Developmental Cell Fate and Virulence Are Linked to TrehaloseHomeostasis in Cryptococcus neoformans

Michael R. Botts,a* Mingwei Huang,a Regen K. Borchardt,a* Christina M. Hulla,b

Department of Biomolecular Chemistrya and Department of Medical Microbiology and Immunology,b School of Medicine and Public Health, University of Wisconsin-Madison, Madison, Wisconsin, USA

Among pathogenic environmental fungi, spores are thought to be infectious particles that germinate in the host to cause disease.The meningoencephalitis-causing yeast Cryptococcus neoformans is found ubiquitously in the environment and sporulates inresponse to nutrient limitation. While the yeast form has been studied extensively, relatively little is known about spore biogene-sis, and spore germination has never been evaluated at the molecular level. Using genome transcript analysis of spores and mo-lecular genetic approaches, we discovered that trehalose homeostasis plays a key role in regulating sporulation of C. neoformans,is required for full spore viability, and influences virulence. Specifically, we found that genes involved in trehalose metabolism,including a previously uncharacterized secreted trehalase (NTH2), are highly overrepresented in dormant spores. Deletion of thetwo predicted trehalases in the C. neoformans genome, NTH1 and NTH2, resulted in severe defects in spore production, a de-crease in spore germination, and an increase in the production of alternative developmental structures. This shift in cell typessuggests that trehalose levels modulate cell fate decisions during sexual development. We also discovered that deletion of theNTH2 trehalase results in hypervirulence in a murine model of infection. Taken together, these data show that the metabolicadaptations that allow this fungus to proliferate ubiquitously in the environment play unexpected roles in virulence in the mam-malian host and highlight the complex interplay among the processes of metabolism, development, and pathogenesis.

Afundamental requirement for organisms to survive is the abil-ity to adapt to changes in the availability of metabolic fuels.

Metabolic acclimation enhances survival in a given environmentor provides the capacity to exploit a new one. In response to nu-trient limitation, organisms generally decrease their growth rates;however, when nutrients become severely limiting, many mi-crobes undergo a transition from active growth to dormancy (1).In some bacteria and fungi, this transition results in the develop-ment of a new cell type, the spore, and is coupled with structuraland metabolic adaptations that allow spores to remain dormantand withstand severe environmental stresses (2–4). Once sporesencounter more favorable growth conditions, they undergo an-other transition (germination) to resume vegetative growth (5).

For environmental human fungal pathogens, spores likely areinfectious particles (6–9). The properties of spores that allow themto withstand harsh conditions and disperse throughout the envi-ronment (e.g., small size, tolerance for high temperatures, resis-tance to oxidative stress, etc.) also allow them to encounter hostsand initiate disease-causing infections. This is true of Cryptococcusneoformans, a human fungal pathogen for which both yeast andspore forms are plausible infectious particles (10). C. neoformansspores are produced on aerial fruiting bodies (basidia), allowingfor dispersal which, along with their resistance to external stressesand ability to cause disease in a murine model of infection, has ledto the hypothesis that C. neoformans spores are natural infectiousparticles (11, 12). C. neoformans infects people from environmen-tal sources through a respiratory route in which the organism isinhaled and proliferates within the lung. In immunocompro-mised individuals, such as people with AIDS, this infection candisseminate to the central nervous system and cause meningoen-cephalitis (13). C. neoformans spores, also known as basidi-ospores, are produced during sexual development that occurs inresponse to nutritional signals and involves the formation of sev-eral new cell types that reside in multicellular structures. While the

morphological changes that occur during sexual developmenthave been described, relatively little is known about the metabolicsignals or molecular pathways that influence cell fate decisionsand ultimately lead to the production of spores and their ability togerminate in new environments.

To begin to understand spore biogenesis and germination, wecarried out an analysis of spore transcripts in both dormant sporesand a germinating population of spores. Transcripts of genes im-portant for trehalose metabolism were highly overrepresented indormant spores, suggesting a role for the sugar trehalose in C.neoformans spore biology. Trehalose is a disaccharide of two�-linked glucose molecules (�-1,1-glucose) that has been broadlylinked to stress resistance and development in many organisms(14–18). In several fungi, trehalose biosynthesis has been inti-mately linked to virulence, morphogenesis, and the production ofviable spores. In the human pathogen Candida albicans, trehalosebiosynthesis is required for resistance to oxidative stress, and tre-halose metabolism has been linked to both stress resistance andthe yeast-to-hypha transition, both of which are important forvirulence. Trehalose synthesis mutants of C. albicans also showdecreased virulence (19–22). Similarly, trehalose has well-estab-lished roles in both virulence and spore production in the filamen-tous fungal pathogen Aspergillus fumigatus, in which trehalose

Received 24 June 2014 Accepted 2 July 2014

Published ahead of print 7 July 2014

Address correspondence to Christina M. Hull, cmhull@wisc.edu.

* Present address: Michael R. Botts, Division of Biological Sciences, University ofCalifornia–San Diego, La Jolla, California, USA; Regen K. Borchardt, CellularDynamics International, Inc., Madison, Wisconsin, USA.

Copyright © 2014, American Society for Microbiology. All Rights Reserved.

doi:10.1128/EC.00152-14

1158 ec.asm.org Eukaryotic Cell p. 1158 –1168 September 2014 Volume 13 Number 9

on May 27, 2020 by guest

http://ec.asm.org/

Dow

nloaded from

synthesis is important for general stress response and the produc-tion of robust, stress-resistant spores (23). In contrast to otherfungal pathogens, deletion of the trehalose biosynthesis genes inA. fumigatus, TPSA and TPSB, resulted in increased virulence in amurine model of invasive aspergillosis, likely caused by alterationsin the cell wall, making mutant hyphae resistant to phagocytosisby macrophages (23). Taken together, these findings reveal a com-plex and diverse role for trehalose metabolism in regulating thephysiology of fungal pathogens.

In C. neoformans, disruption of either of the genes involved intrehalose synthesis (TPS1 or TPS2) results in severe defects in bothsexual development and virulence, but the mechanisms by whichtrehalose controls these functions are not known (24–26). Previ-ously, a single trehalose-degrading enzyme, NTH1 (neutral tre-halase 1), was studied, and surprisingly, deletion of this genecaused no observable phenotypes (25). Through our gene expres-sion analysis of spores, we discovered a second predicted treha-lose-degrading enzyme that we have designated NTH2 (neutraltrehalase 2) that was overrepresented within dormant spores.

The discovery of this trehalase allowed us to assemble a morecomplete picture of trehalose metabolism and the relationshipsbetween trehalose synthesis and breakdown during spore forma-tion, dormancy, and germination. We found that trehalase mu-tants harbor defects in sexual development, including aberrantfruiting body (basidium) formation, a decrease in spore forma-tion, and decreased spore viability. We also observed that aberrantbasidium formation was accompanied by an increase in the pro-duction of apparent chlamydospores, a previously described alter-nate developmental cell type (26), implicating trehalose as a sig-

naling molecule in C. neoformans cell fate determination. Finally,we determined that the absence of NTH2 led to a significant in-crease in virulence in a murine model of infection, suggesting thatthe trehalose catabolic pathway is active in the mammalian host.Overall, our results indicate that trehalose metabolism is a corecomponent of both sexual development and pathogenesis and un-derscore the importance of trehalose homeostasis in these diverseprocesses in C. neoformans.

MATERIALS AND METHODSStrains and media. All strains used were of the serotype D background(Cryptococcus neoformans var. neoformans strains JEC20 [a] and JEC21[�]) (27) (Table 1). All were handled using standard techniques and me-dia as described previously (28). Sexual development assays were con-ducted on V8 agar medium, pH 7.0, at 22°C in the dark for 2 to 7 days.

Microscopy. All micrographs were created using an Axio Scope.A1with long-working-distance objectives and an AxioVision MRM camerarunning AxioVision software.

