based on the blockade of onco-genic pathways in human tumor cells. Yakugaku Zasshi 2007; 127: 983–991.

80. Ju W, Wang X, Shi H, Chen W, Belinsky SA, Lin Y. A critical role of luteolin-induced reac-tive oxygen species in blockage of tumor necrosis factor-activated nuclear factor-kB pathway and sensitization of apoptosis in lung cancer cells. Mol Pharmacol. 2007; 71: 1381–1388.

81. Bradburn JE, Pei P, Kresty LA, Lang JC, Yates AJ, McCormick AP, Mallery SR. The effects of reactive oxygen species on the tumorigenic phenotype of human head and neck squamous cell carcinoma (HNSCC) cells. Anticancer Res. 2007; 27: 3819–3829.

82. Bode AM, Dong Z. Signal transduction molecules as targets for cancer prevention. Sci Signal. 2009; 2: mr2.

83. Wan Y, Li B, BCR-ABL. BCR-ABL in hematopoietic stem cell renewal and chronic myeloid leukemia. In:Wong, DK, ed. Tumorigenesis Research Advances. Hauppauge, New York, Nova Science Publ. 2007. 159–178.

84. Kovacic P. Does structural commonality of metal complex formation by Pac-1 (anticancer), DHBNH (anti-HIV), AHL (autoinducer), and UCS1025A (anticancer) denote mechanistic simi-larity? Signal transduction and medical aspects. J Recept Signal Transd. 2008; 28: 141–152.

85. Leonard SS, Bower JJ, Shi X. Metal-induced toxicity, carcinogenesis, mechanisms and cel-lular responses. Mol Cell Biochem 2004; 255: 3–10.

86. Chen Y, Yang J, Hu Q, Guo Q, Yi J. Emodin-enhanced arsenic-induced apoptosis on esopha-geal tumor cells. Shanghai Jiaotong Daxue Yixueban 2006; 26: 1227–1232.

87. Kim DW, Ahan SH, Kim TY. Enhancement of arsenic trioxide (As 2 O 3 )-mediated apoptosis

using berberine in human neuroblastoma SH-SY5Y cells. J Korean Neurosurg Soc. 2007; 42: 392–399.

88. Rodríguez-Gabriel MA, Russell P. Distinct signaling pathway to arsenite and reactive oxygen species in Schzosacchromyces pombe . Eukary Cell 2005; 4: 1396–1402.

89. Zhou J, Ye J, Zhao X, Li A, Zhou J. JWA is required for arsenic trioxide induced apoptosis in HeLa and MCF-7 cells via reactive oxygen species and mitochondria linked signal pathway. Toxicol App Pharmacol. 2008; 230: 33–40.

90. Barchowsky A, O’Hara KA. Metal-induced cell signaling and gene activation in lung dis-eases. Free Radic Biol Med. 2003; 34: 1130–1135.

91. Wang S, Leonard SS, Ye J, Ding M, Shi X. The role of hydroxyl radical as a messenger in Cr(VI)-induced p53 activation. Am J Physiol Cell Physiol. 2000; 279: C868-C875.

92. Ye J, Wang S, Leonard SS, Sun Y, Butterworth L, Antonini J, Ding M, Rojanasakul Y, Vallyathan V, Castranova V, Shi X. role of reactive oxygen species and p53 in chromium(VI)-induced apoptosis. J Biol Chem. 1999; 274: 34974–34980.

93. Benedyk M, Sopalla C, Nacken W, Bode G, Melkonyan H, Banfi B, Kerkhoff C. HaCaT keratinocytes overexpressing the S100 proteins S100A8 and Sa00A9 show increased NADPH oxidase and NF-kB activities. J Invest Dermatol. 2007; 127: 2001–2011.

294 P. Kovacic and R. Somanathan

94. Lee J-H, Li Y-C, Ip S-W, Hsu S-C, Chang N-W, Tang N-Y, Yu C-S, Chou S-T, Lin SS, Lin C-C, Yang J-S, Chung J-G. The role of Ca2+ in baicalein-induced apoptosis in human MDA-MB-231 cancer cells through mitochondria and caspase-3-dependent pathway. Anticancer Res. 2008; 28: 1701–1711.

95. He X, Chen MG, Ma Q. Activation of Nrif2 in defense against cadmium-induced oxidative stress. Chem Res Toxicol. 2008; 21: 1375–1383.

96. Waisberg M, Joseph P, Hale B, Beyersmann D. Molecular and cellular mechanisms of cad-mium carcinogenesis. Toxicol. 2003; 192: 95–117.

97. Bhattacharya K, Alink G, Dopp E. Oxidative stress and changed gene expression profi les in fi ber-/particle-induced carcinogenesis. Int J Hum Genet. 2007; 7: 1–21.

98. Mossman BT, Faux S, Janssen Y, Jimenez, LA, Timblin C, Zanella C, Goldberg E, Walsh E, Barchowsky A, Driscoll K. Cell signaling pathways elicited by asbestos. Environ Health Perspect. 1997; 105: 1121–1125.

99. Hamilton RF, Thakur SA, Holian A. Silica binding and toxicity in alveolar macrophage. Free Radic Biol Med. 2008; 44: 1246–1258.

100. Castranova V. Signaling pathways controlling the production of infl ammatory mediators in response to crystalline silica exposure: role of reactive oxygen/nitrogen species. Free Rad Biol Med. 2004; 37: 916–925.

101. Huang R-P, Wu J-X, fan Y, Adamson ED. UV activates growth factor receptors via reactive oxygen intermediates. J Cell Biol. 1996; 133: 211–220.

102. Madson JG, Hansen LA. Multiple mechanisms of Erbb2 activation after ultraviolet irradiation of the skin. Molec Carc. 2007; 46: 624–628.

103. Singh S, Malik B K, Sharma DK. Protein kinase C in prostate cancer and herbal products: a bioinformatics approach. Inten J Integrat Biol. 2007; 1: 71–87.

104. Singh M, Sharma H, Singh N. Hydrogen peroxide induces apoptosis in HeLa cells through a mitochondrial pathway. Mitochondrion 2007; 7: 367–373.

105. Ree SG. Cell signaling: H 2 O 2 , a necessary evil for cell signaling. Science 2007; 312:

1882–1883. 106. Kovacic P, Somanathan R. Alcohol mechanisms, Cell Signaling, Toxicity, Addiction,

Prevention, Therapy and Benefi cial Effects. In: Brozner EY. Ed. New research on Alcohol Abuse and Alcoholism. NY: Nova Science Publishers Inc., 2006: 40–101.

107. Kovacic P, Somanathan R. Benefi cial Effects of Antioxidants in Relation to Carcinogens, Toxins and Various Illnesses In: Panglossi HV ed. Antioxidants: New Research. NY Nova Science Publishers Inc. 2006: 1–37 .

108. Chan W-H. The signaling cascade of ginkgolide B-induced apoptosis in MCF-7 breast cancer cells. Int J Mol Sci. 2007; 8: 1177–1195.

109. Scott DW, Loo G. Curcumin-induced GADD153 upregulation: modulation by glutathione. J Cell Biochem. 2007; 101: 307–320.

110. Antherieu S, Ledirac N, Luzy A-P, Lenormand P, Caron J-C, Rahmani R. Endosulfan decreases cell growth and apoptosis in human HaCaT keratinocytes; partial ROS-dependent ERK1/2 mechanism. J Cellular Physiol. 2007; 213: 177–186.

111. Wan J, Winn LM. Benzene’s metabolites alter c-MYB activity via reactive oxygen species in HD3 cells. Toxicol Appl Pharmacol. 2007; 222: 180–189.

112. Burdick AD, Davis JW, Liu KJ, Hudson LG, Shi H, Monske ML, Burchiel SW. Benzo(a)pyrene quinones increase cell proliferation, generate reactive oxygen species, and transactivate the epidermal growth factor receptor in breast epithelial cells. Cancer Res. 2003; 63: 7825–7833.

113. Bolton JL, Thatcher GRJ. Potential mechanisms of estrogen quinone carcinogenesis. Chem Res Toxicol. 2008; 21: 93–101.

114. Soobrattee MA, Bahorun T, Aruoma OI. Chemopreventive actions of polyphenolic com-pounds in cancer. Biofactors 2006; 27: 19–35.

115. Ding M, Lu Y, Bowman L, Huang C, Leonard S, Wang L, Vallyathan V, Castranova V, Shi X.. Inhibition of AO-1 and neoplastic transformation by fresh apple peel extract. J Biol Chem. 2004; 279: 10670–10676.

29512 Cell Signaling and Cancer: Integrated, Fundamental Approach…

116. Lo A-H, Liang Y-C, Lin-Shiau S-Y, Ho C-T, Lin J-K. Carnosol, an antioxidant in rosemary, suppresses inducible nitric oxide synthase through down-regulating nuclear factor-[kapp] b in mouse macrophages. Carcinogenesis 2002; 23: 983–991.

117. Aruoma OI, Kang K-S, Bahorun T, Sung M-K, Rahman I. Oxidative damage and chronic infl ammation induced by smoking; potential antioxidant and peripheral biomarker consider-ations. Cancer Prevent Res. 2005; 10: 149–158.

118. Feng R, Bowman LL, Lu Y, Leonard SS, Shi X, Jiang BH, Castronova V, Vallyathan V, Ding M. Blacberry extracts inhibit activating protein 1 activation and cell transformation by per-turbing the mitogenic signaling pathway. Nutr Cancer 2004; 50: 80–89.

119. Ahamed N, Gali H, Javed S, Agarwal R. Skin cancer chemopreventive effects of a fl avonoid antioxidant silymarin are mediated via impairment of receptor tyrosine kinase signaling and perturbation in cell cycle progression. Biochem Biophys Res Commun. 1998; 247: 294–301.

120. McLoughlin P, Roengvoraphoj M, Gissel C, Hescheler J, Certa U, Sachinidis A.. Transcriptional response to epigallocatechins-3 gallate in HT 29 colon carcinoma spheroids. Genes Cells 2004; 9: 661–669.

121. Sarkar FH. The role of isofl avones in cancer chemoprevention. Front Biosci. 2004; 9: 2714–2724.

122. Shibata A, Nakagawa K, Sookwong P, Tsuzuki T, Oikawa S, Miyazawa T.Tumor anti-angio-genic effect and mechanism of action of d -tocotrienol. Biochem. Pharmacol. 2008; 76: 330–339.

123. Cerimele F, Battle T, Lynch R, Frank DA, Murad E, Cohen C, Macaron N, Sixbey J, Smith K, Watnik RS, Ellopoulos A, Shehata B, Arbiser JL.. Reactive oxygen signaling and MAPK activation distinguish Epstein-Barr virus (EBV)-positive versus EBV-negative Burkitt’s lym-phoma. PNAS 2005; 102: 175–179.

124. Eskin NAM, Bird R. Antioxidants and cancer therapy: to take or not to take: that is the ques-tion? ACS Symposium Series 2007; 956 (Antioxidant Measurement and Application): 8–14.

125. Fruehauf, J. P., Meyskens, F. L. Reactive oxygen species: a breath of life or death? Clin Cancer Res. 2007; 13, 789–794.

126. Hensley K, Robinson KA, Gabbita SP, Salsman S, Floyd R A. Reactive oxygen species, cell signaling, and cell injury. Free Rad Biol Med. 2000; 28: 1456–1462.

127. Nair S, Wenge K, Ah-Ng T. Natural dietary anti-cancer chemopreventive compounds: redox-mediated differential signaling mechanisms in cytoprotection of normal cells versus cytotox-icity in tumor cells. Acta Pharmacol Sinica 2007; 28: 459–472.

128. Palović D, Dordevic V, Kocić GA. “Cross-talk” between oxidative stress and redox cell sig-naling. Med Biol. 2002; 9: 131–137.

129. Valko M, Leibfritz D, Moncol J, Cronin MT, Mazur M, Telser J.. Free radicals and antioxi-dants in normal physiological functions and human disease. Int J Biochem Cell Biol. 2007; 39: 44–84.

130. Valko M, Rhodes CJ, Moncol J, Izakovic M, Mazur M. Free radicals, metals and antioxidants in oxidative stress-induced cancer. Chem Biol Interact. 2006; 160: 1–40.

131. Townsend DM, Tew KD, Tapiero H. The importance of glutathione in human disease. Biomed Pharmacother 2003; 57: 145–155.

132. Martin V, Herrera F, Garcia-Santos G, Antolin I, Rodriguez-Blanco J, Rodriguez C. Signaling pathways involved in antioxidant control of glioma cell proliferation. Free Rad Biol Med. 2007; 42: 1715–1722.

133. Wu S-J, Ng LT, Lin C-C. Effects of antioxidants and caspase-3 inhibitor on the phenylethyl isothiocyanate-induced apoptic signaling pathways in human PLC/PRF/cells. Eur J Pharmacol. 2005; 518: 96–106.

134. McCord JM. SOD, oxidative stress and human pathologies: a brief history and future vision. Biomed Pharmacother. 2005; 59: 139–142.

135. Ganther HE. Selenium metabolism, selenoproteins and mechanism of cancer prevention: complexities with thioredoxin reductase. Carcinogenesis 1999; 20: 1657–1666.

296 P. Kovacic and R. Somanathan

136. Verma A, Atten BM, Holian O. Selenomethionine stimulates MAPK (ERK) phosphorylation, protein oxidation, and DNA synthesis in gastric cancer cells. Nutr Cancer 2004; 49: 184–190.

137. McLean L, Soto U, Agama K, Francis J, Jimenez R, Pommier Y, Sowers L, Brantley E. Aminofl avin induces oxidative DNA damage and reactive oxidative species-mediated apop-tosis in breast cancer. Int J Cancer 2008; 122: 1665–1674.

138. Chathoth S, Thayyullathil F, Galadari S. Curcumin cell signaling: a possible target for chemo-therapy. Curr Trends Biotech Pharmacy 2008; 2: 226–238.

139. Jawadi P, Segan AT, Tuttle SW, Koumenis C. The chemopreventive agent cucumin is a potent radiosensitizer of human cervical tumor cells via increased reactive oxygen species produc-tion and over activation of the mitogen-activated protein kinase pathway. Mol Pharmacol. 2008; 73: 1491–1501.

