disrupting androgen receptor signaling induces snail ... · alexa fluor 488 (#7395 clone d6f11,...

Tumor and Stem Cell Biology

Disrupting Androgen Receptor Signaling InducesSnail-Mediated Epithelial–Mesenchymal Plasticityin Prostate CancerLu Miao1, Lin Yang1,2, Rui Li1, Daniel N. Rodrigues3, Mateus Crespo3, Jer-Tsong Hsieh1,Wayne D. Tilley4,5, Johann de Bono3, Luke A. Selth4,5, and Ganesh V. Raj1

Abstract

Epithelial-to-mesenchymal plasticity (EMP) has been linkedto metastasis, stemness, and drug resistance. In prostate cancer,EMP has been associated with both suppression and activationof the androgen receptor (AR) signaling. Here we investigatedthe effect of the potent AR antagonist enzalutamide on EMP inmultiple preclinical models of prostate cancer and patienttissues. Enzalutamide treatment significantly enhanced theexpression of EMP drivers (ZEB1, ZEB2, Snail, Twist, andFOXC2) and mesenchymal markers (N-cadherin, fibronectin,and vimentin) in prostate cancer cells, enhanced prostatecancer cell migration, and induced prostate cancer transfor-mation to a spindle, fibroblast-like morphology. Enzaluta-mide-induced EMP required concomitant suppression of AR

signaling and activation of the EMP-promoting transcriptionfactor Snail, as evidenced by both knockdown and overexpres-sion studies. Supporting these findings, AR signaling and Snailexpression were inversely correlated in C4-2 xenografts,patient-derived castration-resistant metastases, and clinicalsamples. For the first time, we elucidate a mechanism explain-ing the inverse relationship between AR and Snail. Specifically,we found that AR directly repressed SNAI1 gene expression bybinding to specific AR-responsive elements within the SNAI1promoter. Collectively, our findings demonstrate that de-repression of Snail and induction of EMP is an adaptiveresponse to enzalutamide with implications for therapy resis-tance. Cancer Res; 77(11); 3101–12. �2017 AACR.

IntroductionProstate cancer is the most common cancer in men. Clinically

localizedprostate cancer is curablewith local therapy (radiationorsurgery). For patients with metastatic prostate cancer, the primarytherapeuticmodalities target the androgen receptor (AR), which isthe key molecular driver of disease. These therapies, collectivelytermed androgen deprivation therapy (ADT), are aimed at eitherdecreasing the production of endogenous androgenic ligandsand/or competitively directly blocking the androgen-binding site

on the AR (antiandrogens; ref. 1). Although most men willrespond to AR-targeted treatments, cancer often recurs with pro-gression to castration-resistant prostate cancer (CRPC). Impor-tantly, in these therapy-resistant tumors, AR signaling remainsactive (2). More potent second-generation AR-targeting agents,including abiraterone (Zytiga) and enzalutamide (Xtandi),have shown efficacy against metastatic CRPC (3, 4). However,durable responses to these newer agents are rare, with manymen exhibiting de novo resistance, and all tumors will progressdespite treatment (5, 6). Mechanisms underlying continued ARsignaling in CRPC include: increased androgen biosynthesis,characterized by the conversion of nontesticular androgens orother steroid hormones to more potent androgens in peripheraltissues (7); overexpression and/or amplification of the AR gene,which can result in the receptor being activated by castratelevels of androgens (8); gain-of-function AR point mutations,resulting in receptors that can be activated by nonclassicalligands and AR antagonists (9, 10) such as ARF876L (11, 12);expression of androgen-independent AR splice variants (13);and aberrant activation of alternative steroid receptor signalingpathways, such as glucocorticoid receptor (14).

Although each of these mechanisms has been noted in a subsetof patients, additional adaptive responses to therapy are likely tocontribute to thedevelopment of resistance.One suchprocess thatmay represent an adaptive response to therapy and a mediator ofresistance is epithelial–mesenchymal transition (EMT) or epithe-lial–mesenchymal plasticity (EMP). EMP encompasses both EMTand the reverse process, mesenchymal–epithelial transition(MET). The concept of EMT emerged from embryological studiesanddescribes a process bywhich cells lose features of epithelia, for

1Department of Urology, University of Texas Southwestern Medical Center atDallas, Dallas, Texas. 2Department of Urology, The First Affiliated Hospital ofMedical College of Xi'an Jiaotong University, Urology Institute of Xi'an JiaotongUniversity, Xi'an, Shaanxi, China. 3Division of Clinical Studies, The Institute ofCancer Research, London, United Kingdom. 4Dame Roma Mitchell CancerResearch Laboratories, Adelaide Medical School, University of Adelaide, Ade-laide, South Australia, Australia. 5Freemason's Foundation Centre for Men'sHealth, Adelaide Medical School, University of Adelaide, Adelaide, SouthAustralia, Australia.

Note: Supplementary data for this article are available at Cancer ResearchOnline (http://cancerres.aacrjournals.org/).

L. Miao and L. Yang contributed equally to this article

L. Miao and L. Yang are the co-first authors of this article.

Corresponding Author: Ganesh V. Raj, University of Texas SouthwesternMedical Center, 5323 Harry Hines Boulevard, Dallas, TX 75390. Phone: 214-648-8532; Fax: 214-648-8786; E-mail: [email protected]

doi: 10.1158/0008-5472.CAN-16-2169

�2017 American Association for Cancer Research.

CancerResearch

www.aacrjournals.org 3101

on August 15, 2020. © 2017 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

Published OnlineFirst March 16, 2017; DOI: 10.1158/0008-5472.CAN-16-2169

http://crossmark.crossref.org/dialog/?doi=10.1158/0008-5472.CAN-16-2169&domain=pdf&date_stamp=2017-5-18

http://cancerres.aacrjournals.org/

example intercellular adhesion and tight junctions, and acquiremesenchymal traits, for example motility and migratory capacity(15). Molecularly, EMP is driven by transcription factors such asSnail/Slug, Twist, and ZEB1/2 and is characterized by downregu-lation of epithelial factors [e.g., E-cadherin and epithelial celladhesionmolecule (EpCAM)] and upregulation of mesenchymalfactors (e.g., vimentin, fibronectin and N-cadherin; ref. 15). EMPhas been proposed as a putative, albeit not necessarily essential,mechanism utilized by carcinoma cells to invade adjacent tissuesand gain access to the bloodstream (16–18) and has been asso-ciated with increased stemness, suppression of apoptosis, andsenescence (16) and therapy resistance (18). The clinical relevanceof EMT remains somewhat controversial as evidence of a mesen-chyme-like phenotype is rarely observed in histologic specimensof most human carcinomas (19). However, EMP would allowtumor cells to transition to-and-fromamesenchyme-like state andcould provide a plausible explanation for this apparent contro-versy (20, 21).