RNA isolation and amplification. Spores were isolated by scrapingsexually developing populations of cells from V8 agar and suspendingthem in 65% Percoll made isotonic with phosphate-buffered saline (PBS).Suspensions were subjected to centrifugation (10,000 � g, 30 min, 4°C),and spores were collected from the bottom of the gradient and counted.An aliquot of 4 � 108 spores was frozen in liquid N2 to serve as thezero-time-point sample. The remaining spores (1.6 � 109) were resus-pended in 6 ml of liquid yeast extract-peptone-dextrose (YPD) and incu-bated at 30°C with shaking at 200 rpm. Samples were collected every 2 hfor 10 h and frozen in liquid nitrogen. RNA was extracted from frozenspores using hot acid-phenol as described previously and was furtherpurified using the RNeasy minikit (Qiagen, Valencia CA) (29). RNA am-plification was carried out using the MessageAmp II amplification kit

TABLE 1 Strains and oligonucleotides used in this study

Strain GenotypeReference/source ordescriptiona

C. neoformans var. neoformans serotype DJEC20 MATa 27JEC21 MAT� 27CHY2083-2085 MATa nth2::NEOR This studyCHY2089-2091 MAT� nth2::NEOR This studyCHY1705-1707 MATa nth1::NATR This studyCHY1711-1713 MAT� nth1::NATR This studyCHY2182-2183, 2188 MATa nth1::NATR nth2::NEOR This studyCHY2180-2181, 2184 MAT� nth1::NATR nth2::NEOR This study

Oligonucleotides used in cloning and PCRCHO1565 TAATCAGTGGGTGAGGTGTG NTH1 5= Flank FWDCHO1566 GCTCACATCCTCGCAGCCTCGAAGTTGGAGTGAAGGAGA NTH1 5= Flank REVCHO1567 CTAGTTTCTACATCTCTTCCCTGGAAACATTCTTGATGG NTH1 3= Flank FWDCHO1568 TCTCGCCCCTCCTAAACTAT NTH1 3= Flank REVCHO1569 TCTCCTTCACTCCAACTTCGAGGCTGCGAGGATGTGAGC NATR cassette FWDCHO1570 CCATCAAGAATGTTTCCAGGGAAGAGATGTAGAAACTAG NATR cassette REVCHO2636 GTGTATCCAATCCAAGCACT NTH2 5= Flank FWDCHO2637 GTCATAGCTGTTTCCTGGAGCTTTCGTTCATCAAGTC NTH2 5= Flank REVCHO2764 CATCCTCGCAGCAAGGGCGTTTTGAGGTTCGAGGGTGAG NTH2 3= Flank FWDCHO2765 CCCATACTACCGCAGCAATC NTH2 3= Flank REVCHO2640 GACTTGATGAACGAAAGCTCCAGGAAACAGCTATGAC NEOR cassette FWDCHO2641 GGCTATGTTCAATGGGTATCCGCCCTTGCTGCGAGGATG NEOR cassette REVCHO2979 GCCTTCTCGAGGGGCTGGGA NTH1 northern probe FWDCHO2980 CGTGGGCTTCGCCAGTCGTT NTH1 northern probe REVCHO2938 GCCGCCCCATGCGTGTAAGT NTH2 northern probe FWDCHO2939 CTCACCACCTCCTCCAGCGG NTH2 northern probe REV

a FWD, forward; REV, reverse.

Trehalose Metabolism Controls Spore Production

September 2014 Volume 13 Number 9 ec.asm.org 1159

on May 27, 2020 by guest

http://ec.asm.org/

Dow

nloaded from

(Ambion) according to manufacturer specifications. Five hundred ng oftotal RNA from each germinating time point was used as the startingmaterial. After production of antisense RNAs containing aminoallyl-UTPs (aRNAs), each sample was assessed for quantity and average lengthof aRNA using an RNA Pico chip and an Agilent Bioanalyzer 2100 (Agi-lent Technologies, Santa Clara, CA). Before hybridization, equal amountsof aminoallyl-UTP-incorporated aRNA were conjugated to oyster dyes(Boca Scientific) according to the manufacturer’s instructions.

Microarray hybridization and analysis. Fluorescently labeled aRNAswere hybridized to C. neoformans whole-genome spotted microarrays of70-mer oligonucleotides containing 7,765 open reading frame (ORF)probes. The data presented for each experiment represent 8-fold coverageof ORFs: quadruplicate experiments (including dye swap), with each slidecontaining ORF probes spotted in duplicate. Slides were incubated asreported previously (30). Extracted data were analyzed using the Gene-Spring 10.0 software package (Agilent Technologies, Santa Clara, CA).Data were normalized using the LOWESS (locally weighted scatter plot-smoothing) algorithm and assessed for statistical significance utilizinganalysis of variance (ANOVA) (31). A total of 2,512 genes meeting thecriterion of P � 0.05 were considered statistically significant and used infurther analyses (32). Significant genes meeting a 2-fold-change thresholdbetween any two time points (1,499) were clustered using Cluster 3.0.Clusters were assessed for KEGG database pathway and Gene Ontology(GO) term enrichment using the Database for Annotation, Visualization,and Integrated Discovery (DAVID) (33–35).

Generation of deletion strains. Gene deletion constructs were createdusing fusion PCR (36) (oligo sequences are listed in Table 1). The NTH15= region was amplified with primers CHO1565 and CHO1566, and the 3=region was amplified with CHO1567 and CHO1568. The NATR cassettewas amplified with CHO1569 and CHO1570. PCR fusion usingCHO1565 and CHO1568 was used to create the final nth1::NATR deletioncassette. The NTH2 5= region was amplified with primers CHO2636 andCHO2637, and the 3= region was amplified with CHO2638 andCHO2639. The NEOR cassette was amplified with CHO2640 andCHO2641. PCR fusion using CHO2636 and CHO2639 was used to createthe final nth2::NEOR deletion cassette. The nth1::NATR and nth2::NEOR

deletion cassettes were transformed into JEC20 and JEC21 by biolistictransformation, grown on medium containing 1 M sorbitol, and selectedon medium containing 200 �g/ml G418 or 200 �g/ml nourseothricin(37). Resulting colonies were screened using PCR for correct insertion ofthe knockout construct and assessed via Southern blotting for single in-tegration of the construct to identify multiple independent knockouts(29). Each mutant then was crossed with wild-type yeast to obtain knock-out progeny in both mating types. The resulting F1 progeny then wererescreened by PCR for the absence of the deleted gene to confirm thestrain genotype. nth1� nth2� double mutants were constructed by back-crossing a nth2� (CHY2082) with � nth1� (CHY1710), isolating andgerminating spore progeny from this cross, and then replica plating theseprogeny onto solid medium containing both nourseothricin and G418.Double mutants then were rescreened by PCR to confirm the absence ofNTH1 and NTH2 open reading frames (CHY2184).

NTH1 and NTH2 transcript analysis. RNA was prepared from C.neoformans yeast or crosses as described previously (30). Northern blotswere conducted according to standard protocols using 10 �g total RNAper sample. Probes were generated by PCR amplification utilizing the ExTaq PCR system (TaKaRa Bio Inc.) and oligonucleotides CHO2979 andCHO2980 (NTH1), CHO2938 and CHO2939 (NTH2), and CHO1696and CHO1697 (GPD1). Probes were radiolabeled using Ready-To-GoDNA labeling beads (GE Healthcare Life Sciences, Piscataway, NJ) ac-cording to the manufacturer’s instructions and hybridized to blots at 65°Cas described previously (38). Blots were exposed to a phosphor screen andimaged with a Molecular Dynamics Storm 860 phosphorimager (GE, Am-ersham).