140. Numsen H. Mitochondrial reactive oxygen species affect sensitivity to curcumin-induced apoptosis. Free Rad Biol Med. 2008; 44: 1382–1393.

141. Valerie K, Yacoub A, Hagan MP, Curiel DT, Fisher PB, Grant S, Dent P. Radiation-induced cell signaling: inside-out and outside-in. Mol Cancer Ther. 2007; 6: 789–801.

142. Bauer G, Abteilung V. Low dose radiation and intercellular induction of apoptosis: potential implications for the control of oncogenesis. Int J Rad Biol. 2007; 83: 873–888.

143. Shao C, Folkard M, Held KD, Prise KM.. Estrogen enhanced cell-cell signaling in breast cancer exposed to targeted irradiation. BMC Cancer 2008; 8: 184.

144. Rigas B, Sun Y. Induction of oxidative stress as a mechanism of action of chemopreventive agents against cancer. Brit J Cancer 2008; 98: 1157–1160.

145. Rigas B, Williams JL. NO-donating NSAIDs and cancer: overview with a note on whether NO is required for their action. Nitric Oxide 2008; 19: 199–204.

146. Hwang J-T, Dong W, Lin SK, Kim HM, Kim YM, Park OJ. Resveratrol induces apoptosis in chemoresistant cancer cells via modulation of AMPK signaling pathway. Ann New York Acad Sci. 2007; 1095: 441–448.

147. Al-Ayyoubi S, Gali-Muhtasib H. Anti-tumor signaling pathways modulated by plant poly-phenols.In: Valentine RG, ed. New Cell Apoptosis Research. Hauppauge, N. Y: Nova Science Publishers; 2007: 85–105.

148. Hwang J-T, Ha J, Park I-J, Lee S-K, Baik HW, Youg M, Park OJ. Apoptotic effect of EGCG in HT-colon cancer cells via AMPK signal pathway. Cancer Lett. 2007; 247: 115–121.

149. Halder B, Bhattacharya U, Mukhpadhyay S, Giri AK. Molecular mechanism of black tea polyphenols induced apoptosis in human skin cancer cells: involvement of bax translocation and mitochondria mediated death cascade. Carcinogenesis 2008; 29: 129–138.

150. Levovich I, Nudelman A, Berkovitch G, Swift LP, Cutts SM, Phillips DR, Rephaeli A. Formaldehyde-releasing prodrugs specifi cally affect cells by depletion of intracellular gluta-thione and augmentation of reactive oxygen species. Cancer Chemo Phamacol. 2008; 62: 471–482.

151. Kuo P-L, Chen C-Y, Hsu Y-L. Isoobtusilactone A induces cell cycle arrest and apoptosis through reactive oxygen species/apoptosis signal-regulating kinase 1 signal pathway in human breast cancer cells. Cancer Res. 2007; 67: 7406–7420.

152. Hong H-Y, Kim B-C. Mixed lineage kinase 3 connects reactive oxygen species to c-Jun NH2-terminal kinase-induced mitochondrial apoptosis in genipin-treated prostate cancer cells. Biochem Biophys Res Commun. 2007; 362: 307–312.

153. Guo J, Jiang C, wang Z, Lee H-J, Hu H, Malewicz B, lee H-J, Lee J-H, Baek N-I, Jeong J-H, Kim D-K, Kang K-S, Kim, S-H, Lu J. A novel class of pyranocoumarin anti-androgen receptor signaling compounds. Mol Cancer Therap. 2007; 6: 907–917.

154. Ambrose M, Ryan A, O’Sullivan GC, Dunne, C, Barry OP. Induction of apoptosis in renal cell carcinoma by reactive oxygen species: involvement of extracellular signal-regulated kinase ½, p38 d / g , cyclooxygenase-2-down-regulation, and translocation of apoptosis-inducing factor. Mol Pharmacol. 2006; 69: 1879–1890.

155. Shim H-Y, Park J-H, Paik H-D, Nah S-Y, Kim DSHL, Han YS. Acacetin-induced apoptosis of human cancer MCF-7 cells involves caspase cascade, mitochondria-mediated death signal-ing and SAPK/JNK1/2-cjun activation. Mol Cells 2007; 24: 95–104.

29712 Cell Signaling and Cancer: Integrated, Fundamental Approach…

156. Hsu W-H, Hsieh Y-S, Kuo H-C, Teng C-Y, Huang H-I, Wang C-J, Yang S-F, Liou Y-S, Kuo W-H. Berberine induces apoptosis in SW620 human colonic cells through generation of reac-tive oxygen species and activation of JNK/p38 MAPK and FasL. Arch Toxicol. 2007; 81:719–728.

157. Hwang J-T, Kim YM, Surh Y-J, Baik HW, Lee S-K, Ha, J, Park OJ. Selenium regulates cyclooxygenase-2 and extracellular signal-regulated kinase signaling pathways by activating AMP-activated protein kinase in colon cancer cells. Cancer Res. 2006; 66: 10057–10063.

158. Filmeni G, Aquilano K, Rotillo G, Ciriolo MR. Reactive oxygen species-dependent c-Jun NH

2 -terminal kinase/c-jun signaling cascade mediates neuroblastoma cell death induces by

diallyl disulfi de. Cancer Res. 2003; 63; 5940–5949. 159. Wu X-J, Stahl T, Hu Y, Kassie F, Mersch-Sundermann V. The production of reactive oxygen

species and the mitochondrial membrane potential are modulated during onion oil-induced cell cycle arrest and apoptosis in A549 cells. J Nutr. 2006; 136: 608–613.

160. Kim C, Hee H, Song L, Lee SY, Youk HS, Moon JY, Duong HQ, Park MJ, Joo YM, Park HG, Kim YJ, Yoo MA, Lim S-C, Kang HS. Protein kinase c-ERK1/2 signal pathway switches glucose depletion-induced necrosis to apoptosis by regulating superoxide dismutase and sup-pressing reactive oxygen species production in A549 lung cancer cells. J Cellular Physiol. 2007; 211: 371–385.

161. Sur YJ, Na HK, Lee JS. Redox-sensitive transcription factors as prime targets for chemopre-vention with anti-infl ammatory and antioxidative phytochemicals. J Nutr. 2005; 135: 2993S–3001S.

299M. Chatterjee and K. Kashfi (eds.), Cell Signaling & Molecular Targets in Cancer, DOI 10.1007/978-1-4614-0730-0_13, © Springer Science+Business Media, LLC 2012

Introduction

In the 1980s, studies of the mechanism of action of cytokines, their corresponding receptors, and the effects of activated receptors on intracellular molecules identifi ed a series of intracellular pathways responsible for activation of gene transcription. One of the fi rst pathways studied in detail was the pathway activated by interferons (IFNs). These elaborate studies of IFN signaling led to the discovery of the signal transducer and activator of transcription (STAT) molecule [ 1– 3 ] .

STATs are latent cytoplasmic transcription factors. They are activated by tyrosine phosphorylation, dimerize, and translocate to the nucleus where they bind to DNA and act as transcription factors activating gene expression [ 4 ] . Their dual role as both transducers of cell signaling and activators of transcription inspired their name [ 3 ] . STATs are vital molecules in the transduction of almost all growth factors and cytokine signaling, having important roles in hematopoiesis, immunology, and tumor biology [ 5– 7 ] . Today, it is well known that STAT molecules play an impor-tant role in cancer biology, being constitutively activated in different cancer types [ 8– 13 ] . Because STATs play a key role in cancer biology, several investigators have been developing compounds capable of inhibiting STATs and/or their signaling pathways.

Z. Estrov (*) Department of Leukemia , The University of Texas, Anderson Cancer Center , 1515 Holcombe Boulevard, Unit 0428 , Houston , TX 77030, USA e-mail: zestrov@mdanderson.org

Chapter 13 Targeting Signal Transducer and Activator of Transcription (STAT) for Anticancer Therapy*

Fabio P.S. Santos , Inbal Hazan-Halevy , and Zeev Estrov

* Confl icts of interest: none to declare.

300 F.P.S. Santos et al.

Structure and Function of STATs

STAT Activation–Inactivation Cycle

A classical pathway for STAT activation–inactivation has been described, even though there are many variations to this scheme [ 3, 14 ] (Fig. 13.1 ). STAT molecules exist in a monomeric, latent state in the cytoplasm. In order to be activated, they need to be phosphorylated on a tyrosine residue located in the C-terminal portion of the protein. Once the STAT monomers are phosphorylated, they form dimers by means of a reciprocal interaction between the phosphorylated tyrosine residue and the Src-homology 2 (SH2) domain of each molecule. The activated dimer translo-cates to the nucleus, where it binds to specifi c DNA sequences in the promoter of target genes according to the type of dimer that was formed.

Fig. 13.1 STAT activation pathways. STATs are tyrosine phosphorylated, dimerize through recip-rocal association of the phosphotyrosine residue with the SH2 domain, and translocate to the nucleus where they bind to DNA and increase transcription of target genes. Several kinases are responsible for tyrosine phosphorylation of STATs, including non-receptor tyrosine kinases (Jaks [which can be bound to cytokine receptors or G-protein receptors] and Src) and receptor tyrosine kinases (such as EGFR and PDGFR a / b )

30113 Targeting Stats in Cancer

Table 13.1 Mouse knockout gene models

STAT Knockout phenotype References

STAT1 • Viable [ 50, 52, 53 ] • Increased risk of bacterial and viral infections • Increased risk of tumors • Diminished response to IFN type I and type II

STAT2 • Viable [ 60 ] • Increased risk of bacterial infections • Diminished response to IFN type I

STAT3 • Embryonically lethal [ 71– 78 , 177– 191 ] • Conditional knockout revealed:

° Impaired cell survival ° Impairment of wound healing and keratinocyte

migration ° Thymus hypoplasia ° Diminished T-lymphocyte survival ° Increase in granulocytes ° Enhanced infl ammatory responses to pathogens,

leading to chronic colitis ° Impaired breast development ° Impaired neuronal migration ° Heart: decrease in resistance to infl ammation and

increase in fi brosis ° Multiple other effects

STAT4 • Viable [ 84, 85 ] • Diminished Th1 CD4 + T-lymphocyte polarization • Diminished risk of autoimmune disorders • Increased risk of intracellular bacterial infections

STAT5a/b • Viable [ 94– 97, 99– 101 ] • Impaired development of mammary gland (STAT5a) • Impaired growth (mSTAT5b) • Diminished T-lymphocyte survival • Diminished responsiveness to EPO • Diminished stem cell repopulation ability

STAT6 • Viable [ 106, 107 ] • Diminished Th2 CD4 + T-lymphocyte polarization • B-lymphocytes cannot class-switch and produce IgE

STAT Function

As multifaceted regulators of transcription, with many different activation path-ways, it is no wonder that STATs perform a myriad of functions in diverse tissues. Mouse knockout models of STAT genes provide insight into the primary roles of these proteins (Table 13.1 ).

302 F.P.S. Santos et al.

STAT Phosphorylation and Activation

In order to be activated, STATs need to be phosphorylated on a tyrosine residue located in the TAD (~position 700) (Table 13.2 , Figs. 13.1 and 13.2 ). Upon phos-phorylation on tyrosine residues, two STAT molecules dimerize, forming homodim-ers or heterodimers [ 3, 14 ] . All STATs (with the exception of STAT2) can form homodimers, and STAT1/STAT2 and STAT1/STAT3 can form heterodimers.

STATs can be phosphorylated on tyrosine residues by several mechanisms (Fig. 13.1 ). The first one to be described was the cytokine receptor pathway [ 3 ] . Cytokine receptors usually do not have intrinsic tyrosine kinase (TK) activ-ity. They associate with Jaks, which are cytoplasmic TKs first described in 1989 [ 15 ] . There are four members of the Jak family: Jak1, Jak2, Jak3, and Tyk [ 16 ] . Jaks bind to the cytoplasmic portion of cytokine receptors. Once the cytokine binds to its receptor, it induces dimerization or oligomerization of the receptor complex. This approximates the Jak kinases bound to each receptor chain and allows for transphosphorylation and activation of each Jak kinase. Once activated, the Jak kinase phosphorylates the receptor chain. This allows

Table 13.2 STAT subtypes – gene locus and phosphorylation residues

STAT Gene locus

Phosphorylation site

References Tyrosine Serine

STAT1 2q32.2-q32.3 701 727 [ 47, 48 ] STAT2 12q13.2 690 – [ 58 ] STAT3 17q21 705 727 [ 70 ] STAT4 2q32.2-q32.3 694 721 [ 48 ] STAT5a 17q11.2 694 725/779 [ 88 ] STAT5b 17q11.2 699 730 [ 88 ] STAT6 12q13 641 756 [ 102 ]

Fig. 13.2 STAT protein structure and domains

30313 Targeting Stats in Cancer

binding to the receptor of molecules with SH2 domains, such as STAT molecules. Once they bind to the receptor, the Jak kinase phosphorylates and activates STAT [ 6, 17 ] .

STAT Serine Phosphorylation and Other STAT Modifi cations

Besides tyrosine phosphorylation, STAT molecules can undergo other modifi ca-tions with important biological effects. The most relevant ones are serine phospho-rylation, lysine acetylation, and threonine O-glycosylation [ 18 ] . For a review of STAT serine phosphorylation [ 19 ] .

Whereas STAT tyrosine phosphorylation has a clear function, leading to STAT dimerization, nuclear translocation, and activation of transcription, STAT serine phosphorylation has different consequences, depending on the stimulus that leads to serine phosphorylation, the kinases involved, and the subtype of STAT molecule phosphorylated. In the context of STAT tyrosine phosphorylation, serine phospho-rylation is ligand induced and is necessary for full transcriptional activity [ 19, 20 ] .

Activation of Transcription

As transcription factors, the main function of STATs is to bind to DNA and activate transcription of target genes. Once they reach the nucleus, STATs bind to the pro-moter regions of specifi c genes and induce transcription. The TAD domain is essen-tial for the transcriptional activity of STATs, and their ability to increase transcription depends on the recruitment and interaction between the TAD and coactivator pro-teins and other transcription factors [ 21, 22 ] .

