dna based analysis of thrips diversity and thrips...
TRANSCRIPT
DNA based analysis of thrips
diversity and thrips-borne Iris yellow
spot virus (Tospovirus: Bunyaviridae)
from Pakistan
Submitted in partial fulfillment of
Doctor of Philosophy
By
Romana Iftikhar
2015
Department of Biotechnology (NIBGE)
Pakistan Institute of Engineering and Applied Sciences
Nilore-45650 Islamabad, Pakistan
National Institute for Biotechnology and Genetic Engineering
P. O. BOX 577, JHANG ROAD, FAISALABAD.
(Affiliated with PIEAS, Islamabad)
Declaration of Originality
I hereby declare that the work accomplished in this thesis is the result of my own research
carried out in Agricultural Biotechnology Division (NIBGE). This thesis has not been
published previously nor does it contain any material from the published resources that
can be considered as the violation of international copyright law.
Furthermore, I also declare that I am aware of the terms “copyright” and “plagiarism” and
if any copyright violation was found out in this work, I will be held responsible of the
consequences of any such violation.
Signature: _______________
Name of the Student: Romana Iftikhar
Registration No. 10-7-1-017-2008
Date: ______________
Place: NIBGE, Faisalabad
National Institute for Biotechnology and Genetic Engineering
P. O. BOX 577, JHANG ROAD, FAISALABAD.
(Affiliated with PIEAS, Islamabad)
Research Completion Certificate
Certified that the research work contained in this thesis entitled “DNA based analysis
of thrips diversity and thrips-borne Iris yellow spot virus (Tospovirus:
Bunyaviridae) from Pakistan” has been carried out and completed by “Romana
Iftikhar” under my supervision during her PhD studies in the subject of Biotechnology.
---------------------------- ----------------------------
Date Dr. Muhammad Ashfaq (FFP)
Research Supervisor
Submitted Through
------------------------ ---------------------------
Dr. Shahid Mansoor Controller of Examination
Director NIBGE
Certificate of Approval
This is to certify that the work contained in this thesis titled “DNA based analysis of
thrips diversity and thrips-borne Iris yellow spot virus (Tospovirus:
Bunyaviridae) from Pakistan” was carried out by “Romana Iftikhar” in our
opinion is fully adequate in scope and quality for the degree of Doctor of Philosophy
in Biotechnology from Pakistan Institute of Engineering and Applied Sciences
(PIEAS).
Approved by:
Signature: _____________________
Dr. Muhammad Ashfaq
Internal Examiner/Supervisor
Verified by:
Signature: _____________________
Dr. Shahid Mansoor
Head, Department of NIBGE (Biotechnology)
Stamp:
i
ACKNOWLEDGEMENT
All praises are for Almighty Allah (the most affectionate, the most merciful), and
Holy Prophet Muhammad (May Allah Bless Muhammad & Descendants of
Muhammad). I bow before Almighty Allah with limitless humility and modesty that He
granted me with potential and ability to this material contribution to already existing
ocean of knowledge. I thank from the deep core of heart to Holy Prophet Muhammad
(May Allah bless and peace be upon him) forever a torch of guidance and knowledge
for humanity as a whole.
Special gratitude is due to Higher Education Commission (HEC) of Pakistan for
providing a scholarship under the “Indigenous 5000 fellowship programme Phase
IV” with out which such a costly research project could not be completed.
I crave to thank my eminent supervisor Prof Dr. Muhammad Ashfaq, HEC foreign
faculty member for accepting me as his PhD student. He is a wonderful man and
scientist. He taught me from pipetting to data analysis and how to present scientific
data. I have learned a lot from his experiences not only in research but also in other
fields of life. I am really obliged to him for holding me to a high research standard
and enforcing strict validations for each research result, and thus teaching me how to
do research. His supervision and suggestions helped me in overcoming many
technical difficulties and for all the useful insightful discussions to improve my
research. His presence was always a source of confidence for me. It was indeed an
honor to work under his guidance.
It is my pleasure to thank Dr. Zafar Mehmood Khalid and Dr. Sohail Hameed
former Directors, National Institute for Biotechnology and Genetic Engineering
(NIBGE), Faisalabad, who have been very kind to provide every possible facility to
carry out this research work. I express my deepest gratitude to current Director Dr.
Shahid Mansoor Deputy chief Scientist for facilitating me during research work.
My sincerest appreciations are due to Dr. Hanu R. Pappu, Department of Plant
Pathology, Washington State University, Pullman, USA for my training in virology. I
am very thankful for his precious suggestions, dedicated efforts, kind supervision,
affectionate criticism, extremely encouraging behavior, and inspiring guidance
provided to me throughout the course of virus study. He helped me in each step of
research during my stay in USA. I can never forget the invaluable help and guidance
of Dr. S.V. Ramesh and Dr. Sudeep bag during my research work in USA and Dr.
Khalid Naveed for his helping and friendly behavior to make my stay in USA more
comfortable.
I am very grateful to Dr. Paul Hebert, Director, Biodiversity Institute of Ontario,
University of Guelph Canada and his co-workers at the Canadian Centre for DNA Barcoding for sequencing barcodes of my thrips specimens.
I am extremely thankful to Dr. R. Srinivasn, University of Georgia, Tifton, USA for
giving the opportunity to learn the morphological identification and thrips rearing in
his laboratory and Mr. Stan Diffie, University of Georgia, Tifton, USA for giving me
training in morphological identification and helping me with thrips identification. I
thank to Mr. Sueo Nakahara, USDA ARS, Beltsville MD (retired) for reviewing the
ii
thrips species identification. I am also thankful to Valerie Lynch-Holm, Ph.D.
Franceschi Microscopy & Imaging Center, Washington State University, Pullman,
USA for giving me training and help in electron microscopy of thrips.
I am thankful to my lab colleagues Dr. Akhtar Rasool, Mr. Saleem Akhtar, Dr.
Innam Ullah, Mr. Tayyib Naseem, Dr. Arif M. Khan, Mr. Qamar Abbas, Mr. Shah
Sawar and all others for their cooperation and help in experimental work. I want to
thank to my dear friend, Afshan Mashkoor. The time spent with you is really
memorable. I cannot forget the moments spent with you. I have no words to pay
sincerest thanks to classfellows and hostelmates for their help, encouragement. Their
company made my stay comfortable at NIBGE.
No acknowledgements would ever adequately express my obligation to my loving
brothers, Arbab Iftikhar and Usman Iftikhar, and my cute, loving sister Asna
Iftikhar who always wished me health and success.
Last but not the least, I find it hard to express my gratitude and appreciations in
words to my affectionate parents Mr. Muhammad Iftikhar (Late) and Farhat
Iftikhar who always wished to see me glittering high on the skies of success. None of
this would have been possible without their love, patience and prayers. I am in short
of words to thank my Appo Ji (Late) and uncles, Mr. Israr Ahmad (Late) and Mr.
Isar Javed and my grandparents (Late) for their love, care and support. Finally, it
has been a great pleasure for me to conduct my PhD work but I still have a long way
to go….
Romana Iftikhar
August, 2014
iii
Table of Contents
Contents Page #
Acknowledgment I
Table of contents iii
List of Figures viii
List of Tables ix
List abbriviations x
Abstract xiii
Chapter 1 .................................................................................................................................... 1
INTRODUCTION AND REVIEW OF LITERATURE ........................................................... 1
1.1 Thrips ................................................................................................................... 1
1.1.1 Morphology ......................................................................................................... 1
1.1.2 Feeding behavior ................................................................................................. 1
1.1.3 Dispersal .............................................................................................................. 3
1.1.4 Reproduction....................................................................................................... 4
1.1.5 Life cycle of thrips ............................................................................................... 4
1.2 Taxonomic classification .................................................................................... .5
1.3 Thrips diversity……………..……………………..………………………...……………………………. 6
1.4 Importance of thrips ........................................................................................... 8
1.5 Identification of thrips ........................................................................................ 9
1.5.1 Morphological identification ............................................................................. 10
1.5.2 Molecular identification .................................................................................... 10
1.5.2.1 Use of COI and emergence of DNA Barcoding .................................................. 11
1.6 Thrips and Tospovirus transmission .................................................................. 12
1.7 Tospoviruses ..................................................................................................... 13
1.7.1 Genome Organization ....................................................................................... 14
1.8 Importance of tospoviruses .............................................................................. 16
1.9 Rationale for this study ..................................................................................... 16
1.10 Objectives .......................................................................................................... 17
iv
Chapter 2 .................................................................................................................................. 19
GENERAL MATERIALS AND METHODS ......................................................................... 19
2.1 Thrips collections .............................................................................................. 19
2.1.1 Locations surveyed ............................................................................................ 19
2.1.2 Habitats surveyed ............................................................................................. 19
2.1.3 Collection of specimens .................................................................................... 20
2.2 Tospovirus survey, sample collection (plants and thrips), preservation and
identification ..................................................................................................... 20
2.3 Enzyme-linked immunosorbent assay (ELISA) for thrips and plant samples .... 24
2.3.1 Direct Antigen-Coated (DAC) ELISA for testing thrips for IYSV ......................... 24
2.3.2 Double Antibody Sandwich (DAS) ELISA testing of plants for IYSV ................... 24
2.4 IYSV nucleocapsid (N) gene fragment isolation and cloning of PCR products .. 25
2.4.1 RNA extraction .................................................................................................. 25
2.4.2 RNA quantification ............................................................................................ 25
2.4.3 cDNA synthesis .................................................................................................. 26
2.4.4 DNA polymerase chain reaction (PCR) .............................................................. 26
2.4.5 Agarose gel electrophoresis of PCR products ................................................... 26
2.4.6 Ligation .............................................................................................................. 27
2.4.7 Transformation ................................................................................................. 27
2.4.8 Colony PCR ........................................................................................................ 27
2.4.9 Screening of clones through restriction analysis .............................................. 28
2.4.10 Glycerol stocks of the confirmed clones ........................................................... 29
2.4.11 Sequencing ........................................................................................................ 29
2.4.12 Nucleotide sequence alignments and Phylogenetic analysis ........................... 29
Chapter 3 .................................................................................................................................. 30
THYSANOPTERA DIVERSITY: SURVEY IN PAKISTAN ................................................ 30
3.1 INTRODUCTION ................................................................................................. 30
3.1.1 Thrips taxonomy ............................................................................................... 30
3.1.2 Thrips diversity in South-East Asia .................................................................... 30
3.1.3 Thrips diversity in Pakistan ............................................................................... 31
3.1.4 Objectives of this study ..................................................................................... 32
v
3.2 MATERIAL AND METHODS ................................................................................ 32
3.2.1 Locations and havitats surveyed and collection of specimens ......................... 32
3.2.2 Slide preparation ............................................................................................... 32
3.2.3 Labeling ............................................................................................................. 32
3.2.4 Morphological characters ................................................................................. 33
3.2.5 Identification ..................................................................................................... 33
3.3 RESULTS ............................................................................................................. 35
3.3.1 Thrips diversity .................................................................................................. 35
3.3.2 Thrips species recorded during the survey ....................................................... 35
3.4 DISCUSSION ....................................................................................................... 42
Chapter 4 .................................................................................................................................. 44
ANALYSIS OF THRIPS BY DNA BARCODING ................................................................ 44
4.1 INTRODUCTION ................................................................................................. 44
4.1.1 Identification of thrips ...................................................................................... 44
4.1.2 Thrips identification based on molecular studies ............................................. 45
4.1.2.1 Introduction of DNA barcoding ......................................................................... 45
4.1.2.2 DNA barcoding in thrips species identification……………………………. ...47
4.1.3 Objective of the current study .......................................................................... 48
4.2 MATERIALS AND METHODS .............................................................................. 48
4.2.1 Collection of insects and storage ...................................................................... 48
4.2.2 Database ........................................................................................................... 48
4.2.3 Plate arrays........................................................................................................ 49
4.2.4 DNA extraction .................................................................................................. 49
4.2.5 DNA polymerase chain reaction (PCR) .............................................................. 49
4.2.6 Morphological identification ............................................................................. 50
4.2.7 Data analysis ..................................................................................................... 50
4.2.7.1 Species discrimination using DNA barcodes….………………………………………......…50
4.2.7.2 Genetic diversity and phylogenetic analysis…………………….………………..….……...50
4.2.8 Scanning Electron Microscopy (SEM) ................................................................ 51
vi
4.2.9 Haplotype and distribution analysis .................................................................. 52
4.3 RESULTS ............................................................................................................. 52
4.3.1 DNA barcode analysis of thrips species ............................................................ 52
4.3.2 Morphological identification ............................................................................. 54
4.3.3 SEM of cryptic thrips vector species ................................................................. 71
4.3.4 Global haplotype diversity ................................................................................ 72
4.4 DISCUSSION ....................................................................................................... 79
Chapter 5…………………….……………………………………………………………………………………………… ……..82
GLOBAL ANALYSIS OF POPULATION STRUCTURE, SPATIAL AND TEMPORAL
DYNAMICS OF GENETIC DIVERSITY, AND EVOLUTIONARY LINEAGES OF IRIS
YELLOW SPOT VIRUS (TOSPOVIRUS: BUNYAVIRIDAE) ............................................ 82
5.1 INTRODUCTION ................................................................................................. 82
5.1.1 Tospoviruses: Introduction and importance .................................................... 82
5.1.2 Genome organization ........................................................................................ 83
5.1.3 Tospovirus transmission ................................................................................... 87
5.1.4 Iris yellow spot virus: Introduction and importance ......................................... 88
5.1.5 Importance of Onion in Pakistan ...................................................................... 91
5.1.6 Epidemiology of IYSV ........................................................................................ 92
5.1.7 Assay, detection and diagnosis of Tospoviruses ............................................... 92
5.1.8 Importance of this work .................................................................................... 93
5.1.9 Objectives .......................................................................................................... 93
5.2 MATERIAL AND METHODS ................................................................................ 94
5.2.1 Collection of thrips and plant samples for tospovirus studies .......................... 94
5.2.2 Enzyme-linked immuno-sorbent assay (ELISA) ................................................. 94
5.2.3 Reverse-transcriptase polymerase chain reaction (RT-PCR) ............................. 94
5.2.4 Sequence annotation and analysis ................................................................... 95
5.2.5 In silico RFLP Analysis of the nucleoprotein gene ............................................. 95
5.2.6 Temporal analysis of IYSV genotype distribution ............................................. 95
5.2.7 Recombination detection Analysis .................................................................... 95
5.2.8 Population selection studies and neutrality tests ............................................. 96
vii
5.2.9 Genetic differentiation and gene flow estimates ............................................. 96
5.3 RESULTS ............................................................................................................. 96
5.3.1 Symptomatology ............................................................................................... 96
5.3.2 Enzyme-linked immune-sorbent assay (ELISA) for IYSV.................................... 97
5.3.3 Molecular characterization ............................................................................... 97
5.3.4 Restriction fragment length polymorphism .................................................... 100
5.3.5 Sequence diversity, DNA polymorphism and phylogeny of the N gene ......... 103
5.3.6 Temporal shift in IYSV Genotype .................................................................... 106
5.3.7 Recombination detection ................................................................................ 106
5.3.8 Population selection and test of neutrality .................................................... 110
5.3.9 Genetic differentiation .................................................................................... 111
5.4 DISCUSSION ..................................................................................................... 113
Chapter 6 ................................................................................................................................ 116
GENARAL DISCUSSION .................................................................................................... 116
RECOMMENDATIONS/ FUTURE WORK ........................................................................ 119
Chapter 7 ................................................................................................................................ 120
REFERENCES ...................................................................................................................... 120
APPENDICES ....................................................................................................................... 166
SUPPLEMENTARY TABLE………………………….…………………………………………………......…...…….…...174
PUBLICATIONS……………………………….…………………………...……………………………………………….191
viii
LIST OF FIGURES
Figure 1.1 Schematic model of tospovirus transmission cycle 15
Figure 1.2 Schematic diagram of tospovirus genome 15
Figure 2.1 Physical map of Pakistan with locations of thrips collections indicated
by black triangles
21
Figure 3.1 Diagram of Frankliniella tritici (Fitch) representing the standard
morphological characters used in morphological identifications
34
Figure 4.1 A) Pictures of thrips species (Terebrantia) from Pakistan on BOLD. B)
Pictures of thrips species (Tubulifera) from Pakistan on BOLD
58
Figure 4.2 Barcoding gap analysis (BGA) of thrips species from Pakistan (A)
Maximum intraspecific distance of thrips species versus nearest
neighbor distances (B) Mean intraspecific distance of thrips species
versus nearest neighbor distances (C) Number of individuals per thrips
species versus maximum intraspecific distance (D) Frequency
histogram of distance to nearest neighbor
64
Figure 4.3 Pairwise distance analysis of thrips species from Pakistan generated by
Automatic Barcode Gap Discovery (ABGD)
66
Figure 4.4 NJ tree based on COI sequences (with 500 boot strap value) constructed
with the Kimura two-parameter model
67
Figure 4.5 Barcode-based Phylogenetic analysis of thrips using the Bayesian
inference
69
Figure 4.6 Cluster and distance analysis of 3’COI region of cryptic thrips vector
species (A) T. palmi (B) T. tabaci. Two letter country code provided
with each accession number used in this analysis
70
Figure 4.7 Scanning electron micrographs of cryptic thrips vector species (A) T.
palmi (B) T. tabaci
71
Figure 4.8 Barcode haplotype network analysis of four major thrips vector species
from Pakistan (A) T. tabaci (B) T. palmi (C) S. dorsalis (D) T. flavus
77
Figure 5.1 Phylogeny based on amino acid sequences of nucleocapsid protein of
known tospoviruses
85
Figure 5.2 Schematic representation of the genome organization and replication
strategy of tospoviruses, showing the tree RNAs: Large (L), Medium
(M) and Small (S). The rectangular boxes indicate the proteins coded
86
Figure 5.3 Plant samples showing the IYSV specific symptoms 99
Figure 5.4 PCR amplification of IYSV N gene (1100bp) 99
Figure 5.5 Genotyping of IYSV accessions based on in silico RFLP simulation of
nucleocapsid (N) gene (percentage of accessions under various
genotypes)
101
Figure 5.6 Geographical distribution of various IYSV genotypes 101
Figure 5.7 Host distribution of various IYSV genotypes 102
Figure 5.8 Phylogenetic tree of nucleotide sequences of the nucleocapsid gene of
IYSV isolates available in GenBank
104
Figure 5.9 Temporal shift in genotypes of IYSV (A) IYSV genotypes reported
during the period (1997-2005) (B) IYSV genotypes reported during the
period (2006-2013)
107
Figure 5.10 Recombination events within N gene of various accessions as detected
by RDP v4
108
ix
LIST OF TABLES
Table 2.1 Collection date of samples (onion plants and thrips), location and GPS
coordinates in Pakistan
22
Table 3.1 A check list of thrips species recorded from Pakistan (1947- to date). A)
Family Phlaeothripidae B) Family Aeolothripidae C) Family
Thripidae
36
Table 3.2 GPS coordinates and plant sources of newly recorded thrips species in
current study
40
Table 4.1 Percentage K2P sequence divergence at the COI barcode region among
the 33 thrips species with >2 specimens, among 5 genera with two or
more species and among the 2 families with two or more genera
55
Table 4.2 Barcode Index Numbers (BINs) and maximum intraspecific distances
for thrips species from Pakistan and other countries
56
Table 4.3a Comparisons between geographic region (Asia, Europe, Australia and
America) by AMOVA using COI gene sequences of T. tabaci
75
Table 4.3b Comparisons between geographic region (East Asia, South Asia,
Southeast Asia and Europe) by AMOVA using COI gene sequences of
T. palmi
75
Table 4.3c Comparisons between geographic region (East Asia, South Asia,
Southeast Asia and North America) by AMOVA using COI gene
sequences of S. dorsalis
76
Table 4.3d Comparisons between geographic region (East Asia and South Asia) by
AMOVA using COI gene sequences of T. flavus
76
Table 5.1 List of currently accepted and tentative tospovirus species
(http://ictvonline.org/virusTaxonomy.asp?bhcp=1) and the GenBank
accessions numbers used for comparisons
84
Table 5.2 List of Iris yellow spot virus (IYSV) isolates first reports from different
countries
89
Table 5.3 Genetic diversity of the nucleocapsid gene in various IYSV genotypes
and the population as a whole
105
Table 5.4 Summary of codon substitution studies in nucleocapsid gene of IYSV
genotypes
109
Table 5.5 Summary of Neutrality tests in IYSV population 112
Table 5.6 Genetic differentiation and gene flow of the nucleocapsid gene between
among different IYSV genotypes
112
x
LIST OF ABBREVIATIONS
A- Adenine
Amp- Ampicillin
°C- Degree Celsius
%- Percent
µg- Micrograms
µL- Microlitre
µM- Micromolar
ng- Nanogram
BLAST- Basic Local Allignment Search Tool
BOLD-Barcode of Life Data Systems
bp- Base pair
C- Cytosine
cDNA- Complementary DNA sequence
dATP- Deoxyadenosine Triphosphate
dCTP- Deoxycytidine Triphosphate
ddH2O-Double Distilled Water
dGTP- Deoxyguanosine Triphosphate
DEPC- Diethylpyrocarbonate
DNA- Deoxyribonucleic acid
dNTP-DeoxyriboNucleotide TriPhosphate
dTTP- Deoxythymidine Triphosphate
EB- Elution Buffer
EDTA- Ethylenediaminetetraacetic acid
EtBr- Ethidium Bromide
g- Grams
xi
G- Guanine
GDP- Gross Domestic Product
GPS- Global Positioning System
h- Hour
IPTG- Isopropyl β-D-1-thiogalactopyranoside
kDa- KiloDalton
kg- Killogarm
LB- Lura Bertani
LSD- Least Significant Difference
M- Molar
mg- Milligrams
min- Minutes
ml- Millilitres
mM- Millimolar
mm- Millimeter
mRNA- Messenger RNA
NCBI- National Center for Biotechnology Information
nt- Nucleotide
PCR- Polymerase Chain Reaction
pM- Picomole
RT-PCR- Reverse Transcription PCR
RdRp- RNA dependant RNA Polymerase
RNA- Ribonucleic Acid
rpm- Resolution Per Minute
rRNA- Ribosomal RNA
RT- Reverse Transcription
xii
SDW- Sterile Distilled Water
T- Thymine
TAE- Tris Acetate EDTA
TE- Tris EDTA
U- Units
UV- Ultra Violet
V- Volts
xiii
ABSTRACT
Thrips (Thysanoptera) are one of the most economically important groups of
crop pests at a global scale which damage a wide range of field and horticultural
crops. Some thrips species also serve as vectors of plant viruses. Despite the
importance of this tiny insect as pests, predators, fungal feeders, gall formers,
pollinators and virus vector, scant work was carried out on their systematics in
Pakistan. Currently thrips taxonomy in Pakistan is solely based on morphological
identification. Present study focused on thrips species identification based on the
morphological characters, and developing a database of thrips fauna and their
characterization based on DNA barcoding. Thrips were collected from multiple plants
during 2009-2012 at 158 sites in three climatic regions of Pakistan. Twelve species
from five genera of the suborder Tubulifera and twenty nine species from seventeen
genera of the suborder Terebrantia were identified following standard taxonomic
keys. A checklist of species reported in Pakistan since 1947 including thrips from the
current survey was compiled. A comparison of our species with those previously
reported from this region showed that one species (Apterygothrips
pellucidus Ananthakrishnan) from Tubulifera and seven species (Chaetanaphothrips
orchidii Moulton, Chirothrips meridionalis Bagnall, Megalurothrips distalis Karny,
M. usitatus Bagnall, Neohydatothrips samayunkur Kudo, Taeniothrips major, Thrips
trehernei Priesner) from Terebrantia and four genera (Apterygothrips,
Chaetanaphothrips, Neohydatothrips, Taeniothrips) were the first reports from
Pakistan. Mitochondrial COI sequences were used for discriminating 471 thrips that
represented 55 species in the current survey. Sequence analysis revealed that the
intraspecific and interspecific distances ranged from 0.0% to 7.5% and 2.3% to
22.3%, respectively. In addition, the study showed that four of the major thrips
species in the region, Aeolothrips intermedius, Haplothrips reuteri, Thrips palmi and
Thrips tabaci were cryptic species complexes. The study showed that DNA barcoding
successfully discriminated regional thrips species including those which were
morphologically cryptic. A barcode reference library for thrips from Pakistan was
compiled and regional lineages of four important virus-vector thrips were connected
with those from other countries by haplotype networks. A survey to determine the
xiv
incidence of selected tospoviruses was carried out in onion-growing regions of the
Punjab province of Pakistan during February-May and September-October 2012 in
thirteen administrative districts. Plants with symptoms suggestive of Iris yellow spot
virus (IYSV) infection were collected and tested for the presence of the virus by
ELISA and RT-PCR. Sequence analysis of RT-PCR amplified nucleocapsid (N) gene
confirmed IYSV infection of onion in Pakistan. This was the first report of IYSV
infecting onion in Pakistan. A global analysis of more than 100 IYSV N gene
sequences was carried out to determine the comparative population structure, spatial
and temporal dynamics with reference to its genetic diversity and evolution. Global
IYSV population could be grouped into two genotypes, IYSVBR and IYSVNL and the
analysis showed that the two genotypes were almost equally distributed. A temporal
shift was observed from IYSVNL to IYSVBR genotype over a period of 15 years (1997
to 2013). The diversity in IYSV population and temporal shift in IYSVBR genotype is
attributable to genetic recombination, abundance of purifying selection, insignificant
positive selection and population expansion. Restricted gene flow between the two
major IYSV genotypes (IYSVBR and IYSVNL) further emphasizes the role of genetic
drift in modeling the population architecture, evolutionary lineages and epidemiology
of IYSV.
Chapter 1 Indtroduction and review of literature
1
Chapter 1
INTRODUCTION AND REVIEW OF LITERATURE
1.1 Thrips
1.1.1 Morphology
Thrips are tiny, slender insects belonging to the order Thysanoptera. Their size
ranges from 0.5 to 10 mm. This insect was given the scientific name Thrips by
Linnaeus in 1758 (Lewis, 1997) because of its fringed wings, Thysanos (Fringe) and
Petron (wing). Thrips are commonly known as thunder flies, thunder bugs, storm
flies, thunder blights and corn lice. They have characteristic piercing and sucking
mouthparts with well-developed left mandible and an eversible pretarsal bladder
(arolium) which is different from other insects (Moritz, 1982; Hunter and Ullman,
1992). They are also referred to as “bladder footed insects” or physapoda as their legs
terminate in a small, protrusible bladder. Their body can be clearly differentiated into
head with antennae, a prothorax, a meso- and metathorax and an 11-segmented
abdomen which bears a well-developed ovipositor in sub-order Terebrantia. The
Antennae comprise of 4 to 9 segments which bear sense organ of different size, shape
and position (Heming, 1975; Moritz, 1982b, 1989b). The abdominal segments II and
VIII of adult bear stigmata while depending on the species, segment VIII often has a
complete comb.
1.1.2 Feeding behavior
Thrips are universal in nature and inhabit different kinds of flowers, grasses,
tender leaves of plants and beneath the bark of living and dead trees and feed on
leaves, pollen, fruits, liquids (Kirk 1995, Lewis 1997). They are phytophagous, most
commonly thought of as flower-living insects but approximately 50% of thrips
species feed only on fungi, on fungal hyphae in leaf litter or on dead wood (Mound
and Palmer, 1983) and a very few are known to be predaceous feeding mostly on
Chapter 1 Indtroduction and review of literature
2
mites, thrips, coccids, whiteflies and psocids (Mound and Marullo, 1998). Adult and
larvae of some groups of thrips feed on the flower tissues, including pollen grains as
well as the cells around the bases of anthers and on developing fruits by sucking the
cell sap (Kirk, 1984). Some other groups of thrips feed only on leaves during adult
and larval stages i.e., species of some genera feed on very young leaves (e.g.
Scirtothrips), whereas others (e.g. Selenothrips) are found typically on older leaves
(Fennah, 1965). Many of the flower-living species of genus Aeolothrips are
facultative predators (Kirk, 1985) while some other species of the same genus as well
as few thripidae and a few Phlaeothripidae are obligate predators of small arthropods
(Palmer and Mound, 1990). Ananthakrishnan (1973) has described the basic features,
binomics and ecology, control methods of thrips in general, crop-wise distribution of
economically important thrips and role of thrips in viral disease transmission and gall
formation in India. Thrips larvae and adults feed on the same tissues of the plant and
the difference between the mouth parts of the larvae and adults were insufficient to
account for the difference in viral transmission (Sakimura, 1947). Singh (1947)
recorded Thrips carthami from pampore and reported Liothrips bosei Moulton in
large numbers on wild plant in Tangmarg. Bhatti and Mound (1980) recognized 7 new
genera of Thrips Linnaeus which feed on grasses and cereals.
Feeding apparatus of thrips is unique among insects with only left mandible.
However they are broadly similar across all families of thrips and between larvae and
adults and are used in a similar way. Under the head, individual mouthparts are found
consisting of mouthcone. For feeding a single mandible and a pair of maxillary stylets
protrude out of mouth cone of individual. Mandible, like a microscopic needle is used
to pierce a hole in cell wall of plant cells while the maxillary stylets form a tube
which can enter the tissue through or next to the hole made by mandible and suck the
cell sap. Because of this feeding behavior which include first piercing and then
sucking the liquids from cell, thrips are described as piercing-sucking insects (Hunter
and Ullman, 1992). The maxillary stylets of different species only varies in length and
do not show any adaptation to the food imbibed, except in the spore feeding species
which have broad feeding channel (Mound, 1971). Thrips cause damage to plants by
direct feeding on them. Their feeding behavior on leaves has been studied by direct
observation (Heming, 1978; Hunter and Ullman, 1989) and it appears to be similar to
Chapter 1 Indtroduction and review of literature
3
that on fruits and petals (Childers and Achor, 1991; Achor and Childers, 1995).
Round feeding marks are left on tomato by F. occidentalis (Kumar et al., 1995). On
susceptible varieties of cucumber feeding holes are grouped together (Mollema et al.,
1995) whereas trails of feeding sites are found on peanut leaflets (Mitchell et al.,
1995). Gall thrips in a broad sense feed in a similar way like non galling thrips and
have large salivary glands (Heming, 1993) which is involved in stimulating the
galling response of the plants (Mound, 1994). Some thrips species both in Tubulifera
and Terebrantia are specialist predators that feed on prey (Mound and Marullo 1998).
Some phytophagous thrips species i.e., F. occidentalis, T. tabaci can also be predatory
(Trichilo and Leigh, 1986; Wilson et al., 1996). Thrips can also feed on exposed
liquids such as water droplets on leaves, sugar solutions and nectars (Heming, 1978).
1.1.3 Dispersal
Many thrips species have the crawling behavior. They crawl to the top of the
plant or twig by jumping but for the aerial dispersal thrips are not dependent on the
presence of wings as several wingless species of thrips disperse through the air more
effectively than the fully winged species (Mound, 1972). They can disperse by long
distances depending on the wind system of the area. Like many other small insects,
the wings of thrips are fringed with long cilia. In sub order Terebrantia, like normal
setae, these cilia arise from sockets but in family Phlaeothripidae they arise as
extensions of the wing membrane (Ellington, 1980; Mound et al., 1980). Wings are
adjusted before and during flight by rearrangement of fringe cilia to increase the wing
area (Ellington, 1980). During flight, wing movement is maintained by the complex
interaction of an array of oscillatory muscles (Moritz, 1989). After emergence from
the pupae, adults take a short period of teneral development to function their wing
muscles e.g., Limothrips cerealium takes about 5 hours at 20°C (Lewis, 1973) but it is
considerably short for tropical species. Flight capability also differs between sexes. It
is obvious that only female can be airborne in species with wingless males, but
females predominate in aerial populations in some fully winged species. Immature
individuals from several thrips species e.g., Limothrips cerealium, Frankliniella
intonsa predominate in airborne populations distant from host crops during migrations
in spring and autumn whereas gravid females mostly fly locally among host plants
Chapter 1 Indtroduction and review of literature
4
and in some species of Thrips and Taeniothrips seem less inhibited flyers (Lewis,
1965).
1.1.4 Reproduction
Reproduction starts with the copulation between adults of opposite sex in most
of the Thysanoptera. Thrips are haplodiploid, as male thrips are haploid as they
emerge from an unfertilized egg formed as a result of parthenogenesis while fertilized
eggs always develop into females which are diploid. Many thrips species belonging to
different genera have evolved the ability to reproduce in the absence of males
(Mound, 1976). Obligate Parthenogenesis occurs in few thrips species which results
only in female progeny (thelytoky) and rarely males (deuterotoky). Sexual and
asexual reproduction is common in T. tabaci (Zawirska, 1976) and virgin females can
produce both sexes in the species Apterothrips apteris (Mound, 1992). This type of
reproduction has clear impact for invading pest thrips species to new area. Sexual
dimorphism is common in thrips and sometime remarkable differences are found
between the male and female (Anathakrishnan, 1969). In flower inhibiting thrips
species males are usually smaller than females while in many fungus-feeding species
of family Phlaeothripidae males are larger than the females with conspicuous
tubercles or fore tarsal teeth that reflects their breeding structure in which male
commonly serves as defender of female or an egg mass from the attention of other
males (Crespi, 1990). As these sexual differences is often the subject of allometric
growth patterns in this order, they result in confusing patterns of intra-specific
variation and create problems in correct species identifications (Palmer and Mound,
1978).
1.1.5 Life cycle of thrips
A variety of biologies are found in order Thysanoptera. The life cycle of thrips
begins with a tiny oval shaped egg; the new born larvae are actively feeding with only
two larval instars, followed by nonfeeding one pro-pupa and one or two pupal stages
and then the fully winged, short winged or wingless adult depending on the sex and
species of thrips (Lewis, 1973). Ovipositor morphology clearly distinguishes the two
sub-orders of Thysanoptera. Terebrantian female have well developed ovipositor
Chapter 1 Indtroduction and review of literature
5
which is in upward position in Aeolothripidae and in downward position in other
Terebrantian. This ovipositor is used to pierce the plant tissue to deposit the eggs in
plant tissues. While in Tubulifera this ovipositor is reduced to U shaped chute
(Heming, 1995) and eggs laid on the surface of food substrate (Lewis, 1973). The
members of family Phlaeothripidae deposit their eggs on the food substrate either
horizontally or vertically while members of family Terebrantia insert the eggs into
plant tissues by means of their ovipositor. All Phlaeothripidae members have two
pupal stages found together with the larvae and adults while all members of
terebrantia have one pupa following the propupa and found in the soil away from the
larval feeding site. Life cycle of thrips takes less than 21 days during warm weather
(Brodsgaard, 1994). In many thrips body size of larvae increases rapidly after
hatching and first and second instar larvae resemble to the adult thrips apart from the
wings and genital organs. These two are actively feeding instars. These are followed
by two or three inactive, non-feeding propupal and pupal stages which leads to fully
developed adult thrips.