Quantification of trehalose. Trehalose was quantified in C. neofor-mans crosses using a colorimetric enzyme-linked assay previously used in

S. cerevisiae (39). Crosses were spotted on V8 for 5 days, harvested into 100mM sodium citrate, pH 5.7, and boiled for 10 min. The resulting suspen-sions were lysed using sonication on a 30% duty cycle at level 2 for 5 min,and lysis was confirmed microscopically. Insoluble cell debris was pelletedand discarded. Lysates (100 �l) were treated with 1 U of porcine kidneytrehalase (Sigma-Aldrich) for 4 h at 37°C. Glucose produced was quanti-fied using a glucose assay kit (Sigma-Aldrich) according to the manufac-turer’s instructions. Values of absorbance at 540 nm for lysates were com-pared to a standard curve of glucose and normalized to the starting massof the cell pellet. Calculated trehalose levels were subjected to one-wayANOVA comparing each sample to an a � � cross.

Phenotype testing. A battery of common phenotypes was assessed,including melanin production, capsule production, growth at 37°C, andcell wall integrity. In each case, wild-type, nth1�, nth2�, and nth1� nth2�strains were evaluated. For melanin production, we grew cells on L-3,4-dihydroxyphenylalanine (L-DOPA) agar at 37°C for 3 days and visuallyassessed the production of pigment. For capsule production, we culturedstrains in Dulbecco’s modified eagle medium (DMEM) with 5% fetal calfserum at 37°C in 5% CO2 (40) for 2 days and then stained them with Indiaink and assessed them microscopically (41). For growth at 37°C, we spot-ted serial dilutions of cells onto YPD agar, incubated them at 37°C for 2days, and assessed them visually (25). For cell wall integrity, we spottedserial dilutions of cells onto medium containing calcofluor white MR2,sodium dodecyl sulfate, or caffeine and grew them for 2 days at 37°C (42).For resistance to heat shock, we grew cells on V8 agar, pH 7.0, at 25°C for2 days; suspended them in PBS; incubated them at 42°C and 50°C for 5-,10-, 15-, and 30-min intervals; diluted them; and plated them onto YPDfor 3 days at 30°C (3). For resistance to oxidative stress, we spread 1 � 106

yeast onto a 100-mm-diameter V8 agar plate with a 6-mm disc of What-man paper containing 10 �l 10% H2O2 in the center and incubated themat 30°C for 3 days (43). Germination frequencies were determined bycarrying out crosses on V8 for 5 days and isolating spores. Spores werecounted, plated onto rich medium, and allowed to germinate and grow at30°C for 3 days. Germination frequencies were determined by dividing thenumber of colonies formed by the number of spores plated. Three repli-cates were performed for each strain, and the mean results for each strainwere compared to those of the wild type using a Student t test.

Virulence analysis. Strain virulence was assayed using a murine intra-venous model of infection (44). Wild-type �, � nth1�, � nth2�, and �nth1� nth2� yeast were grown to mid-log phase and washed three timesin PBS. Five female BALB/c mice were inoculated via tail vein with 1 � 106

yeast of each strain. Only the yeast cell type was used to infect the mice,because we could not recover sufficient numbers of mutant spores to carryout spore-mediated infections. The mice were observed daily for rapidweight loss or signs of pain, at which point moribund mice were eutha-nized as described previously (12). The resulting survival times were plot-ted on a Kaplan-Meier plot, and median survival times of mice were an-alyzed using a Wilcoxon rank-sum test. This experiment was carried outtwice with independently derived mutant strains, and the results wereidentical between experiments. The animal studies were reviewed andprotocol approved by the University of Wisconsin–Madison InstitutionalAnimal Care and Use Committee (protocol A01506). The University ofWisconsin-Madison is AAALAC accredited, and the facilities meet andadhere to the standards in the Guide for the Care and Use of LaboratoryAnimals (59).

Microarray data accession number. The full data set determined inthe course of this work has been deposited in the NCBI Gene ExpressionOmnibus database (GEO) and can be accessed through GEO accessionnumber GSE53912 (45).

RESULTSTrehalose metabolism genes are overrepresented in dormantspores. To determine changes in gene expression that occur dur-ing spore germination into yeast, total RNA was isolated fromspores undergoing synchronous germination for whole-genome

Botts et al.

1160 ec.asm.org Eukaryotic Cell

on May 27, 2020 by guest

http://ec.asm.org/

Dow

nloaded from

transcript analysis. Transcripts were competitively hybridized to awhole-genome microarray, and the resulting changes in transcriptlevels were assessed. Coexpressed groups of genes were submittedto DAVID to assess functional groups and to the KEGG databaseto determine placement within pathways.

One of the most enriched pathways within dormant spores wasthe KEGG annotated pathway for starch and sucrose metabolism.Transcripts of 14 genes in this pathway showed a pattern of regu-lation in which their transcripts were overrepresented in dormantspores and became rapidly underrepresented during the first 2 h ofgermination (Fig. 1A). Some spore-enriched genes that fall intothis metabolic pathway have been implicated previously in spore-or germination-specific functions in other systems: SGA1, whichis highly similar to a spore-specific glucoamylase in S. cerevisiae, isresponsible for glycogen degradation during sporulation; SPR1 isa sporulation-specific exo-�-1,3-glucan hydrolase in S. cerevisiae;and CELA is a germination-specific spore coat-modifying enzymefrom the spore-forming amoeba Dictyostelium discoideum (46–48). Detection of these transcripts suggests that their roles areconserved across phyla. In addition, nine of the spore-enrichedtranscripts in this pathway are involved directly in the biosynthesisand breakdown of trehalose or glycogen (Fig. 1A and B).

Among these genes was CNG00690, predicted to encode a tre-halose-degrading enzyme. The presence of CNG00690 was unex-pected, because previous analyses of trehalose synthesis and deg-radation in C. neoformans had not identified this gene (24, 25).Trehalose biosynthesis genes had been shown to be critical forboth the initiation of sexual development (TPS1) and virulence inanimal models (TPS1 and TPS2), but deletion of the only knownneutral trehalase, NTH1, yielded only a modest decrease in growthon trehalose and no discernible phenotypes in sexual develop-ment or virulence (24). This finding was somewhat surprising,

because many fungi harbor more than one trehalase gene, andtheir products often play key roles in fungal metabolism (49–51).Our discovery of the enrichment of the CNG00690 transcript indormant spores led us to hypothesize that this gene (which wehave named NTH2, for neutral trehalase 2) could encode an un-characterized trehalase with specialized functions in sexual devel-opment and/or spore biology.

The presence of NTH2 is consistent with the fact that fungioften harbor both cytosolic and secreted trehalases with charac-teristic features: cytosolic trehalases usually contain a calciumbinding domain and a single trehalase domain, while secreted tre-halases harbor a secretion signal and two trehalase domains (52,53). Through their predicted functional domains and features,NTH1 and NTH2 appear to be the only two genes encoding tre-halase activity in the C. neoformans genome; NTH1 is a predictedcytosolic trehalase, and NTH2 is a predicted secreted trehalase(Fig. 1C). The presence of NTH2 may account for the lack ofphenotypes in NTH1 deletion strains in previous studies andopens the possibility that the degradation of trehalose plays keyroles in C. neoformans biology.

NTH1 and NTH2 are differentially regulated under sexualdevelopment conditions. To determine the expression profiles ofNTH1 and NTH2 under different conditions, we carried out RNAblot hybridization using RNA from wild-type strains grown inrich medium (YPD broth, mid-log phase), from a cross (a � � onV8, pH 7.0, for 72 h), and from purified spores. As suspected basedon previous reports, NTH1 transcript was abundant in cells grownin rich medium, cross conditions, and in spores, suggesting thatthis trehalase is expressed constitutively (25). In contrast, expres-sion of NTH2 was differentially regulated. While NTH2 transcriptwas abundant in both crosses and purified spores, none was de-tected from cells grown in rich medium (Fig. 2A).