A number of recent studies have provided evidence for a linkbetween AR signaling and EMP (22, 23). However, these studieshave produced incongruent findings, with both activation andrepressionofAR signaling associatedwithEMP. Inone study, EMPwas activated both by TGFb and 5a-DHT in prostate cancerepithelial cells, although paradoxically this response was inhib-ited by AR (24). Moreover, AR was demonstrated to upregulateand interacts directly with Slug, leading to cooperative generegulation and facilitating castration resistance both in vitro andin vivo (25, 26). In contrast to the aforementioned studies, othershave reported that inhibition of AR signaling promotes EMP. Sunand colleagues demonstrated that normal mouse prostate tissueand human LuCaP35 prostate tumors displayed a more mesen-chymal phenotype and stem cell-like features in response tocastration (27). In addition, N-cadherin and cadherin-11, bothrobust markers of themesenchymal state, are reported to increasein response to ADT in patients (28, 29). Collectively, these dataindicate an intimate link between AR signaling and EMP butsuggest that the relationship can vary widely in a context-depen-dent manner (22). In this study, we aimed to investigate thisconcept in by examining whether targeting AR signaling with thesecond-generation AR targeting agents could regulate EMP inprostate cancer. We show that enzalutamide induces EMP, andidentify a novel mechanism whereby AR directly represses theEMP-inducing transcription factor Snail.

Materials and MethodsCell lines and reagents

Human prostate cancer cell lines, PC3, LAPC4, VCaP, and22Rv1 were obtained from ATCC. C4-2, PC-3(AR)2, R1-D567were kind gifts from Drs. Leland Chung (Cedar-Sinai MedicalCenter), Theodore Brown (University of Toronto, Toronto,Canada), andScottDehm(University ofMinnesota), respectively.All cell lines are monitored to confirm absence of mycoplasma(e-Myco Kit, Boca Scientific). Provenance of all cell lines is verifiedby microsatellite genotyping using the PowerPlex 1.2 Microsat-ellite Detection Kit (Promega) and the fingerprint library main-tained byATCC. PC3, PC-3(AR)2, andC4-2 cells weremaintainedin RPMI1640 with 10% FBS and antibiotics (100 units/mLpenicillin and 100mg/mL streptomycin). LAPC4 cells weremain-tained in Iscove's modified Dulbecco's medium (IMDM) media.The VCaP and 22Rv1 cells were cultured in DMEM. DHT was

purchased from Sigma; enzalutamide and abiraterone were pur-chased from Selleckchem. DHT and abiraterone were dissolved inethanol and enzalutamide was dissolved in DMSO.

Western blot analysisTotal protein was extracted from the cell pellets by homoge-

nization in RIPA buffer. Protein samples were loaded into 4% to15% SDS-PAGE (Bio-Rad) and subjected to electrophoretic anal-ysis and subsequent blocking. Membranes were incubated withthe primary antibody (overnight at 4�C) and the relevant sec-ondary antibodies (1 h at room temperature). The N-cadherinantibodies were purchased from BD Biosciences (catalog no.610920); vimentin (catalog no. V6389), fibronectin (catalog no.F3648), AR (N-20; catalog no. A9853), and b-actin antibodiesfrom Sigma-Aldrich; AR-V7 antibody from RevMAb Biosciences(catalogno. 31-1109-00), Snail antibody (C15D3)was purchasedfrom Cell Signaling Technology.

In vitro transwell migration assayFor migration assays, 5� 105 cells after 6 days treatments were

plated in the top chamber of a Transwell (24-well insert; poresize ¼ 8 mm; Corning), and incubated in phenol red–free RPMI(pfRPMI) þ 1% CSS. DHT/Ethanol was added in both top andbottom chambers. After incubation for 24 and 48 hours, cells onthe lower surface of the membrane were stained with Cell Stain(Chemicon) and counted under the microscope.

Transfection and RNA silencingCells were transfected with siRNAs using siLentFect Lipid

Reagent (Bio-Rad) according to the manufacturer's protocols. ARsiRNAs were synthesized to specifically target AR exon 1 (targetsequence: CAAGGGAGGUUACACCAAAUU), AR exon 7 (targetsequence: GAAAUGAUUGCACUAUUGAUU), or AR exon 3b(target sequence: GUAGUUGUGAGUAUCAUGA). SNAI1 siRNAsmartpool (L-010847-01-0005) and control siRNA (catalog no.D-001810-01-20) were purchased from Dharmacon.

Total RNA extraction and quantitative real-time RT-PCRanalysis

The total cellular RNA was extracted using the RNeasy Mini Kit(Qiagen). A total of 1 mg RNA was subjected to the ReverseTranscription Kit (Invitrogen). The relative level of mRNA fromeach sample was determined by normalizing 18S rRNA. Allprimers used in this study were listed in the Supplementary TableS1. All experiments were repeated and averaged from threeindependent experiments.

Chromatin immunoprecipitationFollowing treatment, chromatin immunoprecipitation (ChIP)

experiments with antibodies specific for the AR (AR-N20, Sigma-Aldrich) or RNA polymerase 2 (Abcam) were performed for threeindependent biological replicate experiments as described (30).For ChIP-qPCR,DNA (ChIP-enriched and input)was subjected toquantitative PCR using primers specific to the sequences flankingthe AR binding elements or RNA polymerase II binding regionwithin the SNAI1 promoter. Primer sequences are listed in Sup-plementary Table S1.

Immunofluorescence staining of cell linesAfter treatment, cells were fixed with 4% paraformaldehyde in

PBS and permeabilized in 0.1% Triton X-100 in PBS. Cells were

Miao et al.

Cancer Res; 77(11) June 1, 2017 Cancer Research3102




stained by incubation with the primary antibody (overnight at4�C), followed by exposure to the FITC-conjugated anti-mouseIgG (1 hour at room temperature) or Rhodamine (TRITC)-conjugated anti-rabbit IgG were purchased from MolecularProbes. Confocal immunofluorescence microscopy was per-formed using a Zeiss lsm 510 meta confocal microscope.

IHC of xenograft tumorsConsecutive tumor sections of mice xenograft tumors and ex

vivo cultured primary tumors were stained with hematoxylin andeosin (H&E) or antibodies against AR and Snail. IHC staining wascarried out using ABC-staining Kit (Santa Cruz BiotechnologyInc.) and a biotinylated secondary antibody to rabbit IgG(Invitrogen).

