characterization of a single copy gene encoding ferredoxin i from pea

The Plant Cell, Vol. 1, 681 -690, July 1989 O 1989 American Society of Plant Physiologists

Characterization of a Single Copy Gene Encoding Ferredoxin I from Pea

Robert C. Elliott,”3c Thomas J. Pedersen,” Brian Fristensky,” Michael J. White,” Lynn F. Dickey,” and William F. Thompsona.b91 a Department of Botany and bDepartment of Genetics, North Carolina State University, Raleigh, North Carolina 27695

Department of Biological Sciences, Stanford University, Palo Alto, California 94305

We have isolated, mapped, and sequenced a genomic clone containing the ferredoxin I (Fed-7) gene from Pisum safivum. The gene is present as a single copy per haploid genome. It has no introns, and it specifies a 753- nucleotide transcript encoding a 149-amino acid protein including a 52-residue transit peptide. Upstream sequences from Fed-7 contain several elements with similarity to transcriptional regulatory elements from RbcS and Cab genes, and gel mobility shift assays show that nuclear extracts from light-grown pea leaves contain one or more DNA binding activities specific for Fed-7 5’-flanking sequences. RbcS and Cab regulatory sequences are only weak competitors for this binding, however, and the RbcS and Cab similarities mostly lie outside of the region essential for binding. These data are discussed in terms of previously observed physiological differences between the light responses of Fed-7 and other genes.

INTRODUCTION

Ferredoxins are a class of low molecular weight (-1 0,000) soluble proteins first identified by their ability to support photosynthetic reduction of hemes added to washed chloroplasts (reviewed by Arnon, 1977, 1988). Subsequently, it was shown that ferredoxins serve to transfer electrons from photosystem I to ferredoxin/NADP+ reductase, or to cytochrome b563 in cyclic photophosphorylation. Most plants have two or more forms of ferredoxin, and ferredoxins also play a role in other metabolic pathways such as sulfate reduction (Schmidt and Trebst, 1969), nitrite reduction (Ramirez and De1 Campo, 1966), and fatty acid desaturation (Nagai and Block, 1966).

Previously, we have described a ferredoxin I cDNA clone (Dobres et al., 1987) and compared the light responses of this mRNA to those of several other genes (Kaufman et al., 1986; Sagar et al., 1988). Differences between these responses led us to suggest that the molecular mecha- nisms regulating Fed-1 mRNA abundance differ from those affecting RbcS and Cab mRNAs (Thompson, 1988). To begin an analysis of ferredoxin responses at the molecular level, we have now sequenced a genomic clone containing the Pisum sativum Fed-1 gene. We report the Fed-1 sequence, several of its potentially significant features, and a DNA binding activity specific to a possible regulatory region upstream from the transcription start site.

’ To whom correspondence should be addressed.

RESULTS

Genomic Clones

We prepared a Hindlll library of pea nuclear DNA as described in Methods and screened it with 3’P-ni~k-tran~- lated pEA46, the Fed-1 cDNA clone identified by Dobres et al. (1 987). Consistent with our previous suggestion that Fed-1 is a single copy gene (Dobres et al., 1987), we isolated four independent genomic clones that have indis- tinguishable restriction maps in the 1 O-kb region in which they overlap. We infer that these clones represent the same gene, strengthening the argument that Fed-1 is present in a single copy per haploid pea genome.

At least one additional ferredoxin gene must exist to code for ferredoxin 11, which is widely distributed in higher plants (Sakihama and Shin, 1987) and which can differ considerably from ferredoxin I in amino acid sequence. In pea, there are 15 differences between ferredoxins I and II in the 40 residues of N-terminal amino acid sequence for which ferredoxin II data are available (Dutton et al., 1980). It is, therefore, unlikely that our Fed-1 DNA probes would hybridize at normal stringency with gene(s) for ferredoxin II.

The clone XPS4601 was selected for more detailed analysis. A 4.8-kb EcoRl subclone hybridizing to pEA46 was more extensively restriction mapped, and a 2000-bp region containing the Fed-1 gene was sequenced on both strands. The sequence is presented in Figure 1A and will appear in the EMBL/GenBank/DDBJ nucleotide sequence databases under the accession number X14207.

Dow

nloaded from https://academ

ic.oup.com/plcell/article/1/7/681/5970357 by guest on 27 Septem

ber 2021

682 The Plant Cell

The deduced P. sativum ferredoxin I amino acid sequence is similar to those determined by protein sequencing in other plant species (Matsubara and Hase, 1983). Examples are shown in Figure 1B. Primer extension sequencing reactions with poly(A) RNA (data not shown) and comparison with two cDNA and several protein sequences (Figure 1C) show that the Fed-1 gene has no introns within the coding region. We cannot formally exclude the possibility of introns in the 5’-untranslated and 3’-untranslated regions; however, since transcript mapping with the genomic clone (see below) predicts an mRNA of the size we observe on RNA gel blots, any such introns would have to be quite short.

Transcript Mapping

The strategies used for RNase protection mapping are shown in Figure 2A. The major 5’ end identified by RNase mapping as shown in Figure 2B is designated as nucleotide + l . This band is also seen in primer extension experiments such as that illustrated in Figure 2C. A band at -8 is also seen in RNase protection experiments, and primer exten- sions produce a cluster of faint primer bands between -6 and about -15. The significance of these bands is not clear. A start site at +1 would be 28 bp downstream from a sequence that resembles a TATA box (Figure 2A). Most promoters have a TATA box between 19 bp and 27 bp upstream of the transcription start (McKnight and Kings- bury, 1982; Heidecker and Messing, 1986). At the 3’ end of the transcript (Figure 2D), the major protected band corresponds to a site 19 bp downstream from a putative polyadenylation signal (Joshi, 1987) and 4 bp upstream from sequences resembling a GU-rich element required for correct polyadenylation in many eukaryotic genes (Gil and Proudfoot, 1987).