Protein Inhibitor of Activated STAT

PIAS is another constitutive mechanism of suppressing STAT activity. These were originally described as inhibitors of STATs but now have been found to inhibit other transcription factors [ 23 ] . There are four proteins in the PIAS family: PIAS1, PIAS3 (isoforms a and b ), PIASx (also known as PIAS2), and PIASy (also known as PIAS4) [ 23 ] . All PIAS proteins bind to STAT dimers. PIAS1 and PIASx bind to STAT1 dimers. PIAS3 binds to STAT3, and PIASy binds to STAT4 [ 23 ] . PIAS1 and PIAS3 act by blocking and impeding DNA binding of the STAT dimer [ 24, 25 ] . PIASx and PIASy act by recruiting corepressors such as histone deacetylases and blocking transcription of target genes [ 26, 27 ] . Furthermore, all PIAS proteins have SUMO E3 ligase activity, which mediates the SUMOylation of STATs [ 28– 31 ] . As already mentioned, SUMOylation of STAT1 at lysine residue 703 has a negative regulatory function and inhibits STAT1 activity [ 28 ] .

304 F.P.S. Santos et al.

STAT and Tumor Biology

Overview

Neoplasms are thought to be induced by deregulation of gene function caused by chromosomal deletions, translocations, point mutations, or epigenetic DNA modifi -cations. Several molecular abnormalities in cancer cells constitutively activate intra-cellular signaling pathways, thereby enhancing proliferation, resistance to apoptosis, impaired differentiation, angiogenesis, and tumor cell dissemination. Transcription factors are unique mediators of cellular function, as each transcription factor regu-lates several genes. Therefore, deregulation of transcription factor function might induce cellular transformation. In many neoplastic diseases, STATs, particularly STAT3 and STAT5, are constitutively activated and, as a result, transcribe genes known to induce a malignant phenotype [ 5 ] (Fig. 13.3 ). Therefore, STATs are an attractive target for anticancer therapy.

Constitutive Activation of STATs in Cancer

The fi rst studies that demonstrated the role of STAT3 in oncogenesis were con-ducted in virally transformed cells. STAT3 was found to be activated in Rous sar-coma virus (v-Src) transformed cells [ 32 ] , and inhibition of STAT3 signaling impeded transformation of mouse fi broblasts infected by v-Src [ 33, 34 ] , suggest-ing that the ability of v-Src to transform cells depends on STAT3. A mutant form

Fig. 13.3 STAT3 activation and cancer pathogenesis. Several different mechanisms can lead to STAT3 constitutive activation in cancer cells, and the consequences of STAT3 activation include increased cellular proliferation, resistance to apoptosis, increased angiogenesis, and suppression of antitumor immune responses

30513 Targeting Stats in Cancer

of STAT3, which dimerizes spontaneously due to the substitution of two cysteine residues in the SH2 domain, transformed fi broblasts and induced tumor formation in nude mice, suggesting that STAT3 is a potential oncogene [ 34 ] .

These initial studies were followed by several reports that indicated the impor-tance of STATs in several tumor types. However, the mechanisms of STAT activa-tion in cancer cells are not completely understood.

Besides tyrosine phosphorylation, serine phosphorylation of STATs has also been demonstrated in cancer cells. STAT3 is constitutively phosphorylated at S727 in chronic lymphoid leukemia (CLL) cells, and phospho-serine STAT3 binds DNA and activates transcription in the absence of tyrosine phosphorylation in CLL [ 35, 36 ] . Transfection of CLL cells with a STAT3 small hairpin RNA (STAT3-shRNA) leads to a reduction in the expression of several STAT3 target genes and subsequent apoptosis, indicating that serine phosphorylation of STAT3 in CLL has biological signifi cance and leads to gene transcription [ 36 ] . Constitutive serine phosphoryla-tion of STAT3 has also been described in prostate cancer cells, where it drives pros-tate tumorigenesis independent of tyrosine phosphorylation [ 37 ] .

STAT inhibitors also seem to play a role in cancer pathogenesis. Silencing of STAT inhibitors can lead to hyperactivation of STAT3 and/or STAT5, and this could possibly lead to the same outcome as increasing the rate of STAT phosphorylation and activation. DNA methylation is the addition of a methyl group to the C5 posi-tion of the cytosine (C) pyrimidine ring [ 38 ] . This occurs when C is followed by a guanine (G) in the so-called CpG islands, which are clustered in gene regulatory regions, such as promoters (promoter CpG islands) [ 38 ] . DNA methylation of pro-moter CpG islands leads to gene silencing, similar to what would occur if the gene was deleted [ 38 ] . Cancer cells have abnormal patterns of DNA methylation, and this contributes to the malignant phenotype [ 38 ] . Silencing of STAT3 inhibitors by gene promoter hypermethylation has been described in solid tumors and hematologic malignancies and was recently reviewed [ 39 ] .

STATs and Tumor Cell Proliferation and Resistance to Apoptosis

It can be seen that STATs (especially STAT3 and STAT5) are activated by several onco-genic signaling pathways, which is consistent with their role as transcription factors that are active in malignancies. STAT3 increases the transcription rate of several genes that contribute to tumorigenesis. Using a gene expression array, one study showed that activa-tion of STAT3 in fi broblasts enhanced the expression of about 100 target genes, using a threshold of a 1.5-fold increase in expression [ 40 ] . Subsequent analysis of the data revealed that 12 STAT3 target genes were highly expressed in several malignancies, con-sistent with a STAT3 gene signature that was found in cancer [ 40 ] . These 12 target genes include genes involved in increased proliferation (early growth response-1 [EGR-1]), resistance to apoptosis (myeloid cell leukemia-1 [MCL-1]), and increased angiogenesis (vascular endothelial growth factor [VEGF]) [ 40 ] . It is thus clear that STAT3 activates the transcription of several genes that contribute to the phenotype of the cancer cell.

306 F.P.S. Santos et al.

The BCL-2 family of genes is one of the main regulators of apoptosis, and it comprises both anti-apoptotic and pro-apoptotic genes [ 41 ] . A mutant and constitu-tively active form of STAT3 has been demonstrated to increase the expression of the anti-apoptotic gene BCL-X

L [ 42 ] . In multiple myeloma (MM) cell lines dependent

on IL-6, activation of STAT3 has been demonstrated to increase BCL-X L , and block-

age of this signaling pathway leads to a decrease in BCL-X L levels [ 43, 44 ] .

Genes that are responsible for cell cycle regulation are also a target of STAT3 and STAT5. Cyclin D levels increase during the initial portion of the G1 phase of the cell cycle [ 45 ] . Cyclin D binds to cyclin-dependent kinases 4 and 6 (CDK 4/6) and increases their catalytic activity [ 45 ] . CDK 4/6 are serine–threonine kinases that are responsible for initiating the process that leads the cell to division [ 45 ] . Among the many targets of CDK 4/6, the retinoblastoma protein (pRb) stands as one of the most important [ 45 ] . Phosphorylation of pRb permits the cell to transverse the G1 phase restriction point and proceed to the next phase in the cell cycle, DNA synthe-sis (S phase) [ 45 ] . Normally, cyclin D levels are regulated by extracellular mito-genic signals [ 45 ] . It is no wonder then that STAT3 and STAT5 are associated with upregulation of cyclin D.

C-myc is another gene responsible for cell cycle control that is also regulated by STATs. C-myc is a transcription factor, and it increases the expression of several genes that lead to cell proliferation and blockade of cellular differentiation [ 46 ] . Several genes have their transcription levels enhanced by c-myc, including cyclin D, cyclin E, CDK 4/6, and CUL1 (Cullin 1; degrades the CDK inhibitor p27 Kip1 ), as well as the transcription factors of the E2F family [ 47– 52 ] . Cells transfected with the STAT3C mutant have increased levels of c-myc mRNA [ 42 ] . STAT5 has been shown to regulate c-myc in CML cell lines [ 53 ] . IL-6 induces an increase in c-myc levels by signaling through STAT3 [ 54 ] .

The p53 gene is a key tumor suppressor gene that is induced by several signals, especially DNA damage, and activates genes responsible for blocking cell prolifera-tion, repairing DNA, and activating apoptosis [ 55 ] . One important study demon-strated that activated STAT3 binds to the promoter of wild-type p53 and inhibits its transcription [ 56 ] . As STAT3 is upregulated in many cancers, targeting STAT3 might lead to an increase in the transcription level of p53 in tumors without p53 mutations.

STATs and Tumor Angiogenesis

Angiogenesis is the biological process of formation of new blood vessels from pre-existing vasculature, and it is essential for uncontrolled tumor growth, since hypoxia and diminished blood supply can limit the size of tumors [ 57 ] . Angiogenesis is a complex process and depends on the interplay between angiogenic and angiostatic molecules [ 57 ] . VEGF (also known as VEGF-A) is one of the most important medi-ators of angiogenesis [ 57 ] .

30713 Targeting Stats in Cancer

VEGF is a target gene of STAT3, and STAT3-mediated increase in VEGF plays an important role in tumor angiogenesis [ 58, 59 ] . It has been demonstrated that there is a correlation between expression of VEGF and elevated STAT3 activity in several tumor types, including pancreatic cancer, melanoma, head and neck cancer, breast cancer, and gastric cancer [ 59– 65 ] . A mutant, constitutively active form of STAT3 (STAT3C) leads to increased expression of VEGF in NIH3T3 fi broblasts [ 42 ] . STAT3 binding sequences were found in the promoter region of VEGF.

It has been shown that cytokines (e.g., IL-6) and TKs (e.g., Src) have an impor-tant role in promoting tumor angiogenesis and VEGF expression [ 58 ] . There is now ample evidence to indicate that the angiogenic activity of cytokines and growth fac-tors is actually mediated by STATs, especially STAT3 [ 66– 68 ] . IL-6 increases the expression of VEGF in C33A cervical cancer cells, and blockade of STAT3 by a dominant-negative mutant abolishes VEGF expression [ 66 ] . IL-6 also has been shown to increase VEGF levels by STAT3-dependent pathways in gastric cancer [ 69 ] . Luciferase assay indicated that only the Jak2 inhibitor AG490 was capable of suppressing VEGF production induced by IL-6, implicating Jak/STAT3 in the sig-naling pathway responsible for IL-6-induced angiogenesis [ 69 ] .

The VEGF receptor (VEGFR) signals through STAT3 pathways in endothelial cells [ 70 ] . Blocking STAT3 inhibits endothelial cell migration and angiogenesis [ 71 ] . STAT3 also upregulates matrix metalloproteinases (MMP-2 and MMP-9), which are proteolytic enzymes that promote angiogenesis, tumor invasion, and metastasis by degrading the extracellular matrix and the basement membrane [ 72, 73 ] .

Role of STATs in Evading Immune Surveillance Mechanisms

The immune system has developed innate and adaptive immune responses to pre-vent and control the development of tumors. Evading these immune surveillance mechanisms is crucial for the progression of tumors [ 74, 75 ] . It is known that tumor cells induce an immunosuppressive microenvironment that abolishes tumor-specifi c immune responses [ 76, 77 ] . Recently, several studies have indicated that STAT3 plays a major role in the genesis of tumor-induced immunosuppression by inhibit-ing Th1 immune response, blocking the maturation of dendritic cells, inducing regulatory T-cells (TRegs), and shifting the balance to the production of pro-infl am-matory and oncogenic cytokines such as IL-23 [ 78– 80 ] . In this crosstalk between tumor cells and immune cells, STAT3 is a central molecule, linking oncogenic path-ways with immunosuppression.

The observation that STAT3 might be involved in generating an immunosuppres-sive environment came from a gene therapy study of the melanoma B16 tumor in mice. Another study showed an inverse correlation between expression of STAT3 and immune cells infi ltrating melanoma tumors [ 80 ] . Neutrophils isolated from tumors show constitutively active STAT3, and specifi c ablation of STAT3 in the hematopoietic system leads to increased cytotoxicity of neutrophils and NK cells

308 F.P.S. Santos et al.

against tumor targets [ 78 ] . All these results indicate that STAT3 acts to suppress the expression of pro-infl ammatory cytokines that might act as danger signals and attract immune cells to the tumor and to inhibit the function of immune cells that are present in the tumor microenvironment.

STAT3 also downregulates Th1 immune responses, not only by stimulating the production by tumor cells of immunosuppressive factors (VEGF, IL-10) but also by counteracting the immunostimulatory effects of NFkB and STAT1 [ 81, 82 ] and inducing the accumulation of TRegs [ 78 ] . Because many of the immunosuppressive factors are regulated by STAT3, and they signal STAT3-dependent pathways, the maintenance of tumor-induced immunosuppression seems to be dependent on this specifi c molecule, which makes it an attractive target for cancer therapy.

Targeting STATS

Peptidic Inhibitors and Peptidomimetic Inhibitors

Peptidic inhibitors targeting the STAT3 SH2 domain could be developed based on peptide sequences located on STAT3 itself (around Y705) or located on the recep-tors that activate STAT3. STAT3 binds via its SH2 domain to phosphorylated pep-tides based on receptor motifs that contain the sequence pYXXQ (pY is the phosphorylated tyrosine) [ 83– 85 ] and also to phosphorylated peptides based on the STAT3 Y705 sequence pYLKT [ 86 ] . The main challenges with the use of peptides as drugs are their low stability, being subject to degradation by peptidases, and polar nature, which decreases membrane permeability and intracellular concentrations. The requirement of a phosphotyrosine adds another level of diffi culty, since it can be targeted by phosphatases. Peptidic inhibitors, however, could be used as a frame-work upon which to develop peptidomimetic drugs with greater membrane perme-ability and increased stability.

Small-Molecule Non-peptidic Inhibitors

Small-molecule non-peptidic inhibitors represent a class of drugs with greater potential for being developed into clinical use because of their greater stability, increased cell membrane permeability, and non-requirement for a pY residue. Based on computational modeling of the interaction between the SH2 domain and the phosphopeptide, several compounds have been identifi ed by screening of virtual databases.