FIG 1 Trehalose metabolism gene transcripts are overrepresented in spores. (A) Heat map of genes in the KEGG database starch and sucrose metabolismpathway that were spore enriched. Relative fold change is represented from �4 (blue) to 4 (yellow). Each column represents a time point of germination inhours. Dormant spore transcripts are represented in 0 h. Yeast transcripts are represented in 10 h. Each row represents a gene. (B) A schematic of genes predictedto act in the trehalose and glycogen metabolic pathway, with those found to be spore enriched in red. Only one gene, NTH1, was found not to be spore enriched.(C) A schematic of predicted C. neoformans trehalases, Nth1 and Nth2, and their functional domain content, including the family 37 glycosyl hydrolase�,�-trehalase domain (GH37; blue), calcium binding regulatory domain (Ca; green), and predicted signal peptide (purple).

Trehalose Metabolism Controls Spore Production

September 2014 Volume 13 Number 9 ec.asm.org 1161

on May 27, 2020 by guest

http://ec.asm.org/

Dow

nloaded from

To determine the extent to which NTH2 expression was de-pendent on signals from V8 agar medium versus the process ofsexual development, we analyzed RNA from yeast propagated onV8 agar in the absence or presence of a mating partner for 48 h.NTH2 transcript levels increased on V8 medium both in the ab-sence and presence of a mating partner. This finding indicates thatNTH2 is induced largely by V8 medium alone (the same conditionthat promotes sexual development) (Fig. 2B). In contrast to theconstitutive expression of NTH1, NTH2 expression is responsiveto changes in metabolic conditions.

NTH1 and NTH2 are required for trehalose metabolism. Todetermine the functions of NTH1 and NTH2, we created singleand double deletion strains and evaluated them for discerniblephenotypes, including the ability to use trehalose as a sole carbonsource. Wild-type and mutant strains (nth1�, nth2�, and nth1�nth2�) were grown on solid synthetic medium containing 2%glucose or 2% trehalose as the sole carbon source (Fig. 3A). Thewild-type strain and all of the trehalase deletion strains (nth1�,nth2�, and nth1� nth2�) grew similarly on medium containingglucose. However, on medium containing trehalose as the solecarbon source, nth1� strains grew more slowly and to a lowerdensity than wild-type strains, nth2� strains showed no differencein growth compared to the wild type, and nth1� nth2� doublemutants showed severe growth defects with little or no growth ontrehalose-containing medium. Together with the observation thatNTH1 and NTH2 contain the only identifiable trehalase domainsin the C. neoformans genome, these results indicate that bothNTH1 and NTH2 encode functional trehalases and provide com-pelling evidence that these are the only trehalases in C. neofor-mans. Furthermore, given that NTH2 can partially compensate forthe loss of NTH1, these trehalases harbor overlapping (redun-

dant) functions in trehalose catabolism in vegetatively growingcells.

Given this relationship during vegetative growth, we hypothe-sized that the contributions of NTH1 and NTH2 during sexualdevelopment also would be at least partially redundant. In theabsence of NTH1 and NTH2, we predicted that trehalose wouldaccumulate and that this accumulation would be additive in thedouble mutant. To test this hypothesis, trehalose levels were quan-tified from wild-type and mutant crosses after 5 days on V8 me-dium. In contrast to our expectations, we observed that deletion ofNTH1 and NTH2 had opposing effects on trehalose accumula-tion: nth1� crosses accumulated significantly more trehalose thanwild-type crosses, whereas nth2� crosses harbored significantlyless trehalose than the wild type (P � 0.05 in both cases). Thedouble mutant crosses (nth1� nth2�) produced levels of trehalosesimilar to those of the wild type (Fig. 3B). These data indicate acomplex relationship between NTH1 and NTH2 in trehalose ho-meostasis during development that may be due (at least in part) tothe predicted differences in localization between Nth1 and Nth2(Nth1 cytoplasmic and Nth2 secreted). The levels of intracellulartrehalose and glucose likely are influenced by both external andinternal sources, and the activities of Nth1 and Nth2 on differentpools of trehalose could have significant effects on the outcome ofoverall trehalose levels. It also is possible that differences in thelocalization of trehalase activity among specific cell types (e.g.,yeast versus basidia) that control local trehalose levels were notdetected using this assay due to homogenization of trehalose levelsacross the entire population of developing cells (yeast, filaments,basidia, and spores).

Deletion of NTH1 and NTH2 leads to a defect in sporulation.To investigate the roles of trehalases in sexual development,nth1�, nth2�, and nth1� nth2� mutant strains were crossed withwild-type strains and with each other under sexual developmentconditions. Crosses between wild-type strains and all of the mu-tants (nth1�, nth2�, and nth1� nth2�) were indistinguishablefrom wild-type a � � crosses, as were nth1� � nth1� andnth2� � nth2� crosses (Fig. 4). In stark contrast, however, crossesbetween nth1� nth2� mutants (nth1� nth2� � nth1� nth2�) ledto severe defects in spore formation, indicating that both geneshave redundant functions in this process.

At low microscopic resolution, nth1� nth2� � nth1� nth2�crosses were observed to be similar to wild-type crosses, withabundant filaments radiating from the periphery of cells under-going sexual development (Fig. 4A). However, under careful ex-amination at higher magnification, it was clear that the majority ofbasidia in nth1� nth2� crosses did not develop spore chains, andstrikingly, these sporeless basidia appeared extremely enlargedcompared to wild-type basidia (Fig. 4B). In addition, nth1� nth2�crosses exhibited the production of an unusually high number oflarge, ball-like structures, giving the developing filaments a beads-on-a-string appearance (Fig. 4C). Structures like these have beendescribed previously and referred to as chlamydospores (26). Thepurpose of this cell type is poorly understood; however, they havebeen observed to be metabolically active, to harbor glycogen, andto be capable of budding off new yeast. It has been hypothesizedthat C. neoformans chlamydospores offer an alternative fate forsexually developing cells and a means of producing new satellitecolonies independent of sporulation (26). The structures pro-duced in abundance by nth1� nth2� crosses also were capable of

FIG 2 NTH1 and NTH2 are differentially expressed. (A) NTH2 is inducedduring sexual development. Lanes: 1 and 2, a and � yeast grown in rich me-dium (YPD liquid); 3, a and � yeast mixed under cross conditions (V8 agar, pH7, at 22°C for 72 h); 4, spores from a cross after 72 h. Top, middle, and bottomimages reflect probes to the transcripts of interest: NTH2, NTH1, and GPD1,respectively. (B) NTH2 is induced on V8 agar. Lanes: 1 and 2, a and � yeastgrown on rich medium (YPD agar); 3 and 4, a and � yeast grown individuallyon V8 agar for 48 h; 5, a and � yeast grown in mixed culture on V8 agar for 48h. Probes used were to NTH2 and GPD1. GPD1 was used as a loading andhybridization control.

Botts et al.

1162 ec.asm.org Eukaryotic Cell

on May 27, 2020 by guest

http://ec.asm.org/

Dow

nloaded from

budding off yeast, were found to harbor glycogen via iodine stain-ing (data not shown), and were morphologically indistinguishablefrom the previous description of chlamydospores. These featuresled us to conclude that the nth1� nth2� structures very likely werethe same type of cells designated previously as chlamydospores inC. neoformans (26). Given the phenotypes of nth1� nth2� mutantstrains, we posit that the ratio of trehalose to glucose in basidia is adeterminant of cell fate. The cleavage of trehalose by NTH1 andNTH2 drives spore formation, whereas the accumulation of treh-alose in the nth1� nth2� strain shifts the developmental path,resulting in a marked increase in alternative cell type (chlamy-dospore) production.

Spores harboring trehalase deletions show defects in germi-nation. Given the enrichment of NTH2 transcripts in spores andthe importance of trehalase function in sporulation, we hypothe-sized that trehalases also are important for germination. Despitethe observation that nth1� nth2� � nth1� nth2� crosses show amarked decrease in spore numbers, these crosses still produced alimited number of spores that were morphologically indistin-guishable from wild-type spores by light microscopy (data notshown). To test whether spores from trehalase-deficient crosseswere viable, spores were isolated from wild-type, nth1�, nth2�,

and nth1� nth2� crosses, counted, and grown on rich medium. Asexpected, nearly 100% of wild-type spores germinated and grewinto colonies (Fig. 5). Similarly, spores from nth1� and nth2�crosses also germinated at wild-type frequencies. In contrast,however, spores from nth1� nth2� crosses showed significant de-creases in germination frequency, with only 33% of spores form-ing colonies (Fig. 5). These data indicate that nth1� nth2� crossesnot only lead to aberrant basidium formation and a decrease inspore formation but also result in substantial numbers of sporesthat are unable to grow in response to germination conditions.These findings again indicate overlapping functions of NTH1 andNTH2.