Comparison of Pea and Silene Transcribed Sequences

Figure 1 C shows that the pea Fed-1 gene sequence contains several regions of similarity to the Silene Fed-1 cDNA sequenced by Smeekens, van Binsbergen, and Weisbeek (1985). The coding region is conserved, whereas both the 3’-untranslated and 5’-untranslated regions show consid- erable divergence. However, as shown in Figure 1 D, there is a stretch of about 40 bp in the 3’-nontranslated region in which the pea and Silene sequences show significant similarity, including a 1 O-bp core of identical sequence. This region is of interest because it includes the putative polyadenylation signal and because elements involved in controlling mRNA stability are similarly located near the 3‘ ends of several animal mRNAs (reviewed by Hunt, 1988). No similarity was found between pea Fed-1 and Anacyctis petF mRNAs in the untranslated regions.

Comparison of Fed-7 5’-Flanking Sequences with Those of Other Light-Responsive Genes

Many genes are regulated at the transcriptional level, and the cis-acting elements involved in this regulation are commonly short, conserved sequences situated near the 5‘ end of the gene (Maniatis, Goodburn, and Fischer, 1987). Recent work on two light-regulated genes in plants, RbcS and Cab, has revealed several major consensus motifs that may represent important light-response elements. We compared sequences 5’ to the Fed-1 gene with these motifs.

Grob and Stüber (1987) identified a block of similarity containing the “LAMP” site, CCTTATCAT, near the TATA box in a number of light-regulated (mostly RbcS) genes. However, when we applied the Grob and Stüber algorithm to the Fed-1 gene, we found no sequences that would identify Fed-1 as a phytochrome-dependent, light-inducible gene by their criterion.

Castresana et al. (1 987,1988) proposed two consensus motifs based on their work with Cab genes. As shown in Figure 3A, there are two elements in Fed-1 with recogniz- able similarity to the CAAT/GATA motif, which is found -100 bp upstream from the translation start site of Cab genes in a wide range of genera. We were unable to find significant similarity to the other Cab gene consensus element (ACCGGCCCACTT) identified by Castresana et al. (1988).

Giuliano et al. (1 988) compared the upstream sequences of several tobacco and tomato RbcS genes and found regions of similarity 13 bp to 19 bp in length, which they designated the L, I, and G boxes. The G box has been found in RbcS genes from Arabidopsis, tomato, soybean, and pea, and was shown to bind a factor (G box binding factor) present in nuclear extracts from tomato and Ara- bidopsis. Figure 38 shows that sequences similar to these three boxes can be found in Fed-1. However, as shown in Figure 4, the spacing of these elements in Fed-1 did not correspond to that in RbcS genes.

A different set of conserved sequence motifs, designated boxes I to V, was described by Fluhr et al. (1 986a) for pea RbcS genes. Box IV is similar to a TATA box, and box V is found at the transcription start site. Boxes I, II, and 111 are found in close proximity between about 160 nucleotides and 11 O nucleotides upstream of the transcription start site. Boxes II and 111 of RbcS-3A have been shown to be important for light regulation by in vitro mutagenesis, using transgenic plants to assay the light responses of the modified genes (Kuhlemeier et al., 1987). In addition, DNase footprinting experiments have shown that a nuclear protein designated GT-1 can bind to boxes II, II*, 111, and 111* (Green, Kay, and Chua, 1987).

As shown in Figure 3C, the upstream sequences of Fed- 1 have several similarities to corresponding regions in the pea RbcS-3A gene. Figure 4 shows the locations of these elements in the two genes, as well as locations of the sequences noted above in connection with other RbcS

Dow



ber 2021

A -600 -500 -400 -300 -200 -100 t1 +101 1201 +301 t401 t501 t601 t701 t801 t901 tlOOl t1101 t1201 t1301

B Spinach

Pisum Medicago

C P . S . P . S . s .p . A.n. P.S. P.S. s . p . A.n.

P . S . P.S. S . P . A.n. P . S . P .S . s . p . A . n .

P . S . P . S . s . p . A . n .

P . S . P . S . s .p . A.n. P . S . P . S . S .P. A.n. P . S .

D

5 ' s.p.

3 ' s.p.

5 ' P.S.

3' P.S.

Figure 1.

GACC'I'C1':'TGTSACAI A ' G'I'CAAAGACCCA(; 1 XMCGTASCI 7 :'I'C'TATMCTCT_CATIAT.~~~A'l'C : C; ATTAAGATAAAGATACCTTAAGCCCCCA TGAMXTCACATACTCATGTGCTAAAT TTAAM'I'ATTXCAAACC': TCTCTYZC'I' TT !"I'IIATTAACT_AATTTAAT~~ATG ATGMGACT': GAZ'lAnTTAGT :'ACCACA TCA'IAhAAGA(;ATACA1'AACCTGA~GCA~AAAAC~TCCCACCTI~CA ACAACCTCCTTATTTCATTCAT'I'CATTCAI' I'CTCTATC'~':'1"rTA~CAl' u MCCACACCAGCTTTGTATGGAACTGCTGTCAGCACTTCCTTCCTCAGGACTCAGCCAATGCCMTGTCAGTCACCACCACAAAAGCATTTTCCMTGGC TTTCTCGGTTTGAAAACCAGTCTCAAACGTGGAGATCTTGCAGTTGCTATGGCTTCTTACAAAGTGAAACTAGTTACACCAGATGGMCTCAAGAGTTTG AATGTCCAAGTGATGTTTACATTCTTGACCATGCTGMG~GTTGGMT~GATCTTCCTTACTCATGCAGAGCTGGCTCTTGTTCTTCATGTGCTGGTM

A S Y K V K L V T P D G T Q E F E C P S D V Y I L D H A E E V G I D L P Y S C R A G S C S S C A G K AGTTGTTGGCGGTGAAGTTGATCAATCTGATGGTTCTTTCCTTGATGATGMCAGATTGMGCTGGTTTTGTTCTTACTTGTGTTGCTTATCCTACCTCT V V G G E V D Q S D G S F L D D E Q I E A G F V L T C V A Y P T S