1.2 Taxonomic classification
Thysanoptera was suggested to be divided into three sub-orders, Terebrantia,
Tubulifera and Polystigmata (Bagnall, 1912). But according to a widely accepted
classification, Thysanoptera is divided into two sub-orders, Terebrantia and
Tubulifera (Halidy, 1836; Priesner, 1968). Tubulifera has a range of distinct
characters including structures of sperm and adult as well as life history but the major
distinguishing character is the presence of tubular tenth abdominal segment. Mound et
al. (1980) has placed family Phlaeothripidae in the sub-order Tubulifera. The family
Phlaeothripidae is composed of two sub-families, Idolothripinae and Phlaeothripinae.
Almost 50% of the species of Phlaeothripidae feed on fungal hyphae found on dead
branches and leaf litter, but a large number of Oriental species produce leaf galls. One
group of species in this family is abundant on flowers of grasses and Asteraceae, and
a few species are predators on arthropods. Two largest families of thrips are
Phlaeothripidae and Thripidae. There are 2400 described species in family Thripidae,
while about 3500 described species are placed in the family Phlaeothripidae (Mound
and Morris, 2007).
Chapter 1 Indtroduction and review of literature
6
1.3 Thrips diversity
Stannard (1957) has worked on Thysanoptera and published a monograph on
the phylogeny of Tubulifera of North America. A key to six species of Chirothrips
from the Australian region was provided by Strassen (1960). Priesner (1961)
identified 10 tribes of thrips; Plectrothripini; Haplothripini; Phlaeothripini;
Hoplothripini; Glyptothripini; Hyidiothripini; Leeuweniin; Emprosthiothripini;
Terthrothripini and Rhopalothripini and a sub-family Urothripininae and 13 sub tribes
in the Hoplothripini. Baily (1964) provided a key to 13 species of genus Scirtothrips
from North America. Sakimura (1967a) reworked on the genus Chaetothrips Priesner
and recognized the three taxa with keys to the species. Sakimura (1967b) also
redefined the generic and sub-generic characters of Isoneurothrips Bagnall and thrips
(Isothrips) provided the key to 12 species of Isothrips. Sakimura (1967c) also
provided the key to 7 species of Isochaetothrips.
Ananthakrishnan (1969) documented 154 genus group names in the sub-
family Idolothripinae including six new genera of which 75 names are placed in
synonyms. Ananthakrishnan and Jagdish (1970a, b) recognized 10 species of
Tubulifera from West Bengal. Pitkin (1972) described 14 new species in genus
Odonothripiella Bengal. Sub-family Urothripinae demoted to tribe rank (Mound,
1972). Three genera in the Merothripidae was recognized two namely Damerothrips
and Erotiodothrips with one species each and Merothrips with 13 species (Mound and
O’Neill, 1974). Sub-family Panchaetothripinae comprises 35 genera and 98 species
(Wilson, 1975). Dichromothrips indicus was described from Darjeeling West Begnal
(Mound, 1976a).
Muraleedharan (1982) has described 22 new species including 2 new genera
and 17 species of Tubulifera from North-Eastern India. Ananthakrishnan (1978)
described almost three hundred species of about 90 genera of Tubulifera inducing
galls. Majority of gall thrips belongs to Liothrips, Eothrips, Mesothrips,
Eugynothrips, Liophlaeothrips and Crotonothrips. Bhatti (1980) reported Thrips
flavus Schrank from Tangmarg and Thrips hawaiiensis Morgan from Jammu and
Kashmir. Furthermore Bhatti (1982) revised the Stenchaetothrips Bagnall fauna of
India covering taxonomic studies of 20 species with description and keys. Mound and
Chapter 1 Indtroduction and review of literature
7
Palmer (1981) worked on identification, distribution and host plants of pest species of
genus Scirtothrips. Lone and Bhagat (1984) recognized 8 thrips species from Kashmir
valley. Lone and Bhagat (1986) also reported 6 Thrips species belonging to
Terebrantia from Kashmir. Bhatti (1998) has placed 3000 species in the family
Phlaeothripidae. Four families have wingless species.
Nakahara has provided the key to thrips species of Nearctic region. Nakahara
(1991) discussed the systematic of Thysanoptera and several species that are
economically important in United States and Canada and distinguished
morphologically six families of thrips in North America and 6 economic species viz.,
Taeniothrips inconsequens. Thrips calcartus, F. occidentalis, Frankliniella tritici,
Frankliniella fusca, T. tabaci. Nakahara (1994) reported 62 thrips species from new
world including 43 species endemic to Canada and USA. In sub-family
Dendrothripinae, about 95 leaf feeding species in 13 genera were reported that share
structural characters with some species in Panchaetothripinae (Mound, 1994). Mound
and Marullo (1996) described three lineage groups of Phlaeothripidae viz.,
Phlaeothrips lineage, Haplothrips lineage, Liothrips lineage. Lewis (1997) has
reported several thrips species as serious pest of many crops causing great economic
losses. A key was provided for 33 species of Scirtothrips from Mexico (Johansen and
Mojica-Guzman, 1999), 21 Scirtothrips species from Australia (Hoddle and Mound,
2003) including 11 newly described Scirtothrips species. Hoddle et al. (2004) also
reported 238 species under 87 genera and 8 families of Thysanoptera in California
USA. Masumoto and Okajima (2005) reported 31 species of genus Tricomothrips
worldwide. Masumoto and Okajima (2006) also provided the key to the genus
Mycterothrips which includes 27 species from tropical and temperate countries of the
world but none from Central or South America whereas 3 species reported from North
America.
Diffie et al. (2008) gave a list of 275 thrips species from Florida and 202 thrips
species from Georgia; the list was compiled from literature, reviews, museum
collections and new records. Eight species are listed in the genus Stomatothrips, two
of these are from North America (S. brunneus from Arkansas and S. crawfordi from
illinois), one is known from Texas, two from Brazil and one each from Argentina and
Chapter 1 Indtroduction and review of literature
8
Trinidad (Bailey, 1952). Cott (1956) reported 9-species in the genus Bagnalliella
Karny of order Tubulefera from North America, New Guinea and Africa.
1.4 Importance of thrips
Thrips are polyphagous and highly mobile insects which have high population
densities because of the rapid reproductive rates. They can damage the plants directly
by feeding on plants and indirectly by transmitting the bacterial, fungal and viral
diseases to the plants (Mound, 1973) resulting in huge economic losses. They are
voracious pests of different ornamental, vegetable plants and fruit crops in open field
and greenhouses worldwide (Tommasini and Maini, 1995). They damage plants by
reducing its photosynthetic capacity with leaf surface disruption and thus removing
the mesophyll cell contents by feeding that leads to yield reduction in crop plants
(Alfredo et al., 2007). Direct feeding of thrips can induce a range of symptoms in
plants including silvering, scarring on fruits and corky tissue development as on
banana fruit (Trochoulias et al., 1984). Premature flower loss and ultimately reduction
of pollen below critical level is caused by large populations of thrips (Kirk, 1984).
Silvering is the typical of thrips damage. S. aurantii in Africa and S. citri in the USA
cause the corky scarring to the citrus fruits (Kamburov, 1991; EPPO/CABI, 1996).
The bean bacterioris (Pseudomonas medicaginis var. phaseolicola) has been shown to
be transmissible by Hercinothrips femoralis and the lesions are always associated
with the feeding damage by thrips (Lewis, 1973). Sakimora (1947) stated that the fig-
spoilage disease in California, USA was caused by a complex of bacteria, yeast, fungi
and thrips, particularly F. occidentalis, T. tabaci and F. tritici.
Thrips cause damage to crops by transmitting tospoviruses. The known vector
species belong to four genera, three of which are from family Thripidae. They are not
from closely related phylogenetic groups but they do share some common characters
i.e, extremely polyphagous and their ability to reproduce on a broad range of host
plants (Mound, 1996). The species of the genera Frankliniella and Thrips are major
pests of many important plant species (Lewis, 1973). For example, a single thrips
species (T. tabaci Lindeman), is a varocious pest of bean, garlic, leeks, onions, peas,
shallots, strawberry and white cabbage all over the world (Edelson et al., 1986;
Mustafa, 1986; MacIntyre Allen et al., 2005; Tunc, 1998).
Chapter 1 Indtroduction and review of literature
9
Bacteria and fungi are mainly disseminated by air, and water, while virus
spread often relies on vectors. Several thrips species feed on fungal hyphae and spores
(Mound and Teulon, 1995) and can transfer pathogenic fungal spores and conidia to
healthy plants by carrying on their bodies (Farrar and Davis, 1991). Thrips have also
been associated with bacterial wilt of corn (Pantoea stewartii) (Elliot and Poos,
1940). Thrips also provide entry points for other disease organisms to plants by
causing injury (Lindorf, 1931; Smith, 1931; Hardy and Teakle, 1992).
Flower thrips are also considered as pollinator in many crops (Mackie and
Smith, 1935; Veer, 1978). Thrips are also predator of mites and lepidopterans on
different crops. But these benefits are overshadowed by the pest status of thrips. F.
occidentalis besides its pest and virus vector status also acts as a good predator of
mites on cotton plants (Gonzalez et al., 1982; Pickett et al., 1988). But it is often
considered as a poor biological control agent for mites because its population cannot
increase fast enough to keep up with the mite population (Bailey, 1939; Parrella and
Horsburgh, 1983). Scolothrips sexmaculatus can be the ideal biological control agent
of mites (Gilstrap, 1995). For the control of tetranychid mites in greenhouses and in
fields, potential use of Scolothrips longicornis has been much studied (Gerlach and
Sengonca, 1985, 1986; Sengonca and Gerlach, 1984; Selhorst et al., 1991), but it has
not been used commercially as a biological control agent in greenhouses.
1.5 Identification of thrips
Taxonomy and systematics of the order Thysanoptera is entirely based on
morphology. Until now, multiple classification systems for thrips have been proposed
(Bhatti, 1988, 1992, 2006; Zherikhin, 2002) but there is no harmony to intraordinal
relationships (Mound et al., 1980). Recently, molecular data based identification are
being used along with morphological identification of thrips which helps to overcome
the constrain of morphological identification by the minute size of insect, scarcity of
characters, adult and greater resemblance of nymphal stages of different thrips species
(Brunner et al., 2002), polymorphism (Murai and Toda, 2001) and lack of trained
manpower. Molecular diagnostic technologies supported the morphotaxonomic keys
in few most economically important and global pests e.g. fruit flies (Armstrong et al.,
1997), tussock moths (Armstrong et al., 2003), leaf roller moths (Dugdale et al., 2002)
Chapter 1 Indtroduction and review of literature
10
and thrips (Toda and Komazaki, 2002). mtCOI partial sequences of T. palmi and T.
tabaci confirmed their morphological identification.
1.5.1 Morphological identification
Morphological identification based on the distinguishing characters found on
the main body of insects, e.g., head, thorax and abdomen region, and colour of the
body. Thrips species can be identified using conventional morphological characters
based methods. However, identification of thrips based on morphological
characteristics is difficult, although many available standardized morphological keys
for thrips identification have been published as follows: Hoddle et al. (2008) for
Thysanoptera of California, Moritz et al. (2000, 2001, 2004) for pest species of the
world, Mound and Kibby (1998) for major genera of the world, Mound and Marullo
(1996) for the Neotropical Thysanoptera, Zur Strassen (2003) for European
Terebrantia, Priesner (1964) for the Thysanoptera of Egypt, Wilson (1975) for the
world genera of Panchaetothripinae, Mound and Ng (2009) for the Thripinae genera
of Southeast Asia, and Masumoto (2010) for the genera of the subfamily Thripinae
associated with Japanese plant quarantine.
1.5.2 Molecular identification
Molecular methods of species identification have several advantages over
morphological identification. When there is a lack of taxonomic expertise, molecular
methods would be very useful to verify the identity of the species. Molecular
approaches for the species identification and phylogenetic relationships of insects are
increasingly becoming common. DNA polymorphisms in mitochondrial and nuclear
genes have been used for insect molecular systematic (Simon et al., 1994) and
diagnostics (Gariepy et al., 2007). Bertin et al. (2010) used ITS2 region to
discriminate between externally indistinguishable Hyalesthes luteipes and Hyalesthes
scotti and found this molecular tool fast and reliable for species identifications.
Buckman et al. (2013) used nuclear and mitochondrial genes to make the
phylogenetic analysis of thrips. Phylogeny of Acacia gall-forming thrips was
determined using two mitochondrial genes, adult morphology and behavior and gall
morphology (Crespi et al., 1997).
Chapter 1 Indtroduction and review of literature
11
Molecular genetic analysis can also detect the morphologically cryptic species
as very limited morphological differences are found in some closely related species
(Knowlton, 1993; Jarman and Elliot, 2000; Witt and Hebert, 2000; Hebert et al., 2004;
Schiffer et al., 2004). Two molecular markers COI and 28S (mitochondrial and
nuclear) barcodes were used to identify two sympatric cryptic species within the
global pest F. occidentalis in its native California (Rugman-Jones et al., 2010).
Many molecular techniques are being used for the identification of insect
fauna. Based on the mitochondrial COI DNA, real time quantitative PCR has been
developed for the identification of thrips species (Kox et al., 2005). Brunner et al.
(2002) developed a method of DNA barcoding for the identification of economically
important thrips species based on COI sequences which were further confirmed (Frey
and Frey, 2004).
1.5.2.1 Use of COI and emergence of DNA Barcoding
Hebert et al. (2003a, b) purposed the use of partial sequence of 5’end of
mitochondrial cytochrome oxidase I (mtCOI) coding gene (barcode region) for the
species level identification of insects universally. COI gene was used to detect several
haplotypes from different thrips species and proved excellent genetic marker (Brunner
et al., 2002; Asokan et al., 2007; Zhang et al., 2011). According to Timm et al. (2008)
mtCOI sequence analysis was a rapid, and accurate, means of identifying thrips
species present in southern Africa. Glover et al. (2010) found varying degrees of
discrimination of thrips species while they compared five different loci, and among
them COI provided sufficient variation to be used for future DNA barcoding studies
of thrips. DNA barcoding has been effectively used for the species identification of
aphids from the Korean Peninsula (Lee et al., 2011). The DNA barcoding has been
used for pest monitoring and quarantine in several hexapod orders: Coleoptera (Lobl
and Leschen, 2005), Diptera (Scheffer et al., 2006), Ephemeroptera (Ball et al., 2005),
Hemiptera (Foottit et al., 2008), Hymenoptera (Smith et al., 2008) and Lepidoptera
(Hajibabaei et al., 2006; Ashfaq et al., 2013).
COI sequence data was used to resolve the cryptic species, Pseudophilothrips
gandolfoi, within Pseudophilothrips with morphometric studies (Mound et al., 2010).
Chapter 1 Indtroduction and review of literature
12
Kadrival et al. (2013) used partial sequence of 3’COI gene for grouping of different
thrips species coexisting in a particular cropping system which successfully grouped
with reference sequences of morphologically identified species including F.
occidentalis, F. schultzei, S. dorsalis, T. palmi, T. tabaci and an unclassified group of
species. Phylogenetic analysis of Australian T. tabaci showed that T. tabaci clustered
corresponding to differences in vector competency of TSWV and the host from which
they were collected, instead of the geographical distances so as geographical distances
had no influence on genetic diversity of T. tabaci (Westmore et al., 2013).
1.6 Thrips and Tospovirus transmission
Among more than 6000 species of thrips (Mound, 2014) described worldwide
including 100 serious agricultural pest species which mostly belong to two genera,
Frankliniella and Thrips (Thripidae: Thysanoptera) 14 species have been documented
as vectors of plant pathogenic tospoviruses (Nagata et al., 2004; Ghotbi et al., 2005;
Lin et al., 2005; Premachandra et al., 2005; Ohnishi et al., 2006; Jones, 2005; Pappu
et al., 2009). Thrips have been recognized as exclusive vectors of the virus species
belonging to genus Tospovirus (Family Bunyaviridae) (Ullman et al., 1997; Whitfield
et al., 2005). Riley et al. (2011) provided a list of thrips vector species with their
common names, key diagnostic characters, distribution and important host crop plants
along with the disease symptoms on various crops.
Eight thrips species, five from the genus Frankliniella and three from the
genus thrips are the vectors of TSWV (Mound, 1996; Webb et al., 1998; Sakimura,
1961; Cho et al., 1987; Jenser et al., 2003), and Scirtothrips dorsalis and Thrips flavus
are suspected as TSWV vectors (Mound, 1996; Singh and Krishanareddy, 1996).
These vector species do not encompass a single evolutionary lineage (Mound, 2002),
so possibly other species of thrips have lost the ability to transmit viruses or
attainment of vector ability has occurred independently in several thrips species.
Vector competency to transmit TSWV was found in cryptic species of T. tabaci with
different modes of reproduction and host ranges (Jacobson et al., 2013). At any given
location, the vector competency of T. tabaci also depends on the thrips and virus
populations that are present at that location (Jacobson and Kennedy, 2013).
Chapter 1 Indtroduction and review of literature
13
Only those adult thrips are capable of transmitting tospovirus which acquired
these viruses in their first or second larval instars. Tospoviruses then multiply inside
the mid-gut of these larvae, survive through later developmental stages and the
resulting adult thrips become viruliferous and can transmit virus throughout their life
(Ullman et al., 1997; Moritz et al., 2004; Whitfield et al., 2005). The virus enters
thrips midgut epithelial cells which is the first site of viral infection (Ullman et al.,
1993) and then circulates to other organs of thrips localized in the midgut epithelial
cells, muscle cells surrounding the alimentary canal and salivary glands (Ullman et
al., 1995a; Wijkamp et al., 1993). The virus has to cross at least four membrane
barriers in order to circulate to the salivary glands and subsequent egestion for
inoculation of other healthy plants. Virus multiplication and circulation to the salivary
glands occur during the virus acquisition to successful inoculation period, also known
as median latent period. The median latent period in F. occidentalis is temperature-
dependent (Wijkamp and Peters, 1993; Wijkamp et al., 1995). Virus can be acquired
but cannot be transmitted by adult thrips (Paliwal, 1974, 1976; Amin et al., 1981;
German et al., 1992; Ullman et al., 1992, 1995a).
1.7 Tospoviruses
The genus Tospovirus is the only genus of family Bunyaviridae that contains
plant-infecting viruses (Elliott, 1990, 1996; Goldbach and Peters, 1996) while all
other genera of this family include vertebrate or insect-infecting viruses. TSWV is the
type species of the genus after which its name derived as genus Tospovirus (Fauquet
and Mayo, 2001) and the most important and widely occurring tospovirus species
with host range more than 1100 plant species in 80 families (Goldbach and Peters,
1994) and causes significant damage to a wide range of crops in many parts of the
world (Gera et al., 2000; Anfoka et al., 2006; Pappu et al., 2009). In Iran this virus
also infects tomato, cucurbits and soybean (Golnaraghi et al., 2001; Massumi et al.,
2007, 2009). Genus Tospovirus includes more than 30 virus species that can cause
severe losses to a range of vegetable and crop plants (Hallwass, 2012, Pappu et al.,
2009). The greatest diversity of tospoviruses has been found in the Asian continent
where 14 tospovirus species have been identified infecting different crops (Mandal et
al., 2012).
Chapter 1 Indtroduction and review of literature
14
1.7.1 Genome Organization
Tospoviruses have quasi-spherical, enveloped particles which has diameter of
80-100 nm and a tripartite single-stranded (ss) RNA genome, containing large (L),
medium (M) and small (S) RNAs (small). The L RNA is negative polarity and the M
and S RNA are ambisense in nature. These RNAs, together, code for at least four
structural proteins that include RNA-dependent RNA polymerase, Gn/Gc (membrane
glycoproteins) and N (nucleocapsid) proteins (Chu et al., 2001).
Chapter 1 Indtroduction and review of literature
15
Whitfield et al., 2005
Figure 1.1: Schematic model of tospovirus transmission cycle
Whitefield et al., 2005
Figure 1.2: Schematic diagram of tospovirus genome
Chapter 1 Indtroduction and review of literature
16
1.8 Importance of tospoviruses
Tospoviruses cause significant losses in quality and yield of many vegetable,
legume and ornamental crops throughout the world (Mumford et al., 1996; Pappu,
1997; Pearce, 2005; Persley et al., 2006; Pappu et al., 2009; Mandal et al., 2012).
Although the infection at early stages of plant growth causes substantial decrease in
plant stand leading to considerable yield losses, the infection at later stages of plant
growth is also responsible for significant yield and quality losses to the produce
(Culbreath et al., 2003). Serious losses in food and fibre production, as well as in
ornamental crops are caused by these viruses worldwide (Brittlebank, 1919;
Sakimura, 1963; Best, 1968; Francki and Hatta, 1981; Peters et al., 1991; Ullman,
1996). Groundnut bud necrosis virus (GBNV) is the most important tospovirus found
in the Indian subcontinent (Pappu et al., 2009) and can affect a wide range of crops
and substantial losses (Kunkalikar et al., 2011). Iris yellow spot virus (IYSV) is an
emerging tospovirus and its presence and distribution dramatically increased in the
whole world (Gent et al., 2006; Pappu et al., 2009; Mandal et al., 2012) and could
negatively impact Allium species, especially onion seed and bulb crops. Watermelon
bud necrosis virus (WBNV), is also another important tospovirus species from Asia
that caused up to 100% yield losses in various cucurbitaceous hosts in India (Pappu et
al., 2009).
Tospoviruses show a considerable degree of biological diversity as described
by the variation in symptoms, pathogenicity or virulence (Qiu et al., 1998; Mandal et
al., 2006), difference in thrips specificity and transmissibility (Ullman et al., 1997;
Whitfield et al., 2005), and ability to break host plant resistance (Roggero et al., 2002;
Margaria et al., 2004; Ciuffo et al., 2005; Persley et al., 2006). Under field and
protected cropping conditions, the continued occurrence of damaging virus epidemics
in diverse crop species is due to a number of factors. These factors include the
overlapping and wide host ranges of many tospoviruses and their thrips vectors and
lack of effective and economical thrips control options (Daughtrey et al., 1997; Gent
et al., 2006; Pappu et al., 2009). Bosco and Tavella (2010) worked on the integrated
management of vector and pest T. tabaci in Italy and showed that control of T. tabaci
based on the visual inspection of plants is effective. A risk index for TSWV was
Chapter 1 Indtroduction and review of literature
17
developed for peanut in Georgia, USA which resulted in significant reduction in the
final disease incidence (Culbreath et al., 2003). Insecticide resistance monitoring
(IRM) should be a component of IPM programs to control thrips as a pest and vector
(Gao et al., 2012).
1.9 Rationale for this study
Most thrips species are invasive in nature and can easily spread due to an
increase in the world-wide trade activities. The identification of thrips species at
juvenile stages is very important to contain the spread of thrips. Due to the minute
size and less developed morphological identification keys thrips identification and
quarantine is challenging. For example, in case of EU quarantine species, T. palmi, is
an A1 quarantine pest for EPPO (OEPP/EPPO, 1989) and an A2 pest for CPPC.
Species identification of thrips has become more difficult because of high
intraspecific variations (Mound and Zur Strassen, 2001). A rapid and accurate
identification method is needed for the identification of quarantine pest species on the
agricultural product imports. It is also important to know the species diversity of a
region as it affects the international trade in case of quarantine pest species. For these
reasons, use of molecular data has been increasingly applied for the thrips
identification (Glover et al., 2010).
Tospoviruses are important worldwide because of international horticultural
trade which has resulted in increased movement of host plants for both the vector and
the viruses they transmit (Latham and Jones, 1997). Intensive investigations have
been done on the relationship of thrips and tospovirus transmission over the last two
decades. An increased understanding of the interrelationships between thrips and
virus determinants that modulate vector specificity has been facilitated by the
availability of number of different tools including serological, biochemical and
molecular tools that permit the sensitive detection (Bandla et al., 1998; Sin et al.,
2005; Whitfield et al., 2005, 2008). The aim of the present research was to determine
the diversity of thrips species in different regions of Pakistan using morphological and
molecular approaches and carry out surveys for selected tospoviruses and characterize
them at the molecular level.
Chapter 1 Indtroduction and review of literature
18
1.10 Objectives
The overall goal of this study was to collect, identify, characterize, describe
and document the thrips fauna of Pakistan. To accomplish this, morphological and
molecular markers were utilized. Additionally, surveys of various vegetable crops
were carried out to ascertain the incidence of selected tospoviruses in Pakistan.
Specific objectives were:
1) Document and describe the thrips diversity based on morphological characters.
2) Summarize the molecular taxonomy of morphologically identified thrips species
from current surveys using COI-5’ sequences (DNA barcoding).
3) Identification and molecular characterization of Iris yellow spot virus (IYSV),
analyzing its occurrence in Pakistan and a global analysis of all known IYSV N gene
sequences with reference to the IYSV isolates from Pakistan.
Chapter 2 Materials and Methods
19
Chapter 2
Materials and Methods
2.1 Thrips collection
2.1.1 Locations surveyed
Thrips specimens were collected from 158 localities across the country during
2009-2012. Collection locations were selected based on accessibility, vegetation type,
and habitat type. GPS coordinates were recorded and locations were mapped. The
collection sites spread over an altitude range of 127-2660 m in three climatic regions
of the country in 37 administrative districts that included Abbas Pur, Bahawalpur,
Bagh, Chakwal, Dera Ghazi Khan, Forward Kahuta, Faisalabad, Gujranwala, HariPur
Hazara, Haveli, Hyderabad, Islamabad, Jaranwala, Kaghan, Mirpur Khas,
Muzaffarabad, Multan, Murree, Nagar Parker, Neelum, Naran, Narowal, Nankana,
Pallandri, Paye, Rawalpindi, Rawala Kot, Sheikhupura, Sahiwal, Sargodha, Sialkot,
Shakar Ghar, Seri, Shogran, Sanghar, Tando Allahyar, Taxila and Umer Kot (Fig.
2.1).
2.1.2 Habitats surveyed
Habitats surveyed included agricultural fields (Agricultural research stations,
farmer fields and crop nurseries Azad Jammu and Kashmir, Chakwal, Faisalabad,
Islamabad, Nankana), floricultural fields (Botanical Garden, University of
Agriculture, Faisalabad, Botanical Garden, National Agricultural Research Centre
(NARC), Islamabad, and several other flower farms in Azad Jammu and Kashmir,
Faisalabad, Lahore, Sahiwal), natural forests (Changa-manga Forest, Chinji National
Park, Tobatak Singh Forestation, Harrappa vegetation areas), and disturbed habitats
(home gardens, fallow rice fields, weedy patches and grasslands).
Chapter 2 Materials and Methods
20
2.1.3 Collection of specimens
Thrips were collected by beat method (Bradley and Mayer, 1994). Foliage or
inflorescence of plants and shrubs was beaten on a white blank paper and thrips were
collected with a fine camel hair brush. Specimens were transferred to 1.5 ml
Eppendorf tubes containing 85% ethanol and stored in a freezer until further analysis.
Name of collector, date of collection, location, GPS coordinates, and host plants were
recorded
2.2 Tospovirus survey, sample collection (plants and thrips), preservation and
identification
Onion plants found with characteristic symptoms associated with IYSV
infection such as spindle-shaped straw- colored irregular chlorotic lesions, necrotic to
hay-colored spots were collected from thirteen districts of southern and northern
Punjab in Pakistan (Chiniot, Faisalabad, Gujranwala, Hafizabad, Jaranwala, Jhang,
Jhelum, Layyah, MandiBahauddin, Muzafargarh, Nankana sahib, Sargodha,
Sheikhupura) during February 2012 to March 2013. The GPS co-ordinates of the
collection locations fall between latitude 30.28 -31 degree to 71-73 degree longitude
(Table 2.1). Thrips were also collected from the same fields and preserved in 85%
ethanol. Later, T. tabaci were identified by running the keys based on morphological
characters and were preserved in -20oC until further analysis.
During summer 2011, onion seed and bulb crops showing characteristic
symptoms including chlorotic lesions, spindle and long yellow stripes caused by
IYSV were collected from the commercial fields in the states of Colorado, Idaho,
New Mexico, New York and Washington, USA. The leaf samples were preserved in
-80oC until further analysis.
Chapter 2 Materials and Methods
21
Figure 2.1: Physical map of Pakistan with locations of thrips collections
indicated by black triangles.
Chapter 2 Materials and Methods
22
Table 2.1: Collection date of samples (onion plants and thrips) location and GPS
coordinates in Pakistan.
S No. Date of Collection Location Latitude (°) Longitude (°)
1 5-5-2012 AliPur Saidaan 31.28114 72.37553
2 5-5-2012 Ali abad 31.24719 72.29815
3 5-5-2012 Hasubulail 31.03636 71.099335
4 5-5-2012 Rafiqabad 30.94107 71.31338
5 5-5-2012 Rahmatabad 30.77851 71.22623
6 5-5-2012 Muhammad wala 30.67667 71.23772
7 5-5-2012 Abassi chok 30.4000 71.23967
8 24-5-2012 Paroti 31.64537 73.23488
9 24-5-2012 Hafizabad 32.08767 73.08564
10 24-5-2012 GoharPur Sani 31.52592 74.14623
11 21-3-2012 Maliwala 31.1441 73.5102
12 21-3-2012 Kirchpur 31.2307 73.4649
13 21-3-2012 Mangtawala 31.2102 73.5002
14 21-3-2012 Youngsanabad 31.2844 73.3704
15 21-3-2012 5 chak 31.2941 73.3521
16 27-2-2012 Parray wali 31.2353 73.4626
17 27-2-2012 Dhorkot 31.2728 73.4132
18 27-2-2012 10 chak 31.2845 73.3310
19 27-2-2012 Dalachanda Singh 31.3458 73.3148
20 27-2-2012 Panwan 31.3510 73.3525
21 27-2-2012 Raesainwala 31.2846 73.3551
22 21-3-2012 Chandar Kot 31.3217 73.4106
23 21-3-2012 Manawala 31.3459 73.4135
24 13-4-2012 Said Pur 32.66464 73.33781
25 13-4-2012 Illyas Pur 32.10118 74.16538
26 13-4-2012 Wazirabad 32.47992 74.08982
27 13-4-2012 Tatly wali 31.98014 74.12818
28 13-4-2012 Tulianwala 31.94399 74.10758
Chapter 2 Materials and Methods
23
29 13-4-2012 Sheikhupura 31.58249 73.74887
30 13-4-2012 Malot 32.91570 73.61472
31 13-4-2012 Daira Jumma Khan 32.65755 73.42243
32 13-4-2012 Naiabadi 32.78509 73.56263
33 13-4-2012 Pir Chak 32.66483 73.35577
34 17-4-2012 Painsra 31.2036 72.4947
35 30-4-2012 Jamsher 31.2814 73.2751
36 30-4-2012 Piplanwala 31.2031 73.4545
37 30-4-2012 Khudanwali 31.2203 73.3403
38 30-4-2012 Morkhunda 31.1944 73.4818
39 15-9-2012 Shahkot 31.3453 73.2957
40 15-9-2012 Lundiawala 31.1822 73.3409
41 15-9-2012 Chak 65 31.2303 73.1749
42 15-9-2012 Naaiwala 31.1919 73.4522
43 30-4-2012 Nankana 31.2654 73.4123
44 15-9-2012 Motiwala 31.2156 73.2053
45 15-9-2012 Khurianwala 31.3039 73.1659
46 15-9-2012 Mirpur 31.3246 73.2934
47 30-4-2012 Ghandraan 31.3421 73.3058
48 30-4-2012 Barnala 31.2253 73.1351
49 30-4-2012 Kot Namdar 31.1956 73.4339
50 16-10-2012 Chiniot 31.4240 73.0034
51 16-10-2012 Lalian 31.5006 72.4717
52 16-10-2012 Chak no 38SB 31.5446 72.5334
Chapter 2 Materials and Methods
24
2.3 Enzyme-linked immune-sorbent assay (ELISA) for thrips and plant samples
2.3.1 Direct Antigen-Coated (DAC) ELISA for testing thrips for IYSV
Individual thrips were ground in single 200 µL PCR tubes using micropestles
with 50 ul of ELISA extraction buffer {0.01 M Sodium-Potassium phosphate buffer
pH 7.4, containing 0.02% sodium azide (w/v), 0.8% sodium chloride (w/v), 0.05%
Tween 20 (v/v) and 2% PVP mol.wt. 40,000 (w/v)}to each tube. The samples (in a
total volume of 50 µL) were transferred to a microtiter plate and incubated for 37°C
for 2 hours. The plate was washed for three times with 1X PBST with 3-minute
incubation at room temperature after each wash. Afer the last wash, blocking agent
(1% BSA in 1X PBS) was added to the sample wells (100 ul per well) and incubated
for 2 hours at 37°C or 4°C overnight. The plate was washed for three times with 1X
PBST as before. Polyclonal antiserum prepared against IYSV-coded NSs protein(Bag
et al., 2014) was diluted 1:4000 in antibody dilution buffer, {1X PBST with 0.2%
BSA (w/v), 2% PVP mol.wt. 40,000 (w/v) and 0.02% sodium azide (w/v), pH 7.4 and
stored at 4°C} and 75 µL of the diluted antiserum was added to each well and the
ELISA plate was incubated at 37°C for 2 hours or 4°C overnight. After washing the
ELISA plate for three times with 1X PBST as before, secondary antibody (goat-anti
rabbit IgG conjugated with alkaline phosphatase; Sigma A7539) (dilution used was
1:5000) was added to each well and the plate was incubated at 37°C for 2 hours.
ELISA plate was washed for three times with 1X PBST as before. After the last wash,
substrate solution {1mg/ml pNPP in 1 M diethanolamine buffer containing 0.5 mM
MgCl2 and 0.02% sodium azide} was added to each well of the ELISA plate and
incubated at 37°C for one hour (Appendix 1). Absorbance was taken at 405 nm at 30
min, 1 hour and 2 hours.