Multiplex immunofluorescenceMultiplex sequential immunofluorescence (IF) staining was

performed on 4 mm sections from formalin-fixed, paraffin-embedded tissue. Antigen retrieval was performed using CC1buffer (#950-224; Ventana Medical Systems) at 98�C for 36minutes in a water bath. Tissue sections were incubated for 60minutes at room temperature with antibodies against Snail(#ab180714, dilution 1:500; Abcam), E-cadherin (# M361201,clone NCH-38, dilution 1:100; Dako), and AR conjugated toAlexa Fluor 488 (#7395 clone D6F11, dilution 1:50; Cell Signal-ing Technology). A second layer antibody using Alexa Fluor 555-conjugated IgG (HþL) goat anti-rabbit (# A21429; Invitrogen)and Alexa Fluor 647-conjugated goat anti-mouse IgG (HþL;#A21236; Invitrogen) were used to detect Snail and E-cadherin,respectively. Nuclei were counterstained with DAPI(#10236276001; Roche) and tissue sections were mounted withProLong Gold Antifade Reagent (P36930; Molecular Probes).Slides were imaged with a multispectral fluorescence microscope(Vectra; PerkinElmer) under �20 magnification.

Gene-set enrichment analysisGene-set enrichment analysis (GSEA) was performed using

GSEA v2.07 (Broad Institute; ref. 31) with publicly availabledatasets.

Statistical analysisAll error bars in graphical data represent mean � SD. Pearson

correlation coefficients were used to determine correlationbetween the expressions of two genes. Student t tests and one-way ANOVAwere performed using GraphPad Prism 6 software todetermine the statistical significance of differences between treat-ments. P < 0.05 was considered as statistically significant.

ResultsEnzalutamide induces EMP in a reversible manner

Both activation and suppression of AR signaling have beenlinked to induction of EMP in prostate cancer (24, 27), but theeffect of enzalutamide on this process has not been examined.Prostate cancer cells were treated with enzalutamide (10 mmol/L)following an experimental design comprising four distinct states(Fig. 1A), abbreviated DD, DE, EE, and ED. This design enabledthe evaluation of both 3 days (DE vs. DD) and 6 days (EE vs. DD)of enzalutamide treatment, and allowed the assessment of wheth-er the enzalutamide-mediated changes were reversible with theaddition of androgens (ED vs. EE).

Enzalutamide treatment of C4-2 prostate cancer cells inducedmesenchymal markers, including fibronectin, vimentin and N-cadherin, within 3 days and more robustly at 6 days (Fig. 1B, DEand EE vs. DD). These enzalutamide-induced EMP changes werereversible with the addition of androgens (ED vs. EE; Fig. 1B).Concurrently, we observed loss of AR signaling (shown for AR)and E-cadherin expression (Fig. 1B). In addition, enzalutamideinduced several molecular drivers of EMP at the mRNA level,including FOXC2, Twist, vimentin, ZEB1 and ZEB2 (Fig. 1C).Induction of EMPmarkers by enzalutamide was also noted in theLAPC4 and 22Rv1 prostate cancer cells (Fig. 1C and D). Asexpected, enzalutamide inhibited AR signaling in the cell linemodels tested (Supplementary Fig. S1). In addition to theobserved molecular changes, enzalutamide increased the migra-tory capacity of C4-2 prostate cancer cells (Fig. 1E). In support ofthese in vitro findings, we noted that AR target genes were posi-tively correlated with epithelial markers and negatively correlatedwithmesenchymalmarkers in two large prostate cancer transcrip-tomic datasets (Supplementary Table S2). Collectively, thesefindings suggest that active AR signaling maintains the prostatecancer epithelial state, and that inhibition of AR signaling withenzalutamide is sufficient to induce EMP.

AR is necessary for induction of EMP by enzalutamideKnockdown of AR expression in C4-2 cells using siRNA abro-

gated the ability of enzalutamide to induce EMP (Fig. 2A). In AR-negative PC3 cells, enzalutamide could neither induce the expres-sion of mesenchymal genes nor alter their migratory potential ormorphological architecture (Fig. 2B). In contrast, in a PC3-derivedcell line stably expressing AR under the control of its endogenouspromoter [PC-3(AR)2], there is a striking decrease in basal expres-sion of mesenchymal markers (fibronectin and N-cadherin; Fig.2C). In these cells, enzalutamidewas able to induce the expressionof mesenchymal markers, enhance cell migration (Fig. 2C; Sup-plementary Fig. S2), and promote amore spindle- and fibroblast-likemorphology (Fig. 2C). Together, these results indicate that ARsignaling is necessary for enzalutamide-mediated EMP in prostatecancer cells.

Snail is critical for the induction of EMP by enzalutamideAlthough the transcription of multiple EMP drivers was

induced by enzalutamide, only the Snail protein was consistentlyincreased at both the RNA and protein levels following 3 or 6 daysof treatment in C4-2 and LAPC4 cells (Fig. 3A–C and Supple-mentary Fig. S3). Induction of Snail by enzalutamide was revers-ible with the addition of androgens (Fig. 3A and 3B; compare EEwith ED). In contrast, in AR-negative PC3 cells, enzalutamide wasunable to alter snail expression (Fig. 3D). Knockdown of Snailexpression altered both the basal level and inducibility of mes-enchymal factors, such as fibronectin (Fig. 3E, top). Importantly,knockdown of Snail did not affect AR expression either in theabsence or in the presence of enzalutamide (Fig. 3E). Further-more, knockdown of Snail expression in C4-2 cells abrogated theability of enzalutamide to enhance cellmotility (Fig. 3E, bottom).Collectively, these data indicate that enzalutamide-induced EMPrequires concomitant inhibition of AR and upregulation of Snailexpression.

SNAI1 is an AR-regulated geneTo determine if SNAI1 is an androgen-regulated gene, prostate

cancer cells were treated with DHT and Snail expression was

Enzalutamide Promotes Prostate Cancer EMP

www.aacrjournals.org Cancer Res; 77(11) June 1, 2017 3103




examined by qRT-PCR and Western blotting. In C4-2 and 22Rv1cells, Snail was suppressed in a dose- and time-dependentmannerby androgen treatment at both the protein (Fig. 4A) and mRNA

(Fig. 4B) level. These findings were validated in highly androgen-responsive VCaP cells (Fig. 4C), and in PC-3(AR)2 but not PC3cells (Fig. 4D). Knockdownof ARwith siRNA attenuated the effect

Figure 1.