GATGTTGTTATTGAGACTCACMGGAAGAAGATCTCACTGCTTMTTTTTCATTTCTGTTACTGCTATGCTATGATATGATATCATGTTATGTTTGTTTC rACAATGAGTAGTMCTCTATT~TTCCTTCACCTGTTTGTAGT~CATGTGAAGTT~T~TGTTATGTTATGTTGTTTTTTTGCTCACAATTCTT~ rTTCCTATCTTTTCTTCGGTTGACTATTATATAAAATTTGATATTATTCATCAAGTGTTTTATTMGCATGGATTTTCATGTCTAACAAGTAGTT GATGTATGATTATGGTCAGGACAGGACCCTCTTTGAGGGCGTGCMGACAGACTCCGATTTGACATGTAGGGCTTCGAAAACTTMGACGATACTGATTA TGATGCTAAATTTATTGATTCTAGTAATGTGATATATAATATACATCTATGTTTGATAGAGTTCMGMTGATTTGCACATCTATACTAAACTATATAGG ATTCTAGTCTGTTATGCAGTAG~TTTAAATACATACATATGACACTTAAAATTGATCATGTTTTGTGAAACAFVlTCTTGMGAGTTTCGACTTTAGTCTCGT CTCTGTCGCCMCATCATTGTAATGTGMTTMTATGTCTGGATTTG~~TCAGTTGAGTCATGGAGGTTGTTAGMGTCAC~TC~CTGGTCT ACTGAAGTTACTGTCATCTGATGCAAAGACTCTMGTCTMTGMGTGTCGAGTCAGCGTCCCGGATAGCGATAGTTATCTCATGGCCCTCTCATCGATG TGATTCTAGGGAACATAGTTGATC

D V V I E T H K E E D L T A

A

Sequence of the Pea Fed-7 Gene and Comparison with Protein and cDNA Sequences.

(A) Nucleotide sequence of the gene and flanking regions. The nucleotides are numbered from the 5' end of the major RNA species (see text). The 3' end is marked with a triangle. The deduced amino acid sequence is shown below the nucleotide sequence, with amino acids in the putative transit peptide underlined. Nucleotide sequences similar to those involved in polyadenylation in other organisms (Gil and Proudfoot, 1987) are underlined. (6) Comparison of the derived amino acid sequence from the pea genomic clone with amino acid sequences determined for ferredoxin I proteins from Medicago safiva and Spinacia oleracea. Single dots represent conservative substitutions, double dots represent identical residues. (C) Comparison of the nucleotide sequence of the transcribed region of the pea Fed-7 genomic clone (top) with sequences from a pea cDNA (Dobres et al., 1987), a Silene pratense cDNA (Smeekens, van Binsbergen, and Weisbeek, 1985), and an Anacysfis nidulans genomic clone (Reith, Laudenbach, and Strauss, 1986). ldentical nucleotides are indicated by asterisks. Dashes indicate gaps. The deduced translation start and stop sites of the pea gene are marked Met and Stop. The downward arrow indicates the site at which the precursor peptide is probably cleaved (Keegstra and Bauerle, 1988). (D) Comparison of 3'-untranslated and 5'-untranslated sequences of the pea Fed-7 gene with corresponding regions of the cDNA sequence from S. pratense determined by Smeekens, van Binsbergen, and Weisbeek (1985). The alignments were chosen using the regions of highest similarity found with the Genbank program "SEARCH." The asterisks show conserved nucleotides. The nucleotide sequence at the 5' end of the Silene transcript is not known beyond the point indicated, so the region of similarity might be larger than that indicated in the figure. The underlined regions represent the sequence similarities discussed in the text.

Dow



ber 2021

684 The Plant Cell

-800 -400 1 +400 +800 +1200ATG TAA

S C

1 2 3

B BE H A

1 2 1 2 3

I

I + 753

Figure 2. RNase Protection and Primer Extension Mapping.

(A) Diagram showing the strategies used for mapping. The probefor RNase protection mapping was synthesized with T3 RNApolymerase and the plasmid pRE658 digested with Hinfl, produc-ing a probe that extended from -119 to +127. The oligonucleotidefor primer extension mapping hybridized to nucleotides between+186 and +202. The probe for RNase protection mapping of the3' end extends from the Hincll site at +582 to the Avail site at+827.(B) RNase protection mapping at the 5' end. Lane 1, no RNA;lane 2, tobacco RNA; lane 3, pea RNA.(C) Primer extension mapping at the 5' end. Lane 1, sequencing(T reaction) of Fed-1 genomic subclone pRESO, using the sameprimer. In this reaction, stops are obtained where A residues areindicated in Figure 1; lane 2, primer extension of pea poly(A) RNA.(D) RNase protection mapping at the 3' end. Lane 1, no RNA;lane 2, tobacco RNA; lane 3, pea RNA.

genes. The overall arrangement shows both similaritiesand differences, and functional assays will clearly be re-quired to establish whether or not any of these elementsplay a role in regulating Fed-1 transcription.

DNA Binding Assays

As the first of several approaches to a functional analysisof transcriptional regulatory elements, we have begun ananalysis of factors in pea nuclear extracts that interactwith Fed-1 promoter sequences. Figure 5A shows thattwo distinct bound complexes (BC1 and BC2) were re-solved in gel shift experiments (Fried and Crothers, 1981)

A. PEA FED-1CCAACAATATGTGGTGATAAAAGAGATAGATA

PEA FED-1CAATGCCACCTGGCAGATAGGGTTGCATGCAG

PEA RBCS 3ACAATATTAAGACCATAATATTGGAAATAGATA** * * *** ****

PEA AB80CCAACTAGCCATAGCTTTAGATAACACACGATA

(Slnt) TATA -28

( 4nt) TATA -28

(13nt) TATA -27

(13nt) TATA -30PETUNIA 22LCCAATGAAATTGTAGATAGAGATATCATAAGATAA (21nt) TATA ca.-37* * * * * * * * * * * * * * * *ARABIDOPSIS AB165CCAATGAATGAACAGATAAAGATTACTTCAGATA (23nt) TATA -34LEMNA AB30CCAATGGCGTGCCGCCAGTAGATATCGGTGGATA (34nt) TATTA -36