2.3.2 Double Antibody Sandwich (DAS) ELISA testing of plants for IYSV
The capture (=coating) antibody was made by diluting the antibody in 1X
coating buffer to a final dilution of 1:200 (Appendix 1). ELISA plate was coated with
capture antibody (100 µL /well) and incubated at 4°C overnight. ELISA plate was
washed for three times with 1X PBST giving 3-minute incubation at room
temperature for each wash. Plant samples were prepared by grinding in liquid
Chapter 2 Materials and Methods
25
Nitrogen and extraction buffer was added (1:10 w/v) that was provided with the kit.
The contens were centrifuged for 2 minutes at 8000 rpm. 100 µl of of the supertanant
of each sample was then transferred to each well of ELISA plate and incubated at 4°C
for overnight. Plate was washed for three times with 1X PBST as previously
described. Secondary antibody (conjugated with -alkaline phosphatase) was diluted in
1X conjugate buffer (1:200) according to the supplier’s directions and 100 µL of the
diluated antibody were added to each well of ELISA plate and the plate was covered
tightly with parafilm and incubated at 37°C for 4 hours. The plate was washed for
three times with 1X PBST as before. Substate was prepared by dissolving pNPP
(para-nitrophenyl-phosphate) in substrate buffer (1 mg/ml) and 200 µL of substrate
solution was added to each test well and was incubated at 37°C. Absorbance values
were taken at 405 nm at 30 min, 1 hour and 2 hours using an ELISA plate reader.
2.4 IYSV nucleocapsid (N) gene fragment isolation and cloning of PCR products
2.4.1 RNA extraction
Following the standard laboratory protocols, all the glassware and all other
equipment were cleaned. For RNA work, all glassware was additionally
washed/cleaned with 0.1% [v/v] diethylpyrocarbonate (DEPC) treated water. Using
the RNeasy Plant Mini kit (Qiagen, Maryland, USA), RNA extraction from sample
plant leaves was done following the manufacturer’s instructions (Appendix 2). RNA
precipitation was done with double the volume of 95% ethanol and 1/10 volume of
3M sodium acetate. Then washing of RNA pellet was done with 75% ethanol and
pellet was re-suspended in DEPC-treated sterile distilled water. Extracted RNA was
stored at −80°C.
2.4.2 RNA quantification
Total RNA was first verified by 1% (w/v) agarose gel electrophoresis,
followed by staining the gel with ethidium bromide. RNA was quantified by using a
NanoDrop® Spectrophotometer ND-1000 (NanoDrop, USA).
Chapter 2 Materials and Methods
26
2.4.3 cDNA synthesis
Superscript cDNA synthesis kit with an oligo (dT)-primer (Invitrogen, Cat.
No.11904-018) was used for the synthesis of first strand cDNA using 500 ng RNA as
suggested by the manufacturer (Appendix 3). RNA and oligo (dT) primers were
mixed and briefly incubated at 65ºC for 5 min. 10 µL reaction mixture including 10X
RT buffer 2 µL, 25mM MgCl2 4 µL, 0.1M DTT 2 µL, RNase out (40U/µL) 1 µL was
added into it, mixed gently and then SuperScript II 1 µL was added into this mixture.
These samples were then incubated at 42ºC for 50 min and final incubation was given
at 70ºC for 10 min.
2.4.4 DNA polymerase chain reaction (PCR)
The optimum reagents and PCR profiles used for the amplification of different
gene fragments from thrips and plant samples were described later in this section.
PCR reaction of 50 µL was made by adding 1X PCR buffer (750 mM Tris-HCl [pH
8.8], 200 mM (NH4)2SO4, 0.1% (v/v) Tween20), 1.5-2 mM MgCl2, 0.2 mM dNTPs
(dGTP, dCTP, dATP and dTTP), both primers (Forward and Reverse) 5pM each, 50-
100 ng of template cDNA and 2.5 U of Taq DNA Polymerase (5 U/µL) and then
volume was made up to 50 µL with SDW.
2.4.5 Agarose gel electrophoresis of PCR products
The amplicons were analyzed by electrophoresis using 1.0% (w/v) agarose gel
and 0.5X TAE buffer (20 mM Tris [pH 8.0] 10 mM Acetic acid and 0.5 mM EDTA)
followed by staining with ethidium bromide (0.5 μg / ml) (Appendix 4). To perform
the electrophoresis, minigel (12 x 9 cm) or midigel apparatus (18 x 15 cm) was used.
The PCR product (5 µL) was mixed with 6X loading dye (Appendix 4) (bromophenol
blue) (2 µL) before loading onto the gel. To determine the fragment size of PCR
product 1kb DNA ladder was used (Fermentas, USA) (Appendix 4). The
electrophoresis was performed in 0.5X TAE buffer for 1h at 80 volts and the gel was
illuminated under ultraviolet (UV) light and photographed using Eagle Eye still video
system (Stratagene, La Jolla, CA, USA).
Chapter 2 Materials and Methods
27
2.4.6 Ligation
Ligation of PCR amplicons into T/A cloning vector (pGEM®-T Easy) was
done using T4 DNA Ligase kit (Fermentas) (Appendix 5). Ligation reactions were
done following the supplier’s instuctions. Reaction mixture, in a 20 µL total vlume,
was made by adding 2 µL of 10X ligation buffer for T4 DNA Ligase, 10 µL PCR
product, 1 µL of T4 DNA ligase, 1 µL of TA cloning vector (pGEM®
-Teasy) and
nuclease-free water. Ligation was carried out at 4°C overnight.
2.4.7 Transformation
Transformation of competent cells was carried out using methods described by
Sambrook (1989). The ligated material was transformed into heat shock competent E.
coli cells. Heat shock competent E. coli cells were prepared following the protocol
described in Appendix 9.
Approximately 10 μL of ligation mixture was added into 200 μL of competent
cells and placed on ice for 30 min. Transformation was carried out by incubating the
mixture at 42°C for 2 min in a dry bath. Reaction was placed on ice then for 2 min.
and then one ml of LB medium was added into it, mixed well and this reaction
mixture was incubated at 37°C for 1 h. Centrifugation was done at 3,000 rpm for 2
min and pelletted cells were recovered by removing the supernatant. Re-suspension
of pellet was done in 100 μL of fresh LB medium (Appendix 6) and ~50 µL of this
liquid culture was evenly spread with the help of a sterile glass rod on LB agar plates
(Appendix 7) supplemented with appropriate antibiotic in the presence of IPTG/X-gal
(Appendix 8). The plates were incubated at 37°C overnight. Blue/white colonies in
the TA cloning was confirmed the transformation.
2.4.8 Colony PCR
A grid was made on a master plate in preparation for transfer of bacterial
clonoies after picking white colonies from transformation plate for toothpick or
colony PCR. 50 ul of sterile ddH2O was pipetted into PCR tubes and individual white
colonies were picked using a toothpick and placed in PCR tube and also dotted the
toothpick on the grid plate to verify the positive colonies for the PCR fragment of
Chapter 2 Materials and Methods
28
interest. PCR tubes with water/colony mix were heated at 94°C for 3-4 minutes in the
PCR machine to burst the cells open. A master mix was prepared with the reagent
ratio of 1.5 mM MgCl2, 0.2 mM dNTPs (dATP, dCTP, dGTP and dTTP), 1X PCR
buffer (750 mM Tris-HCl [pH 8.8], 200 mM (NH4)2SO4, 0.1% (v/v) Tween20),
Forward and Reverse primers 2 pM each and 2 U of Taq DNA Polymerase (5 U/µL)
and then sterile ddH2O for volume of 20 µL per reaction. 15 μl of this mix was
dispensed into each PCR tube and 5 μl colony/water template was added. The
following PCR profile was used to amplify the N-gene of Iris yellow spot virus.
PCR profile:
Temperature Time
Denaturation temperature 94°C 3 min
Denaturation temperature 94°C 30 Sec
Annealing temperature 55°C 45 Sec 35 Cycles
Extension temperature 72°C 1 min
Final extension temperature 72°C 10 min
Hold 15°C ∞
White colonies that gave the PCR amplification of an expected amplicon were
picked from the master plate and individually cultured in 3 ml of LB liquid
supplemented with ampicillin (100 µg/ml) with vigorous shaking at 37°C. Using
GeneJETTm
Plasmid Miniprep Kit, (Fermentas Cat. No. K0503), plasmid DNA was
extracted from bacterial cultures following the provided protocol (Appendices 10, 11).
2.4.9 Screening of clones through restriction analysis
Digestion of plasmid vector DNA was done with specific restriction
endonucleases (New England Biolabs). Two µL of 10X recommended buffer for a
given restriction enzyme, 5-10 U (0.5-1 µL) of restriction enzyme, ~1 µg/2 µL of
substrate DNA, and 15 µL of SDW were used to make 20 µL reaction. Reaction
mixtures were incubated for 3-4 hours at temperature that is optimum for the given
enzyme.
Chapter 2 Materials and Methods
29
2.4.10 Glycerol stocks of the confirmed clones
To preserve the cultures of confirmed clones, glycerol stocks were made.
Glycerol stocks of the confirmed clones were prepared by adding 300 µL of glycerol
into 700 µL fresh overnight cultures of confirmed clones and stored at −80°C.
2.4.11 Sequencing
Cloned genes and PCR products were sequenced bidirectionally using the
dideoxynucleotide chain termination method (Sanger et al., 1977). For sequencing
reactions, PCR-based BIG DYE kit (Perkin-Elmer, Massachusetts, USA) was used
with M 13 forward or reverse primers or gene-specific primers. Contigs were
assembled and edited using EditSeq (DNAStar, Madison, WI).
2.4.12 Nucleotide sequence alignments and Phylogenetic analysis
To determine the evolutionary relationships of IYSV, nucleotide sequences of
N-gene of IYSV from our study and those obtained from GenBank (NCBI) were
aligned. Using Clustal W with default parameters, multiple alignments were carried
out. MEGA version 5 was used to conduct the phylogenetic and molecular
evolutionary analyses and dendrograms developed (Tamura et al., 2013) for thrips and
tospovirus. Neighbor-joining method was used to visualize the patterns of sequence
divergence among taxa. Thrips species identities and sequence comparisons were
performed using BOLD and NCBI.
Chapter 3 Thysanoptera Diversity
30
Chapter 3
THYSANOPTERA DIVERSITY: SURVEY IN PAKISTAN
3.1 INTRODUCTION
3.1.1 Thrips taxonomy
According to the traditional and widely accepted classification of the order
Thysanoptera (Priesner, 1961), the order has been divided into two suborders:
Terebrantia and Tubulifera. The suborder Terebrantia includes eight families, and the
suborder Tubulifera is represented by a single worldwide family (Mound et al., 1980;
Mound and Morris, 2007; Buckman et al., 2013). Phlaeothripidae is the largest family
of Thysanoptera. This family includes 3,500 described species in 455 genera from two
subfamilies, Phlaeothripinae with 160 genera and Idolothripinae comprising about
700 species (Mound and Palmer, 1983; Mound and Marullo, 1996). Whereas families;
Uzelothripidae, Merothripidae, Melanthripidae, Aeolothripidae, Adiheterothripidae,
Fauriellidae, Heterothripidae and Thripidae were placed in the sub-order Terebrantia
(Mound and Morris, 2007). The second largest family of the order Thysanoptera is
Thripidae. It has 2,121 species in 306 genera. Family Thripidae is divided into 4
subfamilies, Thripinae, Dendrothripinae, Sericothripinae, and Panchaetothripinae
(Bhatti, 1989). The largest subfamily Thripinae includes 1,730 species in 248 genera
of which 64 species and 13 genera are fossil records (ThripsWiki, 2014). Family
Aeolothripidae includes 200 species. In 29 genera of Aeolothripidae, 6 genera and 11
species were found in fossil form (ThripsWiki, 2014).
3.1.2 Thrips diversity in South-East Asia
Thrips are distributed worldwide in tropical and temperate zones inhabiting
forests, grasslands, bushes, leaves and flowers (Lewis, 1973), litter and galls (Mound,
1972). Thrips diversity is higher in the warm tropical parts than in the colder regions
of the world. In the Indian subcontinent, several studies documented the thrips
diversity from India. Ananthakrishnan and Sen (1980) provided a critical assessment
Chapter 3 Thysanoptera Diversity
31
of the taxonomic criteria, classification, and keys for the identification of 650 species
from India. Nearly 100 species of the genus Thrips Linnaeus were reported in the area
between the Indian peninsula, Australia, and the Pacific islands (Palmer, 1992). Bhatti
(1980) recorded and generated keys to 33 thrips species from India. Palmer and
Mound (1978) reported nine genera of fungus-feeding Thysanoptera from the oriental
region. Ananthakrishnan (1973) published mycophagous Thysanoptera of India. Sen
et al. (1988) gave the keys and description of Thysanoptera of north-eastern India.
Merothrips indicus was described from Tamil Nadu and Kerala in India and
Merothrips morgani Hood was redescribcd from Indian specimens (Bhatti and
Ananthakrishnan, 1975). Twenty six species of the family Phlaeothripidae were
reported from Pakistan by different authors (Akram 2000; Akram et al., 2003b; Ali,
1976; Saeed and Yousuf, 1994; Umar, 2004; Present study).
An illustrated key of 65 genera of Thripinae from South-East Asia was
provided by Mound and Ng (2009). Tillekaratne et al. (2007) described thrips species
from Sri Lanka under three families (Aeolothripidae, Thripidae, and Phlaeothripidae),
46 genera and 78 species. Later, Tillekaratne et al. (2011) provided the list of 72
thrips species in 45 genera from Sri Lanka. Of the nine families of order Thysanoptera
(Mound and Minaei, 2007), Aeolothripidae, Thripidae and Phlaeothripidae are the
more prevalent thrips families of the subcontinent for example, Haplothrips spp.,
Megalurothrips spp., Microcephalothrips abdominalis are widely distributed thrips
species in the subcontinent (Tillekaratne et al., 2011).
3.1.3 Thrips diversity in Pakistan
Pakistan geographically includes the Himalayan and Karakorum highlands of
northern areas of Pakistan to plains of Punjab and deserts of Sindh, and due to this
geography, Pakistan is rich in biodiversity. A large amount and variety of flora and
fauna is found in the area which needs to be identified. Agricultural production in this
area is affected by a wide diversity of insect pests. Being an agricultural country and
with the fertile lands Pakistan needs to be investigated about the insect pest and virus
vectors as well as beneficial insects for IPM (insect pest management) strategies to
increase the crop yield and quality, and for conservation of biodiversity for
ecosystem. As compared to other insect groups, thrips from Pakistan are understudied.
Chapter 3 Thysanoptera Diversity
32
Studies conducted so far on the incidence and descriptions of thrips in Pakistan have
provided some information about this important pest (Akram, 2002; Akram et al.,
2003a, b; Palmer, 1992; Saeed and Yousuf, 1994; Umar, 2004) but lack
corresponding molecular data.
3.1.4 Objectives of the study
The objective of this study was to survey, identify and compile a comprehensive list
of thrips species in Pakistan and to generate baseline knowledge on thrips diversity
which could be useful in improved understanding of their distribution.
3.2 MATERIALS AND METHODS
3.2.1 Locations and habitats surveyed and collection of specimens
This part was done as described in section 2.1.
3.2.2 Slide preparation
Slides for specimen identification were prepared using Hoyer’s Medium and a
water-soluble mountant. Individual thrips were removed from the collection fluid into
clean 70% alcohol. Before fixing the specimens on mountant, their wings were
opened and antennae straightened with the help of micro-pins. A drop of Hoyer’s
Mountant was dispensed onto a cover slip (13mm circle, No. 0 or 1) and the specimen
was placed on the drop by ventral side up and a glass slide was gently lowered onto
the drop to fix the specimen. Slide was inverted as soon as the mountant had spread
sufficiently. The slide was placed immediately into an oven, or onto a hot-plate, at
about 50°C and left for 24 hours and then examined under a microscope. The slide
was incubated in the oven for about 3 weeks to let the mountant dry, and then ringed
with nail varnish.
3.2.3 Labeling
Insect specimens were labeled appropriately with the original data, including
the name of collector, collection site, and date of collection. The standard methods
were used for labeling.
Chapter 3 Thysanoptera Diversity
33
3.2.4 Morphological characters
Insect morphology was discriminated on the basis of differences found in
colour of body and three main body parts, head, thorax and abdomen. The important
characters studied in head morphology were: shape of head, eye size, color and shape
of ocelli, position of ocellar setae. The distinguishing characters were also studied in
thorax and abdomen region. Body coloration and ocelli, size and number of antennal
segments, sense cone on antennae, size, no and location of major setae on the head,
pronotum, forewing, abdominal tergite, posteromarginal comb on tergite VIII, shape
of tergite X and ovipositor (Fig. 3.1).
3.2.5 Identification
Thrips were identified using the published description
(http://www.ozthrips.org, http://keys.lucidcentral.org/keys/v3/thrips_of_california). In
addition, standardized morphological keys for thrips were used to identify the species.
Morphological characters were studied using a compound microscope (Olympus BX
41) under magnifications, 40X, 100X and 400X. Voucher specimens were verified by
Mr. Stan Diffie, University of Georgia, Tifton campus, USA and Sueo Nakahara,
USDA ARS, Beltsville, MD., USA. ThripsWiki (2014) was accessed on 26 Apr 2014
for the valid species names of thrips reported in Pakistan since 1947 including thrips
from the current survey.
Chapter 3 Thysanoptera Diversity
34
Figure 3.1: Diagram of Frankliniella tritici (Fitch) representing the standard
morphological characters used in morphological identifications
Chapter 3 Thysanoptera Diversity
35
3.3 RESULTS
3.3.1 Thrips diversity
Thrips species from Pakistan documented in prior reports and from this survey
are presented in table 3.1. A total of 85 species in 40 genera have been recorded from
three families (Aeolothripidae, Thripidae and Phlaeothripidae) and two suborders
(Terebrantia and Tubulifera) (Table 3.1). Each family listed by the currently valid
genera and species name, and each species name is referenced to its record from
Pakistan. Source plants and collection localities of thrips species are provided for the
new records in current survey (Table 3.2).
3.3.2 Thrips species recorded during the survey
A total of 41 species of thrips in 21 genera from 3 families were
morphologically identified during the current survey. Family Thripidae included the
most number of species 28 in 16 genera. Family Phlaeothripidae was represented by
12 species in 3 genera making it the second largest family of thrips collected,
followed by family Aeolothripidae with only one species and one genus identified
morphologically in the current survey. Four genera and 8 thrips species are the first
records from Pakistan.
The four newly recorded genera Apterygothrips, Chaetanaphothrips,
Neohydatothrips, and Taeniothrips were each represented by a single newly recorded
species: Apterygothrips pellucidus, Chaetanaphothrips orchidii, Neohydatothrips
samayunkur and Taeniothrips major. One species (Chirothrips meridionalis) from the
genus Chirothrips, two species (Megalurothrips usitatus and M. distalis) from the
genus Megalurothrips, and one species T. trehernei were identified in the genus
Thrips. Twenty six of the species in our survey have been reported as cosmopolitan
pests and five as potential viral vectors (Moritz et al., 2001).
Chapter 3 Thysanoptera Diversity
36
Table 3.1: A check list of thrips species recorded from Pakistan (1947- to date)
S.No. Genus Species Reference
A) Family Phlaeothripidae
1 Bamboosiella
Ananthakrishnan
Bamboosiella murreensis Φ Saeed and Yousuf,
1994
2 Bamboosiella varia
Ananthakrishnan and
Jagadish
Akram, 2000
3 Allothrips Hood Allothrips pillichellus
Priesner
Akram et al.,
2003b
4 Apterygothrips Priesner Apterygothrips pellucidus
(Ananthakrishnan) ϯ
Present study
5 Ecacanthothrips Bagnall Ecacanthothrips tibialis
(Ashmead)
Akram, 2000
6 Ethirothrips Karny Ethirothrips longisetis
(Ananthakrishnan and
Jagadish)
Akram et al.,
2003b
7 Gynaikothrips
Zimmermann
Gynaikothrips khushabensis
Φ
Saeed and Yousuf,
1994
8 Gynaikothrips robustus Φ Saeed and Yousuf,
1994
9 Haplothrips Amyot and
Serville
subgenus Haplothrips
Haplothirps (H.) bagrolis
Bhatti *
Ali, 1976
10 Haplothirps (H.) ciliatus *
Φ
Saeed and Yousuf,
1994
11 Haplothirps (H.)
ganglbaueri Schmutz *
Ali, 1976
12 Haplothirps (H.) gowdeyi
(Franklin) *
Saeed and Yousuf,
1994
13 Haplothirps (H.)
longisetosus
Ananthakrishnan
Saeed and Yousuf,
1994
14 Haplothirps (H.) stylatus *
Φ
Saeed and Yousuf,
1994
15 Haplothirps (H.)
tenuipennis Bagnall *
Saeed and Yousuf,
1994
16 Haplothrips (H.) andresi
Priesner *
Akram, 2000
17 Haplothrips (H.) bicolour
(Ananthakrishnan)
Akram, 2000
18 Haplothrips (H.) ceylonicus
Schmutz
Akram, 2000
19 Haplothrips (H.) reuteri *
Karny
Akram, 2000
Chapter 3 Thysanoptera Diversity
37
20 Haplothrips (H.) howei
(Mound & Minaei, 2007)
Akram, 2000
21 Trybomiella Bagnall
(subgenus)
Haplothrips (T.) clarisetis
Priesner
Saeed and Yousuf,
1994
22 Plicothrips Bhatti Plicothrips apicalis Bagnall
*
Ali, 1976
23 Ananthakrishnana
Bhatti
Ananthakrishnana
euphorbiae Priesner *
Saeed and Yousuf,
1994
24 Liothrips Uzel Liothrips aberrans
Muraleedharan and Sen
Akram, 2000
25 Liothrips bournieri Sen Akram, 2000
26 Liothrips infrequens
Muraleedharan and Sen *
Akram, 2000
B) Family Aeolothripidae
1 Aeolothrips Haliday Aeolothrips distinctus
Bhatti
Saeed and Yousuf,
1994
2 Aeolothrips intermedius
Bagnall *
Saeed and Yousuf,
1994
3 Aeolothrips collaris
Priesner
Akram, 2000
C) Family Thripidae
1 Anaphothrips Uzel Anaphothrips sudanensis
Trybom *
Akram, 2000
2 Anascirtothrips Bhatti Anascirtothrips arorai
Bhatti
Saeed and Yousuf,
1994
3 Aptinothrips Haliday Aptinothrips rufus Haliday Akram, 2000
4 Arorathrips Bhatti Arorathrips mexicanus
Crawford *
Akram, 2000
5 Astrothrips Karny Astrothrips stannardi Bhatti Saeed and Yousuf,
1994
6 Astrothrips tumiceps Karny Akram, 2000
7 Caliothrips Daniel Caliothrips indicus Bagnall Akram, 2000
8 Chaetanaphothrips
Priesner
Chaetanaphothrips orchidii
Moulton ϯ
Present study
9 Chirothrips Haliday Chirothrips africanus
Priesner
Saeed and Yousuf,
1994
10 Chirothrips meridionalis
Bagnall ϯ
Present study
11 Dendrothripoides
Bagnall
Dendrothripoides ipomoeae
Bagnall
Akram, 2000
12 Dendrothripoides innoxius ϯ Present study
13 Elbuthrips Bhatti Elbuthrips latis Bhatti
(1973)
Saeed and Yousuf,
1994
14 Fulmekiola Karny Fulmekiola serrata Kobus Akram, 2000
15 Frankliniella Karny Frankliniella insularis
Franklin
Saeed and Yousuf,
1994
Chapter 3 Thysanoptera Diversity
38
16 Frankliniella schultzei
Trybom *
Ali, 1976
17 Helionothrips Bagnall Helionothrips mube Kudo Akram, 2000
18 Hydatothrips Karny Hydatothrips atactus Bhatti
*
Akram, 2000
19 Hydatothrips ekasi Kudo Akram, 2000
20 Indothrips Bhatti Indothrips religiosus Φ Saeed and Yousuf,
1994
21 Megalurothrips Bagnall Megalurothrips peculiaris
Bagnall *
Akram, 2000
22
Megalurothrips usitatus
Bagnall ϯ
Present study
23
Megalurothrips distalis
Karny ϯ
Present study
24 Microcephalothrips
Bagnall
Microcephalothrips
abdominalis Crawford *
Ali, 1976
25 Mycterothrips Trybom Mycterothrips nilgiriensis
Ananthakrishnan *
Akram et al., 2002
26 Bregmatothrips Hood Bregmatothrips binervis
Kobus
Akram, 2000
27 Neohydatothrips John
Neohydatothrips
samayunkur Kudo ϯ
Present study
28 Pseudodendrothrips
Schmutz
Pseudodendrothrips bhatti
Kudo *
Akram, 2000
29 Rhipiphorothrips
Morgan
Rhipiphorothrips cruentatus
Hood
Saeed and Yousuf,
1994
30 Scirtothrips Shull Scirtothrips bispinosus
Bagnall
Saeed et al., 1994
31 Scirtothrips dorsalis Hood
*
Ali, 1976
32 Scirtothrips mangiferus Φ Saeed et al., 1994
33 Scirtothrips oligochaetus
Karny*
Saeed et al., 1994
34 Scolothrips Hinds Scolothrips rhagebianus
Priesner *
Saeed and Yousuf,
1994
35 Sorghothrips Priesner Sorghothrips jonnaphilus
Ramakrishna
Saeed and Yousuf,
1994
36 Stenchaetothrips
Bagnall
Stenchaetothrips biformis
Bagnall
Akram, 2000
37 Stenchaetothrips faurei
Bhatti
Akram, 2000
38 Taeniothrips (Amyot &
Serville, 1843)
Taeniothrips major Bagnall
ϯ
Present study
39 Thrips Linnaeus Thrips alatus Bhatti * Akram et al.,
2003a
40 Thrips apicatus Priesner * Saeed and Yousuf,
1994
41 Thrips beharensis Saeed and Yousuf,
Chapter 3 Thysanoptera Diversity
39
Ramakrishna and
Margabandhu
1994
42 Thrips carthami Shumsher
*
Palmer, 1992
43 Thrips coloratus Schmutz * Palmer, 1992
44 Thrips decens Palmer * Akram et al.,
2003a
45 Thrips evulgo Palmer Palmer, 1992
46 Thrips flavus Schrank * Palmer, 1992
47 Thrips florum Schmutz * Akram et al.,
2003a
48 Thrips garuda Bhatti Akram et al.,
2003a
49 Thrips hawaiiensis Morgan
*
Palmer, 1992
50 Thrips kodaikanalensis
Ananthakrishnan and
Jagadish
Akram et al., 2000
51 Thrips orientalis Bagnall Saeed and Yousuf,
1994
52 Thrips palmi Karny * Palmer, 1992
53 Thrips subnudula Karny Palmer, 1992
54 Thrips tabaci Lindemann * Palmer, 1992
55 Thrips trehernei Priesner ϯ Present study
56 Thrips unonae Priesner Akram et al.,
2003a
(*) thrips species recorded in the current survey, (ϯ) thrips species first records from
Pakistan. (Φ) previous reported species from Pakistan and I could not find their names
in any database. Specimens are also not available to confirm the valid names.
Chapter 3 Thysanoptera Diversity
40
Table 3.2: GPS coordinates and plant sources of newly recorded thrips species in
current study.
Species
Location (GPS
coordinate)
Source plants
Apterygothrips pellucidus
(Ananthakrishnan, 1968)
32˚9167ʹ N, 72˚7167ʹE
32˚5457ʹ N, 72˚4251ʹE
Avena sativa L. (Poaceae),
Evolvulus alsinoides (L.)
L. (Convolvulaceae),
Erigeron sublyratus DC.
(Asteraceae).
Chaetanaphothrips orchidii
(Moulton)
33˚91ʹ N, 73˚4ʹE
33˚7ʹ N, 73˚6833ʹE
33˚5437ʹ N, 73˚243ʹE
33˚4215ʹ N, 73˚4038ʹE
Brassica oleracea var.
botrytis L. (Brassicaceae),
Brassica oleracea L.
(Brassicaceae), Oxalis
annae F. Bol.
(Oxalidaceae), Evolvulus
alsinoides L.
(Convolvulaceae).
Chirothrips meridionalis
(Bagnall)
32˚5333ʹ N, 71˚9333ʹE
33˚75ʹ N, 73˚1333ʹE
33˚91ʹ N, 73˚4ʹE
Triticum aestivum L.
(Poaceae), Bidens pilosus
L. (Asteraceae), Brassica
oleracea L. (Brassicaceae).
Megalurothrips distalis
(Karny) ϯ
34˚3667ʹ N, 73˚45 ʹE
24˚7333ʹ N, 69˚7833ʹE
24˚4331ʹ N, 69˚4850ʹE
Calendula officinali
(Asteraceae),
Lantana montevidensis
(Verbenaceae), Lantana
pastazensis (Verbenaceae).
Megalurothrips usitatus
(Bagnall) ϯ
26˚0333ʹ N, 68˚9333ʹE
33˚8ʹ N, 72˚9167ʹE
33˚8ʹ N, 73˚9667ʹE
33˚7ʹ N, 73˚6833ʹE
33˚8167ʹ N, 73˚8167ʹE
Acacia karoo (Fabaceae),
Sesbania bispinosa
(Fabaceae), Ambrosia
trifida (Asteraceae), Viola
glabella (Violaceae),
Brassica napus L.
(Brassicaceae).
Neohydatothrips
samayunkur (Kudo)
34˚4ʹ N, 73˚3833ʹE
34˚243ʹ N, 73˚239ʹE
34˚2352ʹ N, 73˚2324ʹE
33˚469ʹ N, 73˚5222ʹE
33˚7667ʹ N, 73˚8833ʹE
33˚8ʹ N, 73˚9667ʹE
Eupatorium sp.
(Asteraceae), Melilotus
indicus L. (Fabaceae),
Bidens pilosus L.
(Asteraceae), Euphorbia
sp. (Euphorbiaceae),
Mimosa pudica L.
(Fabaceae), Mimosa invisa
Mart. (Fabaceae).
Taeniothrips
major (Bagnall)
34˚15ʹ N, 73˚6833ʹE
33˚9ʹ N, 73˚3833ʹE
Achyranthes aspera L.
(Amaranthaceae),
Chapter 3 Thysanoptera Diversity
41
33˚542ʹ N, 73˚232ʹE
33˚8167ʹ N, 73˚8167ʹE
Callistephus chinensis (L.)
Nees (Asteraceae),
Capsicum frutescens L.
(Solanaceae), Amaranthus
spinosus L.
(Amaranthaceae).
Thrips trehernei (Priesner) 33˚74ʹ N, 73˚77ʹE
35˚74ʹ N, 71˚7ʹE
35˚4333ʹ N, 71˚4233ʹE
34˚82ʹ N, 74˚34ʹE
Rosa L. (Rosaceae),
Dahlia cav. (Asteraceae),
Chenopodium L.
(Amaranthaceae), Erigeron
sublyratus DC.
(Asteraceae).
Chapter 3 Thysanoptera Diversity
42
3.4 DISCUSSION
This study found that members of Thysanoptera are widely distributed
throughout the country including tropical coastal lands, subtropical continental low
lands, and subtropical continental high lands. Thrips species were found on different
plant hosts including crops, ornamental plants, and weeds. Most thrips species found
during the surveys belonged to the families Thripidae and Phlaeothripidae. Species of
family Phlaeothripidae were mostly found from subtropical continental high lands but
they were also present in the subtropical continental low lands. The most commonly
found genus of family Phlaeothripidae in the current study was genus Haplothrips.
Two species of genus Haplothrips (H. ganglbaueri and H. tenuipennis) were found to
be distributed throughout the country.
The most frequently found species of family Thripidae in our study were
major pests and virus-vectors including, T. palmi, T. tabaci, T. flavus, S. dorsalis, and
F. schultzei. Genus Thrips is the largest genus of the subfamily Thripinae. It includes
more than 280 species (Mound and Masumoto, 2005). This genus is diverse and
found in many parts of the world except the Neotropical region. Several species of
economic importance are included in this genus (Bhatti, 1980) including T.
angusticeps Uzel, T. eridionalis Priesner, T. flavus Schrank, T. hawaiiensis (Morgan),
T. palmi Karny and T. tabaci Lindeman (Moritz et al., 2001). T. palmi is an Asian
polyphagous species that spread around the world during the 1980s (Mound, 2005).
Thrips trehernei was also found for the first time in Pakistan. Scirtothrips is another
important genus of the family Thripidae. It includes 103 species from around the
world (ThripsWiki, 2014), several of which are important pests (Mound and Palmer,
1981; Mirab-balou et al., 2013). Two species of the genus Scirtothrips (S. dorsalis, S.
oligochaetus) were recorded from Pakistan in the current study.
Scolothrips (Thripidae) includes the well known predator species of mites
(Mound, 2011). Sixteen species in this genus are recognized (ThripsWiki, 2014), of
which one species (Scolothrips rhagebianus) was found in the current study.
Microcephalothrips abdominalis (sunflower thrips), was found in Faisalabad region
as well as Sindh. The genus Megalurothrips Bagnall includes thirteen species
(ThripsWiki, 2014), some of them are pests of legume crops (Masumoto, 2010).
Chapter 3 Thysanoptera Diversity
43
Although Palmer (1987) has provided details on species of the genus Megalurothrips,
their identification continues to be a challenge. Three species of genus
Megalurothrips (M. usitatus, M. distalis and M. peculiaris) were found at both
highland and lowland sites in Pakistan, on several plant species.
In summary, this study adds new information to the diversity of Thysanoptera
in Pakistan. A total of 41 thrips species were morphologically identified, representing
3 families and 21 genera. The array produced 8 species and 4 genera that were
reported for the first time from Pakistan. Intensive surveys of thrips fauna, with
repetitive collections during different seasons of the year are needed to better
understand the highly diverse thrips fauna from this region.