Enzalutamide can induce mesenchymal phenotype in a reversible manner. A, Prostate cancer cells growing in androgen-deprived media were supplementedwith DHT (10 nmol/L) or were treated with enzalutamide (10 mmol/L) for 3 days. Media was then changed to compare the effects of enzalutamide versusDHT treatment for additional 3 days. B, Following the treatment protocol as described in the schema in A, C4-2 cells were fixed and stained for EMPmarkers. Scale bar, 50 mm. C, Panel of EMP master genes was assessed by real-time PCR analysis in C4-2 and LAPC4 cells. Data from three independentexperiments mean � SD; �, P < 0.05 as determined by one-way ANOVA. D, Western blot analysis shows expression of EMP markers and AR in C4-2, LAPC4,and 22Rv1 cells. E, Migration assay in C4-2 cells. Data from three independent experiments mean � SD; � , P < 0.05 as determined by one-way ANOVA.

Miao et al.





of DHT on Snail protein expression in C4-2 cells (Fig. 4E),confirming the requirement of AR for DHT-mediated repressionof Snail.

Analysis of publicly available ChIP-Seqdata derived fromVCaPcells (35, 36) revealed a putative AR binding site within thepromoter region of the SNAI1 gene following androgen treatment(Fig. 5A). In these same studies, the recruitment of AR wasassociated with a significant decrease in RNA polymerase IIbinding at the SNAI1 transcriptional start site. We validated thesefindings by directed ChIP-qPCR in VCaP cells (Fig. 5B). Indeed,recruitment of AR was detectable at three separate regions withinthe SNAI1 promoter (Fig. 5B). To confirm that these binding siteswere responsible forAR regulation,we cloned theSNAI1promoterupstreamof luciferase and conducted reporter assays. As expected,transcriptional activity of this construct was suppressed by andro-gens in C4-2 cells (Fig. 5C). Together, these data indicate that theSNAI1 gene is under the direct transcriptional control of AR.

In the VCaP model, DHT treatment resulted in a modest butreproducible decrease in AR-V7 protein, which is consistent withprior observations and suggests that SNAI1 gene may be tran-scriptionally regulated by this AR variant (32). To address this

possibility, we used 22Rv1 cells, which express high levels of boththe full-length AR (AR-FL) and the AR-V7 variant. Selectiveknockdown of AR-FL (using siRNA to exon 7) increased basalexpression and abrogated DHT-mediated repression of Snailprotein. Knockdown of AR-V7 (using siRNA to exon 3b) alsodecreased AR-FL levels and increased basal Snail protein expres-sion. However, when the AR-V7 knockdown cells were stimulatedwith DHT, Snail expression was substantially decreased. Thesedata indicate that AR-FL is the primary regulator of SNAI1expression.

In support of this finding, we found that the ARv567es variantdoes not bind to the SNAI1 promoter in R1-D567 cells (Supple-mentary Fig. S4A), which have been genetically engineered suchthat they express only the ARv567es variant and not AR-FL (33).These data are also consistent with publishedARChIP-Seq studiesin R1-D567 cells, which failed to identify ARv567es chromatinbinding events at the SNAI1 promoter (34). As expected, given thelack of AR-FL in R1-D567 cells, Snail expressionwas not altered bythe addition of DHT (Supplementary Fig. S4B). Taken together,our data indicate that AR-FL, but not AR variants, is the primaryregulator of SNAI1 expression.

Figure 2.

AR is necessary for the induction of EMP by enzalutamide. A, Enzalutamide-mediated EMP induction and migration in C4-2 cells was blocked by AR siRNA.B, Enzalutamide does not induce EMP phenotype in PC3 cells, as evidenced by Western blotting evaluation of EMP markers, morphological structures,migration, and wound healing assays. C, Enzalutamide induced EMP in PC-3(AR)2 cells. Data from three independent experiments mean � SD; � , P < 0.05as determined by one-way ANOVA.






Enzalutamide enhances Snail expression in vivoExamination of transcriptomic data indicated that SNAI1 was

negatively associated with AR activity in two large, independentcohorts, The Cancer Genome Atlas (TCGA) andMemorial Sloan–Kettering Cancer Center (MSKCC; ref. 37), as assessed by GSEA

(Fig. 6A) and correlation analysis (Fig. 6B). Moreover, SNAI1expression showed an initial increase following castration andsubsequent decrease as the tumors gained a castration-resistantphenotype in KUCaP xenografts (Fig. 6C, left), whereas a gene setinduced by AR exhibited the inverse response (Fig. 6C, right).

Figure 3.

Snail is critical for the induction of EMP by enzalutamide: A, qPCR analysis of Snail mRNA expression following schema. Data from three independentexperiments mean � SD; �, P < 0.05 as determined by one-way ANOVA. B, Snail expression was evaluated in C4-2 and 22Rv1 cells by Western blotting. C,Snail expression was evaluated in PC3 and PC-3(AR)2 cells by Western blotting. D, Effect of knockdown of Snail on the expression of mesenchymalmakers and migration capability of C4-2 cells.

Miao et al.





Finally, in a set of prostatic biopsies obtainedbefore andafter ADTinitiation (38), RNA-seq analysis revealed that six of seven treat-ment pairs exhibited an increase in SNAI1 expression after ARsuppression (Fig. 6D).

To experimentally evaluate this correlation in vivo, subcutane-ous xenograft of C4-2 cells in nude mice were evaluated undereither hormonally intact or castrate conditions (Supplementary

Fig. S5). Within 6 days of castration, Snail expression increasedand AR expressionwas decreased (Fig. 6E). To investigate whetherthe inverse relation between AR and Snail can be observedin patients, we used multi-color immunofluorescence for E-cadherin, AR, and Snail on samples acquired at three time-pointsfrom a patient who developed metastatic castration-resistantprostate cancer. In the first CRPC sample, an adenocarcinoma

Figure 4.

SNAI1 is an AR-regulated gene. A and B, Dose–response and time-course analysis of Snail expression after AR activation by DHT (1 and 10 nmol/L) was conductedin C4-2 or 22Rv1 cells shown by Western blotting (A) and qRT-PCR analyses (B) following schema in A. B, FKBP5 expression shows AR signaling. C, Time-course of Snail expression in response to either DHT (10 nmol/L) or enzalutamide (10 mmol/L) in VCaP cells. D, qRT-PCR analysis revealed that AR signalingactivation suppressed Snail expression in PC-3(AR)2 but not in PC3 cells. E, Knockdown of AR expression in C4-2 or 22Rv1 cells alleviated the suppressiveeffect of DHT on Snail expression. Data from three independent experiments mean � SD; � , P < 0.05 as determined by one-way ANOVA.






phenotype that is positive for AR and E-cadherin but negative forSnail is observed. Abiraterone was commenced shortly after thissample was taken. A year later, although still responding toabiraterone, the adenocarcinoma phenotype with AR andE-cadherin expression is retained. A third sample, a liver biopsy,was taken shortly after this patient progressed on abiraterone anda neuroendocrine phenotype, with strong Snail nuclear expres-sion, weak E-cadherin and absent AR was detected (Fig. 6F).Neuroendocrine prostate cancer is defined as tumors with lowexpression of AR and AR-regulated genes (39, 40) and the asso-ciation between neuroendocrine disease and upregulation ofSnail has been previously described (41). Here we demonstratethat downregulation of AR and upregulation of Snail in thesetumors can occur after prolonged anti-androgenic therapy.