CAB CONSENSUSCCAATT GATA GATA GATA TATA

B. LBOXFed-1 ATTCACCAAC -110

cons AAATTAACCAACT ca. -280Fed-1' AAATTAAC -283

I BOXCOOS CTAGGATGAGATAAGATTA ca. -230Fed-1' TGATATAAGATAT -258

GBOXcons TCTTACACGTGGCA ca. -200Fed-1' TCTGCCTGGTGGCA -51

C. BOXES I AND IIFed-1 TTTTAAATACTATAAGGTGAAGATG -132

RbcS 3A I TTTCAAA|rCT1|GTGTGGTTAATATG| -138* * * * * * * *

Fed-1 ATGTGGTGATAAAA -101BOX III

Fed-1 TATTTTTTTATCTAT -234

RbcSSA TTTIATCATTTTCACP'ATC -112(-248 £or box III*)

BOX IVFed-1 CAGTTCATATAGCAGCTT -21

RbcS 3A IACATTATATATACCAAGTT -18—— —BOXV

Fed-1 TTTCCACAAGCTCCTATTT +7

RbcS 3A TTAGCAqAAGCTTTTGCAA] +13

Figure 3. Comparison of Fed-1 5'-Flanking Sequences with Ele-ments Thought To Be Involved in Regulating Transcriptional Initi-ation in Cab and RbcS Genes.

(A) Details of the nucleotide sequence extending from the CAATbox to the TATA box in pea Fed-1, pea RbcS, and several Cabgenes (from Figure 5 in Castresana et al. (1987). The Fed-1 geneis shown twice to compare the spacing of the two copies of themotif. The distance from the TATA box to the transcription startsite is indicated.(B) Sequences from Fed-7 showing similarity to the L, I, and Gbox consensus sequences described by Giuliano et al. (1988) forseveral RbcS genes. Primes indicate that a given fed-1 sequenceis in the opposite orientation from that of the corresponding RbcSelement.(C) Sequences from Fed-1 showing similarity to conserved se-quences (boxes I to V) identified by Fluhr et al. (1986a) in fourpea RbcS genes.

Dow



ber 2021

Characterization of Fed-7 from Pea 685

Fed I I I 1 L 11 1v v

-n n .: .:.: . .

- 4 0 0 < G L I 111 - RbcS

I I I * * L I G I I * I I I IV v .:.:. :,:.:.:..:., n n n g

l u I U I L

11’. 111’ 111 - 4 0 0

Figure 4. A Schematic Representation of the Pea Fed-7 Gene and a Hypothetical RbcS Gene Showing the Positions and Ori- entations of the Simiiarities in Figure 3.

The gene used to locate the L, I, and G boxes (shown in grey) was RbcS-8B from Nicotiana plumbaginifolia (Poulsen et al., 1986), while the locations of boxes I to V (shown in white) were taken from the pea RbcS-3A gene (Fluhr et al., 1986a; Green et ai., 1988). Pea RbcS-3A does not contain an L or an I box. The CAAT/GATA boxes (Castresana et al., 1987) are shown in black. Numbers indicate the distance from the transcription start site. Boxes shown below the line represent sequences in the opposite orientation from those shown above the line.

with a 5‘ Fed-7 probe and nuclear extracts prepared as described by Green, Kay, and Chua (1987). The Fed-7 probe comprised nucleotides -23 to -494, and thus included all the sequences discussed in the preceding sec- tion except those corresponding to RbcS box V and part of the box IV similarity.

Both bound complexes involve interactions with some degree of sequence specificity since they are seen under conditions in which nonspecific binding of vector DNA has been eliminated by the inclusion of excess poly(d1-dC:dl- dC), and since no bound complexes were seen with probes containing selected sequences from the protein coding or 3’-untranslated regions of Fed-7. In the case of BC2, specificity could also be demonstrated in the competition experiments that are described below. Figure 58 shows that binding activity was completely abolished by treating the extracts with proteinase K, whereas RNase A was ineffective. Pretreatment of the extracts with heat (90°C, 1 O min) resulted in the selective loss of the ability to form BC2, but had little or no effect on the formation of BCl. These results indicate that these factors are composed, at least in part, of protein and that at least two activities differing in thermal stability are involved.

Since the Fed-7 promoter contains sequences similar to known enhancer-like elements in the RbcS promoter, we carried out competition experiments in which excess unlabeled DNA from the pea RbcS-3A promoter was included in the binding reactions. The fragment we used contains binding sites for the RbcS binding factors GT-1 (Green,

Kay, and Chua, 1987; Green et al., 1988) and GBF (Giuli- ano et al., 1988). Figure 5C shows that this RbcS fragment is not an effective competitor in the formation of BC2, whereas excess unlabeled Fed- 7 fragment competes as expected. Unrelated sequences, such as vector DNA, also do not compete in BC2 formation.

We do not see similar competition effects in the case of BC1, even in self-competition experiments with unlabeled Fed-7 promoter fragment. However, as noted above, we also do not see BCl with other probes and thus do not believe it represents a completely nonspecific interaction. At present, we can only speculate that BC1 involves an abundant protein(s), so that binding is not saturated even at high concentrations of DNA. If this assumption is correct, we must also suppose that BC1 is characterized by a relatively high dissociation constant to account for the presence of significant amounts of free probe even in the absence of competitor DNA. Clearly, more evidence will be required to clarify the nature of this interaction.

The different sensitivities of BCl and BC2 in competition experiments suggest that different types of binding interactions are involved, which is consistent with the data on differential thermal stability mentioned above. In addition, we can separate sequences required to form BC1 from those required to form BC2 in progressive deletion experiments such as that illustrated in Figure 6. Deletions were made from the 3’ end of the promoter fragment as described in Methods, and a series of size classes eluted from a polyacrylamide gel were tested in the gel retardation assay. BC2 formation was eliminated when sequences between approximately -265 and -300 were removed. BC1 formation was unaffected in these assays, but was eliminated by extending the deletion to about -340.