Chapter 4 DNA Barcoding
44
Chapter 4
ANALYSIS OF THRIPS BY DNA BARCODING
4.1 INTRODUCTION
4.1.1 Identification of thrips
The identification of thrips is mainly based on their biology (e.g.,
developmental stages and host range) and morphology (e.g., number and patterns of
setae on the wings, head, and other parts of the exoskeleton; patterns carved in the
exoskeleton cuticle; antennal segment; and shape of ovipositor). Morphological
identification of thrips is constrained by the minute size of insect, scarcity of
characters, adult and nymphal stages of different thrips species has high degree of
similarity (Brunner et al., 2002), polymorphism (Murai and Toda, 2001) and lack of
trained manpower etc. To study the morphological characters for thrips species
identification traditionally requires slide mounting of specimens and knowledge of
distinct characters of species which are visible through microscopic examination
(Palmer et al., 1989; Bisevac, 1997), whereas it is impossible to examine the
morphological characters of different thrips species at larval stages (Brunner et al.,
2002). Mostly thrips within each of two suborders are inquisitively uniform in
morphology albeit some species exhibit conspicuous features. Like many other small
unrelated insects, thrips also bear a fringe of long setae on their wings. In this
situation it is difficult to identify different thrips species both at adult and at larval
stages with routinely used morphological methods with reliability.
Thrips species from Pakistan have been identified by morphology and the
available taxonomic keys on Thysanoptera of the region are limited in scope (Palmer,
1992). More recent reports on thrips from the families Thripidae and Phlaeothripidae
(Akram et al., 2002, 2003a, b; Ali, 1976; Saeed and Yousuf, 1994; Saeed et al., 1994;
Umar, 2004) are all based on morphology.
Chapter 4 DNA Barcoding
45
4.1.2 Thrips identification based on molecular studies
Molecular identification is generally considered reliable for thrips
identification as it overcomes the limitations associated with the developmental stage
(Brunner et al., 2002). Identification of thrips by molecular means has advanced, and
different genes have been used as markers for species discrimination (Walsh et al.,
2005; Kox et al., 2005; Toda and Komazaki, 2002). Molecular markers have the
advantage where polymorphism is a problem e.g., because of the prevailing
temperature, color and size variation occurs in T.tabaci and it hampered correct
identification of insect (Murai and Toda, 2001). Species-specific primers enable a
non-specialist to identify the target species at any developmental stage (Asokan et al.,
2007).
Various molecular techniques have been used for thrips species identification
and for population diversity studies mostly for pest and virus vector thrips species.
These molecular techniques include DNA sequencing (Brunner et al., 2004; Morris
and Mound, 2004) and PCR based methods i.e., real time PCR (Walsh et al., 2005;
Kox et al., 2005), PCR-restriction fragment length polymorphism (PCR-RFLP) (Toda
and Komazaki, 2002; Brunner et al., 2002; Rugman-Jones et al., 2006), amplified
fragment length polymorphism (AFLP) (Fang et al., 2005), and simple sequence
repeat (SSR-PCR) (Brunner and Frey, 2004). Toda and Komazaki (2002) used a PCR-
RFLP method to identify nine species of S. dorsalis. Buckman et al. (2013) reliably
used nuclear and mitochondrial genes for the phylogenetic analysis of thrips of 99
thrips species from seven of the nine families. One of the molecular methods that has
received widespread acceptance is DNA barcoding that is based on the differences in
the DNA sequence of the mitochondrial cytochrome c oxidase I gene (COI) (Hebert et
al., 2003a). Karimi et al. (2010) proposed that the DNA barcoding can be a useful
method for thrips species identification and quarantine purposes.
4.1.2.1 Introduction of DNA barcoding
Use of 658 bp of COI-5ʹ (DNA barcode) (Hebert et al., 2003b) has proved as a
reliable method to discriminate animals to their species and has been widely accepted
Chapter 4 DNA Barcoding
46
for resolving insect species including cryptic complexes (Burns et al., 2007; Foottit et
al., 2008; Ashfaq et al., 2014a, b). Inter-specific variations found in mtCOI gene are
more reliable than any other gene markers (Savolainen et al., 2005). The COI
divergence within the species rarely exceeds 2%, while among different species it
typically shows a higher divergence (Hebert et al., 2003a, b). COI has been
extensively used for identification of vertebrate (Hebert et al., 2004; Hajibabaei et al.,
2006) and invertebrate (Costa et al., 2007; Mikkelsen et al., 2007) species
identification.
DNA barcoding provides robust analysis of the specimen taxonomy by
integrating ecological, genetic and morphological data (Dayrat, 2005). Dasmahapatra
and Mallet (2006) discussed the recent successes and future prospects of DNA
barcoding to discriminate different species and they presented the view that
taxonomic approaches integrating morphology, DNA sequencing and ecological
studies will achieve maximum efficiency in species identification. Frohlich et al.
(1999) used the COI to distinguish lineages of B. tabaci and 383 different haplotypes
have now been identified for this gene (de Barro, 2012). Global invasion histories
varied for different species in complex e.g., in B. tabaci (de Barro and Ahmed, 2012)
and these lineages have differential roles in disease transmission to various crops
showing the correlation between vector genotypes and their capacity to transmit
disease pathogens (Legg et al., 2002; Chowda-Reddy et al., 2012; Fansiri et al., 2013).
It is previously reported that some of the thrips species have subspecies (Brunner et
al., 2004; Glover et al., 2010; Karimi et al., 2010). In present studies examination of
sequence diversity in the mitochondrial COI gene has been used for understanding the
genetic relationships in these complexes.
The barcode data in BOLD has been organized in Barcode Index Numbers
(BINs) (Ratnasingham and Hebert, 2013). The BIN system contains the overall
information about the indexing, storage, and retrieval of the OTUs (Operational
taxonomic units). The BIN system is based on the analysis of patterns of nucleotide
variation in the barcode region of the cytochrome c oxidase I (COI) gene. It is
persistant taxonomic registry at species-level for the animal kingdom. BINs have
aided retrospect taxonomy by flagging possible cases of synonymy and also by
Chapter 4 DNA Barcoding
47
comparing geographical information, descriptive metadata, and images for specimens
that are likely to belong to the same species, even if it is undescribed.
The development of BIN system (Ratnasingham and Hebert, 2013) has
provided a mechanism to organize animal barcode sequences as studies have shown
that most morphological species and BINs are congruent (Zahiri et al., 2014). The
BINs have been used as a species-level taxonomic registry for various animal groups
(Hausmann et al., 2013) and have aided the discovery of new species (Landry and
Hebert, 2013; Mutanan et al., 2013; Ashfaq et al., 2014a). BINs also play a pragmatic
role in biodiversity as most animal species anticipate a description (Trontelj and Fiser,
2009) and many described taxa in actual represent a complex of species (Bickford et
al., 2007). BIN system allows the examination of many issues that require species
level identifications. It also provides the powerful tool to assess local biodiversity
(Young et al., 2012). BIN analysis permits examination of species turnover in space
and time (Carr et al., 2011).
4.1.2.2 DNA barcoding in thrips species identification
Thrips are mainly identified on morphological basis but molecular approaches
have been advanced in respect to the identification of species in the different genera
of thrips (Brunner et al., 2002). Mitochondrial COI has been considered a suitable
marker for thrips identification as it exhibits reliable inter-species variations
(Savolainen et al., 2005) as compared to other markers (Frey and Frey, 2004; Asokan
et al., 2007; Zhang et al., 2011). Kadirvel et al. (2013) found the partial cytochrome
oxidase I (COI) sequences very useful to identify and classify unknown thrips.
According to Timm et al. (2008) mitochondrial cytochrome oxidase I (mtCOI) gene
sequence analysis is a rapid, accurate, and simple means of identifying the thrips
species present in southern Africa. Glover et al. (2010) found varying degrees of
discrimination of thrips species while compared five different loci and among them
COI provided sufficient variation to be used for future DNA barcoding studies of
thrips. Reference libraries are needed for thrips identification based on the molecular
data but more research studies on biology of thrips have been focused on the pest
thrips species. Most studies are done on crop pests and tospovirus vector species of
thrips (Persley et al., 2010). During the past 30 years the one third of total
Chapter 4 DNA Barcoding
48
publications on Thysanoptera has addressed F. occidentalis (Western flower thrips)
(Reitz, 2009).
A rapid increase in global trade warrants the development of a more universal
and anticipatory system to identify the unfamiliar taxa invading a country’s borders.
Invasive species could reduce the local biodiversity and also affect the economy by
damaging crops (Vitousek et al., 1996). Accurate species identification is critical for
controlling arthropod pests (Rosen, 1986; Davies et al., 2004; Armstrong and Ball,
2005), since misidentification of a pest may lead to the use of improper control
measures resulting in the loss of time, money and effort (Rosen, 1986).
4.1.3 Objective of the current study
Current study was aimed at
1) DNA barcode-based identification and analysis of thrips from Pakistan.
2) Development of a regional barcode reference library for Thysanoptera.
3) Analysis of thrips diversity and cryptic species complexes.
4.2 MATERIALS AND METHODS
4.2.1 Collection of insects and storage
Thrips were collected and preserved for further investigation using the method
described in sec. 2.1.
4.2.2 Database
Data was organized in Excel by adding information on sample ID, specimen
field number, museum voucher catalog number, taxonomic identification, identifier’s
name and email, voucher type, extra information, life stage of specimen, date of
collection, continent, country, province, district, location and GPS coordinates and
submitted to the Barcode of Life Data Systems (BOLD) under the project, MATHR
Chapter 4 DNA Barcoding
49
"Thrips Species of Pakistan". Each specimen was photographed using a camera fitted
stereo microscope and the images were uploaded to BOLD (Fig. 4.1).
4.2.3 Plate arrays
Thrips specimens were placed in 96 well plate, one specimen per well, in accordance
with the data and images upload in BOLD system.
4.2.4 DNA extraction
DNA isolation was carried out at the Canadian Centre for DNA Barcoding
(CCDB) within the Biodiversity Institute of Ontario following protocols described in
Porco et al. (2010). Vouchers were recovered for slide preparation and morphological
analysis.
4.2.5 DNA polymerase chain reaction (PCR)
Amplification of the 658 bp of the COI-5ʹ barcode region was performed with
the primers C_LepFolF and C_LepFolR. PCR profile followed was; 94°C (1 min), 5
cycles of denaturation at 94°C (40 s), annealing at 45°C (40 s), extention at 72°C (1
min); 35 cycles of denaturation at 94°C (40 s), annealing at 51°C (40 s), extention at
72°C (1 min) and final extension of 72°C (5 min). These primers are the mixtures of
LepF1 (ATTCAACCAATCATAAAGATATTGG)/LCO1490 (GGTCAACAAATCA
TAAAGATATTGG) and LepR1 (TAAACTTCTGGATGTCCAAAAAATCA)/
HCO2198 (TAAACTTCAGGGTGACCAAAAAATCA), respectively. Amplification
of 439 bp of COI-3ʹ was performed with primer pair C1-J-1751
(GGATCACCTGATATAGCATTYCC)/C1-N-2191 (CCCGGTAAAATTAAAATA
TAAACTTC) under the PCR conditions outlined above. PCRs were carried out in
12.5 µL reactions containing standard PCR ingredients and 2 µL of DNA template.
PCR products were analyzed on 2% agarose E-gel® 96 system (Invitrogen Inc.).
BigDye Terminator Cycle Sequencing Kit (v3.1) (Applied Biosystems) on an Applied
Biosystems 3730XL DNA Analyzer was used to sequence the amplicons
bidirectionally. CodonCode Aligner (CodonCode Corporation, USA) was used to
assemble, align and edit the forward and reverse sequences and the sequences were
submitted to BOLD. Sequences were also inspected and translated in MEGA V5 to
Chapter 4 DNA Barcoding
50
verify that they were free of stop codons. All sequences generated in this study are
accessible on BOLD under the project MATHR.
4.2.6 Morphological identification
Specimen carcasses were retrieved after the genomic DNA extractions from
intact specimens (Rugman-Jones et al., 2010) and were mounted onto the slides using
Hoyer’s medium. Standardized morphological keys for thrips were used for species
level identification. Morphological characters were studied using a compound
microscope (Olympus BX 41) under magnifications, 40X, 100X and 400X. Voucher
specimens were verified by Mr. Stan Diffie, University of Georgia, Tifton campus,
USA and Sueo Nakahara, USDA ARS, Beltsville, MD., USA.
4.2.7 Data analysis
4.2.7.1 Species discrimination using DNA barcodes
Sequence similarities between the sequences from each species generated in
this study and those available in the GenBank were determined by nBLAST
(http://www.ncbi.nlm.nih.gov/blast/). Further, barcode sequence from each specimen
was compared with those on BOLD using the ‘Identification Request’ function. Prior
studies have revealed that most different species of thrips show 2% sequence
divergence at COI (Hebert et al., 2003b), and researchers have used a 2% distance
threshold for species delimitation (Strutzenberger et al., 2011). The BOLD follows
Barcode Index Number (BIN) system (Ratnasingham and Hebert, 2013) to organize
the barcode data for records into operational taxonomic units (OTUs) which are
lacking a formal taxonomic assignment. Different BINs have assigned to the
specimens belong to different species. All thrips sequences in this study were
assigned to a BIN.
4.2.7.2 Genetic diversity and phylogenetic analysis
MEGA 5 (Tamura et al., 2011) was used to perform the ClustalW nucleotide
sequence alignments (Thompson et al., 1994) and NJ clustering analysis. The Kimura-
2-Parameter (K2P) (Kimura, 1980) distance model along with pairwise deletion of
Chapter 4 DNA Barcoding
51
missing sites, with nodal support estimated using 500 bootstrap replicates was used.
The online version of Automatic Barcode Gap Discovery (ABGD) was used for
pairwise distance analysis and to generate distance histograms and distance ranks
(Puillandre et al., 2012). As a test of the reliability for species discrimination,
presence or absence of a ‘barcode gap’ (Meyer and Paulay, 2005) was determined for
each species. The ‘Barcode Gap Analysis’ (BGA) was performed using BOLD. Using
the barcode gap criterion, a species is distinct from its nearest neighbor (NN) if its
maximum intraspecific distance is less than the distance to its NN sequence
(Ratnasingham and Hebert, 2007).
Because the morphological species were represented by variable number of
sequences, a consensus sequence for each BIN or species was obtained using the
‘Consensus Barcode Generator’ function of TaxonDNA. Consensus sequences were
used in Bayesian inference (BI) analysis and BI trees were obtained using MrBayes
v3.2.0 and the Markov Chain Monte Carlo (MCMC) technique. The data was
partitioned in two ways; i) a single partition with parameters estimated across all
codon positions, ii) a codon-partition in which each codon position was allowed
different parameter estimates. The analyses were run for one million generations with
sampling every 1,000 generations. Bayesian posterior probabilities were calculated
from the sample points once the MCMC algorithm began to converge. The trees
generated through this process were visualized using FigTree v1.4.0. Rhopalosiphum
padi (HQ979401) was used as outgroup.
4.2.8 Scanning Electron Microscopy (SEM)
For verification of barcode-identified cryptic vector thrips species, SEM
analysis was performed to identify subtle morphological differences found in these
cryptic species. Individual thrips from two cryptic thrips species (T. palmi and T.
tabaci) were placed on double sticky carbon tabs attached to aluminum stubs under
the light microscope and placed in a vacuum desiccator overnight to remove any
residual moisture. The samples were sputter coated with gold prior to viewing with
the FEI Quanta 200F SEM.
Chapter 4 DNA Barcoding
52
4.2.9 Haplotype and distribution analysis
Barcode sequences of important tospovirus vectors (S. dorsalis, T. tabaci, T.
palmi and T. flavus) from Pakistan, combined with published records from other
countries were ClustalW aligned in MEGA5 and exported as MEGA files. For this
analysis each morphological species was treated as one taxon regardless of the
number of lineages/BINs in its barcode sequences. Haplotypes for each species were
generated using sequence polymorphism software (DnaSP 5.10) (Librado and Rozas,
2009). For Analysis of molecular variance (AMOVA), the genetic structure of
haplotypes data derived from DnaSP 5.10 saved as Arlequin output file was used.
AMOVA was performed to estimate the genetic structure of different barcode
haplotypes of each thrips species using Arlequin v.3.5 (Excoffier and Lischer, 2010).
For each species, a minimum spanning tree (MST) based on the number of nucleotide
differences between haplotypes was constructed from Arlequin. Arlequin output data
file (minimum spanning tree) of haplotypes was used for the construction of
haplotypes tree using software HapStar Version 0.5 (C) (Teacher and Griffiths, 2011)
to visualize the network of interrelationships between the haplotypes.
4.3 RESULTS
4.3.1 DNA barcode analysis of thrips species
Barcode sequences greater than 500 base pairs (bp) were recovered from 471
of the 504 specimens (93%), providing at least one sequence for each of the identified
species/ genera from three families. The K2P sequence divergence among the 33
thrips species with >2 specimens, among the 5 genera with two or more species and
among the 2 families with two or more genera are shown in Table 4.1. The intra- and
interspecific distances ranged from 0-7.56% and 5.64-27.08%. The nearest-neighbor
(NN) distances for all the species were more than 5% (Table 4.1). Intraspecific
distances could not be determined for 17 species with only a single representative.
Sequence divergence increased with the taxonomic rank (Table 4.1, Fig. 4.2) with a
little overlap between conspecific and congeneric distances. The distances within
families ranged from 6.55 to 35.57% with a mean of 22.67%.
Chapter 4 DNA Barcoding
53
Barcode Gap analysis showed that both the maximum and mean distances to the NN
were higher than the respective intra-specific distances for all the species (Fig. 4.2).
The ABGD was used to generate distance (K2P) histograms and distance ranks (Fig.
4.3). The analyses revealed a clear gap between intraspecific and interspecific
distances (Fig. 4.3b). The analysis further showed 51 groups with initial partition,
while 56 groups with recursive partition, which were in congruence with the BINs on
BOLD.
The BIN system assigned the 471 sequences to 55 BINs. Morphological
identifications and BINs were congruent for 39 species while conspecific sequences
from A. intermedius, H. reuteri and T. palmi were assigned to two BINs. All of the 55
BINs were a single species at the 2% threshold with the largest pairwise intra-specific
distance being 1.67%, except for T. flavus (2.7%), and T. tabaci (3.7%).
The Barcode Index Numbers (BINs) and maximum intra-specific distances for
thrips species from Pakistan and other countries are shown in Table 4.2. Sequence
comparison of thrips from this study with those on BOLD and GenBank revealed
close sequence matches (<2% divergence) for only eight species in this study.
NJ clustering analysis showed that each of the 55 BINs formed a
monophyletic cluster (Fig. 4.4). Although all the barcodes from T. tabaci were
assigned to one BIN, the NJ analysis showed two deeply divergent clusters for this
species. The Bayesian analysis supported the results from the NJ analysis clusters and
showed the lineages determined by the BIN system and NJ clustering were
monophyletic. Further, the species from the Tubulifera and Terebrantia were grouped
in the tree with their respective suborders (Fig. 4.5).
DNA barcoding showed that T. palmi and T. tabaci each comprised of two
deeply divergent lineages. The barcode sequences from these species in the published
databases are limited and do not provide a complete identity analysis. COI-3ʹ gene
fragments from both the species were sequenced for identity analysis based on this
region which has been frequently used for thrips analysis and has a comparatively
larger number of published sequences. NJ clustering analysis of COI-3ʹ from T. palmi
revealed two divergent (K2P, 8.4%) lineages; one showed 100% nucleotide identity
with T. palmi from India (EF117830) while the other with that from Dominican
Republic (FN546137) (Fig. 4.6a). Similarly, COI-3ʹ from T. tabaci, showed the
presence of two lineages (K2P, 4.1%); one showed 99% nucleotide identity with T.
Chapter 4 DNA Barcoding
54
tabaci from the United Kingdom (FN546168) while the other with that from Israel
(FN546150) (Fig. 4.6b).
4.3.2 Morphological identification
Morphological characters indicated the presence of 42 thrips species in the
collection (Table 4.2). Five species were identified only to their genera, including two
from Thrips, two from Aeolothrips and one from Haplothrips. Five more were
identified only to the family. Pictures of the barcoded thrips species with their BOLD
ID are presented in fig. 4.1.
Chapter 4 DNA Barcoding
55
Table 4.1: Percentage K2P sequence divergence at the COI barcode region among the
33 thrips species with >2 specimens, among the 5 genera with two or more species
and among the 2 families with two or more genera
Distance class n Taxa Comparisons Min (%) Mean (%)
Max (%)
Intraspecific 426 33 8747 0 0.59
7.56
Congeners 362 5 22197 5.64 18.98
27.08
Confamilial 424 2 28324 6.55 22.71
35.57
Chapter 4 DNA Barcoding
56
Table 4.2: Barcode Index Numbers (BINs) and maximum intraspecific distances for
thrips species from Pakistan and other countries.
Max intraspecific
distribution
(individuals) %
Family Species BIN Pakistan Combin
ed
Countries with
matches Aeolothripidae Aeolothrips intermedius AAU0572 0.2(3) ----- -----
Aeolothripidae Aeolothrips intermedius AAZ8618 0.8(10) ----- -----
Aeolothripidae Aeolothrips spp. PK02 AAZ8619 0.2(3) ----- -----
Aeolothripidae Aeolothrips spp. PK01 AAN6626* --- ----- -----
Thripidae Anaphothrips
sudanensis AAV3388* --- ----- -----
Phlaeothripidae Ananthakrishnana
euphorbiae ACA2783* --- ----- -----
Phlaeothripidae Apterygothrips
pellucidus AAY6328 0.0(2) ----- -----
Thripidae Arorathrips mexicanus AAN5064 0.2(2) ----- -----
Thripidae Chaetenaphothrips
orchidii AAP7685 0.6(4) ----- -----
Thripidae Chirothrips
meridionalis AAN5797 0.0(3) 0.8(7) Croatia
Thripidae Dendrothripoides
innoxius AAN5065 0.2(8) ----- -----
Thripidae Frankliniella schultzei AAN6620 0.5(24) 0.5(30) Australia, India, Kenya
Phlaeothripidae Haplothrips andresi AAN5799 0.2(7) ----- -----
Phlaeothripidae Haplothrips bagrolis AAZ8515* --- ----- -----
Phlaeothripidae Haplothrips ciliatus AAU5460 0.5(5) ----- -----
Phlaeothripidae Haplothrips
ganglbaueri ACF1370 0.0(39) ----- -----
Phlaeothripidae Haplothrips gowdeyi AAN5798* --- ----- -----
Phlaeothripidae Haplothrips reuteri ACA2784 0.6(7) ----- -----
Phlaeothripidae Haplothrips reuteri AAI6863* --- ----- -----
Phlaeothripidae Haplothrips spp. PK01 ACA2828* --- ----- -----
Phlaeothripidae Haplothrips stylatus AAU6351* --- ----- -----
Phlaeothripidae Haplothrips tenuipennis AAN4488 2.3(25) ----- -----
Thripidae Hydatothrips atactus AAN9110* --- ----- -----
Thripidae Lefroyothrips lefroyi ACI6048* --- ----- China, India (sequences
not public)
Phlaeothripidae Liothrips infrequens ACA2829* --- ----- -----
Thripidae Megalurothrips
pecularis AAN6623 0.3(10) 0.7(20) China
Thripidae Megalarothrips usitatus AAM8053 1.1(5) 1.7(11) Australia, India
Thripidae Microcephalothrips
abdominalis AAI0410 0.3(15) 1.4(27) Australia, United States,
Canada, China Thripidae Mycterothrips
nilgiriensis ACA2806* --- ----- -----
Thripidae Neohydatothrips
samayunkur AAP7680 0.2(7) 0.2(10) South Africa
Phlaeothripidae Plicothrips apicalis AAN6622 0.3(4) ----- -----
Thripidae Pseudodentothrips
bhattii ACG8261* --- ----- -----
Thripidae Scirtothrips dorsalis AAC9748 1.7(10) 3.2(48) China, India, Japan,
Thailand, United States Thripidae Scritothrips AAZ8518* --- ----- -----
Chapter 4 DNA Barcoding
57
oligochaetus
Thripidae Scolothrips
rhagebianus AAZ8517* --- ----- -----
Thripidae Taeniothrips major AAN6621 0.2(4) ----- -----
Thripidae Thrips alatus AAN6625 0.0(2) ----- -----
Thripidae Thrips apicatus AAY6262 0.2(5) --- -----
Thripidae Thrips carthami AAP7682 0.5(7) --- ----
Thripidae Thrips coloratus AAK1804 0.5(15) --- -----
Thripidae Thrips decens AAP7679* --- ----- -----
Thripidae Thrips flavus AAN6624 2.7
(105)
2.7
(113)
China
Thripidae Thrips florum AAP7683 0.2(2) ----- -----
Thripidae Thrips hawaiiensis AAZ8516 0.0(2) 1.3(10) China, India
Thripidae Thrips palmi AAE7913 0.3(8) 2.0(46) China, India, Japan,
Thailand, Dominican
Republic, United Kingdom Thripidae Thrips palmi AAN2747 0.3(38) 1.6(145) India
Thripidae Thrips tabaci AAB3870 3.7(38) 6.5(211) New Zealand, Australia,
Canada, China, Norway,
United States, Tanzania,
Madagascar, Serbia, Japan,
United Kingdom, Bosnia
and Herzegovina,
Israel, Germany, Peru,
India, South Africa Thripidae Thrips trehernei AAN9105 0.0(4) 2.4(106) Canada, China, Iran,
United Kingdom, Croatia,
Germany
Thripidae Thrips spp. PK01 AAN9111 2.2(7) --- -----
Thripidae Thrips spp. PK02 AAP7684* --- ----- -----
Phlaeothripidae --- ACA9557* --- ----- -----
Phlaeothripidae ---- ACK3864 0.2(6) ----- -----
Thripidae ---- AAP7681 0.4(5) ----- -----
Thripidae --- ACA3048 0.0(3) ----- -----
Thripidae --- ACP4916* --- ----- -----
(*) species have single representative sequences so no intraspecific distance could be
determined
Chapter 4 DNA Barcoding
58
Figure 4.1: A) Pictures of thrips species (Terebrantia) from Pakistan on BOLD.
Chapter 4 DNA Barcoding
59
Chapter 4 DNA Barcoding
60
Chapter 4 DNA Barcoding
61
Chapter 4 DNA Barcoding
62
Figure 4.1: B) Pictures of thrips species (Tubulifera) from Pakistan on BOLD.
Chapter 4 DNA Barcoding
63
Chapter 4 DNA Barcoding
64
a)
b)
0
5
10
15
20
25
30
0 2 4 6 8 10 12 14
Max. intraspecific dist. (%)
Dis
tance
to N
N
0
5
10
15
20
25
30
0 2 4 6 8 10 12 14
Mean intraspecific dist.(%)
Dis
tance
to N
N
Chapter 4 DNA Barcoding
65
c)
d)
Figure 4.2: Barcode gap analysis (BGA) of thrips species from Pakistan by Bold.
a) Maximum intraspecifid dististance of thrips species versus nearest neighbor
distances b) Mean intraspecific distance of thrips species versus nearest neighbor
distances c) Number of individuals per thrips species verses max. intra-specific
distance and d) frequency histogram of distance to nearest neighbour.
Chapter 4 DNA Barcoding
66
a) Histogram of distances
b) Ranked distances
Figure 4.3: Pairwise distance analysis of thrips species from Pakistan generated
by Automatic Barcode Gap Discovery (ABGD).
Chapter 4 DNA Barcoding
67
Thrips flavus
Thrips carthami shamsher
Thrips trehernei
Thrips coloratus
Thrips hawaiiensis Thrips apicatus
Microcephalothrips abdominalis
Mycterothrips nilgiriensis Thrips decens
Thrips alatus Thrips PK02
Thrips florum
Thrips palmi (AAE7913)
Thrips palmi (AAN2747)
Thripidae2 (AAP7681) Thripidae1 (ACA3048)
Thrips tabaci (AAB3870)
Thrips tabaci (AAB3870)
Lefroyothrips lefroyi Thrips PK01
Chirothrips meridionalis
Neohydatothrips samayunkur Pseudodendrothrips bhattii
Taeniothrips major
Megalurothrips pecularis
Megalurothrips usitatus Scolothrips rhagebianus
Hydatothrips atactus
Dendrothripoides innoxius
Scirtothrips oligochaetus
Scirtothrips dorsalis
Frankliniella schultzei
Anaphothrips sudanensis Thripidae3 (ACP4916)
Chaetanaphothrips orchidii Aeolothrips PK01
Aeolothrips PK02 Aeolothrips intermedius (AAU0572)
Aeolothrips intermedius (AAZ8618)
Arorathrips mexicanus Phlaeothripidae1 (ACK3864)
Plicothrips apicalis
Apterygothrips pellucidus Haplothrips bagrolis
Haplothrips stylatus Haplothrips reuteri (ACA2784)
Haplothrips reuteri (AAI6863) Haplothrips andresi Haplothrips gowdeyi
Phlaeothripidae2 (ACA9557)
Haplothrips tenuipennis
Liothrips infrequens Ananthakrishnana euphorbiae
Haplothrips PK01 Haplothrips ciliatus
Haplothrips ganglbaueri
Rhopalosiphum padi (HQ979401: outgroup)
99
99 99
99
99
99
99
99
99
99
99
99
99
51
59
81
66
86
50
86
99
99
99
99
99
99
99
99
99
99
99
99
99
99
99
99
99
83
99
99
99
99
99
99
99
96
99
99
99
99
99
99
69
99
84
54
52
99
0.05
Chapter 4 DNA Barcoding
68
Figure 4.4: NJ tree based on COI sequence (with 500 boot strap value)
constructed with the Kimura two-parameter model
Taxa are labeled with the BIN numbers. Bootstrap support ≥ 50% is indicated at
branches. The node for each species with multiple specimens was collapsed to a
vertical line or triangle, with the horizontal depth indicating the level of intraspecific
divergence. Number of individuals analysed are shown in brackets next to each
species name. COI barcode sequences (658bp) of species Rhopalosiphum padi
(HQ979401), order Hemiptera was used as the out group. Morphological
identifications of thrips species used in Cluster analysis and Bayesian analysis are
given in Table 4.2.
Chapter 4 DNA Barcoding
69
Figure 4.5: Barcode-based phylogenetic analysis for thrips using Bayesian
inference
Probability values and species names are indicated at branches. COI barcode
sequences (658bp) of species Rhopalosiphum padi (HQ979401), order Hemiptera was
used as the out group.
Chapter 4 DNA Barcoding
70
a)
b)
Figure 4.6: Cluster and distance analysis of 3’COI region of cryptic thrips vector
species (Thrips palmi and T.tabaci). Two letters country code provided with each
accession number used in this analysis. a) NJ tree of T. palmi b) NJ tree of T. tabaci
Chapter 4 DNA Barcoding
71
4.3.3 SEM of cryptic thrips vector species
SEM analysis did not reveal any unique morphological characters among
specimens from T. palmi or T. tabaci while detailed study was done for each species
including antennal segments with sensorium, pronotum, mesonotum and metanotum
characteristics (Fig. 4.7).
a)
b)
Figure 4.7: Scanning Electron Micrographs of cryptic thrips vector species
a) Scanning Electron Micrographs of T. palmi b) Scanning Electron Micrographs of
T. tabaci
Chapter 4 DNA Barcoding
72
4.3.4 Global haplotype diversity
COI-5ʹ sequences of four thrips vector species (T. tabaci, T. palmi, T. flavus,
S. dorsalis) were combined with those from GenBank to construct the haplotype
networks (Fig. 4.8). Sequences for the other species were either too few to generate a
network or they lacked matches from COI-5ʹ region for the haplotype networks.
For T. tabaci, 36 sequences from this study combined with 115 from GenBank
from four partitioned geographic regions (Asia, Europe, Australia and America) were
analysed for number of haplotypes. Sequence polymorphism software (DnaSP 5.10)
revealed 15 T. tabaci haplotypes with haplotypes diversity 0.740 ± 0.030 and 14
polymorphic sites (SNPs). Significance of variance analysis of the genetic structure of
T. tabaci haplotypes among these geographic regions (Table 4.3a) revealed the T.
tabaci populations from different geographic regions of the world showed similar
level of genetic variability regardless of their different geographic regions (-0.01889
% population variance). Population variations among populations within geographic
regions and within populations were 47.35 % and 54.06 %, respectively and these
variations were significant. Haplotypes tree demonstrated that these haplotypes were
clustered into three groups connected through haplotype from United Kingdom
(Figure 4.8a). The most common haplotype (n = 70) was found in nine countries
including Pakistan. Moreover the tree showed a link between haplotypes and
geographic region for some haplotypes. Three low frequency haplotypes were found
and restricted to Pakistan.
The sequences from the 132 T. palmi specimens from four partitioned
geographic regions (East Asia, South Asia, Southeast Asia and Europe) containing 47
sequences from this study combined with 85 from GenBank were analysed. Sequence
polymorphism analysis revealed 16 T. palmi haplotype groups with haplotypes
diversity 0.664 ± 0.028. Moreover there were 43 polymorphic sites (SNPs) among
these haplotypes. For AMOVA the genetic structure of haplotypes data were
partitioned into four groups on the basis of geographic locations; East Asia, South
Asia, Southeast Asia and Europe. AMOVA analysis (Table 4.3b) revealed that the T.
palmi populations from different geographic regions of the world did not show similar
level of genetic variability (9.75607% population variance). While the variations
among populations within geographic regions and within populations were 4.04 %
Chapter 4 DNA Barcoding
73
and 16.17 %, respectively and these variations were significant. According to
haplotypes tree (Fig. 4.8b) 16 haplotypes were clustered into two groups connected
through missing haplotype data. Out of 16 haplotypes 9 haplotypes were found in
India with 7 haplotypes restricted to India and two haplotypes shared between India
and Pakistan (Fig. 6b). The network showed the haplotypes were clustered into two
groups with records from Pakistan found in both. Pakistan showed 5 haplotypes of T.
palmi out of which two haplotypes restricted to Pakistan.
The sequences from 41 S. dorsalis specimens from four partitioned geographic
regions (East Asia, South Asia, Southeast Asia and North America) containing 10
sequences from our collection combined with 31 from GenBank were analysed.
Sequence polymorphism analysis revealed 23 S. dorsalis haplotype groups with
haplotypes diversity 0.905 ± 0.034. Moreover there were 32 polymorphic sites (SNPs)
among these haplotypes. For AMOVA the genetic structure of haplotypes data were
partitioned into four groups on the basis of geographic locations; East Asia, South
Asia, Southeast Asia and North America. AMOVA analysis (Table 4.3c) revealed that
the S. dorsalis populations from different geographic regions of the world did not
show similar level of genetic variability (0.21799% population variance). While the
population variations among populations within geographic regions and within
populations were 10.72 % and 77.68 %, respectively but these variations were not
significant. Haplotype tree (Fig. 4.8c) demonstrates that the 23 haplotypes were
clustered into three groups connected through haplotype 8. 21 haplotypes were low
frequency haplotypes represented by only one or two sequence of S. dorsalis. While
13 haplotypes of these were confind to India. 6 haplotypes of S. dorsalis were found
in Pakistan out of which 4 were limited to Pakistan (Fig. 6c).