The nth2� deletion strain is hypervirulent in a mouse modelof cryptococcosis. To evaluate the roles of trehalase function inpathogenesis, we assessed the virulence of the trehalase mutantstrains in a mouse tail vein model of infection. It had been shownpreviously that deletion of NTH1 alone had no effect on virulence(25). This result was initially surprising because of the predictedimportant roles for trehalose in stress tolerance and the apparentabsence of other trehalases in the genome (17). However, ouridentification of NTH2, and the obviously redundant roles ofthese genes described above, raised the possibility that deletion of

FIG 3 Deletion of NTH1 and NTH2 causes a severe synthetic defect in trehalose utilization. (A) Wild-type a, wild-type �, a nth1�, � nth1�, a nth2�, � nth2�,a nth1�nth2�, and � nth1�nth2� strains (left) were struck onto synthetic defined media containing either 2% glucose (middle) or 2% trehalose (right) as a solecarbon source and grown for 2 days at 30°C. (B) Trehalose was quantified in wild-type and mutant crosses after 5 days on V8, pH 7.0. Mean trehalose values fromthree biological replicates were compared using one-way ANOVA statistics, and those crosses that differed significantly (P � 0.05) from the wild type (a � �) aremarked with an asterisk.

Trehalose Metabolism Controls Spore Production

September 2014 Volume 13 Number 9 ec.asm.org 1163

on May 27, 2020 by guest

http://ec.asm.org/

Dow

nloaded from

NTH1 resulted in no phenotype due to the presence of NTH2-derived trehalase activity (Fig. 3A).

Wild-type, nth1�, nth2�, or nth1� nth2� strains were inocu-lated into mice via tail vein at 1 � 106 yeast cells/mouse. As ex-pected, the effects of wild-type and nth1� strains were indistin-guishable from one another, causing mean times to death of 34and 35 days, respectively (Fig. 6). In contrast, however, the nth2�and nth1� nth2� strains both caused morbidity in mice signifi-cantly faster (P � 0.05) (average time to death of 27 and 28 days,respectively) than wild-type and nth1� strains, indicating in-creased virulence in the absence of NTH2. This result is consistentwith the previous findings that strains harboring deletions of thetrehalose biosynthesis genes TPS1 and TPS2 are less virulent. Itseems likely that deletion of the biosynthesis genes would decreasethe abundance of trehalose, while deletion of the NTH2 trehalasewould increase overall abundance. Together, these results support

the hypothesis that the level of trehalose, which has been linked toenvironmental stress resistance in other organisms, is importantfor survival against stressors in the host as well.

To test this hypothesis, we evaluated the ability of the strains toresist heat shock (at temperatures of 37°C, 42°C, and 50°C) andsurvive exposure to reactive oxygen species (in an H2O2 disk dif-fusion assay). We also tested capsule-inducing conditions (RPMIwith 5% CO2 at 37°C), melanizing medium (L-DOPA agar), andcell wall stressing agents (1.5 mg/ml calcofluor white and 0.5mg/ml caffeine) (54). In no case did the nth1�, nth2�, or nth1�nth2� mutant strains respond differently than the wild-type strain(data not shown). The trehalase mutants were not intrinsicallymore resistant to global stressors than their wild-type counter-parts, suggesting that changes in trehalose levels alone were notresponsible for the hypervirulence of nth2� strains.

A surprising aspect of the virulence data was that the functions

FIG 4 Deletion of NTH1 and NTH2 leads to aberrant sexual development. (A) The wild-type, nth1�, nth2�, and nth1� nth2� crosses after 5 days all shownormal filament formation. Magnification, �100; bar, 100 �m. (B) nth1� nth2� crosses form large, ball-like structures in place of basidia and do not producespore chains. Magnification, �400; bar, 10 �m. (C) After 7 days of development, nth1� nth2� crosses produced numerous large, swollen nodules on filaments,giving them a beads-on-a-string appearance (black arrows), consistent with previous descriptions of chlamydospores. Magnification, �200; bar, 50 �m.

Botts et al.

1164 ec.asm.org Eukaryotic Cell

on May 27, 2020 by guest

http://ec.asm.org/

Dow

nloaded from

of NTH1 and NTH2 were not overlapping. In the absence ofNTH2 alone, there was a hypervirulence phenotype, indicatingthat NTH1 was not compensating for the loss of NTH2 activity.Furthermore, there was no change in the phenotype in the absenceof both NTH1 and NTH2. While the NTH1 and NTH2 activitieswere largely redundant outside the host, it appeared that theirfunctions diverge within the host, implicating an NTH2-specificfunction or feature in modulating virulence.

DISCUSSION

Using transcriptional profiling, we discovered that spores of thehuman fungal pathogen C. neoformans contain high levels of tran-scripts associated with the synthesis and breakdown of the disac-charide trehalose, including a previously unrecognized trehalase,NTH2. Through molecular and genetic analyses, we revealed thatNTH2 and a previously characterized trehalase, NTH1, are fullyresponsible for trehalose utilization in C. neoformans and havelargely overlapping trehalase functions, even though Nth1 is pre-dicted to be cytosolic and Nth2 secreted. Significantly, we show forthe first time that trehalose degradation is a key function in C.neoformans that is important for fruiting body formation, sporebiogenesis, and germination. Trehalases play a critical role in sig-naling cell fate decisions. In the absence of trehalases, very fewspores are produced during sexual development; instead, devel-opment shifts to the formation of chlamydospores. The pheno-types of NTH1 and NTH2 diverge in a mouse model of infectionwhere the deletion of NTH2 results in hypervirulence.

Trehalose homeostasis determines cell fate during sexual de-velopment. Trehalose has been shown to play two primary roleswithin microbes. First, trehalose is a reserve carbohydrate that canbe accumulated and cleaved into two glucose molecules when ex-ternal carbon sources are scarce, and second, trehalose acts as anosmostabilizer and stress protectant (17). In C. neoformans, treh-alose biosynthesis is required for initiating sexual development,but roles for trehalose degradation in sexual development havenot been documented in any system (23, 55). Our data now bringthe full trehalose pathway to light and show that trehalose degra-

dation influences many aspects of C. neoformans biology and iscritical for complete sexual development. Notably, in the absenceof trehalase genes, development shifts from the formation of fruit-ing bodies and spores to the formation of what appears to be analternative cell type known as chlamydospores (26). While little isknown about the properties of chlamydospores in C. neoformans,they have been postulated to be structures from which yeast canbud off and establish new colonies (26). Lin and Heitman proposethat nutrient sensing through the accumulation of carbohydratestorage molecules, particularly glycogen, drives cell fate decisionsbetween chlamydospore formation and sporulation. However,glycogen biosynthesis genes, whose transcripts are also highly en-riched in spores, are dispensable for both chlamydospore forma-tion and sporulation (26), implicating signaling roles for othercarbohydrates. Our findings indicate that trehalose functions as ametabolic signal for determining whether filamentous growthshould be terminated with spore production or whether condi-tions are sufficiently favorable to continue proliferating (via chla-mydospores) and return to vegetative growth.

Based on these findings, we propose a model in which trehaloselevels are a readout for glucose availability (refer to Fig. 1B). In thismodel, as glucose becomes limiting, sexual development can ini-tiate, and spore formation is favored; trehalose levels remain lowbecause of limited substrates for its production, indicating themetabolic need to differentiate into spores. Spores are the termi-nal consequence of development under these conditions; thus, thecurrent colony is abandoned by dispersed spores for growth in amore favorable environment elsewhere. However, if nutrientstores are replenished at any point during filamentation, trehaloselevels rise (as glucose-derived substrates become plentiful), indi-cating a change in nutrient availability, and normal growth andcolony expansion can be restored through chlamydospore pro-duction.