DISCUSSION

Previous work from this laboratory has shown that Fed-7 mRNA accumulates more rapidly than RbcS or Cab mRNA (Kaufman, Briggs, and Thompson, 1985) and shows an unusual requirement for active phytochrome even after accumulation is complete (Kaufman et al., 1986). In addition, light increases Fed-7 abundance only in the cytoplasm, whereas transcripts of other genes increase in both cytoplasm and nuclei (Sagar et al., 1988). We have sug- gested that Fed- 7 response involves molecular mecha- nisms different from those known to operate in the case of RbcS and Cab genes (Thompson, 1988).

The binding data presented here raise the possibility that protein factors regulating Fed- 7 transcription may differ from those regulating other light-responsive genes. In this connection, it is important to recognize that we do not yet know whether light affects transcription of Fed-1. “Run on” transcription assays have so far been inconclu- sive, whereas experiments with chimeric gene constructs show that the transcribed portion of Fed-7 conveys normal light responsiveness even when driven by a cauliflower

Dow



ber 2021

686 The Plant Cell

B

V e c t o r

I VectorVector

Inser ts

I——BC1 .Illlall,BC2

—— BC1

2Q. zo

pBS- Fed-1 RbcS

Figure 5. Pea Nuclear Extracts Contain One or More Factors That Bind Specifically Upstream of Fed-1.

(A) Different portions of the Fed-1 genomic clone were used to probe nuclear extracts for DMA binding factors: P, promoter (-494 to-23); C, coding region (+231 to +528); U, 3'-untranslated region (+528 to +1049). Positions are relative to the transcription start site.Binding reactions were incubated either with (+) or without (-) nuclear extract prepared from plants grown in the dark for 4 days andthen given 3 days of white light.(B) Effects of various pretreatments on the Fed-1 binding activity in pea nuclear extracts. Extract was incubated at 37°C without additions(Sham), incubated at 37°C with proteinase K or RNase A (1 mg/mL), or incubated at 90°C for 10 min before being assayed for bindingactivity as described above. The lefthand lane contains a reaction incubated without nuclear extract. F, free DNA; BC1, bound complex1; BC2, bound complex 2; vector, labeled plasmid DNA.(C) Competition experiments. Various unlabeled DNAs were included in the binding reactions at the indicated molar ratios relative to thelabeled probe. None, no competitor; pBS-, competitor was linearized vector pBSM13- (Stratagene); Fed-1, competitor DNA was alinearized plasmid containing promoter sequences (-494 to -23) as well as vector sequences; RbcS-3A, linearized plasmid containingsequences from -402 to -10 of the FtbcS-3A promoter.

mosaic virus 35S promoter (Elliott et al., 1989). The latterobservation is consistent with the idea that light acts mainlyat a post-transcriptional step, and we are currently testingthis hypothesis.

Even if light effects prove to be entirely at the post-transcriptional level, organ-specific and tissue-specificexpression of Fed-1 might still be transcriptionally con-trolled. We expect to test this hypothesis by examiningthe expression of chimeric Fed-1 genes in various celltypes.

METHODS

Genomic Library Construction

A genomic library was prepared using the following modificationsof the method of Maniatis, Fritsch, and Sambrook (1982). Pea

nuclear DNA was isolated (Watson and Thompson, 1986) andpartially digested with Hindlll. The DNA was then size-fractionatedon a preformed 0.86 M to 3.45 M NaCI gradient (Maniatis, Fritsch,and Sambrook, 1982) and 10-kb to 25-kb fragments were se-lected for cloning into X phage L47.1 (Loenen and Bramer, 1980).A arms were purified as follows: the vector was annealed, ligated,cut with BamHI, Xhol, and Hindlll, and then size-fractionated on3.94 M to 5.65 M CsCI gradient in a TV865 rotor (Sorvall) at39,500 rpm for 2 hr. Phage arms (2 ^g) plus 4 /ig of partiallyHindlll-digested, size-fractionated genomic DNA were ligated in10 /iL of buffer with 1 unit of T4 DNA ligase at 20°C for 4 hr.Recombinant DNA was packaged in vitro with "Packagene" pack-aging extracts (Promega-Biotech). The resulting 1.1 x 10s plaque-forming units were plate-amplified once, and the resulting bacte-riophage suspension was centrifuged and stored at 4°C (with0.3% chloroform) (Maniatis, Fritsch, and Sambrook, 1982). Theamplified library contained approximately 95% recombinants.Phage plaques were screened as described by Maniatis, Fritsch,and Sambrook (1982).

Dow



ber 2021


1111 °• w * *'•»•—BC1

^

-494 -400

5 4

-300 -200

1 I ——2 ' ————

? !

4 1 ————

5 1

r '

7 1 ————

n 1

L 1 in G————————————————————————— -106

—————————————————————— -151

————————————————— -207O ft 1

—————————— -302

——————— -340

————— -375

. —— . Tan

Figure 6. Localization of Binding Regions in the Fed-1 Promoter.

Different size classes were separated from a Bal31 digest asdescribed in Methods and used as probes in binding assays.Reactions were incubated either with (+) or without (-) nuclearextract prepared from plants grown in the dark for 7 days andexposed to white light for 1 hr to 2 hr prior to harvesting. Theaverage length of each probe size class was estimated on a 6%polyacrylamide gel relative to standards (Hinfl fragments ofpBSM13-), and average deletion endpoints were calculated fromthese estimates. These endpoints are shown in the diagram belowthe autoradiogram in relation to the elements indicated inFigure 4.