For T. flavus, 111 sequences from GenBank containing 103 sequences from
Pakistan and merely eight sequences were available in GenBank were analysed for
number of haplotypes. Polymorphism analysis revealed 15 T. flavus haplotype groups
with haplotypes diversity 0.356 ± 0.059 and 23 polymorphic sites (SNPs). Population
variations among populations within geographic regions and within populations were
77.48 % and 22.52%, respectively (Table 4.3d) and these variations were significant.
Haplotype tree demonstrated that the 15 haplotypes were clustered into three groups
connected through haplotype from United Kingdom (Figure 4.8d). 13 T. flavus
haplotypes were of low frequency records only with 1-3 T. flavus sequences 5 of
Chapter 4 DNA Barcoding
74
which were restricted to China and rest were limited to Pakistan. Only one haplotype
population was shared between Pakistan and China. One T. flavus haplotype confined
to Pakistan was of very high frequency showed by 89 T. flavus sequences from the
country.
Chapter 4 DNA Barcoding
75
Table 4.3a: Comparisons between geographic region (Asia, Europe, Australia and
America) by AMOVA using COI gene sequences of T. tabaci
Model
Hierarchical
levels
Degree
of
freedom
Sum of
square
Variance
components
Fixation
indices
Percentage
of
variation
P-value
Geograph-
ical
regions
Among
Groups
3
31.095
-0.01889
-0.01408FCT
11.60
0.21799
Among
Populations
Within
Groups
12
59.652
0.63518
0.46689FSC
47.35
0.00000
Within
Populations
136
98.635
0.72526
0.45939FST
54.06
0.00000
Total
151
189.382
1.34154
Table 4.3b: Comparisons between geographic region (East Asia, South Asia,
Southeast Asia and Europe) by AMOVA using COI gene sequences of T. palmi
Model
Hierarchical
levels
Degree
of
freedom
Sum of
square
Variance
components
Fixation
indices
Percentage
of
variation
P-value
Geograph-
ical
regions
Among
Groups
3
196.624
9.75607
0.79787FCT
79.79
0.02346
Among
Populations
Within
Groups
3
36.645
0.49445
0.20005FSC
4.04
0.00000
Within
Populations
133
262.967
1.97719
0.83830FST
16.17
0.00000
Total
139
496.236
12.22771
Chapter 4 DNA Barcoding
76
Table 4.3c: Comparisons between geographic region (East Asia, South Asia,
Southeast Asia and North America) by AMOVA using COI gene sequences of S.
dorsalis
Model
Hierarchical
levels
Degree
of
freedom
Sum of
square
Variance
components
Fixation
indices
Percentage
of
variation
P-value
Geograph-
ical
regions
Among
Groups
3
11.013
0.25409
0.11596FCT
11.60
0.21799
Among
Populations
Within
Groups
2
6.995
0.23490
0.12126FSC
10.72
0.19746
Within
Populations
37
62.981
1.70218
0.22316FST
77.68
0.00293
Total
42
80.989
2.19117
Table 4.3d: Comparisons between geographic region (East Asia and South Asia) by
AMOVA using COI gene sequences of T. flavus
Model
Hierarchical
levels
Degree
of
freedom
Sum of
square
Variance
components
Fixation
indices
Percentage
of
variation
P-value
Geograph-
ical
regions
Among
Populations
1
57.942
3.82773
-----
77.48
0.00000
Within
Populations
109
121.233
1.11223
0.77485FST
22.52
0.00000
Total
110
179.175
4.93996
Chapter 4 DNA Barcoding
77
Chapter 4 DNA Barcoding
78
Figure 4.8: Barcode haplotype network analysis of four major thrips vector
species from Pakistan and its comparison with globally reported thrips species.
Circles in haplotype tree show standard haplotypes with branch lengths that are
representative of connection distance. DNA barcoded sequences frequency of each
haplotype is indicated inside circle. Haplotype networks were generated using
minimum spanning network (MSN) values using Kimura 2P model with 1000
permutations. a) Thrips tabaci global haplotype network, b) Thrips palmi global
haplotype network, c) Scritothrips dorsalis global haplotype network and d) Thrips
flavus global haplotype network.
Supplementary Table 1: Process ID of sequences, Haplotype ID, Country of origin
and codes used for each accession in the haplotype analysis.
Chapter 4 DNA Barcoding
79
4.4 DISCUSSION
Molecular identification keys have been successfully used for species
determination (Mainali et al., 2008). A major limitation for using molecular
approaches for identification is the limited proportion of reference taxa that is
available. Using molecular identification techniques, incorrect identification of a
particular species could be possible if there is no representative species found in
reference database (Virgilio et al., 2010). In our study, 24 % of thrips species from
our collection were successfully identified based on the COI sequences data.
The effectiveness of DNA barcoding has facilitated development of DNA
barcode reference libraries for several animal groups (Guralnick and Hill, 2009;
Janzen et al., 2009; Zhou et al., 2011; Webb et al., 2012). For example non-biting
midges (Diptera: Chironomidae) could not be identified, even to their correct genus, if
well-matching COI sequence were not already available in the library (Ekrem et al.,
2007). Lee et al. (2011) used COI barcodes to identify the Aphid species from the
Korean Peninsula. These reference libraries aid in the documentation of biodiversity
(Janzen et al., 2005; Naro-Maciel et al., 2010) including endangered species (Elmeer
et al., 2012; Vanhaecke et al., 2012), to disclose endemism (Bossuyt et al., 2004;
Quilang et al., 2011; Sourakov and Zakharov, 2011; Ashfaq et al., 2013) and to
identify the unknow thrips species (Karimi et al., 2010; Kadrival et al., 2013).
The 471 barcode sequences in our study were assigned to 55 unique BINs
which signal the presence of a similar number of species in our collection. We were
able to identify 42 species by morphology and the identitification of the rest of the
specimens could not be validated. Additionally, 39 morphologically identified species
were congruent with the BINs.
Based on cluster analysis, all the morphologically identified species
considered in the current study formed distinct clades. Bayesian analysis further
supported the NJ analysis and the BINs. Results from Bayesian analysis and cluster
analysis in this study are in agreement with those from Crespi (1996) and Mound and
Morris (2007) that stated Frankliniella and Thrips species are associated by molecular
phylogenetic analysis of 18S rDNA using maximum parsimony (MP) and maximum
likelihood (ML) analysis. In present analysis species from genus Thrips did not
constitute a single cluster of closely related species.
Chapter 4 DNA Barcoding
80
DNA barcoding is known to resolve cryptic species complexes (Hebert et al.,
2004; Burns et al., 2007; Park et al., 2011; Deng et al., 2012; Ashfaq et al., 2014a)
and aid ecological studies (Valentini et al., 2009; Pramual and Kuvangkadilok, 2012;
Ashfaq et al., 2014b). For example, DNA barcodes revealed the cryptic species of
sphingid moths (Vaglia et al., 2008), while Nieukerken et al. (2012) discriminated
cryptic species of leaf-mining Lepidoptera. Likewise, sibling species of Aphis
gossypii was also discriminated using DNA barcodes (Carletto et al., 2009). In the
current study DNA barcodes revealed that A. intermedius, H. reuteri, T. palmi and T.
tabaci may be species complexes in Pakistan.
The gap between maximum intraspecific and minimum interspecific distances
has been used for species delimitation in various animal groups (Hebert et al., 2004;
Meyer and Paulay, 2005; Meier et al., 2006, 2008; Puillandre et al., 2012). Although
barcode gap analysis showed the intra-specific distances within the populations of A.
intermedius, H. reuteri, T. palmi, and T. tabaci were higher but the maximum
divergence was lower than the NN distance. This enabled the separation of all the
species including the most closely related species. Kadrival et al. (2013) has
suggested the S. dorsalis, T. palmi and T. tabaci may be cryptic species with intra-
specific distances ranging from 1 to 19%. Presence of cryptic species in T. tabaci
(Brunner et al., 2004) and S. dorsalis (Hoddle et al., 2008; Dickey et al., 2012) has
been previously reported. Karimi et al. (2010) has suggested that based on COI
sequences T. palmi falls into two clades. The intra-specific variations between A.
intermedius (3.61%) H. reuteri (3.68%), S. dorsalis (3.46%), T. flavus (4.58%), T.
palmi (7.47%) and T. tabaci (5.62%) suggest these species are complexes of multiple
lineages. Further comparisons of the COI-3' sequences from T. palmi and T. tabaci
with those retrieved from GenBank showed that the two clusters corresponded to each
thrips species from different locations. Morphological identifications of T. tabaci and
T. palmi based on the slide-mounted identification of voucher carcasses by running
the standard taxonomic keys and detailed study by scanning electron microscopy
showed these species lacked any unique visible morphological characters. Further
studies are needed to reveal the possibility of reproductive isolation of these species,
similar to the information available for F. occidentalis (Rugman-Jones et al., 2010).
Analysis of sequence diversity in COI-5' revealed that 15 haplotypes of T.
tabaci have been reported in the world until now. Diversity analysis also revealed the
Chapter 4 DNA Barcoding
81
presence of five haplotypes complex of T. tabaci in Pakistan and out of these three
haplotypes was restricted to Pakistan only. Pakistan shared one T. tabaci haplotype
with China, Canada, Australia, India, Madagascar, USA, UK, Norway and that there
may be possibility that the two Pakistani T. tabaci haplotypes originated from this
ancestor haplotype. Other T. tabaci haplotype shared with Serbia, Japan, Norway,
USA, Bosnia, Australia, and China. The one other most commonly found T. tabaci
lineage was shared by USA, Germany, Norway, Canada, Madagascar, UK, Bosnia,
Serbia but it was not found in Pakistan. This information could be helpful in studying
the diversity of vector species around the world and virus transmission efficiency of
different haplotypes as Wijkamp et al. (1995) and Chatzivassiliou et at. (2002) found
that different populations of T.tabaci showed different virus vector efficiencies. Two
haplotypes of T. palmi which were shared by India and Pakistan connected through
many nodes of missing haplotypes, and one of these haplotypes restricted to this
region only. While one major COI haplotype of T. palmi was shared by Pakistan,
China, United Kingdom, Japan, and Dominican Republic. Only one S. dorsalis
haplotype from Pakistan shared the network from India and rest of the S. dorsalis
haplotype from Pakistan were only restricted to the region. T. flavus haplotypes from
Pakistan were not shared with other parts of the world except for one shared with that
of China. In summary, this study represents one of the first attempts to use and apply
DNA barcoding to understand the species diversity of thrips at the molecular level in
Pakistan and should form a basis for further studies in this area.
Chapter 5 Iris yellow spot virus (Tospovirus)
82
Chapter 5
GLOBAL ANALYSIS OF POPULATION STRUCTURE, SPATIAL
AND TEMPORAL DYNAMICS OF GENETIC DIVERSITY, AND
EVOLUTIONARY LINEAGES OF IRIS YELLOW SPOT VIRUS
(TOSPOVIRUS: BUNYAVIRIDAE)
5.1 INTRODUCTION
5.1.1 Tospoviruses: Introduction and importance
Tospoviruses belong to the genus Tospovirus in the family Bunyaviridae.
Members of this genus are the only plant-infecting viruses in the family Bunyaviridae.
All other genera of this family include the animal-infecting virus genera such as
Hantavirus, Nairovirus, Orthobunyavirus, Phlebovirus (Fauquet et al., 2005).
Delineation of of tospoviruses to species level is based on the amino acid sequence
identity of the nucleocapsid protein (N) gene, host range and vector specificity (Pappu
et al., 2009). The genus Tospovirus comprises of more than 30 species reported from
different geographical regions of the world (Table 5.1, Fig. 5.1) (Pappu and Bag,
2014). The genus includes several economically important viruses including
Groundnut bud necrosis virus (GBNV), Impatiens necrotic spot virus (INSV), Iris
yellow spot virus (IYSV) and Tomato spotted wilt virus (TSWV) (Fauquet et al.,
2005; Pappu, 2008; Tsompana and Moyer, 2008; Pappu et al., 2009). Asia has the
widest tospovirus diversity (Pappu et al., 2009) and five tospoviruses, Capsicum
chlorosis virus (CaCV), Groundnut or peanut bud necrosis virus (GBNV), Iris yellow
spot virus (IYSV), Peanut yellow spot virus (PYSV) and Watermelon bud necrosis
virus (WBNV) were reported to be endemic in the Indian subcontinent (Mandal et al.,
2012). Groundnut bud necrosis virus (GBNV) occurs in farmer’s fields in Pakistan
based on ELISA surveys (Delfosse et al., 1995). TSWV is the most important virus
Chapter 5 Iris yellow spot virus (Tospovirus)
83
economically (Pappu et al., 2009). TSWV causes severe damage to many vegetables
and ornamentals worldwide (Best, 1968; Cho et al., 1987).
5.1.2 Genome organization
Tospoviruses are quasispherical (80-110 nm in diameter) enveloped particles. The
genome of tospovirus is characterized by three RNAs: large (L), medium (M), and
small (S) (Adkins, 2000; Goldbach and Peters, 1996; Moyer, 1999, 2000; Sherwood
et al., 2000). The negative sense L RNA, in virion-complementry sense codes for the
RNA dependent RNA polymerase (RdRp) (de Haan et al., 1991; Bag et al., 2010)
while M RNA and S RNA have ambisense genome organization (Adkins, 2000; Bag
et al., 2009b; Cortez et al., 2002; Moyer, 1999; Nichol et al., 2005; Pappu, 2008;
Tsompana and Moyer, 2008). M RNA in the viral sense codes for a non-structural
movement protein (NSm) and in the viral complementary sense codes for a
glycoprotein precursor (Bag et al., 2009a; Cortez et al., 2002). The S RNA codes for
one non-structural protein (NSs) and the nucleocapsid protein (N) (Cortes et al.,
1998). The genomic RNAs are tightly bound by the N protein and encapsulated in a
lipid envelope (Moyer, 1999, 2000; Sherwood et al., 2000). The complete genome of
several tospoviruses have been sequenced for genetic diversity studies and the
molecular characteristics of N gene were utilized in studying their genetic
relationships (de Avila et al., 1993 ; Nischwitz et al., 2007; Krauthausen et al., 2012;
Pappu et al., 2006).
Chapter 5 Iris yellow spot virus (Tospovirus)
84
Table 5.1: List of currently accepted and tentative tospovirus species
(http://ictvonline.org/virusTaxonomy.asp?bhcp=1) and the GenBank accessions
numbers used for comparisons
(Source: Pappu and Bag, 2014)
No. Species (Recognized-2013) Abbreviation S RNA
1 Groundnut bud necrosis virus GBNV U27809
2 Groundnut ringspot virus GRSV AF251271
3 Groundnut yellow spot virus GYSV AF013994
4 Impatiens necrotic spot virus INSV X66972
5 Polygonum ringspot virus PolRSV EF445397
6 Tomato chlorotic spot virus TCSV JX244198
7 Tomato spotted wilt virus TSWV AF020659
8 Watermelon silver mottle virus WSMoV U78734
9 Zucchini lethal chlorosis virus ZLCV AF067069
10 Alstroemeria necrotic streak virus ANSV GQ478668
11 Bean necrotic mosaic virus BeNMV JN587268
12 Callalily chlorotic spot virus CCSV AY867502
13 Capsicum chlorosis virus CaCV DQ355974
14 Chrysanthemum stem necrosis virus CSNV AB600873
15 Groundnut ringspot virus-USA GRSV-USA HQ644140
16 Gloxinia tospovirus GlaxRSV AF059578
17 Hippeastrum chlorotic ringspot virus HCRV JX833564
18 Iris yellow spot virus IYSV AF001387
19 Lisianthus necrotic ringspot virus LNRV AB852525
20 Melon yellow spot virus MYSV FJ386391
21 Melon severe mosaic virus MSMV EU275149
22 Pepper necrotic spot virus PNSV HE584762
23 Peanut chlorotic fan-spot virus PCFV AF080526
24 Physalis severe mottle virus PhySMV AF067151
25 Soybean vain necrosis virus SVNV GU722319
26 Tomato necrosis virus TNeV AY647437
27 Tomato necrotic ringspot virus TNRV FJ489600
28 Tomato yellow fruit ring virus TYFRV/TYRV DQ462163
29 Tomato zonate spot virus TZSV EF552433
30 Watermelon bud necrosis virus WBNV GU584184
Chapter 5 Iris yellow spot virus (Tospovirus)
85
(Source: Pappu and Bag, 2014)
Figure 5.1: Phylogeny based on amino acid sequences of nucleocapsid protein of
known tospoviruses
GlaxRSV
TneV
CaCV
WSMoV
GBNV
WBNV
CCSV
TZSV
TNRV
MYSV
PhySMV
IYSV
TYRV
HCRV
PolRSV
BeNMV
SVNV
INSV
MSMV
ZLCV
CSNV
TSWV
GRSV
TCSV
ANSV
PNSV
GYSV
PCFV
LNRV
Bunyamwera
99
100
89 80
85
98
57
58
89
94
35
99
94
99
31
57
40
99
99
99
70
69
96 43
99
80
83
0.2
Chapter 5 Iris yellow spot virus (Tospovirus)
86
(Source: Pappu and Bag, 2014)
Figure 5.2: Schematic representation of the genome organization and replication
strategy of tospoviruses, showing the tree RNAs: Large (L), Medium (M) and
Small (S). The rectangular boxes indicate the proteins coded
Chapter 5 Iris yellow spot virus (Tospovirus)
87
5.1.3 Tospovirus transmission
Thrips are pests of both agricultural and horticultural crops directly and
indirectly cause the severe plant damage by transmitting some of the most important
plant viruses worldwide (Ullman et al., 2002). To date, 14 thrips species are reported
to be tospovirus vectors worldwide (Jones, 2005). WBNV is transmitted by Thrips
palmi, while IYSV is transmitted by T. tabaci (Singh and Krishna Reddy, 1996; Ravi
et al, 2006). TSWV is transmitted by F. occidentalis, F. fusca, F. schultzei, S.
dorsalis, T. palmi, T. setusus and T. tabaci (Moyer, 1999; Whitfield et al., 2005). T.
palmi Karni was reported to transmit GBNV in a persistent manner (Palmer et al.,
1990; Rangarao and Vijayalakshmi., 1993; Whiteman and Rao, 1994). In India,
GBNV (what was reported at that time as TSWV) was reported to be transmitted by
two thrips species F. schultzei Trybom and S. dorsalis (Ghanekar et al., 1979; Amin et
al., 1981).
A peculiarity of tospovirus transmission is that only those adult thrips can
transmit virus to other plants which acquire the virus in their nymph stage (Whitefield
et al., 2005). Tospovirus infection cycle starts when female adult thrips lay eggs on a
tospovirus infected plant and the larvae may acquire the virus and the virus is
transtadially passed through different larval stages to adult stage. For TSWV and
IYSV infected larvae, the median latent period was similar, and ranges from 80 to 170
h when they were kept at either 27°C or 20°C (Wijkamp et al., 1993). The adult may
remain viruliferous throughout its life, which may last for 20 to 40 days depending on
the environmental conditions. Virus transmission efficiency of each thrips species
varies greatly. For example, F. occidentalis transmits different tospovirus species
(GRNV, INSV, TCSV and TSWV) with variable efficiency (Wijkamp et al., 1993).
IYSV can be transmitted by two thrips species, F. fusca and T. tabaci with
considerably different efficiencies (Srinivasan et al., 2012). The tospovirus epidemics
can only occur when the biological entities involved in this pathosystem (thrips
vector, tospoviruses and the plant species, serving as hosts for both viruses and the
vector species) coincide in an appropriate environment (Ullman, 1996).
Chapter 5 Iris yellow spot virus (Tospovirus)
88
5.1.4 Iris yellow spot virus: Introduction and importance
IYSV is a distinct tospovirus species that infects Allium species and has
become an increasingly important constraint to the production of bulb and seed onions
in many onion growing regions around the world (Gent et al., 2006; Mandal et al.,
2012; Pappu et al., 2009; Turina et al., 2012). This is the most damaging disease of
onion crop reducing the bulb size of onion (Gent et al., 2004) and may cause the crop
loss upto 100% (Pozzer et al., 1999). First reports of IYSV came from Brazil in 1981
(de Avila et al., 1981), since then virus has begun to spread rapidly and started
appearing from many parts of the world. This viral disease was characterized by
symptoms of chlorotic and necrotic lesions with green island at the center, also called
diamond eye (Gent et al., 2006). Similar symptoms were observed in onion growing
regions of the Treasure Valley of Idaho and Oregon in the USA in 1989 (Hall et al.,
1993). These symptoms were referred to as “straw bleaching” (Gent et al., 2006).
IYSV was reported in the Netherland as a new tospovirus infecting iris (Iris
hollandica) from fields and in leek and named it as Iris yellow spot virus (Cortes et
al., 1998; Derks and Lemmers, 1996). IYSV is now reported from many other
contries of Asia, America, Australia and Europe where onion is a major crop (Pappu
et al., 2009; Mandal et al., 2012; turina et al., 2012). In addition to cultivatied onion
(Allium cepa), IYSV was also reported from wild onion A. altaicum, (Pappu et al.,
2006; Cramer et al., 2011) and other allium species as A. galanthum (Cramer et al.,
2011), A. porrum (Schwartz et al., 2007; Gent et al., 2007), A. pskemense (Pappu et
al., 2006), A. roylei (Cramer et al., 2011), A. sativum (Bag et al., 2009b), A.
schoenoprasum and A. tuberosum (Cramer et al., 2011) and A. vavilovii (Pappu et al.,
2006; Cramer et al., 2011). IYSV was also reported from other susceptible crops,
ornamentals and weeds that could be serving as potential reservoir sources of virus
inoculums. IYSV was reported from a number of weed hosts from Idaho (Sampangi et
al., 2007), on Atriplex micrantha and Setaria viridis from Utah (Evans et al., 2009 a,
b), in spiny sowthistle (Sonchus asper) from Georgia (Nischwitz et al., 2007) in the
USA. IYSV was reported from many countries around the world from twelve
different Allium and non-allium species (Table 5.2).
Chapter 5 Iris yellow spot virus (Tospovirus)
89
Table 5.2: List of Iris yellow spot virus (IYSV) isolates first reports from different
countries.
Host Common
Name
Location Year of first observed/Report of
IYSV
Allium cepa Onion Brazil 1994 (Pozzer et al., 1999)
Israel 1998 (Gera et al., 1998)
Japan 1999 (Kumar and Rawal, 1999)
Slovenia 2000 (Mavric and Ravnikar, 2000)
Italy 2003 (Cosmi et al., 2003)
Australia 2003 (Coutts et al., 2003)
Tunisia 2005 (Ben Moussa et al., 2005)
Spain 2005 (Cordoba-Selles et al., 2005)
Chile 2005 (Rosales et al., 2005)
India 2006 (Ravi et al., 2006)
Rèunion
Island
2006 (Robene-Soustrade et al.,
2006)
Peru 2006 (Mullis et al., 2006)
Guatemala 2006 (Nischwitz et al., 2007)
France 2007 (Huchette et al., 2008)
Canada 2007 (Hoepting et al., 2008)
Serbia 2007 (Bulajic et al., 2008)
South Africa 2007 (du Toit et al., 2007)
New Zealand 2007 (Ward et al., 2008)
Greece 2008 (Chatzivassiliou et al., 2009)
Mauritius 2010 (Lobin et al., 2010)
Uruguay 2010 (Colnago et al., 2010)
Mexico 2010 (Velasquez and Reveles,
2011)
Austria 2011 (Plenk and Groger, 2011)
Kenya 2011 (Birithia et al., 2011)
Uganda 2011 (Birithia et al., 2011)
Bosnia and
Herzegovina
2012 (Trkulja et al., 2013)
A.ampeloprasum Egyptian leek Egypt 2011 (Hafez et al., 2011)
A.cepa var.
ascalonicum
Shallot Rèunion
Island
2005 (Robene-Soustrade et al.,
2006)
A. galanthum Snowdrop
Onion
New Mexico 2010 (Cramer et al., 2011)
A. porrum Leek Australia 2003 (Coutts et al., 2003)
Rèunion
Island
2005 (Robene-Soustrade et
al., 2006)
Colorado 2006 (Schwartz et al., 2007)
Greece 2008 (Chatzivassiliou et al., 2009)
Sri Lanka 2009 (Widana Gamage et al.,
2010)
Germany 2010 (Krauthausen et al., 2012)
Chapter 5 Iris yellow spot virus (Tospovirus)
90
A. sativum Garlic Rèunion
Island
2005 (Robene-Soustrade et al.,
2006)
India 2010 (Gawande et al., 2010)
Egypt 2011 (Hafez et al., 2011)
Non-Allium Species
Alstroemeria sp. Alstroemeria Japan 2001 (Okuda and Hanada, 2001)
Bessera elegans Bessera Japan 2005 (Jones, 2005)
Clivia minata Clivia Japan 2005 (Jones, 2005)
Cycas sp. Cycad Iran 2005 (Ghotbi et al.,2005)
Eustoma
grandiflorum
Lisianthus Japan 2003 (Doi et al.,2003)
E. russellianum Lisianthus Israel 2000 (Kritzman et al.,2000)
Hippeastrum
hybridum
Amaryllis Israel 1998 (Gera et al.,1998)
Iris hollandica Iris The
Netherlands
1996 (Derks and Lemmers, 1996)
Pelargonium
hortorum
Geranium Iran 2005 (Ghotbi et al.,2005)
Petunia hybrida Petunia Iran 2005 (Ghotbi et al.,2005)
Portulaca sp. Purslane Italy 2003 (Cosmi et al.,2003)
Rosa sp. Rose Iran 2005 (Ghotbi et al.,2005)
Scindapsus sp. Pothos Iran 2005 (Ghotbi et al.,2005)
Vigna
unguiculata
Cowpea Iran 2005 (Ghotbi et al.,2005)
Chapter 5 Iris yellow spot virus (Tospovirus)
91
5.1.5 Importance of Onion in Pakistan
Onion (Allium cepa L.) is an important vegetable crop grown all over the
world and is one of the important constituents of daily dietary intake. Onion along
with garlic is rich in phosphorus, calcium and several antioxidant compounds,
polyphenols such as flavonoids and sulfur-containing compounds (Banerjee et al.,
2002; Block et al., 1997; Gorinstein et al., 2005; Horie et al., 1992; Ly et al., 2005;
Nuutila et al., 2003; Prasad et al., 1995; Suh et al., 1999; Yamasaki et al., 1994). It not
only adds taste and flavor to the food but also supplies active medicinal compounds
as ingredients that helps to ward off cataract and cardiovascular disease due to its
hypocholesterolemic, thrombolitic and antioxidant effects (Block, 1985; Block et al.,
1997; Nuutila et al., 2003; Vidyavati et al., 2010).
Major onion-growing areas of Pakistan include the district of D.G. Khan,
Gujranwala, Jhang, Kasur, Khaniwal, Sheikhupura, Vehari in the Punjab province;
Badin, Hyderabad, Mirpurkhas, Naushero Feroze, Sanghar, Sukkar in Sind province,
Swat in Khyber Pakhtonkawa and Chagi, Kalat, Khuzdar, Mastung and Turbat in
Balochistan province. According to the Food and Agricultural Organization, Pakistan
is the fifth largest onion producer in the World. The agro-ecological diversity in the
country enables production of onions almost around the year. Onion is susceptible to
numerous diseases caused by bacteria, fungi, viruses and nematodes (Schwartz and
Mohan, 2007). Onion thrips, T. tabaci Lindeman (Thysanoptera: Thripidae), is a key
pest of onion and related Allium spp. in all over the world and is an efficient vector of
Iris yellow spot virus (IYSV, Bunyaviridae: Tospovirus) (Gent et al., 2006; Pappu et
al., 2009). As a pest, T. tabaci causes damage to onion crop and can reduce its bulb
yields by >30–50% (Fournier et al., 1995; Rueda et al., 2007) and losses can be
compounded when T. tabaci infects the crop with IYSV since virus infection can
substantially reduce bulb yield (Gent et al., 2004). T. tabaci is widely distributed all
over Pakistan (Akram et al., 2003a) and is the predominant species found on onion in
Pakistan (Hazara et al., 1999a, b). Considering that T. tabaci, vector of IYSV, was the
predominant thrips species on onion, a survey was conducted to determine if IYSV
was present in these fields.
Chapter 5 Iris yellow spot virus (Tospovirus)
92
5.1.6 Epidemiology of IYSV
IYSV presents an interesting case of epidemiological intrigue. In the US,
while the virus was reported in onion as early as in 1990s, it remained inconsequential
with respect to economic damage. However, since 2000, the virus was reported from
several states in the US and started to cause significant economic losses (Gent et al.,
2006; Pappu et al., 2009). Though tospoviruses continue to be production constraint
to several field and horticultural crops in many parts of the world, there is little or no
information on their occurrence in Pakistan. For this reason, surveys followed by
testing of various vegetable crops from thirteen districts of Punjab, Pakistan were
carried out to determine the presence of IYSV.
5.1.7 Assay, detection and diagnosis of Tospoviruses
Different methods used for identifying tospovirus infection include infectivity
assay, electron microscopic examination of infected samples, enzyme-linked
immunosorbent assay (ELISA), direct tissue-blot assay, dot blot immunoassay, PCR
(Mumford et al., 1996). For routine detection and surveys, ELISA has been the
method of choice for tospovirus detection and identification (Daughtrey et al., 1997).
Antisera specific to many of the individual tospoviruses are commercially available.
These antsiera were produce to the N protein of individual tospoviruses. Serveral
researchers reported the application of RT PCR and variations of it such as
Immunocapture (IC) PCR for tospovirus detection (Mumford et al., 1994). Molecular
methods including RT PCR and qPCR were developed and are being used for
tospovirus identification in plants and thrips (Pappu et al., 2008).
In thrips vector, the presence of non-structural protein, NSs, coded by the S
RNA suggests the virus replication in its vector and hence the viruliferous vector. Bag
et al. (2013) have been produced and used a specific and sensitive antibody to the NSs
of IYSV to detect the NS in T. tabaci. Using an ELISA-based assay and NSs-specific
antiserum, Bag et al. (2013) conducted studies on the seasonal dynamics of
trasnmistters along the field collected populations of adult T. tabaci.
Chapter 5 Iris yellow spot virus (Tospovirus)
93
5.1.8 Importance of this work
Keeping in view of the increasing importance of IYSV on a global sale, we
conducted surveys for IYSV symptomatic plant samples and T. tabaci collection from
the onion fields of Punjab province of Pakistan and characterization of these samples
for IYSV using molecular techniques. We recently reported the occurrence,
distribution and molecular characterization of IYSV from commercial onion crops
from Pakistan (Iftikhar et al., 2013). With increased incidence and economic impact,
research on IYSV was intensified and as a result characterization of IYSV isolates
was carried out with subsequent availability of several N gene sequences in GenBank.
We characterized IYSV at the molecular level in Alliums collected from several
countries (Huchette et al., 2008; Ward et al., 2008; Bag et al., 2009c; Sether et al.,
2010; Lobin et al., 2010; Iftikhar et al., 2013; Pappu and Rauf, 2013). With nearly 100
accessions of complete N gene sequences available in GenBank from more than 23
countries, IYSV N gene sequences now represent a large enough and diverse sample
for detailed genetic diversity studies on a global scale to better understand genetic
drift, population structure and evolutionary lineages of this important emerging viral
pathogen.
5.1.9 Objectives
1. To survey and collect isolates of IYSV and thrips vector species from predominant
onion growing areas of Punjab.
2. To diagnose Iris yellow spot virus by ELISA and RT-PCR.
3. To sequence the NP gene of IYSV.
4. To conduct genetic diversity studies of IYSV on a global scale to better understand
the genetic drift, population structure and evolutionary lineages of this important
emerging viral pathogen.
Chapter 5 Iris yellow spot virus (Tospovirus)
94
5.2 MATERIAL AND METHODS
5.2.1 Collection of thrips and plant samples for tospovirus studies
Vegetable plants found with symptoms associated with IYSV infection such as
spindle-shaped straw colored irregular chlorotic lesions on onion leaves were
collected from thirteen different districts of southern and northern Punjab in Pakistan
during 2012 within the latitude of 30.28 -31 degree to 71-73 degree longitude. Thrips
were also collected from the infected plants to test for tospoviruses. The samples were
catalogued and preserved at -80°C until further analysis. Details have been described
in section 2.2 and Table 2.1.
5.2.2 Enzyme-linked immune-sorbent assay (ELISA)
ELISA of thrips and plant samples were done using the protocol described in
the section 2.3.
5.2.3 Reverse-transcriptase polymerase chain reaction (RT-PCR)
Total RNA from the symptomatic, ELISA-positive leaf samples was extracted
using the RNeasy Plant Mini kit (Qiagen, Maryland, USA) following the
manufacturer’s instructions. First strand complementary DNA (cDNA) synthesis was
done using SuperScript II reverse transcriptase (Invitrogen, Carlsbad, USA) and IYSV
N gene was amplified using forward primer 5’-CTCTTAAACACATTTAACA
AGCAC-3’ and reverse primer 5’-TAAAACAAACATTCA- AACAA-3’ flanking the
nucleocapsid (N) gene encoded by the small RNA of IYSV. Amplified IYSV N gene
fragments were cloned in pGEM-T easy vector (Promega, Madison, USA) and
sequenced at ELIM Biopharma (Hayward, USA). At least two clones for each isolate
were sequenced. Sequences of IYSV N gene obtained from the samples derived from
Pakistan and the USA were annotated and compared to available IYSV N gene
sequences. Complete N gene sequences of various IYSV isolates reported across the
globe were retrieved from the GenBank for comparative analysis.
Chapter 5 Iris yellow spot virus (Tospovirus)
95
5.2.4 Sequence annotation and analysis
Sequence alignment and phylogenetic trees were generated using MEGA 6
(Tamura et al., 2013). The phylogenetic tree was constructed using the neighbor
joining method (default parameters with 2000 replicates in the bootstrap analysis). To
study nucleotide diversity and DNA polymorphism, DnaSP (Librado and Rozas,
2009) was used. The analysis included quantifying the levels of DNA polymorphism
such as the number of haplotypes and haplotype diversity in order to analyze the
distribution pattern of DNA variation, or to compare alternative evolutionary
scenarios.