This model is consistent with the seemingly paradoxical result

FIG 5 Trehalase-deficient spores are defective for growth. Spores from thewild type and nth1�, nth2�, and nth1� nth2� crosses were isolated, counted,and cultured on rich medium for 3 days at 30°C. The x axis represents thegenotype of spores. The y axis represents the percentage of spores plated thatproduced a colony. Resulting mean germination frequencies from three inde-pendent biological replicates were compared using ANOVA, with only nth1�nth2� spores having a significant reduction (P � 0.05) in germination.

FIG 6 Strains harboring nth2� are hypervirulent in mice. The x axis showstime, in days, after tail vein infection with 1 � 106 � wild-type (diamonds), �nth1� (squares), � nth2� (triangles), or � nth1� nth2� (cross hatches) yeast.The y axis shows percent survival of five BALB/c mice per strain. The differencein average time to death between nth2� and nth1� nth2� strains versus wild-type and nth1� strains is 7 days and is both statistically significant (P � 0.05 byWilcoxon rank-sum test) and reproducible between experiments.

Trehalose Metabolism Controls Spore Production

September 2014 Volume 13 Number 9 ec.asm.org 1165

on May 27, 2020 by guest

http://ec.asm.org/

Dow

nloaded from

that deletion of trehalose synthase (TPS1) and deletion of the tre-halases (NTH1 and NTH2) both result in severe defects in sporu-lation. In both cases the substrates derived from glucose to maketrehalose (i.e., glucose-6-phosphate and UDP-glucose) are notused (as in tps1�) or needed (as in nth1� nth2�), resulting in achange in metabolic flux toward carbohydrate storage as glycogen.Given that chlamydospores are hypothesized carbohydrate stor-age structures, a shift toward glycogen storage could result in ashift in development. In this way, trehalose concentration acts as asensor of metabolic conditions to toggle between two differentdevelopmental pathways, controlling a critical cell fate decision byplaying a novel signaling role rather than simply functioning onlyas a fuel source or osmoprotectant. This is akin to the role oftrehalose signaling in plants that serves to regulate developmentand plant physiology. However, plants do not accumulate treha-lose to the high levels typical of fungi; thus, the contribution oftrehalose metabolism to signaling versus stress responses and nu-trition is not well understood in plants. The increased develop-ment of chlamydospores in trehalase-deficient C. neoformans mayserve as a platform to dissect the different contributions of treha-lose metabolism to the physiology of fungal pathogens.

Metabolic adaptation, differentiation, and consequences forvirulence. In this work, we discovered that trehalose degradationaffects spore germination, which is critical for the long-term sur-vival of the organism in both the natural environment and a hostlung. In the absence of NTH1 and NTH2, spore germination drops3-fold, suggesting that trehalase function is important for stabiliz-ing dormant spores, cleaving trehalose into glucose for fuel duringgermination, or both. The fact that both rich medium conditionsand the mammalian lung are germination inducing (3, 11, 12)underscores a characteristic feature of C. neoformans, namely, theability to survive and grow in rapidly changing environmentalconditions. The tissues of a mammalian host are an unusual envi-ronment for C. neoformans to inhabit; thus, the ability to respondto these conditions likely is shaped by the selection pressures of itstypical environmental niches (56, 57). The advantages potentiallyconferred by this relationship have been proposed to explainmany of the survival behaviors exhibited by C. neoformans in thehost. For example, Steenbergen et al. posit that the unusual abilityof C. neoformans to survive and grow within macrophages resultsfrom adaptive strategies developed in the natural environment inresponse to soil amoeba (58).

In the same vein, it would seem likely that adaptations to effi-ciently access internal stores of energy (e.g., trehalase activity tocleave accumulated trehalose) and scavenge trehalose from theenvironment would enhance survival in the host. Surprisingly,however, we discovered that an nth2� strain is hypervirulent in amouse model of infection, indicating a negative correlation be-tween trehalase function and virulence in the mouse host. That is,the presence of an intact trehalose-degrading pathway confers adisadvantage in disease-causing ability. One possible explanationfor this finding lies in the fact that Nth2 is predicted to be secreted.Perhaps Nth2 is an antigen that can be recognized by the adaptiveimmune system, allowing the host immune response more oppor-tunity to inhibit C. neoformans growth.

Altering trehalose metabolism in other fungal pathogens hasbeen shown to both positively and negatively affect virulence inmurine models of infection. Broadly, trehalose accumulation hasbeen associated with increased stress resistance that typically re-sults in increased infectivity or virulence (17). However, changes

in trehalose accumulation can result in changes in cell wall struc-ture and morphogenesis that also may affect the ability of fungalpathogens to cause disease (20, 21, 23). There may be changes thatoccur in trehalase-deficient C. neoformans yeast inside a mamma-lian host, such as cell wall polysaccharide composition or titan cellformation (enlarged yeast cells associated with virulence), that canbe elucidated in future studies of the interaction of trehalase-de-ficient C. neoformans and the host.

Intersections among sexual development, metabolism, andpathogenesis. Spores, as infectious particles, form an obviousconnection between the processes of sexual development andmammalian pathogenesis, but the full relationship is more com-plex. In this work, we reveal a link between the processes of sporeproduction and virulence in a mammalian host through the ac-tions of trehalose-degrading enzymes. This unexpected connec-tion underscores the emerging relationships between sexual de-velopment and virulence among human fungal pathogens ingeneral and the role of metabolic acclimation in C. neoformans inparticular. Responses in C. neoformans to the extreme conditionsbetween the natural environment and human host are of particu-lar interest, because understanding metabolic adaptations prom-ises to reveal pathways that influence pathogenesis.

The importance of these relationships is underscored by recentstudies of C. neoformans morphology in which filamentousgrowth of C. neoformans results in a loss of virulence in mice,implying that yeast morphology plays a role in pathogenesis. Acoincident possibility, however, is that morphology is secondaryto changes in metabolic gene expression between yeast respondingto environmental signals (such as those that initiate developmen-tal changes) and yeast responding to host conditions. The result-ing metabolic acclimation results in both positive and negativeeffects on pathogen survival in the host and could help to explaindifferences in virulence properties observed between clinical andenvironmental isolates. One possibility is that gene expressionpatterns that would normally be advantageous in an environmen-tal niche but disadvantageous within a host are modified, makingthe host a selective environment for cells that have the capacity torapidly modulate expression of metabolic or stress response path-ways. Discovering these pathways provides another route to un-derstanding how host resources are enhanced to prevent fungalinfection and/or disease.

ACKNOWLEDGMENTS

We thank A. Adams, J. Ekena, S. Peters, and J. Kusiak for laboratorysupport and N. Walsh, M. Mead, and C. Fox for comments on the man-uscript. We thank the University of Wisconsin Laboratory Animal Re-source Staff for the care of animals used in this study.

This work was supported by NIH R01 AI064287, NIH R01 AI059370,and a Burroughs Wellcome Fund Career Award in Biomedical Sciences,all to C.M.H. M.R.B. was supported by the University of Wisconsin Mo-lecular Biosciences Training Grant NIH T3GM07215.

REFERENCES1. Harder W, Dijkhuizen L. 1983. Physiological responses to nutrient limita-

tion. Annu. Rev. Microbiol. 37:1–23. http://dx.doi.org/10.1146/annurev.mi.37.100183.000245.

2. Setlow P. 2006. Spores of Bacillus subtilis: their resistance to and killing byradiation, heat and chemicals. J. Appl. Microbiol. 101:514 –525. http://dx.doi.org/10.1111/j.1365-2672.2005.02736.x.