DiscussionAlthough second-generation agents targeting AR signaling have

proven effective, development of resistance to enzalutamide andabiraterone is common. Knownmechanisms of resistance includepoint mutations in the AR that convert antagonists to agonists(9–12), expression of AR variants (13), and overexpression ofother steroid receptors like the glucocorticoid receptor that can actas an oncogenic surrogate for AR (14). Here, we provide evidence

that EMP represents an adaptive responsive to AR-targeted ther-apies andpostulate that this response has implications for therapyresistance. We show that AR directly suppresses the potent EMP-promoting transcription factor Snail and that this is reversed byenzalutamide treatment. The negative relationship between ARsignaling and Snail expressionwas validated inmultiple cell lines,xenografts, and patient samples.

Our results are supported by earlier studies that identified anegative association between AR signaling and EMP (27–29,42, 43). For example, Sun and colleagues showed that castrationpromoted EMP in normal mouse prostate tissue and humanLuCaP35 prostate tumor explants (27). They went on to identifya bi-directional negative feedback loop between AR and ZEB1,providing a potential mechanism for castration-mediated EMP.Supporting these findings, we observed enzalutamide-mediatedupregulation and DHT-mediated suppression of ZEB1 mRNA.However, in the models and treatment conditions used in ourstudy, ZEB1 protein was not upregulated by treatment withenzalutamide (Supplementary Fig. S3). Thus, although we donot rule out the possibility that ZEB1plays a role in enzalutamide-driven EMP, we believe the primary mediator of this adaptiveresponse is Snail.

The zinc-finger transcription factor Snail, amember of the Snailsuperfamily, is recognized as amaster regulator of EMP (44). Snail

Figure 5.

AR regulates Snail expression. A, Gene tracks view of AR ChIP-seq data at the SNAI1 locus. Data were obtained from NCBI Gene Expression Omnibus, representingVCaP cells treatedwith vehicle control or DHT for 12 hours (GSE27823; ref. 28).B,ChIP-PCR analysis of AR binding or RNA polymerase binding enrichment after DHT(10 nmol/L) treatment of VCaP cells for 4 hours. Data from three independent experiments mean� SD; � , P < 0.05 as determined by t test. C, AR binding elementswere critical for DHT suppressed Snail promoter activity. SNAI1 proximal promoter region (�1042 to �56) or (�116 to �56) was subcloned into pGL4.23 promoterreporter vector. C4-2 cellswere reversely transfectedwith two reporter constructs in androgen-deprivedmedia for 24hours andwere stimulatedwithDHT (1 nmol/L)for additional 8 hours. Cells were harvested and tested for reporter activity using the Dual Luciferase Assay Kit.

Miao et al.





Figure 6.

Enzalutamide enhances Snail expression in vivo. A, The inverse relationship between SNAI1 and AR target genes, as demonstrated by GSEA, in 130 humanprimary tumors from a MSKCC cohort (top) or 256 primary tumors from TCGA (bottom). The androgen upregulated gene set has been described.Normalized enrichment scores (NES) and P values are shown. B, The inverse relationship between SNAI1 and AR signaling in the MSKCC (left) and TCGA(right) cohorts. AR signaling represents the mean expression of FKBP5, KLK2, KLK3, KLK4, and TMPRSS2. Pearson r and P values are shown. C, SNAI1expression (left) and AR signaling (right) in KUCaP xenografts (GSE21887) following castration and castration-resistant tumors. One-way ANOVA P valuesare shown. The reciprocal relationship between SNAI1 andAR signaling (calculated as described inB) in KUCaP xenografts. Pearson r and P values are shown.D, Snailexpression in patients biopsy samples prior to or post ADT (GSE48403). E, Snail and AR expression after castration in mice xenograft. F, Multiplex sequentialimmunofluorescence staining for E-cadherin, AR, and Snail was performed on sequentially acquired biopsy samples from a patient with metastatic castration-resistant prostate cancer, before initiation of second generation antiandrogen (top), whereas on antiandrogen (middle) and after failure of antiandrogen (bottom).






mediates EMP by binding to E-box motifs in gene promoters andconcomitantly repressing the expression of key epithelial factors(45, 46)while inducingmesenchymalmarkers (47, 48) and otherEMP-promoting transcription factors, such as ZEB1/2 (48, 49).Herein, we showed for thefirst time that the SNAI1 gene is a direct,repressed target of the AR. Liganded AR binds to the SNAI1promoter and represses its expression. Enzalutamide disrupts ARbinding to the SNAI1promoter, and leads to a rapid and reversibleinduction of gene expression. This pathway was validated inmultiple prostate cancer cell line models, patient tissues andclinical datasets, indicating that it is biologically and clinicallyrelevant. Importantly, Snail induction following enzalutamide-mediated disruption of AR signaling is a key driver of EMP, sinceknockdown of Snail blocked this process. These data establish apotentmechanism bywhich the regulation of androgen signalingcan rapidly modulate EMP in prostate cancer cells.

During preparation of this manuscript, Ware and colleaguesreported that Snail was elevated in prostate cancer metastases andenzalutamide-resistant prostate cancer cells, and that its over-expression contributed to drug resistance by causing upregulationof AR andAR-V7 (50). Thesefindings suggest that the induction ofSnail that we noted early in response to enzalutamide maybecome persistent in enzalutamide-treated tissues. One impor-tant caveat of theWare paper is that the expression level of Snail inenzalutamide-responsive tumors is not known.

One predicted consequence of AR-mediated repression of Snailis that the activities of AR and Snail would be inversely correlatedin prostate cancer. Importantly, we have validated this inversecorrelation between AR signaling and Snail in multiple cell linesand clinical samples. In contrast, Ware and colleagues (50)observed a positive association between Snail and AR/AR variantprotein levels, a finding that we did not observe following Snailknockdown (Fig. 3D). This discrepancy could be attributed to theuse of a tamoxifen-regulated Snail overexpression system byWareand colleagues, and/or differences in cell linemodels between thetwo studies.