5.2.5 In silico RFLP Analysis of the nucleoprotein gene
Complete N gene sequences (ORFs) available in GenBank, NCBI, were
analyzed for in silico RFLP pattern. The RFLP simulation of N gene was carried out
using Restriction Mapper Version3 (http://www.restrictionmapper.org/) to perform
virtual digest of the gene and to map the sites recognized by restriction enzyme Hinf1
(Zen et al., 2005). IYSV isolates could be grouped into IYSV Netherlands (IYSVNL)
or IYSV Brazil (IYSVBR) types (Pozzer et al., 1999) based on Hinf1 digestion. Those
that did not conform to either genotype were considered as “IYSVother”.
5.2.6 Temporal analysis of IYSV genotype distribution
IYSV genotypes were analyzed for the temporal shift in two time periods that
were arbitrarily chosen- those reported before 2005 and after 2005. The year 2005
bifurcates the periods of study (1997-2013) in to two equal halves (1997-2005 and
2006-2013). For the temporal analysis of IYSV genotypes, date of collection of
sample was considered wherever available; otherwise date of submission to GenBank
was taken for the analysis of temporal study of population based on in silico RFLP.
5.2.7 Recombination detection Analysis
Potential recombination events were detected by Recombination Detection
Program-4 (RDP 4 Beta 4.16) (Martin et al., 2010). All the complete N-gene
sequences available in GenBank were used in the analysis and the sequence alignment
Chapter 5 Iris yellow spot virus (Tospovirus)
96
was carried out using Bio-edit sequence alignment editor software (Hall, 1999) and
the aligned sequences were used for recombination detection studies. For identifying
recombination events, step-down correction with the highest acceptable p-value
setting of 0.05 was used along with other default settings for all of nine methods
(RDP, Chimaera, BootScan, 3Seq, GENECONV, MaxChi, SiScan and LARD,
PhylPro) available in the RDP 4 (Martin et al., 2010).
5.2.8 Population selection studies and neutrality tests
Codon-based maximum likelihood methods including SLAC (single like
ancestor counting), FEL (fixed effects likelihood), and REL (random effects
likelihood) were used to calculate the mean rates of non-synonymous (dN) and
synonymous substitutions (dS). The dN/dS ratio in every codon in the alignment was
calculated in order to estimate the selection pressure on the N gene belonging to
various genotypes like IYSVBR, IYSVNL and IYSVother using DATAMONKEY server
(http://www.datamonkey.org). To test the theory of neutral evolution test statistics
like Tajimas’s D (Tajima, 1989), Fu & Li’s D and Fu & Li’s F (Fu and Li, 1993; Fu,
1997) were determined employing DnaSP software.
5.2.9 Genetic differentiation and gene flow estimates
In order to estimate genetic differentiation within the populations of IYSV
genotypes, nucleotide test statistics such as Ks, Kst and Snn (Hudson, 2000) and
haplotype statistics such as Hs and Hst (Hudson et al., 1992a) were computed using
DnaSP. The software was further used to study the extent of gene flow between the
IYSV populations by estimating statistic Fst (Hudson et al., 1992b).
5.3 RESULTS
5.3.1 Symptomatology
Symptoms in commercial onion fields surveyed included spindle-shaped
straw-colored irregular chlorotic lesions, necrotic to hay-coloured spots, long yellow
stripes (Fig. 5.3). Symptoms were found on both onion seed and bulb crops.
Symptomatic plants were predominantly noticed in Faisalabad, Gujranwala, Nankana,
Chapter 5 Iris yellow spot virus (Tospovirus)
97
and Sheikhupura districts in Pakistan. IYSV infection was confirmed by ELISA. Out
of 13 districts, samples from 5 districts, Faisalabad, Gujranwala, Nankana, Sargodha
and Sheikhupura was found positive. Viral genome from samples from two of these
districts (Faisalabad and Nankana) were cloned and sequenced. Virus isolates were
transferred to and maintained in indicator hosts, Datura stramonium and Nicotiana
benthamaiana by mechanical inoculation.
5.3.2 Enzyme-linked immune-sorbent assay (ELISA) for IYSV
Iris yellow spot virus affected onion samples showing different types of IYSV
symptoms collected from different regions of Punjab province. Plant leaves and stems
were tested for the virus. Fifty-two samples from Pakistan (Table 2.1) and five
samples collected from US were tested by DAS-ELISA for the presence of IYSV. The
absorbance values (optical density (OD)) showed that only five samples from
Pakistan and all five from the USA reacted positive to IYSV-NP specific antiserum
with varied degree of serological affinities. The symptoms considered similar to IYSV
were found to be negative in ELISA for most of the samples from Pakistan. The
highest absorbance (2.480OD to 3.500OD) was observed in samples from Faisalabad,
Jaranwala, Nankana and Sheikhupura districts.
In the present study, thrips from family Thripidae were also collected from the
suspected IYSV diseased fields along with the plant samples. Thrips in the collection
were morphologically identified to T. tabaci and individual specimens were tested
against IYSV-NS antiserum by DAC-ELISA. Thrips from Faisalabad, Jaranwala,
Lahore, Nankana and Sheikhupura districts were deemed positive with absorbance
values ranging from 1.782OD to 3.500OD. Vector thrips from IYSV infected fields
showed positive for IYSV.
5.3.3 Molecular characterization
Samples from plants with IYSV-like symptoms that failed to react to the
antisera give a positive test by RT-PCR. The IYSV N gene was cloned and sequenced
from two isolates from the Punjab province of Pakistan and 5 isolates collected from
the USA in 2012 (Fig. 5.4).The N gene of these isolates was 822 nt long and
Chapter 5 Iris yellow spot virus (Tospovirus)
98
potentially coded for a 273-amino acid protein. Sequences of N gene reported in this
study were submitted to GenBank (KF171103, KF171104, KF171105 from Pakistan,
and JQ973065, KF263484, KF263485, KF263486 and KF263487 from the USA.
Chapter 5 Iris yellow spot virus (Tospovirus)
99
Figure 5.3: Plant samples showing the IYSV specific symptoms
Figure 5.4: PCR amplification of IYSV N gene (1100bp)
Chapter 5 Iris yellow spot virus (Tospovirus)
100
5.3.4 Restriction fragment length polymorphism
The in silico RFLP of N gene was carried out to determine the relative
distribution of the two previously described IYSV genotypes, their distribution pattern
across the geographic regions, hosts and over a 20 year time period. The restriction
enzyme Hinf1 was found to delineate IYSV N gene sequences into two genotypes:
Netherlands (IYSVNL) and Brazil (IYSVBR) based on the RFLP pattern. Hinf1
revealed 6 different types of restriction pattern. The frequency of the restriction site in
the known N gene sequences varied from four to nine. Two thirds of the sequences
had five to seven HinfI site (67 accessions out of 98). HinfI produces two digestion
products, 486 bp and 308 bp and differentiates the N gene into IYSVNL and IYSVBR,
respectively. The Hinf1 restriction pattern of N gene divided the 98 accessions almost
equally (46% as NL and 48% as BR) and the remaining 6% of the accessions could
not be placed in either category and were considered IYSVother (Fig. 5.5).
The geographical distribution of IYSV genotypes was assessed and the Asian
isolates were predominantly of IYSVBR (72%) genotype, while 21% of the accessions
belonged to IYSVNL. Interestingly, isolates reported from North America were
predominantly of the IYSVNL type (Fig. 5.5). Also of interest was, IYSV genotypes
generally were confirmed in their incidence to a particular geographic region for
example, IYSVBR genotypes were reported only from Asia but not from Europe.
Similarly the isolates that did not belong to either genotype (IYSVother) were reported
only from Asia and Europe (Fig. 5.6).
Among the hosts from which the various isolates were reported, onion (A.
cepa) was the most commonly reported host of IYSV, while other crops included
Allium tuberosum, Allium sativum, Allium ampeloprasum, and Eustoma russellianum
(Fig. 5.7). Among the isolates characterized from infected onions, the relative
incidence of NL and BR types was about equal: 45% IYSVBR and 47% IYSVNL.
Chapter 5 Iris yellow spot virus (Tospovirus)
101
Figure 5.5: Genotyping of IYSV accessions based on in silico RFLP simulation of
nucleocapsid (N) gene (percentage of accessions under various genotypes)
Figure 5.6: Geographical distribution of various IYSV genotypes
Chapter 5 Iris yellow spot virus (Tospovirus)
102
Figure 5.7: Host distribution of various IYSV genotypes
0 5
10 15 20 25 30 35 40 45
IYSV BR
IYSVNL
Others
Chapter 5 Iris yellow spot virus (Tospovirus)
103
5.3.5 Sequence diversity, DNA polymorphism and phylogeny of the N gene
The N gene sequences generated during this study and all the available
complete N gene sequences in GenBank were used for determining the genetic
diversity, polymorphism and phylogenetic analysis. Nucleotide diversity (π) of
IYSVBR was slightly higher than that for IYSVNL (0.04194 and 0.03133, respectively).
However it was notably higher in IYSVother N gene sequences (0.08297) (Table 5.3)
suggesting that IYSVother is more diverse than the IYSVNL and IYSVBR as number of
polymorphic sites (S) of IYSVother genotype are 136 in 6 isolates (Table 5.3).
The phylogenetic tree based on the N gene sequences showed clustering of
IYSV genotypes into two distinct nodes one each representing IYSVBR and IYSVNL
(Fig 5.8) with a few exceptions. The type isolate of IYSVBR (AF067070) is found in
the IYSVNL node. All IYSVBR genotypes grouped together, while three NL genotypes
(AF271219, AM900393 and AF001387) also grouped with the IYSVBR. Four among
the six isolates that belonged to IYSVother also grouped with IYSVBR (Fig. 5.8).
The nucleotide sequence identity studies revealed that the three isolates from
Pakistan reported here (KF171104, KF171103, KF171105) had 99% sequence
identity with an isolate from Chile (DQ150107), whereas two of the Pakistan isolates
(KF171104, KF171103) exhibited 99% identity with USA isolates (KF263486,
JQ973065) while one isolate (KF171105) showed 98.7% sequence identity with both
the USA isolates. The isolates from Pakistan (KF171104 and KF171103) also showed
98.9% sequence identity with another isolate from USA (KF263487). The isolates
reported from Washington State, USA (KF263486) showed 100% identity with an
IYSV isolate of Japan (AB180921). Other IYSV isolates from different states of USA
including JQ973065, KF263487, KF263485, KF263484 showed 99.7%, 99.8%,
99.3% and 99.6% sequence identity with a Japanese isolate (AB180921), respectively.
Chapter 5 Iris yellow spot virus (Tospovirus)
104
Figure 5.8: Phylogenetic
tree of nucleotide
sequences of the
nucleocapsid gene of
IYSV isolates available
in GenBank. The
percentages of replicate
trees in which the
associated taxa clustered
together in the bootstrap
test are shown next to the
branches. Each IYSV
isolates are indicated by its
GenBank accession
number, place of origin
and host.
Chapter 5 Iris yellow spot virus (Tospovirus)
105
Table 5.3: Genetic diversity of the nucleocapsid gene in various IYSV genotypes and
the population as a whole
Genotype N S π Hd
IYSV NL 44 117 0.03133 0.996
IYSV BR 47 232 0.04194 0.998
IYSV other 6 136 0.08297 1.000
IYSVAll 97 319 0.07712 0.999
N, number of isolates; S, number of polymorphic (segregating) sites; Hd, haplotype
diversity; π, nucleotide diversity within species. IYSV Netherlands (IYSVNL); IYSV
Brazil (IYSVBR); IYSV that belong to neither genotype (IYSVother); entire IYSV
population (IYSVall
Chapter 5 Iris yellow spot virus (Tospovirus)
106
5.3.6 Temporal shift in IYSV Genotype
Analysis of available sequences was carried out to determine if there was a
potential temporal shift in the IYSV genotypes. For this study, two time periods,
before 2005 and after 2005 were arbitrarily selected. It was found that prior to 2005,
the relative proportion of IYSVNL was higher compared to IYSVBR. However, after
2006 the reversal was seen with a greater percentage of IYSVBR (Fig. 5.9a). Prior to
2005, no IYSVother genotype was observed. Interestingly, however, more of the ‘other’
genotypes were reported post-2005. One noteworthy observation from the temporal
studies was the three-fold increase in IYSVBR between the two periods (before and
after 2005), whereas for the same period, IYSVNL genotypes had a two-fold increase
(Fig. 5.9b).
5.3.7 Recombination detection
One potential recombination event was identified by RDP. The recombination
event was detected by SiScan and 3Seq methodologies of RDP and could be of
evolutionary significance. IYSV infecting Allium in Brazil, the type isolate for
IYSVBR genotype appears to be a recombinant in this event. However, only one
parent could be identified-the onion-infecting IYSV isolate from USA, (DQ233478)
which is an IYSV NL genotype and the other recombination break point could not be
identified even though 3Seq identified an onion isolate from Australia (AY345227) as
another potential parent (Fig. 5.10). IYSVBR might have been potentially generated
from IYSVNL through recombination.
Chapter 5 Iris yellow spot virus (Tospovirus)
107
a)
b)
Figure 5.9: Temporal shift in genotypes of IYSV
a) IYSV Genotypes reported during the period (1997-2005)
b) IYSV Genotypes reported during the period (2006-2013)
15
12
0
IYSV genotypes reported during the period
(1997-2005)
NL
BR
Others
30
35
6
IYSV genotypes reported during the period
(2006-2013)
NL
BR
Others
Chapter 5 Iris yellow spot virus (Tospovirus)
108
Figure 5.10: Recombination events within N gene of various accessions as
detected by RDP v4. Recombinant AF067070-Brazil-Allium cepa type isolate of
IYSVBR genotype is a product of recombination involving DQ233478-USA- Allium
cepa as the minor parent. Though the start break-point could not be identified with
certainty, RDP detected nucleotide positions 1-44 as a probable break-point with
accession AY345227-Australia-Allium cepa as a possible major parent.
Chapter 5 Iris yellow spot virus (Tospovirus)
109
Table 5.4: Summary of codon substitution studies in nucleocapsid gene of IYSV
genotypes
a-codons identified by SLAC at a cut off p-value 0.1; b-codons identified by FEL at a
cut off p-value 0.1; c-codons identified by REL at a cut off Bayes factor value 50
dN, the number of non-synonymous substitutions per non-synonymous site; dS, the
number of synonymous substitutions per synonymous site
ω - ratio of dN/dS from SLAC (single like ancestor counting) methodology,
dN-dS obtained from REL (random effects likelihood)
Genotype Positively
selected codon
positions
Amino acid
substitutions
No. of
negatively
selected codons
ω=dN/dS dN-dS
IYSVNL 139b Asp-Asn
Asp-ser
Asp-Val
15a
59b
105c
0.197 -0.797
IYSVBR 139b Ser-Thr
Ser-Asp
25a
66b
0.198 -0.817
IYSVother 270c - 3
a
39b
0.171 -0.810
IYSV All 109b
Leu-Ile
Ile-Phe
52a
90b
0.214 -
139a&b
Asp-Asn
Asp-ser
Asp-Val
Ser-Thr
Ser-Asp
Chapter 5 Iris yellow spot virus (Tospovirus)
110
5.3.8 Population selection and test of neutrality
Population selection studies provide a list of gene codons in an alignment that
are under positive or negative selection pressure and thus could shed light on the
molecular evolution patterns in the N gene. The mean dN/dS (dN-rate of non
synonymous substitutions and dS-rate of synonymous substitutions) for N gene
accessions belonging to the BR genotype were found to be 0.198 and did not have a
single positively selected codon site. However, 25 negatively selected codon sites
were identified using SLAC methodology (Table 5.4). The same data set when
analyzed by FEL, revealed one positively selected codon site (codon no. 139:
AGC/ACC) against 66 negatively selected sites. The mean difference between dN and
dS (dN-dS) for the N gene sequences belonging to the BR genotypes based on REL
analysis was found to be -0.817 suggesting that all the codon sites are under purifying
selection acting against deleterious non-synonymous substitutions (Table 5.4).
Similarly, the mean dN/dS of N-gene sequences of NL genotype was found to
be 0.197and the data set did not reveal any positively selected codons. However, 15
negatively selected codon sites were identified from SLAC analysis. The same data
set when analyzed by FEL revealed a positively selected codon site (GAC) at the
same place where BR genotypes also exhibited positive selection, along with 59
negatively selected codon sites. The dN-dS for the N gene sequences belonging to NL
genotypes based on REL analysis were found to be -0.797. REL analysis also did not
identify any positively selected codon sites as against 105 negatively selected sites.
The mean dN/dS for sequence accessions belonging to neither BR nor NL genotypes
was found to be 0.171 with 3 negatively selected codon sites and not a single
positively selected site have been identified by SLAC. Similarly, FEL analysis
revealed 39 negatively selected codon sites. The dN-dS was revealed to be -0.810,
with one positively selected site (codon 270). Taken together, the results revealed that
the codons were generally negatively selected except codon sites (codon no. 139) both
in IYSVBR (AGC/ACC) and IYSVNL (GAC) and codon 270 (GAC) in IYSVother
which was found to be positively selected in both virus genotypes. Thus, positive
selection of codons (at codon positions 139 and 270) indicates that the replacement
substitutions increase the fitness of the N protein codon 139 (AGC/ACC/ GAC) and
Chapter 5 Iris yellow spot virus (Tospovirus)
111
270 (GAC) in the IYSV population. Negative selection functioning at other sites tends
to remove such substitutions from the N gene. Further, the number of negatively
selected codon sites in BR is higher than in NL genotypes based on SLAC analysis,
suggesting the dominant influence of purifying selection in IYSVBR genotype
compared with IYSV NL.
The population statistic parameters, however, revealed no significant
differences between the two genotypes and the overall population. The statistically
significant and insignificant negative values of Tajima’s D in IYSVBR and IYSVNL,
respectively, suggest the dominance of purifying selection and population expansion
operating in those genotypes (Table 5.5). The test statistic Fu and Li’s D and F also
revealed the same characteristic feature for the IYSVBR and IYSVNL genotypes
underlining the principle of operation of purifying selection and population size
expansion. The statistically significant negative value of Fu’s F further strongly
denotes the expansion observed in IYSVBR population. IYSVother genotype revealed
positive values for both statistical parameters Tajimas’s D and Fu &Li’s D suggesting
a decrease in population size and balancing selection.
5.3.9 Genetic differentiation
The inherent genetic differentiation between the IYSV genotypes was
evaluated by estimating both haplotype-based statistic (Hs and Hst) and nucleotide-
based statistic (Ks, Kst, Snn) (Table 5.6). The statistically significant test values for
Ks, Kst and Z obtained when IYSV populations were compared among themselves
revealed the existence of strong genetic differentiation. Despite the insignificant test
statistical value (Snn) obtained in comparison studies, its value close to one denotes
the genetic differentiation between the IYSV genotypes. The parameter values for Kst
in the comparisons also revealed that IYSVBR is relatively least differentiated from
IYSVother (Kst value of 0.01838*) compared with IYSVNL genotypes (Kst value of
0.06260*). The computed Fst value of 0.68 between IYSVBR and IYSVNL population
indicates restricted gene flow between the populations thus sharing of genetic
information between these two populations is infrequent. While IYSVNL exhibited a
moderate gene flow with IYSVother, IYSVBR exhibited relatively unrestricted gene
flow with IYSVother.
Chapter 5 Iris yellow spot virus (Tospovirus)
112
Table 5.5: Summary of Neutrality tests in IYSV population
Genotypes Tajimas’s D Fu &Li’s D Fu &Li’s F
IYSVBR -1.47873 -360071** -3.35619**
IYSVNL -1.58197 -0.81168 -1.30718
IYSVother 0.57659 0.87044 -0.88804
Table 5.6: Genetic differentiation and gene flow of the nucleocapsid gene between
different IYSV genotypes
Genotypes Hs Hst χ2 P
value
Kt Ks Kst Snn Z Fst
IYSVBR vs
IYSVNL
0.99700 0.00154 91.000 0.3083 62.97485 3.12600* 0.18548* 0.98901 6.65663* 0.68268
IYSVBR vs IYSVother
0.99830 0.00025 53.000 0.3592 39.69303 3.39689* 0.01838* 0.92453 6.15872* 0.11744
IYSVNL vs
IYSVother
0.99614 0.00060 50.000 0.3175 36.92490 2.98441* 0.06260* 0.98000 5.96030* 0.37528
Hs, Hst: Haplotype based statistic to estimate genetic differentiation
Ks, Kst, Snn, Z: Nucleotide based test statistic to estimate the genetic differentiation
(Kst value close to zero indicates no differentiation; Snn value close to one indicates
differentiation)
Fst: Statistic estimates the extent of gene flow between various genotypes (Value close
to zero indicates free gene flow or panmixis value close to one indicates genotypic
groups are closed to gene flow)
Chapter 5 Iris yellow spot virus (Tospovirus)
113
5.4 DISCUSSION
Fifty-two IYSV symptomatic plant samples from Pakistan were tested for
reactivity with IYSV-NP antiserum but only few of them were found positive for
IYSV. The symptoms considered similar to IYSV were found to be negative in
ELISA. IYSV as a viral species imply wide diversity which complicates the virus
detection through serological tests. It is noted that some available serological tools
were not optimally recognized some IYSV isolates from southern Europe (Hallwass
et al., 2012) and this is also shown in our serological analysis as we used the kit which
was based on IYSV isolate of Germany for serological diagnostics and it gave very
weak interaction with IYSV isolates from Pakistan. Different behavior in DAS-
ELISA was noted for different IYSV isolates with various detection kits and these
differences were confirmed by phylogenetic analysis (Hallwass et al., 2012).
IYSV is a major constraint to onion production in many onion-growing
regions of the world. Economic loss due to IYSV infection varies with climate,
production practices, vector thrips populations, onion cultivars and virus strains.
Diverse IYSV symptoms in onion under field conditions are suggested due to
existence of different strains of IYSV or the symptom expression may be affected by
time of infection, age of plants, environmental and stress factors and difference in the
genetic makeup of cultivars (Bag et al., 2012). Knowledge on the population
diversity, spatial and temporal dynamics of IYSV population could be useful in
designing appropriate disease control measures. A previous study showed that IYSV
isolates from some western US states grouped distinctly from those from other parts
of world including Australia, Brazil, Japan, and the Netherlands (Pappu et al., 2006).
Similarly, phylogenetic analysis of N gene from IYSV isolates prevalent in Georgia,
USA and Peru revealed that they are related to one another and divergent from those
reported from the western states of the US. This study suggested that the gene flow
occurred from Peru into Georgia, USA as the former region is known to have IYSV
infection even before its detection in Georgia (Nischwitz et al., 2007).
Computational RFLP simulation studies revealed the categorization of IYSV
genotypes into two groups, IYSVBR and IYSVNL. Interestingly, all the known N gene
accessions were grouped about equally into the two genotype groups. However, a few
Chapter 5 Iris yellow spot virus (Tospovirus)
114
accessions fell into neither category. Interestingly, the IYSVothes genotype was
reported only from Asia and Europe. The plausible role for recombination in the
evolution of IYSVother genotypes could not be disregarded as it tends to rearrange the
genomic regions leading to genetic diversity. Considering the relatively short stretch
of sequence (822nt encoding 273 aminoacids) that was used for identifying potential
recombination events, it was surprising to see even one such event might have taken
place as RDP showed one possible recombination event. The recombination event
involving IYSVNL and IYSVBR is evolutionarily significant as it could have been the
basis for the evolution of the BR from the NL genotype.
The population selection study identified few positively selected codons in the
N gene population as a whole or within the genotypes [codon position 139
(AGC/ACC/ GAC) in all genotypes and overall population), 270 (GAC) in IYSVother)
and 102 (ATT/CTT) in overall population] (Table 5.4). Among the codons of N gene
analyzed as a whole population, 19% of the codon positions were identified to be
negatively selected by SLAC methodology (Table 5.4), whereas 33% of the codon
positions were detected to be negatively selected in FEL methodology. This moderate
level of negative selection of codons operating in N gene population denotes the
action of purifying selection within the IYSV population. The role of positive
selection in amino acid codons have been ascribed to the ability of Tomato spotted
wilt virus (TSWV) to break the host resistance against gene Sw-5 in tomato (Sundaraj
et al., 2014). On the similar lines, the role of negatively selected amino acid codons in
functional properties and their importance to virus survival have been discussed in
case of Tomato mosaic virus (Rangel et al., 2011) and to a lesser extent in Fig mosaic
virus (FMV) (Walia et al., 2014). However most of the N gene amino acid codons are
free from any selection hence they evolve neutrally. This neutral mode of evolution
observed in IYSV population has also been previously observed with the population
of Cucumber mosaic virus (Davino et al., 2012). Findings from our genetic
differentiation studies are in accordance with the phylogenetic analysis of N gene
sequences of various IYSV isolates, wherein IYSVBR and IYSV NL genotypes formed
two distinct groups. The genetic differentiation and the absence of gene flow between
IYSVBR and IYSVNL is also further corroborated from the geographical confinement
of these genotypes as North America had predominantly the NL genotype, whereas
Chapter 5 Iris yellow spot virus (Tospovirus)
115
Asia had the BR genotype. The relatively frequent gene flow between IYSVBR and
IYSVother when compared with IYSVNL further explains the presence of IYSVother in
Asia and Europe only. In summary, a global analysis of IYSV N gene sequences
revealed important characteristics of the virus population structure, spatial and
temporal distribution patterns and provided insights into the evolution of the virus.
IYSV reduces the bulb size, seed yield and quality of onion crop. Plants also
get more susceptible to other pests and diseases due to the IYSV infection. An
economic loss of IYSV varies with differences in climate, vector thrips populations,
onion cultivars and virus strains. Keeping in view the significance of onion bulb and
seed crops in Pakistan and consequences of IYSV attack on this crop, a more
extensive survey of onion-producing areas should be established giving the particular
attention to the presence of viruliferous thrips and possible alternate hosts of t. tabaci.
Chapter 6 General Discussion
116
Chapter 6
GENARAL DISCUSSION
Thrips (Thysanoptera) are small insects which feed on different plant parts.
Besides being crop pests, thrips transmit several plant viruses in the genus Tospovirus.
Members of Thysanoptera are widely distributed throughout Pakistan on field and
horticultural crops and weeds. Their small size and inconspicuous morphological
characters limit their rapid and accurate identification.
Previous studies have shown that the number of thrips species in Pakistan
ranges from 45-63 (Akram et al., 2002, 2003a, b; Saeed and Yousaf, 1994; Saeed et
al., 1994). All these studies relied on morphological characters for the species
identification. However, morphological identification of thrips is not only difficult but
in the absence of elaborative keys, can be misleading, particularly identification of the
immature stages pose a special challenge. The current study was undertaken keeping
in view the importance of thrips and a lack of comprehensive studies on thrips
diversity in Pakistan. The current study identified 41 morphological species from 158
sites in Pakistan. This included 12 species from 5 genera of the suborder Tubulifera
and 29 species from 17 genera of the suborder Terebrantia. Among them, one species
(Apterygothrips pellucidus Ananthakrishnan) from Tubulifera and seven
(Chaetanaphothrips orchidii Moulton, Chirothrips meridionalis Bagnall,
Megalurothrips usitatus Bagnall, Megalurothrips distalis Karny, Neohydatothrips
samayunkur Kudo, Taeniothrips major Bagnall, Thrips trehernei Priesner) from
Terebrantia were first reports from Pakistan. Additionally four genera
(Apterygothrips, Chaetanaphothrips, Neohydatothrips, Taeniothrips) represented in
this collection were also first records from this region. This point towards
undiscovered fauna of thrips in the region and existence of potential species still need
to be described. More detailed and regular survys need to be carried out in order to
obtain a complete picture of the thrips diversity. Some of the previous reports on
thrips species in the region are contradictory as morphological character based
Chapter 6 General Discussion
117
reliable taxonomic keys are not available to researchers for different regions of the
world. Moreover, inadequate exposure of the revised keys for the new species or
endemic species creates challenges for taxonomists. The use of molecular data for
insect species identification has certain advantages over the morphological keys for
resolving the species status with more confidence. The use of mitochondrial COI-5ʹ
(DNA barcode) for the species identification and genetic diversity analysis in animals
has been very effective. Hence barcoding was employed as a molecular tool for
determining the sequence characteristics and variation among thrips from Pakistan.
The Barcode Index Number (BIN) system assigned the 469 sequences to 53
BINs. The recursive partition by Automatic Barcode Gap Discovery (ABGD) also
revealed the presence of 53 groups. Sequence analysis revealed that the intraspecific
and interspecific distances ranged from 0.0% to 7.5% and 2.3% to 22.3%,
respectively. The NJ dendrograms and Bayesian phylogenetic inference supported the
presence of 54 monophyletic lineages. Revelation of a higher number of BINs as
against the number of morphological species identified in the collection points
towards existence of cryptic species. Four of the major pest species in the region, A.
intermedius, H. reuteri, T. palmi and T. tabaci were each comprised of two divergent
lineages indicating their status of species complexes. The DNA barcodes successfully
discriminated thrips to their morphological species. The study compiles the first
barcode reference library for thrips from Pakistan and connects regional lineages of
four important pest and virus-vectors with those from other countries by haplotype
networks.
Onion (Allium cepa L.) is an important vegetable crop in Pakistan and the
agro-ecological diversity in the country enables production of onions almost round the
year. According to the Food and Agricultural Organization (FAO), Pakistan is the
world’s fifth largest onion producer. While onion is known to be infected with a wide
range of viruses belonging to Potyvirus, carlavirus and tospovirus groups, little or no
information is available about the virus status on onions in Pakistan. Tospoviruses are
becoming increasingly important in many parts of the world and thrips-transmitted
Iris yellow spot virus (IYSV, family Bunyaviridae, genus Tospovirus) has become an
important constraint to production of Allium crops worldwide. IYSV is transmitted by
Chapter 6 General Discussion
118
T. tabaci and considering the high prevalence of T. tabaci in onion fields, surveyed
the onion bulb and seed crops for IYSV during March to May 2012. Onion plants
showing symptoms suspected to be caused by IYSV were found in farmers’ fields in
Faisalabad, Nankana, Sheikhupura, and Sialkot districts of Punjab. Approximately
60% of the fields surveyed had about 30% of the plants with IYSV symptoms that
included spindle-shaped, straw colored irregular chlorotic lesions with occasional
green islands on the leaves (Gent et al., 2006; Hall et al., 1993). The presence of
IYSV infection was confirmed first by ELISA and was verified by sequencing the
RT-PCR amplified N gene fragment. This is the first report of IYSV infecting onion
in Pakistan. Systematic and more extensive surveys are needed to assess the incidence
and impact of IYSV on onion bulb and seed crops in Pakistan so that appropriate
management tactics could be developed.
Following the identification of genetic characterization of IYSV from
Pakistan, a global genetic analysis of known IYSV nucleocapsid gene (N gene)
sequences was carried out to determine the comparative population structure, spatial
and temporal dynamics with reference to its genetic diversity and evolution. A total of
98 complete N gene sequences in GenBank from 23 countries were characterized by
in silico RFLP analysis. Based on RFLP, 94% of the isolates could be grouped into
NL or BR types while the rest belonged to neither group. The relative proportion of
NL and BR types was 46% and 48%, respectively. A temporal shift in the IYSV
genotypes with a greater incremental incidence of IYSVBR was found over IYSVNL
before 2005 compared to after 2005. The virus population had at least one
evolutionarily significant recombination event, involving IYSVBR and IYSVNL.
Codon substitution studies did not identify any significant differences among the
genotypes of IYSV. Similar studies on additional IYSV isolates from different parts
of the country could provide a better picture of the genetic diversity of IYSV in
Pakistan. RFLP of N gene would facilitate rapid identification of field-collected
isolates and grouping into one of the three groups.
Findings from the current study provided important information on thrips and
virus diversity at the molecular level and could provide a foundation to further expand
Chapter 6 General Discussion
119
these studies to generate a more comprehensive database. Information gained will be
useful in practical applications for developing thrips and virus management strategies.
RECOMMENDATIONS/ FUTURE WORK
During the past few years, thrips studies were focused on the pest thrips only
that was useful for agricultural entomologists but not for the students and researchers
who want to fully explore the thrips fauna in the region. Biological diversity of thrips
and there interaction with other organisms on field crops should be studied.
During the current study 53 thrips species were barcoded. These results
provide some information on thysanoptera fauna of Pakistan with support of existing
classification but clearly far more information is still needed to explore the highly
diverse thrips fauna from this area. A comprehensive survey should be conducted to
register still undocumented thrips species of Pakistan.
Molecular data of thrips vector species in current surveys have showed the
existence of cryptic species complexes which can be related to virus vector efficiency.
Population genetic structure of cryptic thrips vector species can be studied in relation
to their competency as a vector of Tospovirus. Investigations should concentrate on
correlation of different thrips species with transmission of different Tospovirus
species in Pakistan.
As it is the first ever study of Tospoviruses in Pakistan, researchers should
turn their focus on researching the presence and epidemiology of different Tospovirus
species in Pakistan to avoid a sudden disaster.
Additional studies should be conducted to assess the incidence of Iris yellow
spot virus and its impact on onion bulb and seed crops so that appropriate
management tactics could be developed.
Chapter 7 References
120
Chapter 7
REFERENCES
Achor, D.S., Childers, C.C., 1995. Fixation techniques for observing thrips
morphology and injury with electron microscopy, in: Thrips biology and
management. Springer, pp. 595-600.
Adkins, S., 2000. Tomato spotted wilt virus-positive steps towards negative success.
Mol. Plant Pathol. 1, 151-157.
Akram, W., 2000. Systematics of Thysanoptera of Pakistan. Ph.D. thesis, University
of Agriculture, Faisalabad, Pakistan. pp. 350.
Akram, W., Oh, S.W., Lee, J.J., 2002. Taxonomic review of the genus Mycterothrips
(Terebrantia: Thysanoptera) and its species from Pakistan. Entomolog. Res.
32, 251-254.
Akram, W., Koh, J.B., Lee, J.J., 2003a. Genus Thrips (Thysanoptera: Thripidae) from
Pakistan with most commonly recorded species. Korean J. Entomol. 33, 277-
286.
Akram, W., Shin, B.S., Lee, J.J., 2003b. Description of two genera of Idolothripinae
(Phlaeothripidae: Tubulifera: Thysanoptera) from Pakistan. Entomol. Res. 33,
53-57.