After screening 429,000 compounds in the National Cancer Institute (NCI) Chemical Library, the small molecule inhibitor STA-21 was found to inhibit STAT3 dimerization in vitro at concentrations of 20 mM, and at concentrations of 20–30 mM, it inhibited STAT3 gene transcription and induced apoptosis of human breast carcinoma cells

30913 Targeting Stats in Cancer

(MDA-MB-231, MDA-MB-435, and MDA-MB-468) with constitutively active STAT3 [ 87 ] . STA-21 exerted minimal effects upon cells without constitutively active STAT3.

Another virtual screening of the NCI Chemical Library identifi ed S3I-201 (also known as NSC 74859) as another potential STAT3 inhibitor [ 88 ] . It inhibits STAT3 dimerization, DNA binding, and transcriptional activity, with an IC50 value of 86 m M by EMSA assay [ 88 ] . S3I-201 induced growth inhibition and apoptosis in human breast carcinoma cell lines and suppressed the expression of the STAT3 tar-get genes cyclin D1, BCL-xL, and survivin [ 88 ] . Furthermore, intravenous injection of S3I-201 at a dose of 5 mg/kg every 2 days led to the growth inhibition of human breast carcinoma tumors xenografted into nude mice [ 88 ] .

Another study identifi ed by virtual screening of another chemical library the compound Stattic (STAT three-inhibitory compound). Stattic was found to inhibit the binding of the phosphopeptide GpYLPQTV to the STAT3 SH2 domain [ 89 ] . The effect of Stattic is temperature dependent, exhibiting weak activity at 22°C and strong inhibition at 37°C (IC50 value of 5.1 m M). Stattic was shown to abrogate IL-6-induced STAT3 activation in human HepG2 hepatoma cell lines at a concentra-tion of 20 m M and induce apoptosis of human breast carcinoma cells with constitu-tively active STAT3 [ 89 ] .

Recently, the catechol (1,2 dihydroxybenzene) moiety was found to be a STAT3 SH2 inhibitor by virtual screening [ 90 ] . Catechol compounds dock to the SH2 domain, and computational modeling showed that they form hydrogen bonds with the pY-interacting amino acids [ 90 ] . A series of catechol compounds was synthe-sized and evaluated for activity in vitro as STAT3 inhibitors [ 90 ] . One compound (no. 8) inhibited STAT3 activity with an IC50 value of 106 m M. Further studies of these compounds to evaluate their in vitro and in vivo activities are awaited [ 90 ] .

Inhibitors of STAT DNA Binding Domains

Since STAT is a transcription factor and its action is dependent on DNA binding and activation of transcription, several compounds have been developed that target the DNA binding domain of STAT3 with hopes of blocking its transcriptional activity.

Several compounds derived from platinum (IV) were found to have activity as STAT3 inhibitors. Their mechanism of action is not completely understood, but it involves interacting with STAT3 and blocking its ability to bind DNA. The platinum (IV) derivative IS3 295 was identifi ed on screening of the NCI 2000 diversity set [ 91 ] . IS3 295 was shown to block STAT3 DNA binding activity with an IC50 of 1.4 m M [ 91 ] . IS3 295 directly inhibits STAT3 DNA binding ability, and it interacts with cysteine residues within STAT3 [ 91 ] . IS3 295 abrogated the expression of STAT3 target genes such as cyclin D1 and BCL-xL, and it induced cell growth arrest at G0/G1 and apoptosis of v-Src-transformed NIH3T3 fi broblasts and human breast carcinoma cells at a 10- m M concentration [ 91 ] .

Another compound that targets the DNA binding domain of STAT3 is a tetra-hydro-isobenzofuranone derivative isolated from fermentation broth of the asco-mycete strain A111-95 [ 92 ] . Galiellalactone was discovered during a search for

310 F.P.S. Santos et al.

compounds that inhibit IL-6-mediated signal transduction in HepG2 cells [534]. It blocks IL-6-induced signaling, with IC50 values of 0.25–0.5 m M [ 92 ] , and blocks STAT3 DNA binding without affecting its phosphorylation status. Galiellalactone loses its activity after being incubated with cysteine, and it has been proposed that it acts by binding to a cysteine residue located on the DNA binding domain (C468) of STAT3 and forming an inactive complex [ 92 ] . Galiellalactone at a concentration of 25 m M was demonstrated to downregulate STAT3 gene expres-sion and induce apoptosis of the androgen-insensitive human prostate cancer cell lines DU145 and PC-3 that express constitutive STAT3 [ 93 ] . In nude mice with tumor xenografts of human prostate cancer (DU145 cells), galiellalactone adminis-tered at a dose of 3 mg/kg intraperitoneally induced tumor regression, demonstrating in vivo activity [ 93 ] .

Another approach to block DNA binding of STAT3 would be to target it utilizing peptide aptamers. Peptide aptamers are short-chain peptides that target a specifi c molecule and are bound at each end to a protein scaffold [ 94 ] . Recently, 20-mer peptide aptamers have been identifi ed that target the STAT3 DNA binding domain and block its transcriptional activity [ 95 ] . The peptides were selected from a peptide library of high complexity by an adaptation of the yeast two-hybrid procedure [ 95 ] . Peptide aptamers inhibited DNA binding and transactivation by STAT3 following EGF stimulation of NIH3T3/EGFR (Herc) cells [ 95 ] . Peptide aptamers tagged with a protein transduction motif of nine arginines and fused to thioredoxin as a scaffold protein were cell permeable and induced apoptosis of human multiple myeloma U266 cells at a concentration of 0.27 m M [ 95 ] .

Inhibitors of the N-Terminal Domain

The N-terminal domain of STAT3 is composed of eight a -helices, and it is involved in several protein–protein interactions, such as the formation of STAT3 tetramers and the interaction between STAT3 and other transcription factors [ 96 ] . It was hypothesized that targeting the N-terminal domain of STAT3 might interfere with its transcriptional activity.

One recent report demonstrated for the fi rst time the effi cacy of STAT3 amino-terminal domain inhibitors in abrogating STAT3 activity [ 97 ] . Based on STAT4 data and sequence homology, a library of synthetic peptides derived from the second a -helix of the amino-terminal domain of STAT3 was constructed [ 97 ] . The peptides were fused to penetratin (a 16-amino acid peptide fragment that is internalized by cells) to enable membrane penetration. The fused peptide was found to inhibit STAT3 DNA transcription activity and induce growth inhibition and apoptosis in the human breast cancer cell lines MDA-MB-231, MDA-MB-435, and MCF-7 [ 97 ] . Preliminary data suggest that the peptides interfere with the binding of the histone deacetylase HDAC1 and the DNA methyltransferase DNMT1 to STAT3, but the precise mechanism of action is still unknown [ 97 ] . The same problems described above, with the utilization of peptides as drugs for clinical use, also have to be over-come before this inhibitor can be evaluated in the clinical setting. However, the

31113 Targeting Stats in Cancer

study is important because it demonstrates the proof-of-concept that inhibiting the STAT3 amino-terminal domain blocks its transcriptional activity and represents another approach for targeting it.

Oligonucleotides Targeting STAT3

Oligonucleotides can be used to target STAT3, leading to degradation of STAT3 mRNA, inhibition of DNA binding activity, and disruption of dimerization. Oligonucleotides utilized include single-stranded antisense oligodeoxynucleotides (ODNs), small interfering RNA (siRNA), decoy ODN, and G-quartet ODN.

Single-stranded antisense ODNs (ASO) have a sequence that is complementary to the mRNA of the targeted gene. ASO hybridize with the target mRNA in a sequence-specifi c manner and lead to mRNA degradation, inhibition of mRNA mat-uration by interfering with the splicing mechanism, and inhibition of mRNA transla-tion and protein synthesis [ 98 ] . It has been demonstrated that ASO targeting STAT3 mRNA induce growth inhibition and apoptosis in human hepatocarcinoma and pros-tate cancer cell lines [ 99, 100 ] . A second-generation 2’-O-methoxyethyl (2’-MOE) modifi ed ASO (for increased stability) targeting STAT3 (ISIS 345794) is currently in preclinical development and is expected to enter clinical trials soon [ 101 ] .

siRNA is a class of 20–25-nucleotide-long double-stranded RNA molecules that interfere with the expression of a particular gene. Therapy with siRNA has been utilized to decrease the activity of STAT3 both in vitro and in vivo. Knockdown of STAT3 by siRNA leads to apoptosis in human astrocytoma cell lines A172 and T98G, with decreases in BCL-X

L and survivin [ 102 ] . In another study, STAT3

mRNA was targeted using a dicistronic lentivirus small hairpin RNA (shRNA) [ 103 ] . 4T1 breast cancer cells transduced with the shRNA had decreased levels of STAT3 and did not induce tumor formation in BALB/c mice, whereas 4T1 cells that were not transduced with the shRNA effi ciently formed tumors [ 103 ] .

Decoy ODNs inhibit STAT3 DNA binding activity and mimic the consensus sequence of cis -elements that have a high specifi city for the transcription factor [ 104 ] . Exogenous double-stranded decoy ODN essentially competes with the endogenous cis -elements for binding the transcription factor, resulting in downreg-ulation of the expression of target genes [ 104 ] . A 15-mer STAT3 decoy ODN with the sequence 5 ¢ -CATTTCCCGTAAATC-3 ¢ was shown to bind specifi cally to acti-vated STAT3 and block its binding to DNA sequences found in target genes [ 105 ] . It inhibited proliferation and decreased expression of STAT3 target genes in squamous cell carcinoma of the head and neck cell lines [ 105 ] . Other studies fol-lowed and confi rmed the potential of decoy ODN in inhibiting STAT3 signaling in several cancer cell lines with aberrant STAT3 activity [ 106– 108 ] . Furthermore, decoy ODN injected intratumorally at a dose of 25 m g/day led to regression of tumor xenografts of A459 human lung cancer cells, confi rming in vivo activity [ 109 ] . Another study evaluated the toxicity of an intramuscular injection of a low (0.8 mg) and high (3.2 mg) dose of STAT3 decoy ODN in cynomolgus monkeys [ 110 ] . There was no toxicity observed, and in the monkeys who received the high-dose injection,

312 F.P.S. Santos et al.

there was decreased expression of cyclin D1 and BCL-X L [ 110 ] . A phase I trial

evaluating the safety and biological activity of a single intratumoral injection of STAT3 decoy ODN in patients with head and neck cancer is expected to start soon.

Another class of ODN agents is G-quartet ODNs. G-quartet ODNs are guanine (G)-rich ODNs that have the ability to form inter- and intramolecular four-stranded structures known as G-quartets [ 111 ] . The G-quartet ODN T40214 was identifi ed as a potent inhibitor of STAT3 DNA binding activity, with an IC50 value of 7 m M [ 112 ] . Computational modeling studies revealed that T40214 binds to the SH2 domain of STAT3 and forms hydrogen bonds with residues Q643, Q644, N646, and N647, thus disrupting STAT3 dimerization and DNA binding activity [ 113 ] . In a xenograft model of prostate and breast tumors, T40214 demonstrated in vivo activ-ity leading to growth inhibition and tumor regression when given intravenously at a dose of 5.0 mg/kg [ 114 ] .

Tyrosine Kinase Inhibitors

The class of drugs known as TKIs includes several agents that are currently approved for use in cancer, including the Bcr-Abl/C-Kit inhibitor imatinib (used to treat CML and gastrointestinal stromal tumor [GIST]) [ 115, 116 ] , the EGFR inhibitor erlotinib (used in non-small cell lung cancer) [ 117 ] , the EGFR/Her-2 inhibitor lapatinib (used in breast cancer) [ 118 ] , and the Bcr-Abl/Src inhibitor dasatinib (used in CML) [ 119 ] . TKIs are small-molecule inhibitors that compete with ATP for binding in the ATP pocket located in the TK [ 120 ] . Since the main mechanism of activation of STATs is tyrosine phospho-rylation, it is logical that these compounds are indirect STAT inhibitors. However, TKIs also affect several other signaling pathways that also depend on tyrosine phosphoryla-tion, and it is diffi cult to delineate how much of their effect is due to STAT inhibition.

Natural Compounds

There are several compounds derived from natural sources that can inhibit the STAT3 pathway [ 121 ] . Screening of the NCI diversity set using a cytoblot assay to search for STAT3 phosphorylation inhibitors led to the identifi cation of JSI-124 (cucurbitacin-I) [ 122 ] . JSI-124 is a member of the cucurbitacin family of com-pounds, isolated from the Cucurbitaceae plant family, which is used in herbal medi-cine in China and India [ 123 ] . Cucurbitacins are a group of triterpenoid substances structurally characterized by a tetracyclic cucurbitane nucleus skeleton (9 b -methyl-norlanosta-5-ene) with a variety of oxygen substitutions at different positions [ 123 ] . Cucurbitacin-I was fi rst isolated from Ecballium elaterium [ 124 ] , and it has been shown to inhibit DNA, RNA, and protein synthesis and proliferation in HeLa cells and to inhibit proliferation of Ehrlich ascites carcinoma cells [ 125, 126 ] .

31313 Targeting Stats in Cancer

JSI-124 selectively inhibits STAT3 phosphorylation in vitro at a concentration of 10 m M [ 122 ] . The precise mechanism of action remains unknown, however, since Src, Jak, Erk, and Akt kinases are not inhibited [ 122 ] . JSI-124 decreased the levels of phosphorylated STAT3 in NIH3T3/v-Src transformed fi broblasts and in human lung, breast, and pancreatic cancer, glioma, and lymphoma cells [ 30, 122 ] . JSI-124 administered intraperitoneally at a dose of 1 mg/kg inhibited the growth of human breast (MDA-MD-468) and lung (A459) tumor xenografts in nude mice [ 122 ] . JSI-124 prolonged the survival of mice with murine melanoma and induced antitumor immune responses of dendritic cells, presumably by inhibition of STAT3 activation [ 127 ] . Also, CpG deoxynucleotide (a dendritic cell activator) was combined with JSI-124 in the treatment of melanoma in mice [ 128 ] . The combination led to a greater antitumor effect and correlated with an increase in the level of infl ammatory Th-1 cytokines (including IL-12, IFN- g , TNF- a , and IL-2) and an increase in intra-tumoral CD8+ and CD4+ T-cells expressing activation/memory markers and NK cells [ 128 ] . There was also a signifi cant decrease in immunosuppressive cytokines, as evidenced by lower intratumoral levels of VEGF and TGF- b , and a decreased number of CD4+CD25+Foxp3+ TReg cells in lymph nodes [ 128 ] . JSI-124 is poorly water soluble, and polymeric micelles were developed that increase the water solu-bility and improve the delivery of the drug [ 129 ] .