3. Botts MR, Giles SS, Gates MA, Kozel TR, Hull CM. 2009. Isolation andcharacterization of Cryptococcus neoformans spores reveal a critical role forcapsule biosynthesis genes in spore biogenesis. Eukaryot. Cell 8:595– 605.http://dx.doi.org/10.1128/EC.00352-08.

Botts et al.

1166 ec.asm.org Eukaryotic Cell

on May 27, 2020 by guest

http://ec.asm.org/

Dow

nloaded from

4. Briza P, Breitenbach M, Ellinger A, Segall J. 1990. Isolation of twodevelopmentally regulated genes involved in spore wall maturation inSaccharomyces cerevisiae. Genes Dev. 4:1775–1789. http://dx.doi.org/10.1101/gad.4.10.1775.

5. Haber JE, Halvorson HO. 1975. Methods in sporulation and germinationof yeasts. Methods Cell Biol. 11:45– 69. http://dx.doi.org/10.1016/S0091-679X(08)60316-7.

6. Converse JL, Reed RE. 1966. Experimental epidemiology of coccidioid-omycosis. Bacteriol. Rev. 30:678 – 695.

7. Klein BS, Vergeront JM, Davis JP. 1986. Epidemiologic aspects ofblastomycosis, the enigmatic systemic mycosis. Semin. Respir. Infect.1:29 –39.

8. Latgé JP. 1999. Aspergillus fumigatus and aspergillosis. Clin. Microbiol.Rev. 12:310 –350.

9. Aimanianda V, Bayry J, Bozza S, Kniemeyer O, Perruccio K, Elluru SR,Clavaud C, Paris S, Brakhage AA, Kaveri SV, Romani L, Latgé J-P. 2009.Surface hydrophobin prevents immune recognition of airborne fungalspores. Nature 460:1117–1121. http://dx.doi.org/10.1038/nature08264.

10. Ellis DH, Pfeiffer TJ. 1990. Ecology, life cycle, and infectious propagule ofCryptococcus neoformans. Lancet 336:923–925. http://dx.doi.org/10.1016/0140-6736(90)92283-N.

11. Velagapudi R, Hsueh YP, Geunes-Boyer S, Wright JR, Heitman J. 2009.Spores as infectious propagules of Cryptococcus neoformans. Infect. Im-mun. 77:4345– 4355. http://dx.doi.org/10.1128/IAI.00542-09.

12. Giles SS, Dagenais TR, Botts MR, Keller NP, Hull CM. 2009. Elucidatingthe pathogenesis of spores from the human fungal pathogen Cryptococcusneoformans. Infect. Immun. 77:3491–3500. http://dx.doi.org/10.1128/IAI.00334-09.

13. Mitchell TG, Perfect JR. 1995. Cryptococcosis in the era of AIDS–100years after the discovery of Cryptococcus neoformans. Clin. Microbiol. Rev.8:515–548.

14. Mackenzie KF, Singh KK, Brown AD. 1988. Water stress plating hyper-sensitivity of yeasts: protective role of trehalose in Saccharomyces cerevi-siae. J. Gen. Microbiol. 134:1661–1666.

15. Mitsumasu K, Kanamori Y, Fujita M, Iwata K, Tanaka D, Kikuta S,Watanabe M, Cornette R, Okuda T, Kikawada T. 2010. Enzymaticcontrol of anhydrobiosis-related accumulation of trehalose in the sleepingchironomid, Polypedilum vanderplanki. FEBS J. 277:4215– 4228. http://dx.doi.org/10.1111/j.1742-4658.2010.07811.x.

16. Nwaka S, Holzer H. 1998. Molecular biology of trehalose and the trehala-ses in the yeast Saccharomyces cerevisiae. Prog. Nucleic Acid Res. Mol. Biol.58:197–237.

17. Tournu H, Fiori A, Van Dijck P. 2013. Relevance of trehalose in patho-genicity: some general rules, yet many exceptions. PLoS Pathog.9:e1003447. http://dx.doi.org/10.1371/journal.ppat.1003447.

18. Elbein AD, Pan YT, Pastuszak I, Carroll D. 2003. New insights ontrehalose: a multifunctional molecule. Glycobiology 13:17R–27R. http://dx.doi.org/10.1093/glycob/cwg047.

19. Sánchez-Fresneda R, Guirao-Abad JP, Argüelles A, González-Párraga P,Valentín E, Argüelles J-C. 2013. Specific stress-induced storage of treh-alose, glycerol and D-arabitol in response to oxidative and osmotic stressin Candida albicans. Biochem. Biophys. Res. Commun. 430:1334 –1339.http://dx.doi.org/10.1016/j.bbrc.2012.10.118.

20. Pedreño Y, González-Párraga P, Martínez-Esparza M, Sentandreu R,Valentín E, Argüelles J-C. 2007. Disruption of the Candida albicans ATC1gene encoding a cell-linked acid trehalase decreases hypha formation andinfectivity without affecting resistance to oxidative stress. Microbiology153:1372–1381. http://dx.doi.org/10.1099/mic.0.2006/003921-0.

21. Serneels J, Tournu H, Van Dijck P. 2012. Tight control of trehalosecontent is required for efficient heat-induced cell elongation in Candidaalbicans. J. Biol. Chem. 287:36873–36882. http://dx.doi.org/10.1074/jbc.M112.402651.

22. Zaragoza O, Blazquez MA, Gancedo C. 1998. Disruption of the Candidaalbicans TPS1 gene encoding trehalose-6-phosphate synthase impairs for-mation of hyphae and decreases infectivity. J. Bacteriol. 180:3809 –3815.

23. Al-Bader N, Vanier G, Liu H, Gravelat FN, Urb M, Hoareau CM-Q,Campoli P, Chabot J, Filler SG, Sheppard DC. 2010. Role of trehalosebiosynthesis in Aspergillus fumigatus development, stress response, andvirulence. Infect. Immun. 78:3007–3018. http://dx.doi.org/10.1128/IAI.00813-09.

24. Petzold EW, Himmelreich U, Mylonakis E, Rude T, Toffaletti D, CoxGM, Miller JL, Perfect JR. 2006. Characterization and regulation of thetrehalose synthesis pathway and its importance in the pathogenicity of

Cryptococcus neoformans. Infect. Immun. 74:5877–5887. http://dx.doi.org/10.1128/IAI.00624-06.

25. Ngamskulrungroj P, Himmelreich U, Breger JA, Wilson C, Chayakul-keeree M, Krockenberger MB, Malik R, Daniel H-M, Toffaletti D,Djordjevic JT, Mylonakis E, Meyer W, Perfect JR. 2009. The trehalosesynthesis pathway is an integral part of the virulence composite for Cryp-tococcus gattii. Infect. Immun. 77:4584 – 4596. http://dx.doi.org/10.1128/IAI.00565-09.

26. Lin X, Heitman J. 2005. Chlamydospore formation during hyphal growthin Cryptococcus neoformans. Eukaryot. Cell 4:1746 –1754. http://dx.doi.org/10.1128/EC.4.10.1746-1754.2005.

27. Kwon-Chung KJ, Edman JC, Wickes BL. 1992. Genetic association ofmating types and virulence in Cryptococcus neoformans. Infect. Immun.60:602– 605.

28. Sherman F. 1991. Getting started with yeast. Methods Enzymol. 194:3–21.http://dx.doi.org/10.1016/0076-6879(91)94004-V.

29. Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA.1988. Current protocols in molecular biology. Wiley Interscience, Hobo-ken, NJ.

30. Kruzel EK, Giles SS, Hull CM. 2012. Analysis of Cryptococcus neoformanssexual development reveals rewiring of the pheromone-response networkby a change in transcription factor identity. Genetics 191:435– 449. http://dx.doi.org/10.1534/genetics.112.138958.

31. Kerr MK, Churchill GA. 2001. Statistical design and the analysis of geneexpression microarray data. Genet. Res. 77:123–128. http://dx.doi.org/10.1017/S0016672308009713.

32. Quackenbush J. 2001. Computational analysis of microarray data. Nat.Rev. Genet. 2:418 – 427. http://dx.doi.org/10.1038/35076576.