Other studies have reported that the AR/androgen signalingaxis can promote EMP and/or induce the expression of mesen-chymal markers and EMP drivers (24, 51). In one of the earlieststudies exploring the relationship between these two pathways, itwas found that EMP markers, including Snail, could be inducedby androgens in prostate cancer epithelial cells (24). However,androgen-mediated Snail induction was only observed in LNCaPcells engineered to overexpress TGFb receptor II and AR-negativePC3 cells, which may explain the discrepancy between our andthis study. Moreover, Zhu and colleagues observed that EMPcould only be induced in LNCaP cells when AR was stablyknocked down (24), suggesting that AR-independent nonge-nomic actions of androgens may be responsible for this effect.

Overall, we support the notion that AR generally maintainsepithelial differentiation but that aberrations to the androgensignaling axis found in some experimental systems and tumorsmay, in a context dependent manner, promote de-differentiationand EMP (22). This context dependency is highlighted by thesuggestion that AR can either drive or block EMP subject to theandrogen sensitivity of themodel system (24, 52). An implicationof this concept is that observations made using cell line models,many of which are derived from metastases and represent aggres-sive, abnormal forms of prostate cancer with aberrant (or indeedabsent) AR signaling, necessitate careful interpretation. Contradic-tory findings in the literature could reflect different experimental

conditions and/or laboratory-specific cell lineages. In this respect,it is worth noting that we provided evidence for enzalutamide-mediated de-repression of Snail in primary and CRPC patientsamples and additional published patient cohorts.

Interestingly, the SNAI2 gene, which encodes the Snail familymember Slug, is directly activated by AR, in a Cyclin D1b-dependent manner (53). By contrast to our findings with Snail,AR mediated upregulation of Slug promotes aggressive andprometastatic phenotypes but does so in a manner indepen-dent of epithelial plasticity, which may reflect the fact that Slugis a weak inducer of EMP compared to Snail (53). Nevertheless,in combination with our work herein, this recent study raisesthe intriguing scenario of AR influencing distinct and, to acertain extent, opposing transcriptional programs via dichoto-mous regulation of two related transcription factors, Snail andSlug.

The clinical implications of our findings are potentially signif-icant. Prostate cancer cells that have undergone EMP may haveincreased stemness and tumor-initiating capacity, which coulddrive resistance to AR-targeted therapies (44, 54). Conversely,reversal of EMP (i.e., MET) has been shown to alleviate resistanceto combined cabazitaxel and antiandrogen therapy in advancedprostate cancer (55).We suggest that the induction of EMP shouldbe considered in the context of enzalutamide treatment, andpropose that combining AR-targeting agents with drugs thatsuppress epithelial–mesenchymal plasticity in general (22) orSnail in particular could be a promising therapeutic strategy toenhance the durability of response to endocrine therapy forprostate cancer.

Disclosure of Potential Conflicts of InterestJ.S. de Bono is a consultant/advisory board member for AstraZeneca, Gen-

entech, Taiho, GSK, and Sanofi. G.V. Raj has received speakers bureau honorariafrom Astellas and Medivation. No potential conflicts of interest were disclosedby the other authors.

Authors' ContributionsConception and design: L. Miao, J.-T. Hsieh, W.D. Tilley, J. de Bono, L.A. Selth,G.V. RajDevelopment of methodology: L. Miao, M. Crespo, J. de Bono, G.V. RajAcquisition of data (provided animals, acquired and managed patients,provided facilities, etc.): L. Miao, R. Li, D.N. Rodrigues, M. Crespo, J. de Bono,G.V. RajAnalysis and interpretation of data (e.g., statistical analysis, biostatistics,computational analysis): L. Miao, W.D. Tilley, J. de Bono, L.A. Selth,G.V. RajWriting, review, and/or revision of the manuscript: L. Miao, D.N. Rodrigues,M. Crespo, J.-T. Hsieh, W.D. Tilley, J. de Bono, L.A. Selth, G.V. RajAdministrative, technical, or material support (i.e., reporting or organizingdata, constructing databases): L. Yang, D.N. Rodrigues, J.-T. Hsieh, G.V. RajStudy supervision: L. Yang, J. de Bono, G.V. Raj

AcknowledgmentsThe results published here are in part based on data generated by TCGA,

established by the National Cancer Institute and the National Human GenomeResearch Institute, and we are grateful to the specimen donors and relevantresearch groups associated with this project.

Grant SupportThis work was supported by grants from the U.S. Department of Defense

Prostate Cancer Research Program (W81XWH-12-1-0288 to G.V. Raj,W81XWH-13-2-0093 to G.V. Raj, J. De Bono, and W.D. Tilley) and fundingfrom the National Health and Medical Research Council of Australia (ID1008349 to W.D. Tilley; ID 1083961 to W.D. Tilley and L.A. Selth) and Cancer

Miao et al.





Australia (ID 1043497 to W.D. Tilley), Prostate Cancer Research ProgramsPostdoctoral Training Award from the U.S. Department of Defense (W81XWH-15-1-0543 to L. Miao), a Young Investigator Award from the Prostate CancerFoundation (Foundation 14 award to L. A. Selth), and a National CancerInstitute of the National Institutes of Health under award number5P30CA142543 (to UT Southwestern, Dallas, TX).

The costs of publication of this articlewere defrayed inpart by the payment ofpage charges. This article must therefore be hereby marked advertisement inaccordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received August 14, 2016; revised October 4, 2016; accepted March 7, 2017;published OnlineFirst March 16, 2017.

References1. Wong YN, Ferraldeschi R, Attard G, de Bono J. Evolution of androgen

receptor targeted therapy for advanced prostate cancer. Nat Rev Clin Oncol2014;11:365–76.

2. Robinson D, Van Allen EM, Wu YM, Schultz N, Lonigro RJ, Mosquera JM,et al. Integrative clinical genomics of advanced prostate cancer. Cell2015;161:1215–28.

3. Mateo J, Smith A, Ong M, de Bono JS. Novel drugs targeting the androgenreceptor pathway in prostate cancer. Cancer Metastasis Rev 2014;33:567–79.

4. Bahl A, Masson S, Birtle A, Chowdhury S, de Bono J. Second-line treatmentoptions in metastatic castration-resistant prostate cancer: a comparison ofkey trials with recently approved agents. Cancer Treat Rev 2014;40:170–7.

5. Scher HI, Sawyers CL. Biology of progressive, castration-resistant prostatecancer: directed therapies targeting the androgen-receptor signaling axis. JClin Oncol 2005;23:8253–61.

6. Karantanos T, Corn PG, Thompson TC. Prostate cancer progression afterandrogen deprivation therapy:mechanismsof castrate resistance andnoveltherapeutic approaches. Oncogene 2013;32:5501–11.