DMA Sequencing

Deletions of Fed-1 subclones in the plasmid vector "Bluescribe"(pBSM13-, Stratagene) were obtained by means of the Exolll/mung bean nuclease deletion technique described by Henikoff(1984). A 4.8-kb EcoRI subclone was digested with Pstl andEcoRV, or a 3-kb EcoRI/Sstl subclone was digested with Pstland Smal (see Figure 1). The resulting fragments were thendigested to varying extents with exonuclease III, blunt-ended withmung bean nuclease, ligated with T4 DMA ligase, and transformedinto Escherichia coli DH5« cells. Deleted plasmids were se-quenced with a modified version of the protocol used by Chenand Seeburg (1985). After denaturing 2 ^g of supercoiled plasmid

DMA with one-tenth volume of 2 M NaOH, 1 mM EDTA, the DNAwas neutralized with one-half volume of 1 M NaAc, pH 4.8, andquickly ethanol-precipitated. After centrifugation, the pellet wasdried and resuspended in Klenow DNA polymerase buffer (10 mMTris, pH 7.5, 50 mM NaCI) with 30 ng of one of two oligonucleo-tides (TAATACGACTCACTATAG or ATTAACCCTCACTAAAG)that are complementary to sequences flanking the multiple cloningsite of pBSM13-. After annealing at 37°C for 30 min, 5 units ofKlenow DNA polymerase and 50 MCi of 35S-dATP (800 Ci/mmol)were added. Aliquots of the resulting mixture were added to fourtubes, each containing one of the four dideoxynucleotide mixes,and incubated at 37°C for 20 min. Chase solution (2 mM dCTP,2 mM dATP, 2 mM dTTP, 2 mM dGTP in 50 mM NaCI, 34 mMTris-HCI, pH 8.3, 6 mM MgCI2, 5 mM DTT) was then added andthe reactions were incubated a further 15 min before adding theformamide/EDTA stop solution. After heating to 70°C for 3 min,the samples were loaded on 4% or 6% polyacrylamide gels (0.4mm x 20 cm x 40 cm in TBE). The gels were run at 30 Wconstant power (1000 V to 2000 V) for 2.5 hr. Sequence compar-isons were done using the Bionet (Intellegenetics, Inc., MountainView, CA) programs "SEQ" and "IFIND."

RNase Protection Mapping

A gel-purified (Grabowski, Padgett, and Sharp, 1984) 32P-anti-sense RNA was synthesized (from an appropriate insert in theBluescribe vector) using the methods of Krieg and Melton (1987)and either T7 or T3 RNA polymerase as appropriate. This probewas hybridized to 20 ^g of total RNA in 30 ML of 80% formamide,40 mM PIPES, pH 6.7, 0.4 M NaCI, 1 mM EDTA. Mixtures wereheated to 80°C for 5 min, incubated overnight at 42°C, dilutedinto 300 ML of buffer containing 40 mg/mL RNase A and 1 unit/ML RNase T1, 10 mM Tris, pH 7.5, 5 mM EDTA, and 300 mMNaCI, and digested at 22°C for 30 min as described by Zinn,DiMaio, and Maniatis (1983). After treatment with SDS and pro-teinase K, phenol extraction, and ethanol precipitation, pelletswere taken up in 4 M!- of TE. Formamide/EDTA solution (4 pL)was added, and the samples were heated to 70°C for 3 minimmediately before being loaded on 4% or 6% sequencing gels.

Primer Extension Mapping

Poly(A) RNA was isolated using Hybond AP paper (AmershamCorp.). A 1-cm2 piece of Hybond paper was wetted in 20 mMTris-HCI, pH 7.6, and placed on Whatman 3MM paper. A solutioncontaining 1 mg of total RNA in 1 mL of 20 mM Tris-HCI, pH 7.6,was drawn through the Hybond paper by capillary action. Thefilter was then washed three times (5 min each) at room temper-ature in 20 mM Tris-HCI, pH 7.6, 0.5 M NaCI, and twice in 70%ethanol. The membrane was blotted briefly on 3MM paper andthen heated to 70°C for 3 min in 700 mL of deionized H2O to freethe poly(A) RNA. The resulting RNA solution was then lyophylizedand resuspended in 10 mL of 250 mM KCI and 10 mM Tris-HCI,pH 8.3. Primer extension was carried out using the method ofGeliebter et al. (1986), except that dideoxynucleotides were omit-ted. The formamide/EDTA stop solution was added and sampleswere electrophoresed as in the RNase protection experiments.

Dow



ber 2021

688 The Plant Cell

Nuclear Extracts Gel Shift Assays

The nuclear extracts used in the experiments reported here were prepared from 7-day-old pea seedlings that were either grown for 4 days in in complete darkness and transferred to white light for 3 days or grown for 7 days in complete darkness and transferred to white light 1 hr to 2 hr prior to harvesting. Nuclei were prepared using a modification of the method described by Watson and Thompson (1 986). Apical buds from 7-day-old pea seedlings were harvested onto ice, washed with cold diethyl ether, and rinsed thoroughly with cold grinding buffer (1 .O M hexylene glycol, 10 mM PIPES/KOH, pH 7.6,lO mM MgCI,, 5 mM 2-mercaptoethanol, and 1 mM Na,EDTA). The buds were homogenized in fresh buffer (2 mL/g of tissue) in a Polytron homogenizer, and the homogenate was filtered successively through 500-pm, 300-pm. 1 00-pm, and 50-pm nylon meshes. The filtrate was centrifuged (setting 7 in a clinical centrifuge), and the pellet was gently resuspended in Percoll-Triton buffer [O5 M hexylene glycol, 10 mM PIPES/KOH, pH 7.6,l O mM MgCI2, 5 mM 2-mercaptoethanol, 1 mM Na,EDTA, 60% (v/v) Percoll, and 0.5% (v/v) Triton X-1001. Nuclei were washed twice by pelleting and resuspension in fresh grinding buffer and were immediately lysed and extracted as described by Green, Kay, and Chua (1987).

Probe and Competitor DNAs

The Fed-7 promoter probe was a 472-bp Alul fragment extending from -494 to -23 relative to the Fed-7 transcription start site. This fragment was cloned into the Smal site of pBSM13- (Stra- tagene). Other probes were obtained from the coding region (C) and the 3' end of the gene (U). The coding region probe consisted of a 297-bp Bglll fragment extending from +231 to +528, whereas the 3' probe consisted of a 519-bp Sau3A fragment extending from +528 to +1049. Both the coding and 3' probes were cloned into the BamHl site of pBSM13-. Labeled probes were prepared by digesting with EcoRl and Hindlll to excise the insert and using Klenow DNA polymerase or avian myeloblastosis virus reverse transcriptase to fill in the recessed ends of both the insert and the vector (Maniatis, Fritsch, and Sambrook, 1982). Competitor DNAs were linearized by digestion with appropriate restriction enzymes and were included in the indicated binding reactions at the speci- fied molar ratios. The RbcS-3A competitor was prepared by subcloning the 0.4-kb Hindlll-fragment (-399 to -7, relative to the transcription start site) of p3A (Fluhr et al., 1986b; courteously provided by Dr. Nam-Hai Chua) into the Hindlll Site of pKSM13+ (Stratagene).