Other cucurbitacins have been shown to have activity as STAT3 inhibitors [ 35 ] . Withacnistin, originally identifi ed erroneously as cucurbitacin-Q, is a potent inhibi-tor of STAT3 [ 130 ] . It leads to tumor cell apoptosis and suppresses the growth of human lung and breast tumor xenografts [ 130 ] . It also does not inhibit Jak2, Src, Akt, Erk, or JNK. Cucurbitacin-B is another STAT3 inhibitor that has activity against hepatocellular carcinoma cells and was recently shown to synergize with docetaxel in inducing apoptosis in human laryngeal cancer cells in vitro [ 131, 132 ] .

Curcumin (diferuloylmethane) is the active ingredient of the herbal remedy and dietary spice turmeric [ 133 ] . Turmeric is obtained from the rhizome of the plant Curcuma long and has been used for a long time in traditional medicine in India and China [ 133 ] . Recently, curcumin has been demonstrated to be active as a chemo-therapeutic and chemopreventive agent. Curcumin inhibits STAT3 and several other signaling pathways [ 121, 134 ] . The precise mechanism is unknown, but it has been demonstrated that curcumin inhibits several TKs that are responsible for the activa-tion and phosphorylation of STAT3, including Jak1, Jak2, Src, Erb-b2, and EGFR [ 44 ] . Curcumin can also activate a SHP-2 phosphatase, which leads to the dephos-phorylation of Jak1/2 [ 135 ] . Curcumin suppresses STAT3 phosphorylation after only 30 min at a concentration of 10 m M and downregulates the expression of STAT3 target genes such as BCL-X

L and cyclin D1 [ 136, 137 ] . It was shown that

curcumin inhibited IL-6 signaling and STAT3 activation in multiple myeloma U266 cells, inducing growth inhibition and apoptosis [ 136 ] . Curcumin was more effective than another Jak2 inhibitor, AG490, in blocking STAT3 phosphorylation in myeloma cells (10 vs. 100 m M) [ 136 ] . Curcumin was shown to inhibit both NF k B and STAT3 activity in myeloma CD138+ cells obtained from patients with myeloma, and it was more potent than dexamethasone in this regard [ 138 ] . Curcumin was also shown to

314 F.P.S. Santos et al.

inhibit STAT3 in other human tumor cell lines, including Hodgkin’s lymphoma and head and neck squamous cell carcinoma cells with constitutive STAT3 activation [ 51 ] . Synthetic analogues of curcumin have been developed and have demonstrated activity in a xenograft model of breast cancer [ 139, 140 ] . Curcumin is safe in humans, and clinical trials did not reveal any dose-limiting toxicities when admin-istered in doses up to 8 g/day [ 141 ] . Currently, there are several clinical trials evalu-ating the role of curcumin in the treatment of a broad range of malignancies.

Another natural compound derived from spices is capsaicin, a constituent of green and red peppers from the plant genus Capsicum . Capsaicin blocks IL-6-induced STAT3 activation [ 142 ] . The mechanism involves depletion of intracellular gp130 pools through induction of endoplasmatic reticulum stress [ 143 ] .

Indirubin is the active component of a traditional Chinese herbal medicine, Danggui Longhui Wan, and is used for treatment of CML in China [ 144 ] . Indirubin and its derivatives have activity as cyclin-dependent kinase inhibitors (CDK), com-peting with ATP for binding in the catalytic domain of CDK [ 145 ] . Indirubin induces growth arrest and apoptosis in several tumor cell lines [ 60 ] . Recently, it was shown that the indirubin derivatives E564, E728, and E804 have activity as Src inhibitors, blocking constitutive STAT3 signaling and inducing apoptosis in human breast and prostate cancer cells, with concomitant decreases in the levels of the anti-apoptotic proteins Mcl-1 and survivin [ 146 ] .

Two other compounds with activity as CDK inhibitors were also found to be STAT3 or STAT5 inhibitors [ 147, 148 ] . Flavopiridol is a fl avonoid derivative of the natural product rohitukine isolated from the bark of the tree Dysoxylum binec-tariferum , and it is currently being evaluated in clinical trials for a variety of malig-nancies [ 149, 150 ] . Flavopiridol has activity as a CDK inhibitor [ 151 ] , but it was also reported that it can inhibit STAT3–DNA interactions and disrupt STAT3-directed gene transcription, leading to downregulation of Mcl-1 [ 147 ] . Roscovitine is not a natural compound, but it is a purine analogue and CDK inhibitor that was recently reported to inhibit STAT5 phosphorylation and induce apoptosis in MT-2 T-cells transformed by the human T-cell leukemia virus-1 (HTLV-1) [ 148 ] .

Magnolol is the active component isolated from the Chinese herb Hou p’u ( Magnolia offi cinalis ). Magnolol has potential therapeutic benefi t as an anti-infl am-matory and anticancer agent [ 152, 153 ] . In one study, magnolol was shown to inhibit IL-6-induced STAT3 phosphorylation, DNA binding, and transcriptional activity in endothelial cells, demonstrating that magnolol possesses anti-STAT3 activity [ 154 ] . Magnolol did not affect the phosphorylation status of Jak1/2 or Erk 1/2 [ 154 ] .

Other compounds derived from natural sources that were demonstrated to have STAT3 inhibitory activity are resveratrol and silibinin [ 155, 156 ] . Resveratrol is a phytoalexin with antioxidant and anti-infl ammatory properties that inhibits Src TK activity and blocks constitutive STAT3 protein activation in malignant cells, leading to growth arrest and apoptosis [ 156 ] . Silibinin is a fl avanone isolated from the milk thistle ( Silybum marianum ) that inhibits constitutively active STAT3 and has been shown to induce apoptosis in vitro in DU145 prostate cancer cells [ 155 ] .

31513 Targeting Stats in Cancer

Other Compounds with STAT3 Inhibitory Activity

Sulindac is a nonsteroidal anti-infl ammatory agent currently being studied for chemoprevention of colon cancer. Some of its antineoplastic activity may be due to inhibition of STAT3 [ 157 ] . Sulindac decreases the level of phosphorylated and unphosphorylated STAT3 and induces growth arrest and apoptosis in head and neck squamous cell carcinoma cell lines [ 157, 158 ] . Survivin is one of the downstream mediators of STAT3 that is targeted by sulindac, as forced reexpression of survivin partially reversed the effects of STAT3 inhibition [ 159 ] .

Arsenic trioxide (ATO) is currently used in the treatment of relapsed APL [ 160 ] . In vitro, ATO induces growth arrest and apoptosis of non-APL AML cells from patient samples and from the AML cell line HEL, which has constitutive STAT3 signaling [ 161 ] . This effect was preceded by the downregulation of activated STAT proteins as early as 6 h after treatment with ATO [ 161 ] . Blockage of STAT activity was due to the inhibition of several TKs that are responsible for STAT3 and STAT5 phosphorylation, including Jaks, ZNF198-fi broblast growth factor receptor-1 (FGFR1), FLT3, and Bcr-Abl [ 161 ] . Another study showed that sodium arsenite inhibited the Jak–STAT pathway via direct inhibition of Jak by arsenite [ 162 ] . This effect was independent of arsenite activation of MAPK pathways [ 162 ] . ATO may also induce demethylation of the Jak–STAT pathway inhibitor SOCS1 [ 163 ] . Even though ATO is already being used for the treatment of APL, more studies are neces-sary to confi rm its activity in other neoplasms [ 164, 165 ] .

Triterpenoids are natural compounds synthesized in plants by the cyclization of squalene [ 166 ] . More than 20,000 triterpenoids are known to occur in nature, and two compounds have known anti-infl ammatory properties, oleanoic acid and ursocholic acid [ 167, 168 ] . In an effort to improve their potency, modifi cations were made to the basic triterpenoid structure to obtain synthetic triterpenoids, a new class of noncytotoxic and multifunctional drugs that have several potential applications for anticancer and anti-infl ammatory therapy [ 169 ] . The synthetic triterpenoid CDDO-imidazole (1-[2-cyano-3,12-dioxooleana-1,9-dien-28-oyl]-imidazole) rapidly (within 30–60 min) blocks constitutive or IL-6-induced STAT3 and STAT5 activity in human multiple myeloma and lung cancer cells [ 170 ] . Induction of apoptosis occurred after brief (4 h) exposure to CDDO-imidazole [ 170 ] . The level of phosphorylated STAT3 in myeloma cells was almost undetect-able after only 1 h of treatment with low concentrations (0.25 m M) of CDDO-imidazole, indicating the high potency of this compound [ 170 ] . CDDO-imidazole induced the expression of the Jak–STAT pathway inhibitors SOCS1 and SHP-1, which may contribute to its activity [ 170 ] . Another study demonstrated that the similar compound CDDO-methyl ester blocked the Jak1–STAT3 pathway by forming adducts with Jak1 at C1077 in the kinase domain and inhibiting Jak1 activity and by binding directly to STAT3 and inhibiting the formation of STAT3 dimers [ 171 ] . Clinical studies with CDDO and other synthetic triterpenoids are ongoing.

316 F.P.S. Santos et al.

Activators of STAT Inhibitors

Activation of STAT3 and STAT5 inhibitors is another therapeutic approach that could be exploited. The compound FTY720 (2-amino-2-[2-(4-octylphenyl)ethyl]-1,3-propanediol hydrochloride; also known as fi ngolimod) is an immunomodulator in clinical trials for patients with multiple sclerosis that was shown to activate the phosphatase PP2A and to inhibit the activity of both Bcr-Abl and STAT5 in vitro and in vivo in CML cell lines that are sensitive or resistant to imatinib/dasatinib [ 172 ] . Peroxisome proliferator-activated receptor g (PPAR g ) is a member of the nuclear receptor superfamily. There are several PPAR g ligands, including the pros-tanoid 15-deoxy- D -12,14-prostaglandin J2 (15d-PGJ2) and the antidiabetic thiazo-lidinedione rosiglitazone [ 173, 174 ] . Both compounds were shown to inhibit the phosphorylation and activity of Jak1 and Jak2 as well as STAT1 and STAT3 in glial cells [ 175 ] . Rosiglitazone induces transcription of the Jak–STAT pathway inhibitors SOCS1 and SOCS3. 15d-PGJ2 has the same effect and also induces activation of SHP-2, another negative regulator of the Jak–STAT pathway [ 175 ] . Of note, these effects were independent of PPAR g activation [ 175 ] . In vitro, both rosiglitazone and 15d-PGJ2 were shown to induce differentiation and apoptosis of myeloid (U937 and HL-60) and lymphoid (Su-DHL, Sup-M2, Ramos, Raji, Hodgkin’s cell lines, and primary chronic lymphocytic leukemia) leukemic cells [ 176 ] .

Conclusion

It is clear that STATs are not mere transcription factors for cytokine receptors but rather central molecules in several intracellular signaling pathways. Constitutive activation of STATs contributes to the generation of the malignant phenotype in cancer cells. There are currently no approved agents for targeting STATs, but it is expected that with further development, new compounds will become available that will hopefully improve the outcomes for cancer patients.

References

1. Fu, X.Y., Schindler, C., Improta, T., Aebersold, R., and Darnell, J.E., Jr. 1992, Proc Natl Acad Sci USA, 89, 7840–3.

2. Schindler, C., Fu, X.Y., Improta, T., Aebersold, R., and Darnell, J.E., Jr. 1992, Proc Natl Acad Sci USA, 89, 7836–9.

3. Darnell, J.E., Jr., Kerr, I.M., and Stark, G.R. 1994, Science, 264, 1415–21. 4. Levy, D.E. and Darnell, J.E., Jr. 2002, Nat Rev Mol Cell Biol, 3, 651–62. 5. Yu, H. and Jove, R. 2004, Nat Rev Cancer, 4, 97–105. 6. Ihle, J.N. 2001, Curr Opin Cell Biol, 13, 211–7. 7. Ward, A.C., Touw, I., and Yoshimura, A. 2000, Blood, 95, 19–29. 8. Bromberg, J. 2002, J Clin Invest, 109, 1139–42.

31713 Targeting Stats in Cancer

9. Bromberg, J. and Darnell, J.E., Jr. 2000, Oncogene, 19, 2468–73. 10. Weber-Nordt, R.M., Egen, C., Wehinger, J., Ludwig, W., Gouilleux-Gruart, V., Mertelsmann,

R., et al. 1996, Blood, 88, 809–16. 11. Yu, C.L., Jove, R., and Burakoff, S.J. 1997, J Immunol, 159, 5206–10. 12. Zhang, Q., Nowak, I., Vonderheid, E.C., Rook, A.H., Kadin, M.E., Nowell, P.C., et al. 1996,

Proc Natl Acad Sci USA, 93, 9148–53. 13. Zhang, Q., Raghunath, P.N., Xue, L., Majewski, M., Carpentieri, D.F., Odum, N., et al. 2002,

J Immunol, 168, 466–74. 14. Darnell, J.E., Jr. 1997, Science, 277, 1630–5. 15. Wilks, A.F. 1989, Proc Natl Acad Sci USA, 86, 1603–7. 16. Leonard, W.J. and O’Shea, J. 1998, Annu Rev Immunol, 16, 293–322. 17. Shuai, K., Ziemiecki, A., Wilks, A.F., Harpur, A.G., Sadowski, H.B., Gilman, M.Z., et al.