Alfredo, R., Francisco, R., Badenes, P., Anthony, M.S., 2007. Developing economic
thresholds for onion thrips in Honduras. Crop Prot. 26, 1099-1107.
Ali, R., 1976. Studies on Thripidae of Lyallpur. M.Sc. thesis, University of
Agriculture, Lyallpur, Pakistan. pp. 247.
Chapter 7 References
121
Amin, P.W., Reddy, D.V.R., Ghanekar, A.M., 1981. Transmission of tomato spotted
wilt virus, the causal agent of bud necrosis of peanut, by Scirtothrips dorsalis
and Frankliniella schultzei. Plant Dis. 65, 663-665.
Ananthakrishnan, T.N., 1969. Indian Thysanoptera. C.S.I.R. Zool. Monograph 1, 1-
171.
Ananthakrishnan, T.N., 1973. Mycophagous Tubulifera of India. Loyola College
Madras, Occ. Publications 2, 144.
Ananthakrishnan, T.N., 1978. Thrips galls and gall Thrips. Zool. Monograph 1, 1-69.
Ananthakrishnan, T.N., Jagadish A., 1970a. On three new species of Tubuliferous
Thysanoptera from Darjeeling. Ori. Ins. 4, 259-264.
Ananthakrishnan, T.N., Jagadish A., 1970b. The species of Diceratothrips Bagnall
and allied genera from India (Thysanoptera: Megathripinae; Insecta). Ori. Ins.
4, 265-280.
Ananthakrishnan, T.N., Sen, S., 1980. Taxonomy of Indian Thysanoptera. Zoological
Survey of India (Handbook Series), 1, 1-234.
Anfoka, G.H., Abhary, M., Stevens, M.R., 2006. Occurrence of Tomato spotted wilt
virus (TSWV) in Jordan. EPPO Bull. 36, 517-522.
Armstrong, K.F., Cameron, C.M., Frampton, E.R., 1997. Fruit fly (Diptera:
Tephritidae) species identification: a rapid molecular diagnostic technique for
quarantine application. Bull. Entomol. Res. 87, 111-118.
Armstrong, K.F., McHugh, P., Chinn, W., Frampton, E.R., Walsh, P.J., 2003.
Tussock moth species arriving on imported used vehicles determined by DNA
analysis. NZ Pl. Prot. 56, 16-20.
Armstrong, K.F., Ball, S.L., 2005. DNA barcodes for biosecurity: invasive species
identification. Philosophical Transactions of the Royal Society B: Biol. Sci.
360, 1813-1823.
Chapter 7 References
122
Ashfaq, M., Akhtar, S., Khan, A.M., Adamowicz, S.J., Hebert, P.D., 2013. DNA
barcode analysis of butterfly species from Pakistan points towards regional
endemism. Mol. Ecol. Res. 13, 832-843.
Ashfaq, M., Hebert, P.D.N., Mirza, J.H., Khan, A.M., Zafar, Y., Mirza, M.S., 2014a.
Analyzing mosquito (Diptera: Culicidae) diversity in Pakistan by DNA
barcoding. PLoS ONE, 9, e97268.
Ashfaq, M., Hebert, P.D.N., Mirza, M.S., Khan, A.M., Mansoor, S., Shah, G.S.,
Zafar, Y., 2014b. DNA barcoding of Bemisia tabaci complex (Hemiptera:
Aleyrodidae) reveals southerly expansion of the dominant whitefly species on
cotton in Pakistan. PLoS ONE, 9, e104485.
Asokan, R., Krishna Kumar, N.K., Kumar, V., Ranganath, H.R., 2007. Molecular
differences in the mitochondrial cytochrome oxidase I (mtCOI) gene and
development of a species-specific marker for onion thrips, Thrips tabaci
Lindeman, and melon thrips, T. palmi Karny (Thysanoptera: Thripidae),
vectors of tospoviruses (Bunyaviridae). Bull. Entomol. Res. 97, 461-470.
Bagnall, R.S., 1912. Some considerations in regard to the classification of the order
Thysanoptera. Ann. Mag. nat. Hist. 10, 220-222.
Bag, S., Druffel, K.L., Salewsky, T., Pappu, H.R., 2009a. Nucleotide sequence and
genome organization of the mediumRNA of Iris yellow spot virus (genus
Tospovirus, family Bunyaviridae) from the United States. Arch. Virol. 154,
715-718.
Bag, S., Rogers, P., Watson, R., Pappu, H.R., 2009b. First report of natural infection
of garlic with Iris yellow spot virus in the United States. Plant Dis. 93, 839.
Bag, S., Singh,J., Davis, R.M., Chounet, W., Pappu, H.R.,2009c. Iris yellow spot
virus in Nevada and Northern California. Plant Dis. 93, 674.
Bag, S., Druffel, K.L., Pappu, H.R., 2010. Structure and genome organization of the
large RNA of Iris yellow spot virus (genus Tospovirus, family Bunyaviridae).
Arch. Virol. 155, 275-279.
Chapter 7 References
123
Bag, S., Schwartz, H., Pappu, H.R., 2012. Identification and characterization of
biologically distinct isolates of Iris yellow spot virus (genus Tospovirus,
family Bunyaviridae), a serious pathogen of onion. Eur. J. Plant Pathol. 134,
97-104.
Bag, S., Rondon, S.I., Druffel, K.L., Riley, D.G., Pappu, H.R., 2013. Seasonal
Dynamics of Thrips (Thrips tabaci) (Thysanoptera: Thripidae) Transmitters of
Iris Yellow Spot Virus: A Serious Viral Pathogen of Onion Bulb and Seed
Crops. J. Econ. Entomol. 107, 75-82.
Bailey, S.F., 1939. The six-spotted thrips, Scolothrips sexmaculatus (Perg.). J. Econ.
Entomol. 32, 43-47.
Bailey, S.F., 1952. A review of the genus Stomatothrips Hood. Pan-Pacific Entomol.
28, 154-162.
Bailey, S.F., 1964. A revision of the genus Scirtothrips Shull. Hilgardia 35, 329-362.
Ball, S.L., Hebert, P.D., Burian, S.K., Webb, J.M., 2005. Biological identifications of
mayflies (Ephemeroptera) using DNA barcodes. J. NA Benthol. Soc. 508-524.
Bandla, M.D., Campbell, L.R., Ullman, D.E., Sherwood, J.L., 1998. Interaction of
tomato spotted wilt tospovirus (TSWV) glycoproteins with a thrips midgut
protein, a potential cellular receptor for TSWV. Phytopathology 88, 98-104.
Banerjee, S.K., Maulik, M., Manchanda, S.C., Dinda, A.K., Gupta, S.K., Maulik,
S.K., 2002. Dose-dependent induction of endogenous antioxidants in rat heart
by chronic administration of garlic. Life Sci. 70, 1509-1518.
Ben Moussa, A., Marrakchi, M., Makni, M., 2005. Characterisation of Tospovirus in
vegetable crops in Tunisia. Infec. Gen. Evol. 5, 312-322.
Bertin, S., Picciau, L., Ács, Z., Alma, A., Bosco, D., 2010. Molecular identification of
the Hyalesthes species (Hemiptera: Cixiidae) occurring in vineyard
agroecosystems. Ann. Appl. Biol. 157, 435-445.
Chapter 7 References
124
Best, R.J., 1968. Tomato spotted wilt virus. Adv. Vir. Res. 13, 65–145.
Bhatti, J.S., Ananthakrishan, T.N., 1975. The genus Merothrips in India
(Thysanoptera: Merothripidae). Ori. Ins. 9, 31-43.
Bhatti, J.S., 1980. Species of the genus Thrips from India (Thysanoptera). Syst.
Entomol. 5, 109-166.
Bhatti, J.S., 1982. Revision of the Indian species of Stenchaetothrips Bagnall
(Thysanoptera: Thripidae). Ori. Ins. 16, 385-417.
Bhatti, J.S., 1988. The orders Terebrantia and Tubulifera of the super order
Thysanoptera (Insecta). A Critical Appraisal, Zoology. J. Pure Appl. Zool. 1,
167-240.
Bhatti, J.S., 1989. The classification of Thysanoptera into families. Zoology 2, 1-23.
Bhatti, J.S., 1992. The Order Tubulifera (Insecta): Its characters and classification into
families. Zoology 3, 127-162.
Bhatti, J.S., 1998. New structural features in the order Tubulifera (Insecta). 1.
Amalgamation of labromaxillary complex with cranium and other cephalic
structures Zoology. J. Pure Appl. Zool. 5, 147-176.
Bhatti, J.S., 2006. The classification of terebrantia (insect) into families. Ori. Ins. 40,
339-375.
Bhatti, J.S., Mound, L.A., 1980. The genera of grass and cereal-feeding Thysanoptera
related to the genus thrips (Thysanoptera: Thripidae). Bull. Entomol. 21, 1-22.
Bickford, D., Lohman, D.J., Sodhi, N.S., Ng, P.K., Meier, R., Winker, K., Ingram,
K.K., Das, I., 2007. Cryptic species as a window on diversity and
conservation. Trends Ecol. Evol. 22, 148-155.
Chapter 7 References
125
Birthia, R., Subramanian, S., Pappu, H.R., Sseruwagi, P., Muthomi, J.W., Narla,
R.D., 2011. First report of Iris yellow spot virus infecting onion in Kenya and
Uganda. Plant Dis. 95, 1195.
Block, E., 1985. The chemistry of garlic and onions. Sci. America. 252, 94-99.
Block, E., Calvey, E.M., Gillies, J.Z., Uden, P., 1997. Peeling the onion. In: Johns, T.,
Romeo, J.T., (Eds) Functionality of food phytochemicals. Plenum, New York
1-30.
Bosco, L., Tavella, L., 2010. Population dynamics and integrated pest management of
Thrips tabaci on leek under field conditions in northwest Italy. Entomol. Exp.
Appl., 135, 276-287.
Bossuyt, F., Meegaskumbura, M., Beenaerts, N., Gower, D.J., Pethiyagoda,
R., Roelants, K., Mannaert, A., Wilkinson, M., Bahir, M.M., Manamendra-
Arachchi, K., Ng, P.K., Schneider, C.J., Oommen, O.V., Milinkovitch, M.C.,
2004. Local endemism within the Western Ghats-Sri Lanka biodiversity
hotspot. Science 306, 479-481.
Bradley, S.J., Mayer, D.F., 1994. Evaluation of monitoring methods for western
flower thrips, Frankliniella occidentalis (Thysanoptera: Thripidae), during the
blossom period of'Granny Smith'apples. J. Entomol. Soc. B.C. 91, 63-68.
Brodsgaard, H.F., 1994. Insecticide resistance in European and African strains of
western flower thrips (Thysanoptera: Thripidae) tested in a new residue-on-
glass test. J. Econ. Entomol. 87, 1141-1146.
Brittlebank, C.C., 1919. Tomato diseases. J. Agric. 17, 231-235.
Brunner, P.C., Fleming, C., Frey, J.E., 2002. A molecular identification key for
economically important thrips species (Thysanoptera: Thripidae) using direct
sequencing and a PCR‐RFLP‐based approach. Agric. Forest Entomol. 4, 127-
136.
Chapter 7 References
126
Brunner, P.C., Frey, J.E., 2004. Isolation and characterization of six polymorphic
microsatellite loci in the western flower thrips Frankliniella occidentalis
(Insecta, Thysanoptera). Mol. Ecol. Not. 4, 599-601.
Brunner, P.C., Chatzivassiliou, E.K., Katis, N.I., Frey, J.E., 2004. Host-associated
genetic differentiation in Thrips tabaci (Insecta; Thysanoptera), as determined
from mtDNA sequence data. Heredity 93, 364-370.
Buckman, R.S., Mound, L.A., Whiting, M.F., 2013. Phylogeny of thrips (Insecta:
Thysanoptera) based on five molecular loci. Syst. Entomol. 38, 123-133.
Bulajic, A., Jovic, J., Krnjajic, S., Petrov, M., Kjekic, I., Krstic, B., 2008. First report
of Iris yellow spot virus on onion (Allium cepa) in Serbia. Plant Dis. 92, 1247.
Burns, J.M., Janzen, D.H., Hajibabaei, M., Hallwachs, W., Hebert, P.D., 2007. DNA
barcodes of closely related (but morphologically and ecologically distinct)
species of skipper butterflies (Hesperiidae) can differ by only one to three
nucleotides. J. Lepid. Soc. 61, 138-153.
Carr, C.M., Hardy, S.M., Brown, T., Sheldon, T., Macdonald, T., Hebert, P.D.N.,
2011. A Tri-oceanic perspective: DNA barcoding reveals geographic structure
and cryptic diversity in Canadian polychaetes. PLoS ONE 6: e22232.
Carletto, J., Blin, A., Vanlerberghe-Masutti, F., 2009. DNA‐based discrimination
between the sibling species Aphis gossypii Glover and Aphis frangulae
Kaltenbach. Syst. Entomol. 34, 307-314.
Chatzivassiliou, E.K., Peters, D., Katis, N.I., 2002. The effciency by which Thrips
tabaci populations transmit Tomato spotted wilt virus depends on their host
preference and reproductive strategy. Phytopathology 92, 603-609.
Chatzivassiliou, E.K., Giavachtsia, V., Mehraban, A.H., Hoedjes, K., Peters, D., 2009.
Identification and incidence of Iris yellow spot virus, a new pathogen in onion
and leek in Greece. Plant Dis. 93, 761.
Chapter 7 References
127
Childers, C.C., Achor, D.S., 1991. Structure of the mouthparts of Frankliniella
bispinosa Morgan (Thysanoptera: Thripidae). Ann. Entomol. Soc. Am. 84,
272-282
Cho, J.J., Mau, R.F.L., Mitchell, W.C., Gonsalves, D., Yudin, L.S., 1987. Host list of
plants susceptible to tomato spotted wilt virus (TSWV). Univ. Hawaii, Coll
Tropical Agri. Res Ext. Ser. pp. 78.
Chu, F.H., Chao, C.H., Chung, M.H., Chen, C.C., Yeh, S.D., 2001. Completion of the
genome sequence of Watermelon silver mottle virus and utilization of
degenerate primers for detecting tospoviruses in five serogroups.
Phytopathology 91, 361-368.
Chowda-Reddy, R.V., Kirankumar, M., Seal, S.E., Muniyappa, V., Valand, G.B.,
Govindappa, M.R., Colvin, J., 2012. Bemisia tabaci phylogenetic groups in
India and the relative transmission efficacy of tomato leaf curl Bangalore virus
by an indigenous and an exotic population. J Integr Agric 11, 235-248.
Ciuffo, M., Finetti-Sialer, M.M., Gallitelli, D., Turina, M., 2005. First report in Italy
of a resistance-breaking strain of Tomato spotted wilt virus infecting tomato
cultivars carrying the Sw5 resistance gene. Plant pathol. 54, 564-564.
Colnago, P., Achigar, R., Gonzalez, P.H., Peluffo, S., Gonzalez, I.H., Pianzzola, M.J.,
Galvan, G.A., 2010. First report of Iris yellow spot viruson onion in
Uruguay. Plant Dis. 94, 786.
Córdoba-Sellés, C., Martínez-Priego, L., Muńoz-Gómez, R., Jordá-Gutiérrez, C.,
2005. Iris yellow spot virus: a new onion disease in Spain. Plant Dis. 89, 1243.
Cortês, I., Livieratos, I.C., Derks, A., Peters, D., Kormelink, R., 1998. Molecular and
serological characterization of Iris yellow spot virus, a new and distinct
tospovirus species. Phytopathology 88, 1276-1282.
Cortez, I., Aires, A., Pereira, A.M., Goldbach, R., Peters, D., Kormelink, R., 2002.
Genetic organisation of Iris yellow spot virus M RNA: indications for
Chapter 7 References
128
functional homology between the G (C) glycoproteinsof tospoviruses and
animal-infecting bunyaviruses. Arch. Virol. 147, 2313-2325.
Cosmi, T., Marchesini, E., Martini, G., 2003. Presence and spread of tospovirus and
thrip vectors in Veneto. InformatoreAgrario 59, 69-72.
Costa, F.O., deWaard, J.R., Boutillier, J., Ratnasingham, S., Dooh, R.T., Hajibabaei,
M., Hebert, P.D.N., 2007. Biological identification through DNA barcodes:
the case of Crustacea. Can. J. Fish. Aquat. Sci. 64, 272-295.
Cott, H.E., 1956. Systematics of the suborder Tubulifera (Thysanoptera) in California.
Pub. Entomol. Uni. Cal. 13, 1-216.
Coutts, B.A., McMichael, L.A., Tesoriero, L., Rodoni, B.C., Wilson, C.R., Wilson,
A.J., Perseley, D.M., Jones, R.A.C., 2003. Iris yellow spot virus found
infecting onions in three Australian states. Aus. Plant Path. 32, 555-557.
Cramer, C.S., Bag, S., Schwartz, H.F., Pappu, H.R., 2011. Susceptibility of onion
relative (Allium spp.) to Iris yellow spot virus. Plant Dis. 95, 1319.
Crespi, B.J., 1990. Subsociality and female reproductive success in a mycophagous
thrips: an observational and experimental analysis. J. Insect Behav. 3, 61-74.
Crespi, B.J., Carmean, D., Vawter, L., Von Dohlen, C., 1996. Molecular
phylogenetics of Thysanoptera. Syst. Entomol. 21, 79-87.
Crespi, B.J., Carmean, D., Chapman, T., 1997. The ecology and evolution of galling
thrips and their allies. Annu. Rev. Entomol. 42, 51-71.
Culbreath, A.K., Todd, J.W., Brown, S.L., 2003. Epidemiology and management of
tomato spotted wilt in peanut. Ann. Rev. Phytopathol. 41, 53-75.
Dasmahapatra, K.K., Mallet, J., 2006. DNA barcodes: recent successes and future
prospects. Heredity 97, 254-255.
Chapter 7 References
129
Daughtrey, M.L., Jones, R.K., Moyer, J.W., Daub, M.E., Baker, J.R., 1997.
Tospoviruses strike the greenhouse industry: INSV has become a major
pathogen on flower crops. Plant Dis. 81, 1220-1230.
Davies, H., King, N., Smith, R., 2004. Taxonomy: targeting invasives. BioNET
International. Available online at http://www.bionet-intl.
org/opencms/export/sites/de-fault/caseStudies/pdf/TTI_final. pdf (accessed 24
April 2012).
Davino, S., Panno, S., Rangel, E.A., Davino, M., Bellardi, M.G., Rubio, L., 2012.
Population genetics of Cucumber mosaic virus infecting medicinal, aromatic
and ornamental plants from northern Italy. Arch. Virol. 157, 739-739.
Dayrat, B., 2005. Towards integrative taxonomy. Biol. J. Linn. Soc. 85, 407-415.
Delfosse, P., Bashir, M., Malik, S.N., Reddy, A.S., 1995. Survey of groundnut virus
diseases in Pakistan. International Arachis Newsletter, 15, 51-52.
Deng, J., Yu, F., Zhang, T.X., Hu, H.Y., Zhu, C.D., Wu, S.A., Zhang, Y.Z., 2012.
DNA barcoding of six Ceroplastes species (Hemiptera: Coccoidea: Coccidae)
from China. Mol. Ecol. Res.12, 791-796.
Derks, A.F.L.M., Lemmers, M.E.C., 1996. Detection of tospoviruses in bulbous crops
and transmissibility by vegetative propagation. Acta Horticulture 432, 132-
137.
de Avila, A.C., Gama, M.I.C.S., Kitajima, E.W., Pereira, W., 1981. Um virus do
grupo viracabeca do tomateiro isolado de cebola (Allium cepa L.)
Fitopatologia Brasileira. 6, 525.
de Avila, A.C., de Haan, P., Kormelink, R., Resende, R.O., Goldbach, R.W., Peters,
D., 1993. Classification of tospoviruses based on phylogeny of nucleoprotein
gene sequences. J. Gen. Virol. 74, 153-159.
de Barro, P.J., 2012. The Bemisia tabaci species complex: questions to guide future
research. J Integr Agric 11, 187-196.
Chapter 7 References
130
de Barro, P.J., Ahmed, M.Z., 2012. Genetic networking of the Bemisia tabaci cryptic
species complex reveals pattern of biological invasions. PLoS ONE 6: e25579.
de Haan, P., Kormelink, R., Resende, R.O., van Poelwijk, F., Peters, D., Goldbach,
R., 1991. Tomato spotted wilt virus L RNA encodes aputative RNA
polymerase. J. Gen. Virol. 72, 2207-2216.
Dickey, A.M., Osborne, L.S., Vivek Kumar, Shatters, R.G., McKenzie, C.L., 2012.
Haplotype analysis of global chili thrips (Scirtothrips dorsalis) populations
using the metazoan barcode. In Entomology 2012, Annual meeting Entomol.
Soc. Am. Knoxville, TN.
Diffie, S., Edwards, G.B., Mound, L.A., 2008. Thysanoptera of Southeastern U.S.A:
A checklist for Florida and Georgia. Zootaxa 1787, 45-62.
Doi, M., Zen, S., Okuda, M., Nakamura, H., Kato, K., Hanada, K. 2003. Leaf necrosis
disease of lisianthus (Eustoma grandiflorum) caused by Iris yellow spot virus.
JPN. J. Phytopath. 69, 181-188.
du Toit, L.J., Burger, J.T., McLeod, A., Englebrecht, M., Viljoen, A., 2007. Iris
yellow spot virus in onion seed crops in South Africa. Plant Dis. 91, 1203.
Dugdale, J.S., Gleeson, D., Clunie, L.H. Holder, P.W., 2002. A diagnostic guide to
Tortricidae encountered in field surveys and quarantine inspections in New
Zealand. ISBN 0-478-07953-2: MAF NPPRL.
Edelson, J.V., Cartwright, B., Royer, T.A., 1986. Distribution and impact of Thrips
tabaci (Thysanoptera: Thripidae) on onion. J. Econ. Entomol. 79, 502-505.
Ekrem, T., Willassen, E., Stur, E., 2007. A comprehensive DNA sequence library is
essential for identification with DNA barcodes. Mol. Phylogen. Evol. 43, 530-
542.
Ellington, C.P., 1980. Wing mechanics and take-off preparation of Thrips
(Thysanoptera). J. Exp. Biol. 85, 129-136.
Chapter 7 References
131
Elliott, C., Poos, F.W., 1940. Seasonal development, insect vectors, and host range of
bacterial wilt of sweet corn. J. Agric. Res. 60, 645-686.
Elliott, R.M., 1990. Molecular biology of the Bunyaviridae. J. Gen. Virol. 71, 501-
522.
Elliott, R.M., 1996. The Bunyaviridae: concluding remarks and future prospects. In:
Elliott, R.M. (Ed.), The Bunyaviridae. Plenum Press, New York, pp. 295-332.
Elmeer, K., Almalki, A., Mohran, K.A., AL-Qahtani, K.N., Almarri, M., 2012. DNA
barcoding of Oryx leucoryx using the mitochondrial cytochrome C oxidase
gene. Gen. Mol. Res. 11, 539-547.
EPPO/CABI, 1996. Scirtothrips citri. Scirtothrips dorsalis. In: Quarantine pests for
Europe. 2nd edition (Ed. by Smith, I.M.; McNamara, D.G.; Scott, P.R.;
Holderness, M.). CAB International, Wallingford, UK.
Evans, C.K., Bag, S., Frank, E., Reeve, J.R., Drost, D., Pappu, H.R., 2009a. Natural
infection of Iris yellow spot virus in twoscale saltbush (Atriplex micrantha)
growing in Utah. Plant Dis. 93, 430.
Evans, C.K., Bag, S., Frank, E., Reeve, J.R., Ransom, C., Drost, D., Pappu, H.R.,
2009b. Green foxtail (Setaria viridis), a naturally infected grass host of Iris
yellow spot virus in Utah. Plant Dis. 93, 670.
Excoffier, L., Lischer, H.E.L., 2010. Arlequin suite ver 3.5: A new series of programs
to perform population genetics analyses under Linux and Windows. Mol.
Ecol. Res. 10, 5642567.
Fang, J., Kritzman, A., Yonash, N., Gera, A., Pollak, N., Lavi, U., 2005. Genetic
variation of thrips populations assessed by amplified fragment length
polymorphism (Thysanoptera: Thripidae). Ann. Entomol. Soc. Am. 98, 351-
358.
Farrar, J.J., Davis, R.M., 1991. Relationships among ear morphology, western flower
thrips, and Fusarium ear rot of corn. Phytopathology 81, 661-666.
Chapter 7 References
132
Fauquet, C.M., Mayo, M.A., 2001. The 7th ICTV report. Arch. Virol. 146, 189-194.
Fauquet, C.M., Mayo, M.A., Maniloff, J., Desselberger, U., Ball, L.A., 2005. Virus
taxonomy. VIIIth Report of ICTV. Academic Press, New York. pp.1259.
Fansiri, T., Fontaine, A., Diancourt, L., Caro, V., Thaisomboonsuk, B., Richardson,
J.H., Jarman, R.G., Ponlawat, A., Lambrechts, L., 2013. Genetic mapping of
specific interactions between Aedes aegypti mosquitoes and dengue viruses.
PLoS Genet 9, e1003621.
Fennah, R.G., 1965. The influence of environmental stress on the cacao tree in
predetermining the feeding sites of cacao thrips, Selenothrips rubrocinctus
(Giard), on leaves and pods. Bull. Entomol. Res. 56, 333-349.
Foottit, R.G., Maw, H.E.L., Von Dohlen, C.D., Hebert, P.D.N., 2008. Species
identification of aphids (Insecta: Hemiptera: Aphididae) through DNA
barcodes. Mol. Ecol. Res. 8, 1189-1201.
Fournier, F., Boivin, G., Stewart, R.K., 1995. Effect of Thrips tabaci (Thysanoptera:
Thripidae) on yellow onion yields and economic thresholds for its
management. J. Eco. Entomol. 88, 1401-1407.
Francki, R.I.B., Hatta, T., 1981. Tomato spotted wilt virus. In: Kurstak, E. (Ed.),
Handbook of plant virus infections and comparative diagnosis. Elsevier North-
Holland Biomedical Press, Amsterdam, pp. 492-522.
Frey, J.E., Frey, B., 2004. Origin of intra‐individual variation in PCR‐amplified
mitochondrial cytochrome oxidase I of Thrips tabaci (Thysanoptera:
Thripidae): mitochondrial heteroplasmy or nuclear integration? Hereditas 140,
92-98.
Frohlich, D.R., Torres-Jerez, I.I., Bedford, I.D., Markham, P.G., Brown, J.K., 1999. A
phylogeography analysis of the Bemisia tabaci species complex based on
mitochondrial DNA markers. Mol. Ecol. 8, 1683-1691.
Chapter 7 References
133
Fu, Y., Li, W.H., 1993. Statistical tests of neutrality of mutations. Genetics 133, 693-
709.
Fu, Y., 1997. Statistical tests of neutrality of mutations against population growth,
hitchhiking and background selection. Genetics 147, 915-925.
Gao, Y., Lei, Z., Reitz, S.R., 2012. Western flower thrips resistance to insecticides:
detection, mechanisms and management strategies. Pest. Manag. Sci. 68,
1111-1121.
Gariepy, T.D., Kuhlmann, U., Gillott, C., Erlandson, M., 2007. Parasitoids, predators
and PCR: the use of diagnostic molecular markers in biological control of
Arthropods. J. Appl. Entomol. 131, 225-240.
Gawande, S.J., Khar, A., Lawande, K.E., 2010. First report of Iris yellow spot
virus on garlic in India. Plant Dis. 94, 1066.
Gent, D.H., Schwartz, H.F., Khosla, R., 2004. Distribution and incidence of Iris
yellow spot virus in Colorado and its relation to onion plant population and
yield. Plant Dis. 88, 446-452.
Gent, D.H., du Toit, L.J., Fichtner, S.F., Krishna Mohan, S., Pappu, H.R., Schwartz,
H.F., 2006. Iris yellow spotvirus: an emerging threat to onion bulb and seed
production. Plant Dis. 90, 1468-1480.
Gent, D.H., Martin, R.R., Ocamb, C.M., 2007. First report of Iris yellow spot virus on
onion and leek in western Oregon. Plant Dis. 91, 468.
Gera, A., Cohen, J., Salomon, R., Raccah, B., 1998. Iris yellow spot tospovirus
detected in onion in Israel. Plant Dis. 82, 127.
Gera, A., Kritzman, A., Cohen, J., Raccah, B., Antignus, Y., 2000. Tospoviruses
infecting vegetable crops in Israel. EPPO Bull. 30, 289-292.
Chapter 7 References
134
Gerlach, S., Sengonca, C., 1985. Comparative studies on the effectiveness of the
predatory mite, Phytoselulus persimilis Athias-Henriot, and the predatory
thrips, Scolothrips longicornis Priesner. J. Plant Dis. Prot. 92, 138-146.
Gerlach, S., Sengonca, C., 1986. Feeding activity and effectiveness of the predatory
thrips, Scolothrips longicornis Priesner (Thysanoptera, Thripidae). J. Appl.
Entomol. 101, 444-452.
German, T.L., Ullman, D.E., Moyer, J.W., 1992. Tospoviruses: diagnosis, molecular
biology, phylogeny, and vector relationships. Ann. Rev. Phytopathol. 30, 315-
348.
Ghanekar, A.M., Reddy, D.V.R., Iizuka, N., Amin, P.W., Gibbons, R.W., 1979. Bud
necrosis of groundnut (Arachis hypogaea) in India caused by Tomato spotted
wilt virus. Ann. Appl. Biol. 93, 173-179.
Ghotbi, T., Shahraeen, N., Winter, S., 2005. Occurrence of tospoviruses in ornamental
and weed species in Markazi and Tehran provinces in Iran. Plant Dis. 89, 425-
429.
Gilstrap, F.E., 1995. Six-spotted thrips: a gift from nature that controls spider mites.
In: Thrips Biology and Management. pp. 305-316.
Glover, R.H., Collins, D.W., Walsh, K., Boonhum, N., 2010. Assessment of loci for
DNA barcoding in the genus Thrips (Thysanoptera: Thripidae). Mol. Ecol.
Res. 10, 51-59.
Goldbach, R., Peters, D., 1994. Possible causes of the emergence of tospovirus
diseases. In: Seminars in Virology, Academic Press. 5, 113-120.
Goldbach, R., Peters, D., 1996. Molecular and biological aspects of tospoviruses. In:
ElliottRM (Ed) the Bunyaviridae. Plenum Press, New York, pp. 129-157.
Golnaraghi, A.R., Shahraeen, N., Pourrahim, R., Ghorbani, S., Farzadfar, S., 2001.
First report of Tomato spotted wilt virus on soybean in Iran. Plant Dis. 85,
1290-1290.
Chapter 7 References
135
Gonzalez, D., Patterson, B.R., Leigh, T.F., Wilson, L.T., 1982. Mites: a primary food
source for two predators in San Joaquin Valley cotton. Calif. Agric. 36, 18.
Guralnick, R., Hill, A., 2009. Biodiversity informatics: automated approaches for
documenting global biodiversity patterns and processes. Bioinformatics 25,
421-428.
Gorinstein, S., Drzewiecki, J., Leontowicz, H., Leontowicz, M., Najman, K.,
Jastrzebski, Z., 2005. Comparison of the bioactive compounds and antioxidant
potentials of fresh and cooked Polish, Ukrainian, and Israeli garlic. J. Agric.
Food Chem. 53, 2726-2732.
Hafez, E.E., Abdelkhalek, A.A., El-Morsi, A.A., El-Sbahaby, O.A., 2011. First report
of Iris yellow spot virus infection of garlic and Egyptian leek in Egypt. Plant
Dis. 96,594.
Hajibabaei, M., Janzen, D.H., Burns, J.M., Hallwachs, W., Hebert, P.D.N., 2006.
DNA barcodes distinguish species of tropical Lepidoptera. Proceedings of the
National Academy of Sciences of the United States of America, 103, 968–971.
Haliday, A.H., 1836. An epitome of the British genera, in the Order Thysanoptera,
with indications of a few of the species. Entomol. Magaz. 3, 441.
Hall, J.M., Mohan, K., Knott, E.A., Moyer, J.W., 1993. Tospoviruses associated with
scape blight of onion (Allium cepa) seed crops in Idaho. Plant Dis. 77, 952
Hall, T.A., 1999. BioEdit: a user-friendly biological sequence alignment editor and
analysis program for Windows 95/98/NT Nucleic Acids Symposium Series,
41, 95-98.
Hallwass, M., Leastro, M.O., Lima, M.F., Inoue-Nagata, A.K., Resende, R.O., 2012.
Sequence determination and analysis of the NSs genes of two
tospoviruses. Arch. Virol. 157, 591-596.
Chapter 7 References
136
Hardy, V.G., Teakle, D.S., 1992. Transmission of sowbane mosaic virus by Thrips
tabaci in the presence and absence of virus-carrying pollen. Ann. Appl. Biol.
121, 315-320.
Hausmann, A., Godfray, H.C., Huemer, P., Mutanen, M., Rougerie, R., van
Nieukerken, E.J., Ratnasingham, S., Hebert, P.D., 2013. Genetic patterns in
European geometrid moths revealed by the Barcode Index Number (BIN)
system. PLoS One. 17, e84518.
Hazara, A.H., Shakeel, M., Khan, J., Iqbal, M., Khan, S., 1999a. Effect of non-
chemical methods and botanical insecticides on onion thrips, Thrips tabaci
Lind, (Thysanoptera: Thripidae) in onion crop in Balochistan. Sarhad J. Agric.
15, 619-624.
Hazara, A.H., Khan, J., Shakeel, M., 1999b. Integrated pest management on onion in
Pakistan. Newsletter, SAIC, Dhaka, Bangladesh. 9, 4.
Hebert, P.D., Cywinska, A., Ball, S.L., 2003a. Biological identifications through
DNA barcodes. P. Roy. Soc. Lond. B: Biol. Sci. 270, 313-321.
Hebert, P.D., Ratnasingham, S., de Waard, J.R., 2003b. Barcoding animal life:
cytochrome c oxidase subunit 1 divergences among closely related species. P.
Roy. Soc. Lond. B: Biol. Sci. 270, 96-99.
Hebert, P.D., Penton, E.H., Burns, J.M., Janzen, D.H., Hallwachs, W., 2004. Ten
species in one: DNA barcoding reveals cryptic species in the neo-tropical
skipper butterfly Astraptes fulgerator. P. Natl. Acad. Sci. Am. 101, 14812-
14817.