Deletions from the proximal end of the Fed-7 promoter fragment were generated with nuclease Ba131 as described by Maniatis, Fritsch, and Sambrook (1982). The plasmid containing the promoter was linearized at the unique Hindlll site and digested with Ba131. Aliquots of the reaction were stopped with excess EDTA at 30-sec intervals and pooled. lnserts were separated from the vector with EcoRl and end-labeled by a fill-in reaction using avian myeloblastosis virus reverse transcriptase. The promoter fragments were fractionated by electrophoresis through a 6% polyacrylamide gel (Jensen et al., 1988). After autoradiography of the wet gel, the major size classes were electroeluted from gel slices, ethanol-precipitated, and used in retardation assays.

Binding conditions were essentially as described by Green, Kay, and Chua (1987). Reactions consisted of 3.0 fmol of labeled probe DNA (typically 60,000 dpm), 12.5 pg of poly(d1-dC:dl-dC), 25 mM HEPES/KOH, pH 7.6, 45 mM KCI, 5 mM MgCI,, 0.5 mM DTT, 0.002% bromophenol blue, 5% glycerol, competitor DNAs as indicated, and 6 pg to 10 pg of nuclear protein in a total volume of 25 pL. Nuclear extract was added last and the reactions were incubated at room temperature for 20 min before they were loaded onto 1 Yo agarose gels (in 1 O mM Tris-HCI, pH 7.5, 1 mM EDTA). Electrophoresis was carried out for 2 hr at 7.5 V/cm with constant recirculation of the buffer. Gels were soaked in 10% TCA and blotted dry prior to autoradiography.

ACKNOWLEDGMENTS

This work was supported in part by United States Department of Agriculture competitive research grants 85-CRCR1-191 O and 88- 37262-3893 to W.F.T. R.C.E. was supported in part by a National Science Foundation predoctoral fellowship, T.J.P. in part by grant no. 87G00711 and B.F. by grant no. 88-PMB-015-A89-1,from the North Carolina Biotechnology Center, and M.J.W. by a Sir lzaak Walton Killam Postdoctoral Fellowship from the University of British Columbia. We thank Nam-Hai Chua of the Rockefeller University for the plasmid p3A. Special thanks are due to Winslow Briggs for his advice and encouragement and Dolores Sowinski for her assistance throughout this project. This is paper no. 12181 of the Journal Series of the North Carolina Agricultura1 Research Service.

Received April24, 1989; revised May 1 O, 1989.

REFERENCES

Arnon, D.I. (1 977). Photosynthesis 1950-1 975: Changing con- cepts and perspectives. In Encyclopedia of Plant Physiology, Vol. V (New York: Springer-Verlag), pp. 8-56.

Arnon, D.I. (1988). The discovery of ferredoxin: The photosynthetic path. Trends Biochem. Sci. 13, 30-33.

Castresana, C., Staneloni, R., Malik, V.S., and Cashmore, A.R. (1 987). Molecular characterization of two clusters of genes encoding the Type 1 CAB polypeptide of PS I1 in Nicotiana plumbaginifolia. Plant MOI. Biol. 10, 117-126.

Castresana, C., Garcia-Luque, I., Alonso, E., Malik, V.S., and Cashmore, AR. (1 988). Both positive and negative regulatory elements mediate expression of a photoregulated CAB gene from Nicotiana plumbaginifolia. EMBO J. 7, 1929-1 936.

Chen, E.Y., and Seeburg, P.H. (1985). Supercoil sequencing: A fast and simple method for sequencing plasmid DNA. DNA 4,

Dobres, M.S., Elliott, R.C., Watson, J.C., and Thompson, W.F. (1 987). A phytochrome regulated transcript encodes ferredoxin

165-1 70.

Dow



ber 2021


1. Plant MOI. Biol. 8, 53-59. Dutton, J.E., Rogers, L.J., Haslett, B.G., Takruru, I.A.H.,

Gleaves, J.T., and Boulter, D. (1 980). Comparative studies on the properties of two ferredoxins from Pisum sativum L. J. Exp.

Elliott, R.C., Dickey, L.F., White, M.J., and Thompson, W.F. (1 989). cis-acting elements for light regulation of pea ferredoxin I gene expression are located within transcribed sequences. Plant Cell 1, 691-698.

Fluhr, R., Kuhlerneier, C., Nagy, F., and Chua, N.-H. (1986a). Specific and light-induced expression of plant genes. Science

Fluhr, R., Moses, P., Morelli, G., Coruzzi, G., and Chua, N.-H. (1 986b). Expression dynamics of the pea rbcS multigene family and organ distribution of the transcripts. EMBO J. 5, 2063- 2071.

Fried, M., and Crothers, D.M. (1981). Equilibria and kinetics of lac repressor-operator interaction by polyacrylamide gel electrophoresis. Nucl. Acids Res. 9, 6505-6523.

Geliebter, J., Zeff, R.A., Melvold, R.W., and Nathenson, S.G. (1986). Recombination in germ cells generated two major his- tocompatibility genes shown to be identical by RNA sequence analysis: Kbm9 Kbm6. Proc. Natl. Acad. Sci. USA 83, 3371-3375.

Gil, A., and Proudfoot, N.J. (1987). Position dependent sequence elements downstream of AAUAAA are required for efficient rabbit 0-globin mRNA 3‘ end formation. Cell 49, 399-406.

Giuliano, G., Pichersky, E., Malik, V.S., Timko, M.P., Scolnik, P.A., and Cashmore, A.R. (1 988). An evolutionarily conserved protein binding sequence upstream of a plant light-regulated gene. Proc. Natl. Acad. Sci. USA 85, 7089-7093.

Grabowski, P.J., Padgett, R.A., and Sharp, P.A. (1984). Mes- senger RNA splicing in vitro: An excised intervening sequence and a potential intermediate. Cell 37, 415-427.