1993, Nature, 366, 580–3. 18. Schindler, C., Levy, D.E., and Decker, T. 2007, J Biol Chem, 282, 20059–63. 19. Decker, T. and Kovarik, P. 2000, Oncogene, 19, 2628–37. 20. Wen, Z., Zhong, Z., and Darnell, J.E., Jr. 1995, Cell, 82, 241–50. 21. Horvath, C.M. 2000, Trends Biochem Sci, 25, 496–502. 22. Shuai, K. 2000, Oncogene, 19, 2638–44. 23. Shuai, K. and Liu, B. 2005, Nat Rev Immunol, 5, 593–605. 24. Chung, C.D., Liao, J., Liu, B., Rao, X., Jay, P., Berta, P., et al. 1997, Science, 278, 1803–5. 25. Liu, B., Liao, J., Rao, X., Kushner, S.A., Chung, C.D., Chang, D.D., et al. 1998, Proc Natl

Acad Sci USA, 95, 10626–31. 26. Arora, T., Liu, B., He, H., Kim, J., Murphy, T.L., Murphy, K.M., et al. 2003, J Biol Chem,

278, 21327–30. 27. Liu, B., Gross, M., ten Hoeve, J., and Shuai, K. 2001, Proc Natl Acad Sci USA, 98, 3203–7. 28. Ungureanu, D., Vanhatupa, S., Kotaja, N., Yang, J., Aittomaki, S., Janne, O.A., et al. 2003,

Blood, 102, 3311–3. 29. Ungureanu, D., Vanhatupa, S., Gronholm, J., Palvimo, J.J., and Silvennoinen, O. 2005, Blood,

106, 224–6. 30. Kotaja, N., Karvonen, U., Janne, O.A., and Palvimo, J.J. 2002, Mol Cell Biol, 22, 5222–34. 31. Rogers, R.S., Horvath, C.M., and Matunis, M.J. 2003, J Biol Chem, 278, 30091–7. 32. Yu, C.L., Meyer, D.J., Campbell, G.S., Larner, A.C., Carter-Su, C., Schwartz, J., et al. 1995,

Science, 269, 81–3. 33. Bromberg, J.F., Horvath, C.M., Besser, D., Lathem, W.W., and Darnell, J.E., Jr. 1998, Mol

Cell Biol, 18, 2553–8. 34. Turkson, J., Bowman, T., Garcia, R., Caldenhoven, E., De Groot, R.P., and Jove, R. 1998, Mol

Cell Biol, 18, 2545–52. 35. Frank, D.A., Mahajan, S., and Ritz, J. 1997, J Clin Invest, 100, 3140–8. 36. Hazan-Halevy, I., Harris, D., Liu, Z., Ferrajoli, A., Keating, M.J., and Estrov, Z. 2008, Blood,

112, Abstract 1058. 37. Qin, H.R., Kim, H.J., Kim, J.Y., Hurt, E.M., Klarmann, G.J., Kawasaki, B.T., et al. 2008,

Cancer Res, 68, 7736–41. 38. Herman, J.G. and Baylin, S.B. 2003, N Engl J Med, 349, 2042–54. 39. Ghoshal Gupta, S., Baumann, H., and Wetzler, M. 2008, Leuk Res, 32, 1005–14. 40. Alvarez, J.V., Febbo, P.G., Ramaswamy, S., Loda, M., Richardson, A., and Frank, D.A. 2005,

Cancer Res, 65, 5054–62. 41. Cory, S. and Adams, J.M. 2002, Nat Rev Cancer, 2, 647–56. 42. Bromberg, J.F., Wrzeszczynska, M.H., Devgan, G., Zhao, Y., Pestell, R.G., Albanese, C.,

et al. 1999, Cell, 98, 295–303. 43. Catlett-Falcone, R., Landowski, T.H., Oshiro, M.M., Turkson, J., Levitzki, A., Savino, R.,

et al. 1999, Immunity, 10, 105–15. 44. Catlett-Falcone, R., Dalton, W.S., and Jove, R. 1999, Curr Opin Oncol, 11, 490–6. 45. Malumbres, M. and Barbacid, M. 2001, Nat Rev Cancer, 1, 222–31.

318 F.P.S. Santos et al.

46. Pelengaris, S., Khan, M., and Evan, G. 2002, Nat Rev Cancer, 2, 764–76. 47. Leone, G., Sears, R., Huang, E., Rempel, R., Nuckolls, F., Park, C.H., et al. 2001, Mol Cell,

8, 105–13. 48. Mateyak, M.K., Obaya, A.J., and Sedivy, J.M. 1999, Mol Cell Biol, 19, 4672–83. 49. O’Hagan, R.C., Ohh, M., David, G., de Alboran, I.M., Alt, F.W., Kaelin, W.G., Jr., et al. 2000,

Genes Dev, 14, 2185–91. 50. Bouchard, C., Thieke, K., Maier, A., Saffrich, R., Hanley-Hyde, J., Ansorge, W., et al. 1999,

Embo J, 18, 5321–33. 51. Coller, H.A., Grandori, C., Tamayo, P., Colbert, T., Lander, E.S., Eisenman, R.N., et al. 2000,

Proc Natl Acad Sci USA, 97, 3260–5. 52. Hermeking, H., Rago, C., Schuhmacher, M., Li, Q., Barrett, J.F., Obaya, A.J., et al. 2000,

Proc Natl Acad Sci USA, 97, 2229–34. 53. Huang, M., Dorsey, J.F., Epling-Burnette, P.K., Nimmanapalli, R., Landowski, T.H., Mora,

L.B., et al. 2002, Oncogene, 21, 8804–16. 54. Kiuchi, N., Nakajima, K., Ichiba, M., Fukada, T., Narimatsu, M., Mizuno, K., et al. 1999, J

Exp Med, 189, 63–73. 55. Vogelstein, B., Lane, D., and Levine, A.J. 2000, Nature, 408, 307–10. 56. Niu, G., Wright, K.L., Ma, Y., Wright, G.M., Huang, M., Irby, R., et al. 2005, Mol Cell Biol,

25, 7432–40. 57. Bergers, G. and Benjamin, L.E. 2003, Nat Rev Cancer, 3, 401–10. 58. Chen, Z. and Han, Z.C. 2008, Med Res Rev, 28, 185–200. 59. Niu, G., Wright, K.L., Huang, M., Song, L., Haura, E., Turkson, J., et al. 2002, Oncogene, 21,

2000–8. 60. Choi, J.H., Ahn, M.J., Park, C.K., Han, H.X., Kwon, S.J., Lee, Y.Y., et al. 2006, Apmis, 114,

619–25. 61. Gong, W., Wang, L., Yao, J.C., Ajani, J.A., Wei, D., Aldape, K.D., et al. 2005, Clin Cancer

Res, 11, 1386–93. 62. Hsieh, F.C., Cheng, G., and Lin, J. 2005, Biochem Biophys Res Commun, 335, 292–9. 63. Wei, D., Le, X., Zheng, L., Wang, L., Frey, J.A., Gao, A.C., et al. 2003, Oncogene, 22,

319–29. 64. Xie, T.X., Huang, F.J., Aldape, K.D., Kang, S.H., Liu, M., Gershenwald, J.E., et al. 2006,

Cancer Res, 66, 3188–96. 65. Masuda, M., Ruan, H.Y., Ito, A., Nakashima, T., Toh, S., Wakasaki, T., et al. 2007, Oral

Oncol, 43, 785–90. 66. Wei, L.H., Kuo, M.L., Chen, C.A., Chou, C.H., Lai, K.B., Lee, C.N., et al. 2003, Oncogene,

22, 1517–27. 67. Suganami, E., Takagi, H., Ohashi, H., Suzuma, K., Suzuma, I., Oh, H., et al. 2004, Diabetes,

53, 2443–8. 68. Valdembri, D., Serini, G., Vacca, A., Ribatti, D., and Bussolino, F. 2002, Faseb J, 16, 225–7. 69. Huang, S.P., Wu, M.S., Shun, C.T., Wang, H.P., Lin, M.T., Kuo, M.L., et al. 2004, J Biomed

Sci, 11, 517–27. 70. Bartoli, M., Platt, D., Lemtalsi, T., Gu, X., Brooks, S.E., Marrero, M.B., et al. 2003, Faseb J,

17, 1562–4. 71. Yahata, Y., Shirakata, Y., Tokumaru, S., Yamasaki, K., Sayama, K., Hanakawa, Y., et al. 2003,

J Biol Chem, 278, 40026–31. 72. Dechow, T.N., Pedranzini, L., Leitch, A., Leslie, K., Gerald, W.L., Linkov, I., et al. 2004, Proc

Natl Acad Sci USA, 101, 10602–7. 73. Xie, T.X., Wei, D., Liu, M., Gao, A.C., Ali-Osman, F., Sawaya, R., et al. 2004, Oncogene, 23,

3550–60. 74. Dunn, G.P., Bruce, A.T., Ikeda, H., Old, L.J., and Schreiber, R.D. 2002, Nat Immunol, 3,

991–8. 75. Pardoll, D. 2003, Annu Rev Immunol, 21, 807–39. 76. Gabrilovich, D. 2004, Nat Rev Immunol, 4, 941–52. 77. Zou, W. 2005, Nat Rev Cancer, 5, 263–74.

31913 Targeting Stats in Cancer

78. Kortylewski, M., Kujawski, M., Wang, T., Wei, S., Zhang, S., Pilon-Thomas, S., et al. 2005, Nat Med, 11, 1314–21.

79. Kortylewski, M., Xin, H., Kujawski, M., Lee, H., Liu, Y., Harris, T., et al. 2009, Cancer Cell, 15, 114–23.

80. Burdelya, L., Kujawski, M., Niu, G., Zhong, B., Wang, T., Zhang, S., et al. 2005, J Immunol, 174, 3925–31.

81. Welte, T., Zhang, S.S., Wang, T., Zhang, Z., Hesslein, D.G., Yin, Z., et al. 2003, Proc Natl Acad Sci USA, 100, 1879–84.

82. Hoentjen, F., Sartor, R.B., Ozaki, M., and Jobin, C. 2005, Blood, 105, 689–96. 83. Stahl, N., Farruggella, T.J., Boulton, T.G., Zhong, Z., Darnell, J.E., Jr., and Yancopoulos,

G.D. 1995, Science, 267, 1349–53. 84. Gerhartz, C., Heesel, B., Sasse, J., Hemmann, U., Landgraf, C., Schneider-Mergener, J., et al.

1996, J Biol Chem, 271, 12991–8. 85. Wiederkehr-Adam, M., Ernst, P., Muller, K., Bieck, E., Gombert, F.O., Ottl, J., et al. 2003, J

Biol Chem, 278, 16117–28. 86. Wang, T., Niu, G., Kortylewski, M., Burdelya, L., Shain, K., Zhang, S., et al. 2004, Nat Med,

10, 48–54. 87. Song, H., Wang, R., Wang, S., and Lin, J. 2005, Proc Natl Acad Sci USA, 102, 4700–5. 88. Siddiquee, K., Zhang, S., Guida, W.C., Blaskovich, M.A., Greedy, B., Lawrence, H.R., et al.

2007, Proc Natl Acad Sci USA, 104, 7391–6. 89. Schust, J., Sperl, B., Hollis, A., Mayer, T.U., and Berg, T. 2006, Chem Biol, 13, 1235–42. 90. Hao, W., Hu, Y., Niu, C., Huang, X., Chang, C.P., Gibbons, J., et al. 2008, Bioorg Med Chem

Lett, 18, 4988–92. 91. Turkson, J., Zhang, S., Mora, L.B., Burns, A., Sebti, S., and Jove, R. 2005, J Biol Chem, 280,

32979–88. 92. Weidler, M., Rether, J., Anke, T., and Erkel, G. 2000, FEBS Lett, 484, 1–6. 93. Hellsten, R., Johansson, M., Dahlman, A., Dizeyi, N., Sterner, O., and Bjartell, A. 2008,

Prostate, 68, 269–80. 94. Baines, I.C. and Colas, P. 2006, Drug Discov Today, 11, 334–41. 95. Nagel-Wolfrum, K., Buerger, C., Wittig, I., Butz, K., Hoppe-Seyler, F., and Groner, B. 2004,

Mol Cancer Res, 2, 170–82. 96. Zhang, X. and Darnell, J.E., Jr. 2001, J Biol Chem, 276, 33576–81. 97. Timofeeva, O.A., Gaponenko, V., Lockett, S.J., Tarasov, S.G., Jiang, S., Michejda, C.J., et al.

2007, ACS Chem Biol, 2, 799–809. 98. Chan, J.H., Lim, S., and Wong, W.S. 2006, Clin Exp Pharmacol Physiol, 33, 533–40. 99. Li, W.C., Ye, S.L., Sun, R.X., Liu, Y.K., Tang, Z.Y., Kim, Y., et al. 2006, Clin Cancer Res,

12, 7140–8. 100. Barton, B.E., Karras, J.G., Murphy, T.F., Barton, A., and Huang, H.F. 2004, Mol Cancer Ther,

3, 11–20. 101. Gleave, M.E. and Monia, B.P. 2005, Nat Rev Cancer, 5, 468–79. 102. Konnikova, L., Kotecki, M., Kruger, M.M., and Cochran, B.H. 2003, BMC Cancer, 3, 23. 103. Ling, X. and Arlinghaus, R.B. 2005, Cancer Res, 65, 2532–6. 104. Tomita, N., Ogihara, T., and Morishita, R. 2003, Curr Drug Targets, 4, 603–8. 105. Leong, P.L., Andrews, G.A., Johnson, D.E., Dyer, K.F., Xi, S., Mai, J.C., et al. 2003, Proc

Natl Acad Sci USA, 100, 4138–43. 106. Zhang, X., Zhang, J., Wei, H., and Tian, Z. 2007, Oncol Rep, 17, 1377–82. 107. Sun, X., Zhang, J., Wang, L., and Tian, Z. 2008, Cancer Lett, 262, 201–13. 108. Gu, J., Li, G., Sun, T., Su, Y., Zhang, X., Shen, J., et al. 2008, J Neurooncol, 89, 9–17. 109. Zhang, X., Zhang, J., Wang, L., Wei, H., and Tian, Z. 2007, BMC Cancer, 7, 149. 110. Sen, M., Tosca, P.J., Zwayer, C., Ryan, M.J., Johnson, J.D., Knostman, K.A., et al. 2008,

Cancer Chemother Pharmacol. 111. Williamson, J.R. 1994, Annu Rev Biophys Biomol Struct, 23, 703–30. 112. Jing, N., Li, Y., Xu, X., Sha, W., Li, P., Feng, L., et al. 2003, DNA Cell Biol, 22, 685–96. 113. Zhu, Q. and Jing, N. 2007, J Comput Aided Mol Des, 21, 641–8.