7. Locke JA, Guns ES, Lubik AA, Adomat HH, Hendy SC, Wood CA, et al.Androgen levels increase by intratumoral de novo steroidogenesis duringprogression of castration-resistant prostate cancer. Cancer Res 2008;68:6407–15.

8. Chen CD,Welsbie DS, Tran C, Baek SH, Chen R, Vessella R, et al. Moleculardeterminants of resistance to antiandrogen therapy. Nat Med 2004;10:33–9.

9. Taplin ME, Bubley GJ, Shuster TD, FrantzME, Spooner AE, Ogata GK, et al.Mutation of the androgen-receptor gene in metastatic androgen-indepen-dent prostate cancer. N Engl J Med. 1995;332:1393–8.

10. Taplin ME, Bubley GJ, Ko YJ, Small EJ, Upton M, Rajeshkumar B, et al.Selection for androgen receptor mutations in prostate cancers treated withandrogen antagonist. Cancer Res 1999;59:2511–5.

11. Joseph JD, LuN,Qian J, Sensintaffar J, ShaoG, BrighamD, et al. A clinicallyrelevant androgen receptor mutation confers resistance to second-gener-ation antiandrogens enzalutamide and ARN-509. Cancer Discov 2013;3:1020–9.

12. Korpal M, Korn JM, Gao X, Rakiec DP, Ruddy DA, Doshi S, et al. An F876Lmutation in androgen receptor confers genetic and phenotypic resistanceto MDV3100 (enzalutamide). Cancer Discov 2013;3:1030–43.

13. Nakazawa M, Antonarakis ES, Luo J. Androgen receptor splice variants inthe era of enzalutamide and abiraterone. Horm Cancer 2014;5:265–73.

14. Arora VK, Schenkein E, Murali R, Subudhi SK, Wongvipat J, Balbas MD,et al. Glucocorticoid receptor confers resistance to antiandrogens bybypassing androgen receptor blockade. Cell 2013;155:1309–22.

15. Lim J, Thiery JP. Epithelial-mesenchymal transitions: insights from devel-opment. Development 2012;139:3471–86.

16. De Craene B, Berx G. Regulatory networks defining EMT during cancerinitiation and progression. Nat Rev Cancer 2013;13:97–110.

17. Tsai JH, Yang J. Epithelial-mesenchymal plasticity in carcinomametastasis.Genes Dev 2013;27:2192–206.

18. Fischer KR, Durrans A, Lee S, Sheng J, Li F, Wong ST, et al. Epithelial-to-mesenchymal transition is not required for lungmetastasis but contributesto chemoresistance. Nature 2015;527:472–6.

19. Tarin D, Thompson EW, Newgreen DF. The fallacy of epithelial mesen-chymal transition in neoplasia. Cancer Res 2005;65:5996–6000.

20. OcanaOH, Corcoles R, Fabra A,Moreno-BuenoG, AcloqueH, Vega S, et al.Metastatic colonization requires the repression of the epithelial-mesen-chymal transition inducer Prrx1. Cancer Cell 2012;22:709–24.

21. Celia-Terrassa T, Meca-Cortes O, Mateo F, Martinez de Paz A, Rubio N,Arnal-Estape A, et al. Epithelial-mesenchymal transition can suppressmajor attributes of human epithelial tumor-initiating cells. J Clin Invest2012;122:1849–68.

22. Das R, Gregory PA, Hollier BG, Tilley WD, Selth LA. Epithelial plasticity inprostate cancer: principles and clinical perspectives. Trends Mol Med2014;20:643–51.

23. Bishop JL, Davies A, Ketola K, Zoubeidi A. Regulation of tumor cellplasticity by the androgen receptor in prostate cancer. Endocr Relat Cancer2015;22:R165–82.

24. Zhu ML, Kyprianou N. Role of androgens and the androgen receptor inepithelial-mesenchymal transition and invasion of prostate cancer cells.FASEB J 2010;24:769–77.

25. Jin HJ, Zhao JC, Ogden I, Bergan RC, Yu J. Androgen receptor-independentfunction of FoxA1 in prostate cancer metastasis. Cancer Res 2013;73:3725–36.

26. Wu K, Gore C, Yang L, Fazli L, Gleave M, Pong RC, et al. Slug, a uniqueandrogen-regulated transcription factor, coordinates androgen receptor tofacilitate castration resistance in prostate cancer. Mol Endocrinol2012;26:1496–507.

27. Sun Y, Wang BE, Leong KG, Yue P, Li L, Jhunjhunwala S, et al. Androgendeprivation causes epithelial-mesenchymal transition in the prostate:implications for androgen-deprivation therapy. Cancer Res 2012;72:527–36.

28. Jennbacken K, Tesan T, Wang W, Gustavsson H, Damber JE, Welen K. N-cadherin increases after androgen deprivation and is associated withmetastasis in prostate cancer. Endocr Relat Cancer 2010;17:469–79.

29. Lee YC, Cheng CJ, Huang M, Bilen MA, Ye X, Navone NM, et al. Androgendepletion up-regulates cadherin-11 expression in prostate cancer. J Pathol2010;221:68–76.

30. Selth LA, Das R, Townley SL, Coutinho I, Hanson AR, Centenera MM, et al.A ZEB1-miR-375-YAP1 pathway regulates epithelial plasticity in prostatecancer. Oncogene 2016;36:24–34.

31. SubramanianA, TamayoP,Mootha VK,Mukherjee S, Ebert BL,GilletteMA,et al. Gene set enrichment analysis: a knowledge-based approach forinterpreting genome-wide expression profiles. Proc Natl Acad Sci U S A2005;102:15545–50.

32. Hu R, Lu C, Mostaghel EA, Yegnasubramanian S, Gurel M, Tannahill C,et al. Distinct transcriptional programs mediated by the ligand-dependentfull-length androgen receptor and its splice variants in castration-resistantprostate cancer. Cancer Res 2012;72:3457–62.

33. NyquistMD, Li Y, Hwang TH,Manlove LS, Vessella RL, Silverstein KA, et al.TALEN-engineered AR gene rearrangements reveal endocrine uncouplingof androgen receptor in prostate cancer. ProcNatl Acad Sci U S A 2013;110:17492–7.

34. Chan SC, Selth LA, Li Y, Nyquist MD, Miao L, Bradner JE, et al. Targetingchromatin binding regulation of constitutively active AR variants to over-come prostate cancer resistance to endocrine-based therapies. NucleicAcids Res 2015;43:5880–97.