33. Kanehisa M. 2000. KEGG: Kyoto Encyclopedia of Genes and Genomes.Nucleic Acids Res. 28:27–30. http://dx.doi.org/10.1093/nar/28.1.27.

34. Ashburner M, Ball CA, Blake JA, Botstein D, Butler H, Cherry JM,Davis AP, Dolinski K, Dwight SS, Eppig JT, Harris MA, Hill DP,Issel-Tarver L, Kasarskis A, Lewis S, Matese JC, Richardson JE, Ring-wald M, Rubin GM, Sherlock G. 2000. Gene ontology: tool for theunification of biology. The Gene Ontology Consortium. Nat. Genet. 25:25–29. http://dx.doi.org/10.1038/75556.

35. Huang DW, Sherman BT, Lempicki RA. 2009. Systematic and integra-tive analysis of large gene lists using DAVID bioinformatics resources.Nat. Protoc. 4:44 –57. http://dx.doi.org/10.1038/nprot.2008.211.

36. Davidson RC, Blankenship JR, Kraus PR, de Jesus Berrios M, Hull CM,D’Souza C, Wang P, Heitman J. 2002. A PCR-based strategy to generateintegrative targeting alleles with large regions of homology. Microbiology148:2607–2615.

37. Toffaletti DL, Rude TH, Johnston SA, Durack DT, Perfect JR. 1993.Gene transfer in Cryptococcus neoformans by use of biolistic delivery ofDNA. J. Bacteriol. 175:1405–1411.

38. Sherman F, Fink GR, Hicks JB. 1986. Laboratory course manual formethods in yeast genetics. Cold Spring Harbor Laboratory Press, ColdSpring Harbor, NY.

39. Parrou JL, François J. 1997. A simplified procedure for a rapid andreliable assay of both glycogen and trehalose in whole yeast cells. Anal.Biochem. 248:186 –188. http://dx.doi.org/10.1006/abio.1997.2138.

40. Zaragoza O, Fries BC, Casadevall A. 2003. Induction of capsule growth inCryptococcus neoformans by mammalian serum and CO2. Infect. Immun.71:6155– 6164. http://dx.doi.org/10.1128/IAI.71.11.6155-6164.2003.

41. McFadden D, Zaragoza O, Casadevall A. 2006. The capsular dynamics ofCryptococcus neoformans. Trends Microbiol. 14:497–505. http://dx.doi.org/10.1016/j.tim.2006.09.003.

42. Hu G, Steen BR, Lian T, Sham AP, Tam N, Tangen KL, KronstadJW. 2007. Transcriptional regulation by protein kinase A in Cryptococ-cus neoformans. PLoS Pathog. 3:e42. http://dx.doi.org/10.1371/journal.ppat.0030042.

43. Giles SS, Stajich JE, Nichols C, Gerrald QD, Alspaugh JA, Dietrich F,Perfect JR. 2006. The Cryptococcus neoformans catalase gene family and itsrole in antioxidant defense. Eukaryot. Cell 5:1447–1459. http://dx.doi.org/10.1128/EC.00098-06.

44. Casadevall A, Perfect JR. 1998. Cryptococcus neoformans. ASM Press,Washington, DC.

45. Edgar R, Domrachev M, Lash AE. 2002. Gene Expression Omnibus:NCBI gene expression and hybridization array data repository. NucleicAcids Res. 30:207–210. http://dx.doi.org/10.1093/nar/30.1.207.

46. Yamashita I, Fukui S. 1985. Transcriptional control of the sporulation-

Trehalose Metabolism Controls Spore Production

September 2014 Volume 13 Number 9 ec.asm.org 1167

on May 27, 2020 by guest

http://ec.asm.org/

Dow

nloaded from

specific glucoamylase gene in the yeast Saccharomyces cerevisiae. Mol. Cell.Biol. 5:3069 –3073.

47. Muthukumar G, Suhng SH, Magee PT, Jewell RD, Primerano DA. 1993.The Saccharomyces cerevisiae SPR1 gene encodes a sporulation-specificexo-1,3-�-glucanase which contributes to ascospore thermoresistance. J.Bacteriol. 175:386 –394.

48. Ramalingam R, Blume JE, Ennis HL. 1992. The Dictyostelium discoideumspore germination-specific cellulase is organized into functional domains.J. Bacteriol. 174:7834 –7837.

49. Garre E, Matallana E. 2009. The three trehalases Nth1p, Nth2p and Ath1pparticipate in the mobilization of intracellular trehalose required for re-covery from saline stress in Saccharomyces cerevisiae. Microbiology 155:3092–3099. http://dx.doi.org/10.1099/mic.0.024992-0.

50. Jules M, Beltran G, François J, Parrou JL. 2008. New insights intotrehalose metabolism by Saccharomyces cerevisiae: NTH2 encodes a func-tional cytosolic trehalase, and deletion of TPS1 reveals Ath1p-dependenttrehalose mobilization. Appl. Environ. Microbiol. 74:605– 614. http://dx.doi.org/10.1128/AEM.00557-07.

51. Hirimburegama K, Durnez P, Keleman J, Oris E, Vergauwen R, Mer-gelsberg H, Thevelein JM. 1992. Nutrient-induced activation of trehalasein nutrient-starved cells of the yeast Saccharomyces cerevisiae: cAMP is notinvolved as a second messenger. J. Gen. Microbiol. 138:2035–2043. http://dx.doi.org/10.1099/00221287-138-10-2035.

52. Parrou JL, Jules M, Beltran G, François J. 2005. Acid trehalase in yeastsand filamentous fungi: localization, regulation and physiological func-tion. FEMS Yeast Res. 5:503–511. http://dx.doi.org/10.1016/j.femsyr.2005.01.002.

53. He S, Bystricky K, Leon S, François JM, Parrou JL. 2009. The Saccha-romyces cerevisiae vacuolar acid trehalase is targeted at the cell surface forits physiological function. FEBS J. 276:5432–5446. http://dx.doi.org/10.1111/j.1742-4658.2009.07227.x.

54. Panepinto JC, Komperda KW, Hacham M, Shin S, Liu X, WilliamsonPR. 2007. Binding of serum mannan binding lectin to a cell integrity-defective Cryptococcus neoformans ccr4� mutant. Infect. Immun. 75:4769 – 4779. http://dx.doi.org/10.1128/IAI.00536-07.

55. Ni M, Yu J-H. 2007. A novel regulator couples sporogenesis and trehalosebiogenesis in Aspergillus nidulans. PLoS One 2:e970. http://dx.doi.org/10.1371/journal.pone.0000970.

56. Kronstad J, Saikia S, Nielson ED, Kretschmer M, Jung W, Hu G,Geddes JMH, Griffiths EJ, Choi J, Cadieux B, Caza M, Attarian R. 2012.Adaptation of Cryptococcus neoformans to mammalian hosts: integratedregulation of metabolism and virulence. Eukaryot. Cell 11:109 –118. http://dx.doi.org/10.1128/EC.05273-11.

57. Hu G, Cheng P-Y, Sham A, Perfect JR, Kronstad JW. 2008. Metabolicadaptation in Cryptococcus neoformans during early murine pulmonaryinfection. Mol. Microbiol. 69:1456 –1475. http://dx.doi.org/10.1111/j.1365-2958.2008.06374.x.

58. Steenbergen JN, Shuman HA, Casadevall A. 2001. Cryptococcus neofor-mans interactions with amoebae suggest an explanation for its virulenceand intracellular pathogenic strategy in macrophages. Proc. Natl. Acad.Sci. U. S. A. 98:15245–15250. http://dx.doi.org/10.1073/pnas.261418798.

59. National Research Council. 2011. Guide for the care and use of laboratoryanimals, 8th ed. National Academies Press, Washington, D.C.

Botts et al.

1168 ec.asm.org Eukaryotic Cell

on May 27, 2020 by guest

http://ec.asm.org/

Dow

nloaded from