320 F.P.S. Santos et al.

114. Jing, N., Li, Y., Xiong, W., Sha, W., Jing, L., and Tweardy, D.J. 2004, Cancer Res, 64, 6603–9. 115. Demetri, G.D., von Mehren, M., Blanke, C.D., Van den Abbeele, A.D., Eisenberg, B., Roberts,

P.J., et al. 2002, N Engl J Med, 347, 472–80. 116. O’Brien, S.G., Guilhot, F., Larson, R.A., Gathmann, I., Baccarani, M., Cervantes, F., et al.

2003, N Engl J Med, 348, 994–1004. 117. Shepherd, F.A., Rodrigues Pereira, J., Ciuleanu, T., Tan, E.H., Hirsh, V., Thongprasert, S.,

et al. 2005, N Engl J Med, 353, 123–32. 118. Geyer, C.E., Forster, J., Lindquist, D., Chan, S., Romieu, C.G., Pienkowski, T., et al. 2006, N

Engl J Med, 355, 2733–43. 119. Talpaz, M., Shah, N.P., Kantarjian, H., Donato, N., Nicoll, J., Paquette, R., et al. 2006, N Engl

J Med, 354, 2531–41. 120. Krause, D.S. and Van Etten, R.A. 2005, N Engl J Med, 353, 172–87. 121. Aggarwal, B.B., Sethi, G., Ahn, K.S., Sandur, S.K., Pandey, M.K., Kunnumakkara, A.B.,

et al. 2006, Ann N Y Acad Sci, 1091, 151–69. 122. Blaskovich, M.A., Sun, J., Cantor, A., Turkson, J., Jove, R., and Sebti, S.M. 2003, Cancer

Res, 63, 1270–9. 123. Chen, J.C., Chiu, M.H., Nie, R.L., Cordell, G.A., and Qiu, S.X. 2005, Nat Prod Rep, 22,

386–99. 124. Rao, M.M., Meshulam, H., and Lavie, D. 1974, J. Chem. Soc. Perkin Trans. I 22,

2552–2556. 125. Witkowski, A., Woynarowska, B., and Konopa, J. 1984, Biochem Pharmacol, 33, 995–1004. 126. Gitter, S., Gallily, R., Shohat, B., and Lavie, D. 1961, Cancer Res, 21, 516–21. 127. Nefedova, Y., Nagaraj, S., Rosenbauer, A., Muro-Cacho, C., Sebti, S.M., and Gabrilovich,

D.I. 2005, Cancer Res, 65, 9525–35. 128. Molavi, O., Ma, Z., Hamdy, S., Lai, R., Lavasanifar, A., and Samuel, J. 2008, Immunol Cell

Biol, 86, 506–14. 129. Molavi, O., Ma, Z., Mahmud, A., Alshamsan, A., Samuel, J., Lai, R., et al. 2008, Int J Pharm,

347, 118–27. 130. Sun, J., Blaskovich, M.A., Jove, R., Livingston, S.K., Coppola, D., and Sebti, S.M. 2005,

Oncogene, 24, 3236–45. 131. Liu, T., Zhang, M., Zhang, H., Sun, C., Yang, X., Deng, Y., et al. 2008, Eur J Pharmacol, 587,

78–84. 132. Zhang, M., Zhang, H., Sun, C., Shan, X., Yang, X., Li-Ling, J., et al. 2009, Cancer Chemother

Pharmacol, 63, 635–42. 133. Ammon, H.P. and Wahl, M.A. 1991, Planta Med, 57, 1–7. 134. Kunnumakkara, A.B., Anand, P., and Aggarwal, B.B. 2008, Cancer Lett, 269, 199–225. 135. Kim, H.Y., Park, E.J., Joe, E.H., and Jou, I. 2003, J Immunol, 171, 6072–9. 136. Bharti, A.C., Donato, N., and Aggarwal, B.B. 2003, J Immunol, 171, 3863–71. 137. Bharti, A.C., Donato, N., Singh, S., and Aggarwal, B.B. 2003, Blood, 101, 1053–62. 138. Bharti, A.C., Shishodia, S., Reuben, J.M., Weber, D., Alexanian, R., Raj-Vadhan, S., et al.

2004, Blood, 103, 3175–84. 139. Adams, B.K., Cai, J., Armstrong, J., Herold, M., Lu, Y.J., Sun, A., et al. 2005, Anticancer

Drugs, 16, 263–75. 140. Adams, B.K., Ferstl, E.M., Davis, M.C., Herold, M., Kurtkaya, S., Camalier, R.F., et al. 2004,

Bioorg Med Chem, 12, 3871–83. 141. Hsu, C.H., Chuang, S.E., Hergenhahn, M., Kuo, M.L., Lin, J.K., Hsieh, C.Y., et al. 2002, Gan

To Kagaku Ryoho, 29 Suppl 1, 194–200. 142. Bhutani, M., Pathak, A.K., Nair, A.S., Kunnumakkara, A.B., Guha, S., Sethi, G., et al. 2007,

Clin Cancer Res, 13, 3024–32. 143. Lee, H.K., Seo, I.A., Shin, Y.K., Park, J.W., Suh, D.J., and Park, H.T. 2009, Biochem Biophys

Res Commun. 144. Xiao, Z., Hao, Y., Liu, B., and Qian, L. 2002, Leuk Lymphoma, 43, 1763–8. 145. Hoessel, R., Leclerc, S., Endicott, J.A., Nobel, M.E., Lawrie, A., Tunnah, P., et al. 1999, Nat

Cell Biol, 1, 60–7.

32113 Targeting Stats in Cancer

146. Nam, S., Buettner, R., Turkson, J., Kim, D., Cheng, J.Q., Muehlbeyer, S., et al. 2005, Proc Natl Acad Sci USA, 102, 5998–6003.

147. Lee, Y.K., Isham, C.R., Kaufman, S.H., and Bible, K.C. 2006, Mol Cancer Ther, 5, 138–48. 148. Mohapatra, S., Chu, B., Wei, S., Djeu, J., Epling-Burnette, P.K., Loughran, T., et al. 2003,

Cancer Res, 63, 8523–30. 149. Byrd, J.C., Lin, T.S., Dalton, J.T., Wu, D., Phelps, M.A., Fischer, B., et al. 2007, Blood, 109,

399–404. 150. Shah, M.A., Kortmansky, J., Motwani, M., Drobnjak, M., Gonen, M., Yi, S., et al. 2005, Clin

Cancer Res, 11, 3836–45. 151. Kim, K.S., Sack, J.S., Tokarski, J.S., Qian, L., Chao, S.T., Leith, L., et al. 2000, J Med Chem,

43, 4126–34. 152. Shen, Y.C., Sung, Y.J., and Chen, C.F. 1998, Eur J Pharmacol, 343, 79–86. 153. Kong, C.W., Tsai, K., Chin, J.H., Chan, W.L., and Hong, C.Y. 2000, Shock, 13, 24–8. 154. Chen, S.C., Chang, Y.L., Wang, D.L., and Cheng, J.J. 2006, Br J Pharmacol, 148, 226–32. 155. Agarwal, C., Tyagi, A., Kaur, M., and Agarwal, R. 2007, Carcinogenesis, 28, 1463–70. 156. Kotha, A., Sekharam, M., Cilenti, L., Siddiquee, K., Khaled, A., Zervos, A.S., et al. 2006,

Mol Cancer Ther, 5, 621–9. 157. Nikitakis, N.G., Hamburger, A.W., and Sauk, J.J. 2002, Cancer Res, 62, 1004–7. 158. Scheper, M.A., Nikitakis, N.G., Chaisuparat, R., Montaner, S., and Sauk, J.J. 2007, Neoplasia,

9, 192–9. 159. Scheper, M.A., Nikitakis, N.G., and Sauk, J.J. 2007, Int J Oral Maxillofac Surg, 36, 632–9. 160. Sanz, M.A., Grimwade, D., Tallman, M.S., Lowenberg, B., Fenaux, P., Estey, E.H., et al.

2009, Blood, 113, 1875–91. 161. Wetzler, M., Brady, M.T., Tracy, E., Li, Z.R., Donohue, K.A., O’Loughlin, K.L., et al. 2006,

Clin Cancer Res, 12, 6817–25. 162. Cheng, H.Y., Li, P., David, M., Smithgall, T.E., Feng, L., and Lieberman, M.W. 2004,

Oncogene, 23, 3603–12. 163. Wang, M.M., Zhu, Q., Ren, Z.H., Zou, L.F., Dou, H.J., and Hu, J.P. 2008, Zhongguo Shi Yan

Xue Ye Xue Za Zhi, 16, 1064–8. 164. Parmar, S., Rundhaugen, L.M., Boehlke, L., Riley, M., Nabhan, C., Raji, A., et al. 2004, Leuk

Res, 28, 909–19. 165. Hussein, M.A., Saleh, M., Ravandi, F., Mason, J., Rifkin, R.M., and Ellison, R. 2004, Br J

Haematol, 125, 470–6. 166. Phillips, D.R., Rasbery, J.M., Bartel, B., and Matsuda, S.P. 2006, Curr Opin Plant Biol, 9,

305–14. 167. Huang, M.T., Ho, C.T., Wang, Z.Y., Ferraro, T., Lou, Y.R., Stauber, K., et al. 1994, Cancer

Res, 54, 701–8. 168. Nishino, H., Nishino, A., Takayasu, J., Hasegawa, T., Iwashima, A., Hirabayashi, K., et al.

1988, Cancer Res, 48, 5210–5. 169. Liby, K.T., Yore, M.M., and Sporn, M.B. 2007, Nat Rev Cancer, 7, 357–69. 170. Liby, K., Voong, N., Williams, C.R., Risingsong, R., Royce, D.B., Honda, T., et al. 2006, Clin

Cancer Res, 12, 4288–93. 171. Ahmad, R., Raina, D., Meyer, C., and Kufe, D. 2008, Cancer Res, 68, 2920–6. 172. Neviani, P., Santhanam, R., Oaks, J.J., Eiring, A.M., Notari, M., Blaser, B.W., et al. 2007,

J Clin Invest, 117, 2408–21. 173. Forman, B.M., Tontonoz, P., Chen, J., Brun, R.P., Spiegelman, B.M., and Evans, R.M. 1995,

Cell, 83, 803–12. 174. Lehmann, J.M., Moore, L.B., Smith-Oliver, T.A., Wilkison, W.O., Willson, T.M., and Kliewer,

S.A. 1995, J Biol Chem, 270, 12953–6. 175. Park, E.J., Park, S.Y., Joe, E.H., and Jou, I. 2003, J Biol Chem, 278, 14747–52. 176. Konopleva, M., Elstner, E., McQueen, T.J., Tsao, T., Sudarikov, A., Hu, W., et al. 2004, Mol

Cancer Ther, 3, 1249–62.

323

A Adaptor protein GRB2

anticancer drugs b -bend confi guration, 14 chronic myelogenous leukemia, 16 phosphatase resistance, 14 SH3 domain target selectivity, 15

cancer, 5–6 cell signaling

epithelial morphogenesis, 5 Src homology 2 (SH2) domain, 4

invasion and metastasis actin-based cell motility, 10 ADAMs inhibitors, 8 angiogenesis and dissemination, 12–13 Caldesmon, 11 ECM, 7 FAK autophosphorylation, 7 Hungtingtin, 11 Merlin-binding proteins, 10 podosomes, 11 scatter factor, 8

ADI. See Arginine deiminase (ADI) A Disintegrin And Metalloprotease

(ADAMs), 8 Amplifi ed in breast cancer 1 (AIB1)

biopsies and animal models androgen receptor (AR) coactivator, 141 cancer progression, 141 colony formation, 143 FISH, 140 mammary tumors, 142 pancreatic adenocarcinomas, 141

cancer etiology and signal transduction, 129–130

cell cycle regulation anti-estrogens, 151 cyclin D1, 151 endocrine resistance, 152 Rb, E2F1, 150

hormone-dependent mechanisms endocrine tumors, 145 ER function, 144 estrogen-dependent transcription, 145 sex steroids, 143 signaling pathways, 144

hormone-independent mechanisms ErbB/HER signaling pathway, 147 IGF/PI3K/AKT signaling pathway,

145–146 NF- k B signaling pathway, 147–148 Rb/E2F1, 148

IGF-I, 152–154 invasiveness mechanisms

Drosophila , 148 E-cadherin, 149 epithelial-mesenchymal transition, 149 phosphorylation, 150

physiology central nervous system, 138 development, 136–137 energy homeostasis, 138–139 infl ammatory process, 139 lymphocytes, 140 reproductive tissues, 137 TR b , 139

predictive and prognostic factors ER a Ser118, 157 HER2/Neu activity, 158 microRNA, 158

Index

M. Chatterjee and K. Kashfi (eds.), Cell Signaling & Molecular Targets in Cancer, DOI 10.1007/978-1-4614-0730-0, © Springer Science+Business Media, LLC 2012

324 Index

Amplifi ed in breast cancer 1 (AIB1) (cont.) steroid receptor coactivator/p160 family,

131–136 tamoxifen resistance

antiestrogen resistance, 154 endocrine therapy, 154 HER2/Neu, 154 histone acetyltransferase activity, 155 mechanisms, 156 PI3K/AKT pathway, 155

Anti-angiogenic therapy FGFR3 inhibitors, 100 VEGF inhibitors, 99

Arginine ADI-PEG20, 40 antitumor agent, 38 ASS(-) melanoma cells

ADI-PEG20, 47–48 anti-angiogenesis effects, 46 ASS expression and cisplatin

resistance, 45–46 radiation therapy, 46

citrulline, 38 growth and apoptotic signaling

autophagy, ASS(-) cells, 43–44 mTOR signaling, 42–43 RAF/MEK/ERK1/2 signaling, 43

hepatocellular carcinoma, 41 mesothelioma cell lines, 42 mycoplasma , 37 OCT, 38 urea cyle, 39