35. Asangani IA, Dommeti VL, Wang X, Malik R, Cieslik M, Yang R, et al.Therapeutic targeting of BET bromodomain proteins in castration-resistantprostate cancer. Nature 2014;510:278–82.

36. Massie CE, Lynch A, Ramos-Montoya A, Boren J, Stark R, Fazli L, et al. Theandrogen receptor fuels prostate cancer by regulating central metabolismand biosynthesis. EMBO J 2011;30:2719–33.

37. Taylor BS, Schultz N, Hieronymus H, Gopalan A, Xiao Y, Carver BS, et al.Integrative genomic profiling of human prostate cancer. Cancer Cell2010;18:11–22.

38. Rajan P, Sudbery IM, Villasevil ME, Mui E, Fleming J, Davis M, et al. Next-generation sequencing of advanced prostate cancer treated with androgen-deprivation therapy. Eur Urol 2014;66:32–9.

39. Zhang X, Coleman IM, Brown LG, True LD, Kollath L, Lucas JM, et al.SRRM4 expression and the loss of REST activity may promote the emer-gence of the neuroendocrine phenotype in castration-resistant prostatecancer. Clin Cancer Res 2015;21:4698–708.






40. Beltran H, Prandi D, Mosquera JM, Benelli M, Puca L, Cyrta J, et al.Divergent clonal evolution of castration-resistant neuroendocrine prostatecancer. Nat Med 2016;22:298–305.

41. McKeithen D, Graham T, Chung LW, Odero-Marah V. Snail transcriptionfactor regulates neuroendocrine differentiation in LNCaP prostate cancercells. Prostate 2010;70:982–92.

42. Zhifang M, Liang W, Wei Z, Bin H, Rui T, Nan W, et al. The androgenreceptor plays a suppressive role in epithelial- mesenchymal transition ofhuman prostate cancer stem progenitor cells. BMC Biochemistry 2015;16:13.

43. Huo C, Kao YH, Chuu CP. Androgen receptor inhibits epithelial-mesen-chymal transition, migration, and invasion of PC-3 prostate cancer cells.Cancer Lett 2015;369:103–11.

44. Matuszak EA, Kyprianou N. Androgen regulation of epithelial-mesenchy-mal transition in prostate tumorigenesis. Expert Rev Endocrinol Metab2011;6:469–82.

45. DeepG, JainAK, RamtekeA, TingH, Vijendra KC,Gangar SC, et al. SNAI1 iscritical for the aggressiveness of prostate cancer cells with low E-cadherin.Mol Cancer 2014;13:37.

46. Neal CL, Henderson V, Smith BN, McKeithen D, Graham T, Vo BT, et al.Snail transcription factor negatively regulates maspin tumor suppressor inhuman prostate cancer cells. BMC Cancer 2012;12:336.

47. Cano A, Perez-Moreno MA, Rodrigo I, Locascio A, Blanco MJ, del BarrioMG, et al. The transcription factor snail controls epithelial-mesenchymaltransitions by repressing E-cadherin expression. Nat Cell Bio 2000;2:76–83.

48. Smith BN, Odero-Marah VA. The role of Snail in prostate cancer. Cell AdhMigr 2012;6:433–41.

49. Takkunen M, Grenman R, Hukkanen M, Korhonen M, Garcia de HerrerosA, Virtanen I. Snail-dependent and -independent epithelial-mesenchymaltransition in oral squamous carcinoma cells. Int JOncol 2006;54:1263–75.

50. Ware KE, Somarelli JA, Schaeffer D, Li J, Zhang T, Park S, et al. Snailpromotes resistance to enzalutamide through regulation of androgenreceptor activity in prostate cancer. Oncotarget 2016;7:50507–21.

51. Shiota M, Itsumi M, Takeuchi A, Imada K, Yokomizo A, Kuruma H, et al.Crosstalk between epithelial-mesenchymal transition and castration resis-tance mediated by Twist1/AR signaling in prostate cancer. Endocr RelatCancer 2015;22:889–900.

52. Jacob S, Nayak S, Fernandes G, Barai RS, Menon S, Chaudhari UK, et al.Androgen receptor as a regulator of ZEB2 expression and its implications inepithelial-to-mesenchymal transition in prostate cancer. Endocr RelatCancer 2014;21:473–86.

53. Augello MA, Burd CJ, Birbe R, McNair C, Ertel A, Magee MS, et al.Convergence of oncogenic and hormone receptor pathways promotesmetastatic phenotypes. J Clin Invest 2013;123:493–508.

54. Klarmann GJ, Hurt EM, Mathews LA, Zhang X, Duhagon MA, Mistree T,et al. Invasive prostate cancer cells are tumor initiating cells that have a stemcell-like genomic signature. Clin Exp Metastasis 2009;26:433–46.

55. Martin SK, Pu H, Penticuff JC, Cao Z, Horbinski C, Kyprianou N. Multi-nucleation andmesenchymal-to-epithelial transition alleviate resistance tocombined cabazitaxel and antiandrogen therapy in advanced prostatecancer. Cancer Res 2016;76:912–26.


Miao et al.




2017;77:3101-3112. Published OnlineFirst March 16, 2017.Cancer Res Lu Miao, Lin Yang, Rui Li, et al.

Mesenchymal Plasticity in Prostate Cancer−Epithelial Disrupting Androgen Receptor Signaling Induces Snail-Mediated

Updated version

10.1158/0008-5472.CAN-16-2169doi:

Access the most recent version of this article at:

Material

Supplementary

http://cancerres.aacrjournals.org/content/suppl/2017/03/16/0008-5472.CAN-16-2169.DC1

Access the most recent supplemental material at:

Cited articles

http://cancerres.aacrjournals.org/content/77/11/3101.full#ref-list-1

This article cites 55 articles, 20 of which you can access for free at:

Citing articles

http://cancerres.aacrjournals.org/content/77/11/3101.full#related-urls

This article has been cited by 3 HighWire-hosted articles. Access the articles at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected]

To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://cancerres.aacrjournals.org/content/77/11/3101To request permission to re-use all or part of this article, use this link



http://cancerres.aacrjournals.org/lookup/doi/10.1158/0008-5472.CAN-16-2169

http://cancerres.aacrjournals.org/content/suppl/2017/03/16/0008-5472.CAN-16-2169.DC1

http://cancerres.aacrjournals.org/content/77/11/3101.full#ref-list-1

http://cancerres.aacrjournals.org/content/77/11/3101.full#related-urls

http://cancerres.aacrjournals.org/cgi/alerts

mailto:[email protected]

http://cancerres.aacrjournals.org/content/77/11/3101


disrupting androgen receptor signaling induces snail ... · alexa fluor 488 (#7395 clone d6f11,...

Documents