Green, P.J., Kay, S.A., and Chua, N.-H. (1987). Sequence- specific interactions of a pea nuclear factor with light-responsive elements upstream of the RbcS-3A gene. EM60 J. 6, 2543- 2549.

Green, P.J., Yong, M.-H., Cuozzo, M., Kano-Murakami, Y., Silverstein, P., and Chua, N.-H. (1988). Binding site require- ments for pea nuclear protein factor GT-1 correlates with sequences required for light-dependent transcriptional activation of the rbcS-3A gene. EMBO J. 7, 4035-4044.

Grob, U., and Stüber, K. (1987). Discrimination of phytochrome dependent light inducible plant genes: Prediction of a common light-responsive element (LRE) in phytochrome dependent light inducible plant genes. Nucl. Acids Res. 15, 9957-9973.

Heidecker, G., and Messing, J. (1 986). Structural analysis of plant genes. Annu. Rev. Plant Physiol. 37, 439-466.

Henikoff, S. (1 984). Unidirectional digestion with exonuclease 111 creates targeted breakpoints for DNA sequencing. Gene 28,

BOt. 31,379-391.

232,1106-1 1 12.

351-359. Hunt, T. (1988). Controlling mRNA lifespan. Nature 334 567. Jensen, E.o., Marcker, K.A., Schell, J., and de Bruijn, F.J.

(1988). lnteraction of a nodule specific, trans acting factor with distinct DNA elements in the soybean leghaemoglobin lbc3 5’ upstream region. EMBO J. 7, 1265-1271.

Joshi, P.C. (1 987). Putative polyadenylation signals in nuclear genes of higher plants: A compilation and analysis. Nucl. Acids.

Res. 15,9627-9640. Kaufman, L.S., Briggs, W.R., and Thompson, W.F. (1985). Phy-

tochrome control of specific mRNA levels in developing pea buds. Plant Physiol. 78, 388-393.

Kaufman, L.S., Roberts, L.L., Briggs, W.R., and Thompson, W.F. (1986). Phytochrome control of specific mRNA levels in developing pea buds: Kinetics of accumulation, reciprocity, and escape kinetics of the low fluence response. Plant Physiol. 81,

Keegstra, K., and Bauerle, C. (1 988). Targeting of plant proteins into chloroplasts. Bioessays 9, 15-19.

Krieg, P.A., and Melton, D.A. (1987). In vitro RNA synthesis with an sp6 RNA polymerase. Methods Enzymol. 155,397-414.

Kuhlemeier, C., Fluhr, R., Green, P.J., and Chua, N.-H. (1987). Sequences in the pea rbcS-3A gene have homology to Consti- tutive mammalian enhancers but function as negative regulatory elements. Genes Dev. 1, 247-259.

Loenen, W.A.M., and Bramer, W.J.. (1980). A bacteriophage lambda vector for cloning large DNA fragments made with several restriction enzymes. Gene 10, 249-259.

Maniatis, T., Fritch, E.F., and Sambrook, J. (1 982). Molecular Cloning: A Laboratory Manual, (Cold Spring Harbor, NY: Cold Spring Harbor Laboratory).

Maniatis, T., Goodburn, S., and Fischer, J. (1 987). Regulation of inducible and tissue specific gene expression. Science 236,

Matsubara, H., and Hase, T. (1 983). Phylogenetic considerations of ferredoxin sequences in plants, particularly algae. In Proteins and Nucleic Acids in Plant Systematics, U. Jensen and D.E. Fairbrothers, eds (New York: Springer-Verlag), pp. 169-1 81.

McKnight, S.L., and Kingsbury, R. (1 982). Transcriptional control signals of a eukaryotic protein-coding gene. Science 217, 316- 324.

Nagai, J., and Block, K. (1 966). Enzymatic desaturation of stearyl acyl carrier protein. J. Biol. Chem. 241, 1925-1927.

Poulsen, C., Fluhr, R., Kauffman, J.M., Boutry, M., and Chua, N.-H. (1986). Characterization of an rbcS gene from Nicotiana plumbaginifolia and expression of an rbcS-CAT chimeric gene in homologous and heterologous nuclear backgrounds. MOI. Gen. Genet. 205,193-200.

Ramirez, J.M., and De1 Campo, F.F. (1 966). Ferredoxin-nitrate reductase from spinach. Biochim. Biophys. Acta 118, 58-71.

Reith, M.E., Laudenbach, D.E., and Strauss, N.A. (1986). Isola- tion and nucleotide sequence analysis of the ferredoxin I gene from the cyanobacterium anacystis-nidulins R2. J. Bacteriol.

Sager, A.D., Horwitz, B.A., Elliott, R.C., Thompson, W.F., and Briggs, W.R. (1988). Light effects on several chloroplast com- ponents in Norflurazon-treated pea seedlings. Plant Physiol. 88,

Sakihama, N., and Shin, M. (1987). Evidence from high-pressure liquid chromatography for the existence of two ferredoxins in plants. Arch. Biochem. Biophys. 256, 430-434.

Schmidt, A., and Trebst, A. (1969). The mechanism of photosynthetic sulfate reduction by isolated chloroplasts. Biochim. Bio- phys. Acta 180,529-535.

1033-1 038.

1237-1 245.

168,131 9-1 324.

340-347.

Dow



ber 2021

690 The Plant Cell

Smeekens, S., van Binsbergen, J., and Weisbeek, P. (1985). The plant ferredoxin precursor: Nucleotide sequence of a full length cDNA clone. Nucl. Acids Res. 13, 3179-3194.

Watson, J.C., and Thompson, W.F. (1986). Purification and restriction endonuclease analysis of plant nuclear DNA. Meth- ods Enzymol. 118,57-75.

Zinn, K., DiMaio, D., and Maniatis, T. (1983). ldentification of two distinct regulatory regions adjacent to the human (3-interferon gene. Cell34865-879.

Thompson, W.F. (1 988). Photoregulation of diverse gene responses in greening seedlings. Plant Cell Environ. 11,319-328.

Dow



ber 2021

characterization of a single copy gene encoding ferredoxin i from pea

Documents