Arginine deiminase (ADI), 38 Argininosuccinate synthetase (ASS)

ASS(-) melanoma cells ADI-PEG20, 47–48 anti-angiogenesis effects, 46 ASS expression and cisplatin

resistance, 45–46 radiation therapy, 46

transfection, 39 Aromatase inhibitors. See Lung cancer Arsenic trioxide (ATO), 315 Arylamine N -acetyltransferase 1

acetyl-CoA, 24 androgens, 26 animal models, 29–30 breast cancer progression, 24 cancer, 30–31 drug target, 31–33 gene structure and polymorphism, 25–28 human and prokaryotic structure, 28–29 non-acetylated enzymes, 28 p -aminobenzoylglutamate, 25 phenotypic variation, 27

polymorphisms, 23 SNP, 27 therapeutic drugs, 24 transcriptional regulation, 26 xenobiotic-metabolizing function, 23

B Barrett’s epithelium (BE), 112 Bile acids

carcinogenesis, 110–111 chemical structures, 110 CRC

colon cancer and bile acids, 116–117 COX–2, 117–118

esophagus BE and esophageal adenocarcinoma,

112–113 CDX–2 and Barrett’s epithelium, 113 COX–2 expression and bile acids,

113–114 squamous cell carcinoma, 112

gastric carcinogenesis COX–2, 115–116 duodeno-gastric refl ux, 114–115

GPCR and EGFR EGFR transactivation, 119–120 gastrointestinal tumors, 118 metalloprotease, 119

C Caenorhabditis elegans , 3 cAMP-responsive element (CRE), 57 Colorectal cancer (CRC)

colon cancer and bile acids, 116–117 COX–2, 117–118

Cortactin, 11 Cyclooxygenase (COX), 111

D Dialkyl disulfi de (DADS), 288 Drug target, NAT1

acetyl-CoA, 24 androgens, 26 animal models, 29–30 breast cancer progression, 24 cancer, 30–31 gene structure and polymorphism, 25–28 human and prokaryotic structure, 28–29 human isoenzymes, 23 non-acetylated enzymes, 28 p -aminobenzoylglutamate, 25 phenotypic variation, 27

325Index

polymorphic acetylation, 24 SNP, 27 therapeutic drugs, 24 transcriptional regulation, 26 xenobiotic-metabolizing function, 23

E Endothelial cells (ECs), 213 Esophagus

BE and esophageal adenocarcinoma, 112–113

CDX–2 and Barrett’s epithelium, 113 COX–2 expression and bile acids, 113–114 squamous cell carcinoma, 112

Estrogen receptors ER a , structure of, 192 fulvestrant, 194 gene transcription, 192 human primary lung tumors, 200–201 lung biology, 194 mitochondria, 198–199 SERMs, 193

Extracellular matrix (ECM), 7, 69

F Farnesoid X receptor (FXR), 109 Farnesyltransferase inhibitors (FTIs), 94–95 Fibroblast growth factor receptor 3 (FGFR3), 100 Fluorescence in situ hybridization (FISH), 140 Focal adhesion kinase (FAK), 7

G Gastroesophageal refl ux disease (GERD), 112 G protein–coupled receptor (GPCR)

EGFR transactivation, 119–120 FXR and colon carcinogenesis

chronic infl ammation, 122 deoxycholic acid, 122 glucose metabolism, 123

gastrointestinal tumors, 118 metalloprotease, 119 M 3 muscarinic receptor and EGFR

activation, 120 TGR5 and EGFR transactivation, 120–121

G-Quartet oligodeoxynucleotides (GQ-ODNs) cancer cells, 177 drug delivery and activity in vivo, 177–179 intracellular delivery system

DNA anti-cancer agent, 174 endocytosis, 176 potassium-dependent formation, 174

structure-based drug design, 172

T40214, Stat3 activation anti-cancer agent, 172 cancer therapy, 182–184 DNA-binding activity, 174 IC50, 173 low-toxicity agents, 185 NSCLC tumors, 187 polyethylenimine, 185 prostate cancer therapy, 179 tumor growth, 182 TUNEL assay, 185 in vivo effects, 181

Growth factor receptor-bound protein 2 (Grb2) signaling

adaptor proteins, 1–2 angiogenesis and dissemination, 12–13 Grb family, 2–3 metastatic cascade

actin-based cell motility, 10 ADAMs inhibitors, 8 caldesmon, 11 ECM, 7 FAK autophosphorylation, 7 Hungtingtin, 11 Merlin-binding proteins, 10 podosomes, 11 scatter factor, 8

H Heat shock proteins (HSPs), 95 Hedgehog (HH), 67 Humoral hypercalcemia of malignancy

(HHM), 53 Huntington’s Disease, 11

I Insulin-like growth factor-I (IGF-I), 92 Interleukin–6 (IL–6), 89 Isoobtusilactone (IOA), 287

L L-asparagine, 37 Listeria monocytogenes , 9 Lung cancer

aromatase immunohistochemistry, 205 postmenopausal breast cancer patients, 205 tamoxifen, 206

estrogens endogenous and exogenous, 195–196 estrogen-responsive tissue, 194 mitochondria, 198–199

326 Index

Lung cancer (cont.) membrane-initiated steroid signaling,

197–198 NSCLC, 196–197

M Microparticles (MP) dissemination

blood product storage and processing, 214–215

cancer-associated thrombosis, TF antigen, 228–229 hypercoagulability, 228 mouse models, 229 procoagulant activity, 229

cisplatin, 214 hemostatic factors, 213–214 hypoxia, 214 infl ammatory cytokines, 214 measurement of, 215 mechanism of, 212–213 platelet activation factors, 214 platelet-derived MP, 225–227 thrombus development, 234–235 tumor cell-derived MPs

angiogenesis, 218–222 immune escape, 222–223 metastatic foci, 223–225 tumor invasion and metastasis, 217–218

Mitogen-activated protein kinase (MAPK), 62 Multiple myeloma (MM)

bone marrow microenvironment immunomodulatory therapies, 98–99

epidemiology and aetiology, 87 FGFR3 inhibitors, 100 growth-promoting signalling cascades

Bcl–2 protein family, 93–94 FTIs, 94–95 IGF-I signalling, 92 IL–6 signalling system, 89–92 NF-kB pathway, 92–93 PI3K/AKT pathway, 93

HDAC inhibitors, 97 Hsp90 inhibitors, 95–96 pathobiology, 87–89 P38 MAP kinase inhibitors, 100 proteasome inhibitors

bortezomib, 96 carfi lzomib (PR–171), 97 NPI–0052, 97

TGFb inhibitors, 100–101 TRAIL, 95 VEGF inhibitors, 99

Mycoplasma , 37

N Non-small cell lung cancers (NSCLC)

classical genomic estrogen-signaling pathway, 197

EGFR, 202–204 estrogen receptors, 200–201 membrane-initiated steroid signaling, 197–198 preclinical models, 196–197 subtype-selective ligands, 201–202

N-Wiskott–Aldrich Syndrome protein (N-WASp), 9

O Ornithine carbamoyl transferase (OCT), 38 Oxidative stress (OS)

antioxidants, 284–285 carcinogenesis, stages, 275–277 chemotherapeutic agents and preventions

acacetin, 288 aminofl avone, 285–286 berberine, 288 curcumin, 286 DADS, 288 decursin, 287 formaldehyde, 287 genipin, 287 IOA, 287 nitric oxide, 286 onion, 289 PAC–1 and UCS1025A, 288 phytochemicals, 289 polyphenols, 286–287 quinoline quinone, 287 radiation, 286 resveratrol, 286 selenium, 288 SOD, 289

chronology, 275 endogenous agents

bile acids, 280 interleukin, 279 leukotriene receptor, 278 Nox and Duox enzymes, 278 redox modifi cations, 279 ROS-mediated cell signaling, 277

exogenous agents alcohol, 283 benzene, 283 curcumin, 283 endosulfan, 283 estrogen quinone, 284 ginkgo biloba, 283 hydrogen peroxide, 282

327Index

metals and particulates, 281–282 PAHs, 284 ultraviolet radiation, 282

tenets of, 274–275

P Parathyroid hormone–related protein (PTHrP)

apoptosis caspase–3 activation, 68 cell proliferation, 67 death receptors and mitochondria, 68 transcriptional activation, p53, 69

bone metastases adhesive interactions, 74 anabolic effects, 76 bone-resorptive cytokines, 75 cancer proliferation, 75 osteolytic metastases, 74 PSA, 77 skeletal metastatic involvement, 73 TGF- b , 76

cancer cell growth adenylate cyclase, 59 b -arrestins, 60 ERK1/2 by Ga q , 65–67 ERK1/2 by G

s , 63–64

functional domains of, 59 GPCR kinases, 59 ligand-independent mechanism, 61 microtubule integrity, 62 NHERF, 60 nuclear translocation, 62 osteosarcoma cells, 61 polyhormone, 58 skin carcinogenesis, 58

gene structure and regulation cancers and tumor-derived cell lines, 55 CpG dinucleotide sequences, 58 CRE, 57 Ets factors, 56 methylation, 58 protein isoforms, 54 Ras–MAPK pathway, 56 transcriptional process, 54 3’-untranslated region, 55 VDRE, 57

invasiveness and integrins basement membrane adhesion and

transversion, 71 a 6 b 4 integrin, 72 cell adhesion/migration, 70 ECM, 69 intracrine mechanism, 71

LoVo colon cancer cells, 72 matrix proteolysis and degradation, 69 transcriptional mechanism, 70

Phosphatidylethanolamine (PE), 212 Photodynamic therapy (PDT), 280 Platelet-derived MP (PMP), 225 Polycyclic aromatic hydrocarbons (PAHs), 284 Polyethylene glycol (PEG), 40 Prostate-specifi c antigen (PSA), 77 Proteasome inhibitors

bortezomib, 96 carfi lzomib (PR–171), 97 NPI–0052, 97

Protein disulfi de isomerase (PDI) cellular sources, 232 cryptic and coagulant TF, 231–232 TF, modulation of, 232 thrombus formation, 233

Protein kinase D (PKD) actin cytoskeleton, 246 angiogenesis, 260–261 autoinhibitory mechanism, 245 breast cancer, 260 chemoresistance, 255–256 domain structure and phosphorylation-

dependent regulation, 246 gastric cancer, 259 oncogenic signaling, 262 PKD3, 247 prostate cancer, 260 signaling mechanisms

activation loop phosphorylation, 250–251 initial activation step, 250 phosphorylation and protein

interactions, 251–252 tyrosine phosphorylation, 251

tumor cell migration and invasion cargo transport, 258 cell–cell and cell–matrix aggregation, 257 chemotactic stimulus, 257 cortactin, 257 fi lopodia formation, 257 multiple matrix metalloproteases, 258 multiple myeloma, 259

tumor cell proliferation, 252–253 tumor cell survival signaling, 254–255 upstream activators

cleavage, 250 G proteins, 248–249 growth factor receptors, 248 oxidative stress, 249 RhoGTPases, 249

upstream signaling events phorbol esters, 248

328 Index

S Selective estrogen response modifi ers

(SERMs), 193 Signal transducer and activator of transcription

(STAT) activation–inactivation cycle, 300–301 ATO, 315 function, 301–302 natural compounds

cucurbitaceae , 312 curcumin, 313 indirubin, 314 magnolol, 314

peptidic inhibitors and peptidomimetic inhibitors, 308

phosphorylation and activation, 302–303 protein inhibitor of activated STAT, 303 serine phosphorylation, 303 small-molecule non-peptidic inhibitors

DNA binding domain, 309–310 N-terminal domain, 310–311 oligonucleotides, 311–312

sulindac, 315 transcription factors, 303 triterpenoids, 315 tumor biology

angiogenesis, 306–307 constitutive activation, 304–305 immune surveillance mechanisms,

307–308 neoplasms, 304 tumor cell proliferation, 305–306

tyrosine kinase inhibitors, 312 Signal transducer and activator of transcription

3 (STAT3) biological functions, 168 cancer therapy, 168 cytokines and growth factors, 167 DNA inhibitors, 170 G-quartet oligonucleotides, 170–171 immune system, 188 organic compounds, 169 peptide inhibitors, 169–170 protein inhibitors, 170 signaling pathway, 168 T40214

anti-cancer agent, 172 cancer therapy, 182–184 DNA-binding activity, 174 IC50, 173 low-toxicity agents, 185 NSCLC tumors, 187 polyethylenimine, 185 prostate cancer therapy, 179

tumor growth, 182 TUNEL assay, 185 in vivo effects, 181

tumor microenvironment, 187 tyrosine residue, 167

Single nucleotide polymorphisms (SNP), 27 Steroid receptor coactivator (SRC)

basic helix-loop-helix, 132 DNA-binding domain, 131 HAT activity, 133 non-transcriptional factors, 134–135 nuclear receptors, 131 structural domains, 132 transcriptional activation domain, 133 ubiquitin-proteasome system, 136

T Tamoxifen resistance

antiestrogen resistance, 154 endocrine therapy, 154 HER2/Neu, 154 histone acetyltransferase activity, 155 mechanisms, 156 PI3K/AKT pathway, 155

TGN. See Trans-golgi network (TGN) Thalidomide, 98 Thyroid hormone receptor beta (TR b ), 139 Tissue factor (TF)

antigen, 228–229 cellular origin, 230 cellular sources, 232 cryptic and coagulant, 231–232 hypercoagulability, 228 modulation of, 232 mouse models, 229 procoagulant activity, 229, 231 thrombus formation, 233

Trans-golgi network (TGN), 258 Tumor-derived MPs (TMPs)

angiogenesis, 218–222 immune escape, 222–223 metastatic foci, 223–225 tumor invasion and metastasis, 217–218

V Vaccinia virus, 9 Vascular endothelial growth factor (VEGF), 99 Vitamin D–responsive element (VDRE), 57

W Wiskott–Aldrich syndrome protein (WASp), 257