Heming, B.S., 1975. Antennal structure and metamorphosis in Frankliniella fusca
Hinds (Thripidae) and Haplothrips verbasci Osborn (Phlaeothripidae)
(Thysanoptera). Quaest. Entomol. 11, 25-68.
Chapter 7 References
137
Heming, B.S., 1978. Structure and function of the mouthparts in larvae of Haplothrips
verbasci Osborn (Thysanoptera, Tubulifera, Phlaeothripidae). J. Morphol. 156,
1-38.
Heming, B.S., 1993. Structure, function, ontogeny, and evolution of feeding in thrips
(Thysanoptera). Funct. Morphol. Insect Feeding, 3, 41.
Heming, B.S., 1995. History of the germ line in male and female thrips. In: Parker,
B.L, Skinner, M. and Lewis, T. (Eds) Thrips biology and management.
Plenum, New York, pp. 505-535.
Hoepting, C.A., Allen, J.K., Vanderkooi, K.D., Hovius, M.Y., Fuchs, M.F., Pappu,
H.R., McDonald, M.R., 2008. First report of Iris yellow spot virus on onion in
Canada. Plant Dis. 92, 318.
Hoddle, M.S., Mound, L.A., 2003. The genus Scirtothrips in Australia (Insecta,
Thysanoptera, Thripidae). Zootaxa 268, 1-40.
Hoddle, M.S., Oevering, P., Phillips, P.A., Faber, B.A., 2004. Evaluation of
augmentative release of Franklinothrips orizabensis for control of Scirtothrips
persea in California avocado orchards. Biol. Control 30, 456- 465.
Hoddle, M.S., Heraty, J.M., Rugman-Jones, P.F., Mound, L.A., Stouthamer, R., 2008.
Relationships among species of Scirtothrips (Thysanoptera: Thripidae,
Thripinae) using molecular and morphological data. Ann. Entomol. Soc.
Am. 101, 491-500.
Hoddle, M.S., Mound, L.A., Paris, D., 2008. Thrips of California. CBIT Publishing,
Queensland (CD-ROM).
Horie, T., Awazu, S., Itakura, Y., Fuwa, T., 1992. Identified diallylpolysulfides from
an aged garlic extract which protects the membranes from lipid peroxidation.
Planta Med. 58, 468-469.
Chapter 7 References
138
Huchette, O., Bellamy, C., Filomenko, R., Pouleau, B., Seddas, S., Pappu, H.R.,
2008. Iris yellow spot virus on shallot and onion in France. Plant Health
progress pp. 0610-01.
Hudson, R.R., 2000. A new statistic for detecting genetic differentiation. Genetics
155, 2011-2014.
Hudson, R.R., Boos, D.D., Kaplan, N.L., 1992a. A statistical test for detecting
geographic subdivision. Mol. Biol. 9, 138-151.
Hudson, R.R., Slatkin, M., Maddison, W.P., 1992b. Estimations of levels of gene
flow from DNA sequence data. Genetics 132, 583-589.
Hunter, W.B., Ullman, D.E., 1989. Analysis of mouthpart movements during feeding
of Frankliniella occidentalis (pergande) and F. schultzei (trybom)
(Thysanoptera: Thripidae). Int. J. Insect morphol. Embryo. 18, 161-171.
Hunter, W.B., Ullman, D.E., 1992. Anatomy and ultrastructure of the piercing-
sucking mouthparts and paraglossal sensilla of Frankliniella occidentalis
(Pergande) (Thysanoptera: Thripidae). Int. J. Insect morphol. Embryo. 21, 17-
35.
Iftikhar, R., Bag, S., Ashfaq, M., Pappu, H.R., 2013. First Report of Iris yellow spot
virus Infecting Onion in Pakistan. Plant Dis. 97, 1517-1517.
Jacobson, A.L., Booth, W., Vargo, E.L., Kennedy, G.G., 2013. Thrips tabaci
Population Genetic Structure and Polyploidy in Relation to Competency as a
Vector of Tomato Spotted Wilt Virus. PloS one 8, e54484.
Jacobson, A.L., Kennedy, G.G., 2013. Specific insect-virus interactions are
responsible for variation in competency of different Thrips tabaci isolines to
transmit different Tomato spotted wilt virus isolates. PloS one 8, e54567.
Janzen, D.H., Hallwachs, W., Blandin, P. JOHN M. BURNS3, Cadiou, J.M., Chacon,
I., Dapkey, T., Deans, A.R., Epstein, M.E., Espinoza, B., Franclemont, J.G.,
Haber, W.A., Hajibabaei, M., Hall, J.P.W., Hebert, P.D.N., Gauld, I.D.,
Chapter 7 References
139
Harvey, D.J., Hausmann, A., Kitching, I.J., Lafontaine, D., Landry, J.F.,
Lemaire, C., Miller, J.Y., Miller, J.S., Miller, L., Miller, S.E., Montero, J.,
Munroe, E., Green, S.R., Ratnasingham, S., Rawlins, J.E., Robbins, R.K.,
Rodriguez, J.J., Rougerie, R., Sharkey, M.J., Smith, M.A., Solis, M.A.,
Sullivan, J.B., Thiaucourt, P., Wahl, D.B., Weller, S.J., Whitfield, J.B.,
Willmott, K.R., Wood, D.M., Woodley, N.E., Wilson, J.J., 2009. Integration
of DNA barcoding into an ongoing inventory of complex tropical
biodiversity. Mol. Ecol. Res. 9, 1-26.
Janzen, D.H., Hajibabaei, M., Burns, J.M., Hallwachs, W., Remigio, E., Hebert,
P.D.N., 2005. Wedding biodiversity inventory of a large and complex
Lepidoptera fauna with DNA barcoding. Philosophical Transactions of the
Royal Society B: Biol. Sci. 360, 1835-1845.
Jarman, S.N., Elliott, N.G., 2000. DNA evidence for morphological and cryptic
Cenozoic speciations in the Anaspididae, 'living fossils' from the Triassic. J.
Evol. Biol. 13, 624-633.
Jenser, G., Gaborjanyi, R., Szenasi, A., Almasi, A., Grasselli, M., 2003. Significance
of hibernated Thrips tabaci Lindeman (Thysan., Thripidae) adults in the
epidemic of tomato spotted wilt virus. J. Appl. Entomol. 127, 7-11.
Johansen, R.M., Mojica-Guzman, A., 1999. The genus Scirtothrips Shull, 1909
(Thysanoptera: Thripidae, Sericothripini), in Mexico. Folia entomol. Mex.
104, 23-108.
Jones, D.R., 2005. Plant viruses transmitted by thrips. Eur. J. Plant Pathol. 113, 119-
157
Kadirval, P., Srinivasan, R., Hsu, Y.C., Su, F.C., Pena, R.D.L., 2013. Application of
Cytochrome Oxidase I Sequences for Phylogenetic Analysis and Identification
of Thrips Species Occurring on Vegetable Crops. J. Econ. Entomol. 106, 408-
418.
Chapter 7 References
140
Kamburov, S.S., 1991. Damage to fruit and the impact on crop-set from late
infestations of citrus thrips (Scirtothrips aurantii Faure). Citrus J. 1, 33-34.
Karimi, J., Hassani-Kakhki, M., Awal, M.M., 2010. Identifying thrips (Insecta:
Thysanoptera) using DNA Barcodes. J. Cell Mol. Res. 2, 35-41.
Kimura, M., 1980. A simple method for estimating evolutionary rates of base
substitutions through comparative studies of nucleotide sequences. J. Mol.
Evol. 16, 111-120.
Kirk, W., 1984. Pollen‐feeding in thrips (Insecta: Thysanoptera). J. Zool. 204, 107-
117.
Kirk, W.D., 1985. Pollen‐feeding and the host specificity and fecundity of flower
thrips (Thysanoptera). Ecol. Entomol. 10, 281-289.
Kirk, W., 1995. Feeding behavior and nutritional requirements. In: Parker, B.L.,
Skinner, M. and Lewis, T. (eds) Thrips Biology and Management. Plenum
Press, New York, pp. 21-29.
Knowlton, N., 1993. Sibling species in the sea. Ann. Rev. Ecol. Syst. 24, 189-216.
Kox, L.F.F., Van Den Beld, H.E., Zijlstra, C., Vierbergen, G., 2005. Real‐time PCR
assay for the identification of Thrips palmi. EPPO Bull. 35, 141-148.
Krauthausen, H.J., Gabriele, M.E.L., Muller, J., Radtke, P.C., Jehle J.A., 2012.
Identification and incidence of Iris yellow spot virus in Allium field crops in
Southwest Germany. Eur. J. Plant Path. 134, 345-356.
Kritzman, A., Beckelman, H., Alexandrov, S., Cohen, J., Lampel, M., Zeidan, M.,
Raccah, B., Gera, A., 2000. Lisianthus leaf necrosis: A new disease of
lisianthus caused by Iris yellow spot virus. Plant Dis. 84, 1185-1189.
Kumar, N.K., Ullman, D.E., Cho, J.J., 1995. Frankliniella occidentalis
(Thysanoptera: Thripidae) landing and resistance to tomato spotted wilt
tospovirus among Lycopersicon accessions with additional comments on
Chapter 7 References
141
Thrips tabaci (Thysanoptera: Thripidae) and Trialeurodes vaporariorum
(Homoptera: Aleyrodidae). Environ. Entomol. 24, 513-520.
Kumar, N.K.K., Rawal, R.D., 1999. Onion thrips, Thrips tabaci, a vector of onion
tospovirus. Insect Environ. 5, 52.
Kunkalikar, S.R., Poojari, S., Arun, B.M., Rajagopalan, P.A., Chen, T.C., Yeh, S.D.,
Naidu, R.A., Zehr, U.B., Ravi, K.S., 2011. Importance and genetic diversity of
vegetable-infecting tospoviruses in India. Phytopathology 101, 367-376.
Landry, J.F., Hebert, P.D.N., 2013. Plutella australiana (Lepidoptera, Plutellidae), an
overlooked diamondback moth revealed by DNA barcodes. Zookeys 29, 43-
63.
Latham, L.J., Jones, R.A.C., 1997. Occurrence of tomato spotted wilt Tospovirus in
native flora, weeds, and horticultural crops. Aust. J. Agric. Res. 48, 359-369.
Lee, W., Kim, H., Lim, J., Choi, H.R., Kim, Y., Kim, Y.S., Ji, J.Y., Foottit, R.G., Lee,
S., 2011. Barcoding aphids (Hemiptera: Aphididae) of the Korean Peninsula:
updating the global data set. Mol. Ecol. Res. 11, 32-37.
Legg, J.P., French, R., Rogan, D., Okao-Okuja, G., Brown, J.K., 2002. A distinct
Bemisia tabaci (Gennadius) (Hemiptera: Sternorrhyncha: Aleyrodidae)
genotype cluster is associated with the epidemic of severe cassava mosaic
virus disease in Uganda. Mol. Ecol. 11, 1219-1229.
Lewis, T., 1965. The species, aerial density and sexual maturity of Thysanoptera
caught in mass flights. Ann. Appl. Biol. 55, 219- 225.
Lewis, T., 1973. Thrips, their biology, ecology and economic importance. Academic
press, New York, pp. 349.
Lewis, T., 1997. Thrips as crop pests. CAB International, New York, USA. pp. 203.
Librado, P., Rozas, J., 2009. DnaSP v5: a software for comprehensive analysis of
DNA polymorphism data. Bioinformatics 25, 1451-1452.
Chapter 7 References
142
Lin, Y.H., Chen, T.C., Hsu, H.T., Liu, F.L., Chu, F.H., Chen, C.C., Lin, Y.Z., Yeh, S.
D., 2005. Serological comparison and molecular characterization for
verification of Calla lily chlorotic spot virus as a new tospovirus species
belonging to Watermelon silver mottle virus serogroup. Phytopathology 95,
1482-1488.
Linford, M.B., 1931. Further studies of the transmission of the pineapple yellow spot
virus by Thrips tabaci. Phytopathology 21, i5.
Lobin, K., Saison, A., Hostachy, B., Benimadhu, S.P., Pappu, H.R., 2010. First report
of Iris yellow spot virus in onion in Mauritius. Plant Dis. 94, 645
Löbl, I., Leschen, R.A., 2005. Demography of coleopterists and their thoughts on
DNA barcoding and the Phylocode, with commentary. Coleopt. Bull. 59, 284-
292.
Lone, Bhagat, 1984.Thrips of Kashmir valley, India new records and host range
Geobios new Reports 3, 101 - 103.
Lone, Bhagat, 1986. Dendrothrips saltator Uzel, a new record from India
(Thysanoptera : Thripidae). Zoology 1, 93-95.
Ly, T.N., Hazama, C., Shimoyamada, M., Ando, H., Kato, K., Yamauchi, R., 2005.
Antioxidative compounds from the outer scales of onion. J. Agri. Food Chem.
53, 8183-8189.
Mackie, W.W., Smith, F.L., 1935. Evidence of field hybridization in beans. J. Am.
Soc. Agron. 27, 903-909.
MacIntyre Allen, J.K., Scott-Dupree, C.D., Tolman, J.H., Harris, C.R., 2005.
Resistance of Thrips tabaci to pyrethroid and organophosphorus insecticides
in Ontario, Canada. Pest Manag. Sci. 61, 809-815.
Mainali, B.P., Shrestha, S., Lim, U.T., Kim, Y., 2008. Molecular markers of two
sympatric species of the genus Frankliniella (Thysanoptera: Thripidae). J.
Asia-Pac. Entomol. 11, 45-48.
Chapter 7 References
143
Mandal, B., Pappu, H.R., Csinos, A.S., Culbreath, A.K., 2006. Response of peanut,
pepper, tobacco, and tomato cultivars to two biologically distinct isolates of
Tomato spotted wilt virus. Plant Dis. 90, 1150-1155.
Mandal, B., Jain, R.K., Krishnareddy, M., Krishna Kumar, N.K., Ravi, K.S., Pappu,
H.R., 2012. Emerging problems of Tospoviruses (Bunyaviridae) and their
management in the Indian Subcontinent. Plant Dis. 96, 468-479.
Margaria, P., Ciuffo, M., Turina, M., 2004. Resistance breaking strain of Tomato
spotted wilt virus (Tospovirus; Bunyaviridae) on resistant pepper cultivars in
Almería, Spain. Plant Pathol. 53, 795-795.
Martin, D.P., Lemey, P., Lott, M., Moulton, V., Posada, D., Lefeuvre, P., 2010.
RDP3: a flexible and fast computer program for analyzing recombination.
Bioinformatics 26, 2462-2463.
Massumi, H., Samei, A., Pour, A. H., Shaabanian, M., Rahimian, H., 2007.
Occurrence, distribution, and relative incidence of seven viruses infecting
greenhouse-grown cucurbits in Iran. Plant Dis. 91, 159-163.
Massumi, H., Shaabanian, M., Pour, A.H., Heydarnejad, J., Rahimian, H., 2009.
Incidence of viruses infecting tomato and their natural hosts in the southeast
and central regions of Iran. Plant Dis. 93, 67-72.
Masumoto, M., Okajima, S., 2005. Trichromothrips Priesner (Thysanoptera,
Thripidae) of Japan and Taiwan, with descriptions of four new species and a
review of the Trichromothrips group of genera. Zootaxa 1082, 1-27.
Masumoto, M., Okajima, S., 2006. A revision of and key to the world species of
Mycterothrips Trybom (Thysanoptera, Thripidae). Zootaxa 1261, 1-90.
Masumoto, M., 2010. Key to genera of the subfamily Thripinae (Thysanoptera:
Thripidae) associated with Japanese plant quarantine. Res. Bull. Plant Protec.
Japan 46, 25-59.
Chapter 7 References
144
Mavric, I., Ravnikar, M., 2000. Iris yellow spot tospovirus in Slovenia. in: Proc.
5th
Congress of the Eur. Found. Plant Pathol., Taormina, It. pp 223-225.
Meier, R., Shiyang, K., Vaidya, G., Ng, P.K., 2006. DNA barcoding and taxonomy in
Diptera: a tale of high intraspecific variability and low identification
success. Syst. Boil. 55, 715-728.
Meier, R., Zhang, G., Ali, F., 2008. The use of mean instead of smallest interspecific
distances exaggerates the size of the “barcoding gap” and leads to
misidentification. Syst. Biol. 57, 809-813.
Meyer, C.P., Paulay, G., 2005. DNA barcoding: error rates based on comprehensive
sampling. PLoS boil. 3, e422.
Mikkelsen, N.T., Schander, C., Willassen, E., 2007. Local scale DNA barcoding of
bivalves (Mollusca): a case study. Zoologica Scripta 36, 455-463.
Mitchell, F.L., Lowry, V.K., Kresta, K.K., Smith J.W., 1995. Histological study of
tobacco thrips feeding on peanut foliage. In: Parker, B.L., Skinner, M., Lewis,
T. (Eds) Thrips Biology and Management. Plenum Press, New York, pp. 175-
178.
Mirab-balou, M., Minaei, K., Chen, X.X., 2013. An illustrated key to the genera of
Thripinae (Thysanoptera, Thripidae) from Iran. ZooKeys 317, 27.
Mollema, C., Steenhuis, G., Inggamer, H., 1995. Genotypic effects of cucumber
responses to infestation by western flower thrips. In: Parker, B.L., Skinner,
M., Lewis, T. (Eds) Thrips Biology and Management. Plenum Press, New
York, pp. 397-401.
Moritz, G., 1982. Zur Morphologie und Anatomie des Fransenflügers Aeolothrips
intermedius Bagnall 1934 (Aeolothripidae, Thysanoptera, Insecta). 1.
Mitteilung: Der Kopf. Zoologische Jahrbücher Abteilung für Anatomie und
Ontogenie der Tiere 107, 557e608.
Chapter 7 References
145
Moritz, G., 1989. The ontogenesis of Thysanoptera (Insecta) with special reference to
the Panchaetothripine Hercinothrips femoralis (OM REUTER, 1891)
(Thysanoptera, Thripidae, Panchaetothripinae). Zoologische Jahrbücher
Anatomie 118, 393-429.
Moritz, C.D., Paulsen, M., Mound, L.A., Burgermeister, W., 2000. Modern methods
in thrips identification and information (Insecta: Thysanoptera). Eppo Bull. 30,
591-593.
Moritz, G., Morris, D.C., Mound, L.A., 2001. Thrips ID – Pest Thrips of the World.
CD-Rom Published for ACIAR by CSIRO Publishing, Melbourne.
Moritz, G., Mound, L.A., Morris, D.C., Goldarazena, A., 2004. Pest thrips of the
world. An identification and information system using molecular and
microscopical methods. CD-ROM published by Centre for Pest Information
Technology and Transfer, The University of Queensland, Brisbane, Australia.
Morris, D.C., Mound, L.A., 2004. Molecular relationships between populations of
South African citrus thrips (Scirtothrips aurantii Faure) in South Africa and
Queensland, Australia. Aus. J. Entomol. 43, 353-358.
Mound, L.A., 1971. The feeding apparatus of thrips. Bull. Entomol. Res. 60, 547-548.
Mound, L.A., 1972. Species complexes and the generic classification of leaf-litter
thrips of the tribe Urothripini (Phlaeothripidae). Aust. J. Zool. 20, 83-103.
Mound, L.A., 1973. Thrips and whitefly. In :Gibbs , A.J (ed.) , viruses and
invertebrates. North Holland publ. Co. pp 230-242.
Mound, L.A., ONeill, K., 1974. Taxonomy of the Merothripidae, with ecological and
phylogenetic considerations (Thysanoptera). J. Nat. Hist. 8, 481-509.
Mound, L.A., 1976a. Thysanoptera of the genus Dichromothrips on old world
Orchidaceae. Biol. J. Linn. Soc. Lond. 8, 245-265.
Chapter 7 References
146
Mound, L.A., 1976b. The identity of the green house thrips Heliothrips
haemorroidalis (Bouche`) (Thysanoptera) and the taxonomic significance of
spanadric males. Bull. Entomol. Res. 66, 179-180.
Mound, L.A., Heming, B.S., Palmer, J.M., 1980. Phylogenetic relationships between
the families of recent Thysanoptera (Insecta). Zool. J. Linn. Soc. 69, 111-141.
Mound, L.A., Palmer, J.M., 1981. Identfication, distribution, and host-plants of the
pest species of Scirtothrips (Thysanoptera: Thripidae). Bull. Entomol. Res. 71,
467–479.
Mound, L.A., Palmer, J.M., 1983. The generic and tribal classification of Spore-
feeding Thysanoptera (Phlaeothripidae: Idolothripinae). Bull. Br. Mus. (Nat.
Hist.) Entomol. 46, 1-174.
Mound, L.A., 1992. Patterns of sexuality in Thysanoptera. In: Cameron, E.A., Teulon,
D.A., McCormick, L.H., Kolb, T.E., (Eds) The 1991 Conference on Thrips
(Thysanoptera): Insect and Disease Considerations in Sugar Maple
Management. GTR, NE 161, US Department of Agriculture, Radnor, pp. 2-14.
Mound, L.A., 1994. Thrips and gall induction: a search for patterns. In: Williams,
M.A.J. (ed.) Plant Galls. Systematics association special volume, Clarendon
Press, Oxford, 49, pp. 131-149.
Mound, L.A., Teulon, D.A., 1995. Thysanoptera as phytophagous opportunists. In:
Parker, B.L., Skinner, M., Lewis, T., (Eds) Thrips biology and management.
Plenum, New York, pp. 3-20.
Mound, L.A., 1996. The Thysanoptera vector species of tospoviruses. Acta Horticult.
431, 298-309.
Mound, L.A., Marullo, R., 1996. The Thrips of central and South America: An
Introduction. Mem. Entomol. Int. 6, 1-487.
Mound, L.A., Marullo, R., 1998. Biology and identification of Aeolothripidae
(Thysanoptera) in Australia. Invertebr. Syst. 12, 929-950.
Chapter 7 References
147
Mound, L.A., Kibby, G., 1998. Thysanoptera: An Identification Guide. 2nd Ed.
CABI, Oxford and New York, pp. 70.
Mound, L.A., Zur Strassen, R., 2001. The genus Scirtothrips (Thysanoptera:
Thripidae) in Mexico: a critique of the review by Johansen & Mojica-Guzmán
(1998). Folia Entomol. Mex, 40(1), 133-142.
Mound, L.A., 2002. So many thrips—so few tospoviruses? In Mound, L.A., Marullo,
R., (eds.), Thrips and Tospoviruses: Proceedings of the 7th International
Symposium on Thysanoptera. CSIRO Entomology, Reggio Calabria, Italy. pp.
15-18.
Mound, L.A., 2005. Thysanoptera: diversity and interactions. Ann. Rev. Entomol. 50,
247-269.
Mound, L.A., Masumoto, M., 2005. The genus Thrips (Thysanoptera, Thripidae) in
Australia, New Caledonia and New Zealand. Zootaxa 1020, 1-64.
Mound, L.A., Morris, D.C., 2007. The insect order Thysanoptera: classification
versus systematic. In Zhang, Z.Q., Shear, W.A., (Eds), Linnaeus Tercentenary:
Progress in invertebrate Taxonomy. Zootaxa 1668, 1-766.
Mound, L.A., Minaei, K., 2007. Australian thrips of the Haplothrips lineage (Insecta:
Thysanoptera). J. Nat. Hist. 41, 2919-2978.
Mound, L.A., Ng, Y.F., 2009. An illustrated key to the genera of Thripinae
(Thysanoptera) from South East Asia. Zootaxa 2265, 27-47.
Mound, L.A., Wheeler, G.S., Williams, D.A., 2010. Resolving cryptic species with
morphology and DNA; thrips as a potential biocontrol agent of Brazilian
peppertree, with a new species and overview of Pseudophilothrips
(Thysanoptera). Zootaxa 2432, 59-68.
Mound, L.A., 2011. Species recognition in the genus Scolothrips (Thysanoptera,
Thripidae), predators of leaf-feeding mites. Zootaxa 2797, 45-53.
Chapter 7 References
148
Mound, L.A., 2014. Thysanoptera (Thrips) of the world- a checklist. Available from:
http:// www.ento.csiro.au/thysanoptera/worldthrips.html Captured on 20
March 2014.
Moyer, J.W., 1999. Tospoviruses (Bunyaviridae). In Encyclopedia of Virology: Eds
Webster, R. G., Granoff, A. New York: Academic Press. pp. 1803-1807.
Moyer, J.W., 2000. Tospoviruses. In: Hull, R. (Ed.), Encyclopedia of Microbiology.
Academic Press, 4, 592–597.
Mullis, S.W., Gitaitis, R.D., Nischwitz, C., Csinos, A.S., Rafael Mallaupoma, Z.C.,
Inguil Rojas, E.H., 2006. First report of onion (Allium cepa) naturally infected
with Iris yellow spot virus in Peru. Plant Dis. 90, 377.
Mumford, R.A, Barker, I., Wood, K.R., 1994. The detection of tomato spotted wilt
virus using the polymerase chain reaction. J. Virol. Meth. 46, 303-311.
Mumford, R.A., Barker, I., Wood, K.R., 1996. The Biology of the Tospoviruses. Ann.
Appl. Biol., 128, 159-183.
Murai, T., Toda, S., 2001. Variation of Thrips tabaci in colour and size. In: Thrips and
Tospoviruses: in Proceedings of the 7th International Symposium on
Thysanoptera. 1–8 July 2001, Reggio Calabria, Italy. pp. 377-378.
Muraleedharan, 1982. Studies on Thysanoptera of N-E. India. 4 Tubulifera from
Manipur. Rec. Zool. Sur. India.79, 373-384.
Mustafa, T.M., 1986. Spatial distribution of onion Thrips and cabbage aphid on and
response to some crucifcrous crop plant. J. Plant Dis. Protect. 93, 271-277.
Mutanan, M., Hausmann, A., Hebert, P.D., Landry, J.F., de Waard, J.R., Huemer, P.,
2013. Allopatry as a gordian knot for taxonomists: patterns of DNA barcode
divergence in arctic-alpine lepidoptera. PLoS One 7, e47214.
Chapter 7 References
149
Nagata, T., Almeida, A.C.L., Resende, R.D.O., DeÁvila, A.C., 2004. The competence
of four thrips species to transmit and replicate four tospoviruses. Plant pathol.
53, 136-140.
Nakahara, S., 1991. Systematic of Thysanoptera Pear-Thrip and other economic
species U.S Department of Agriculture , Forest service , North eastern Forest
experiment station. Technical Bull. pp. 41-59.
Nakahara, S., 1994. The genus Thrips Linnaeus (Thysanoptera: Thripidae) of the New
World. United States Department of Agriculture. Technical Bull. 1822, 1-183.
Naro‐Maciel, F., Reid, B., Fitzsimmons, N.N., Le, M., Desalle, R., Amato, G., 2010.
DNA barcodes for globally threatened marine turtles: a registry approach to
documenting biodiversity. Mol. Ecol. Res. 10, 252-263.
Nichol, S.T., Beaty, B.J., Elliott, R.M., Goldbach, R., Plyusnin, A., Schmaljohn, C.S.,
Tesh, R.B., 2005. Bunyaviridae. In: Fauquet, C.M., Mayo, M.A., Maniloff, J.,
Desselberger, U., Ball, L.A. (Eds) Virustaxonomy: VIIIth report of the ICTV.
Elsevier/Academic Press, San Diego, pp. 695–716.
Nieukerken, E.V., Doorenweerd, C., Stokvis, F.R., Groenenberg, D.S.J., 2012. DNA
barcoding of the leaf-mining moth subgenus Ectoedemia s. str. (Lepidoptera:
Nepticulidae) with COI and EF1-α: two are better than one in recognising
cryptic species. Contrib. Zool. 81, 1-24.
Nischwitz, C., Pappu, H.R., Mullis, S.W., Sparks, A.N., Langston, D.R., Csinos, A.S.,
Gitaitis, R.D., 2007. Phylogenetic analysis of Iris yellow spot virus isolates
from onion (Allium cepa) in Georgia and Peru. J. Phyt. 155, 531-535.
Nuutila, A.M., Puupponen-Pimiä, R., Aarni, M., Oksman-Caldentey, K.M., 2003.
Comparison of antioxidant activity of onion and garlic extracts by inhibition
of lipid peroxidation and radical scavenging activity. Food Chem. 81, 485-
493.
Chapter 7 References
150
Ohnishi, J., Katsuzaki, H., Tsuda, S., Sakurai, T., Akutsu, K., Murai, T., 2006.
Frankliniella cephalica, a new vector for Tomato spotted wilt virus. Plant Dis.
90, 685-685.
Okuda, M., Hanada, K., 2001. RT-PCR for detecting five distinct Tospovirus species
using degenerate primers and dsRNA template. J. Virol. Meth. 96, 149-156.
OEPP/EPPO, 1989. Data sheets on quarantine organisms No. 175, Thrips palmi.
Bulletin OEPP/EPPO Bulletin 19, 717-720.
Paliwal, Y.C., 1974. Some properties and thrip transmission of tomato spotted wilt
virus in Canada. Can. J. Bot. 52, 1177-1182.
Paliwal, Y.C., 1976. Some characteristics of the thrips vector relationship of tomato
spotted wilt virus in Canada. Can. J. Bot. 54, 402-05.
Palmer, J.M., Mound, L.A., 1978. Nine genera of fugus-feeding Phlaeothripidae
(Thysanoptera) from the oriental Region. Bull. Br. Mus. (Nat. Hist.) Entomol.
37, 153-215.
Palmer, J.M., 1987. Megalurothrips in the flowers of tropical legumes: a
morphometric study. In: Holman, J., Pelikan, J., Dixon, A.F.G., Weismann, L.,
(Eds). Population structure, genetics and taxonomy of aphids and
Thysanoptera. The Hague (SPB Academic Publishing), pp. 480-495.
Palmer, J., Mound, L.A., Heaume, G.J., 1989. IIE Guides to insects of importance to
man. In: Betts, C.R. (ed.), Thysanoptera. CAB International, Wallingford, UK.
pp. 73.
Palmer, J.M., Reddy, D.V.R., Whiteman, J.A., Rao, G.V.R., 1990. New information
on the thrips vectors of tomato spotted wilt virus in groundnut crops in India.
Int. Arachis news letter, 7, 24-25.
Palmer, J.M., Mound, L.A., 1990. Thysanoptera. In: Rosen, D., (ed.) The Armored
Scale Insects, Their Biology, Natural Enemies and Control, B. Elsevier
Science Publishers, Amsterdam, pp. 67-76.
Chapter 7 References
151
Palmer, J.M., 1992. Thrips (Thysanoptera) from Pakistan to the Pacific: A review.
Bull. Br. Mus. (Nat. Hist.) Entomol. Series 61.
Pappu, H.R., 1997. Managing tospoviruses through biotechnology: progress and
prospects. Biotechnology and Development Monitor, 32, 1417.
Pappu, H.R., du Toit, L.J., Schwartz, H.F., Mohan, K., 2006. Sequence diversity of
the nucleoprotein gene of Iris yellow spot virus (genus Tospovirus, family
Bunyaviridae) isolates from the western region of the United States. Arch.
Virol. 151, 1015-1023.
Pappu, H.R., 2008. Tomato spotted wilt virus (Bunyaviridae), In Mahy, B.W.J., van
Regenmortel, M.H.V., (Eds.). Encyclopedia of Virology. Elsevier Ltd, Oxford,
UK. pp. 133-138.
Pappu, H.R., Rosales, I.M., Druffel, K.L., 2008. Serological and molecular assays for
rapid and sensitive detection of Iris yellow spot virus infection of bulb and
seed onion crops. Plant Dis. 92, 588-594.
Pappu, H.R., Jones, R.A., Jain, R.K., 2009. Global status of tospovirus epidemics in
diverse cropping systems: successes achieved and challenges ahead. Virus
Res. 141, 219-236.
Pappu, H. R., Rauf, A., 2013. First report of Iris yellow spot virus infecting green
onion in Indonesia. Plant Dis. 97, 1665.
Pappu, H.R., Bag, S., 2014. Iris yellow spot virus: A distinct species in the
genus Tospovirus, family Bunyaviridae. International Committee for
Taxonomy of Viruses. In press
Park, D.S., Suh, S.J., Hebert, P.D.N., Oh, H.W., Hong, K.J., 2011. DNA barcodes for
two scale insect families, mealybugs (Hemiptera: Pseudococcidae) and
armored scales (Hemiptera: Diaspididae). Bull. Entomol. Res. 101, 429-434.
Chapter 7 References
152
Parrella, M.P., Horsburgh, R.L., 1983. Functional responses of the black hunter thrips,
Leptothrips mali (Thysanoptera: Phlaeothripidae), to densities of Panonychus
ulmi (Acari: Tetranychidae). Environ. Entomol. 12, 429-433.
Pearce, M.J., 2005. Georgia Plant Disease Loss Estimates. University Georgia
Cooperative Extension Service, pp. 24.
Persley, D.M., Thomas, J.E., Sharman, M., 2006. Tospoviruses—an Australian
perspective. Aust. Plant Pathol. 35, 161-180.
Persley, D., Wilson, C., Thomas, J., Sharman, M., Tree, D., 2010. IXth International
symposium on thysanoptera and tospoviruses, 31 August-4 September, 2009.
J. Insect Sci. 10, 166.
Peters, D., De Avila, A.C., Kitajima, E.W., Resende, R.D.O., Haan, P.D., Goldbach,
R.W., 1991. An overview of tomato spotted wilt virus. ARS-US Department
of Agriculture. In: Virus Thrips-Plant Interactions of TSWV, Proceedings of
the USDA Workshop, Beltsville, USA, pp. 1-14.
Pickett, C.H., Wilson, L.T., Gonzalez, D., 1988. Population Dynamics and Within-
Plant Distribution of the Western Flower Thrips (Thysanoptera: Thripidae) an
Early-Season Predator of Spider Mites Infesting Cotton. Environ. Entomol.
17, 551-559.
Pitkin, B.R., 1972. A revision of the flower living genus odontothrips Amyot and
Serville (Thysanoptera: phlaeothripidae). Bull. Br. Mus. (Nat. Hist.) Entomol.
26, 371-402.
Plenk, A., Grausgruber-Groger, S., 2011. First report of Iris yellow spot virus in
onions (Allium cepa) in Austria. New Disease Reports 23, 13.
Porco, D., Rougerie, R., Deharveng, L., Hebert, P.D., 2010. Coupling non-destructive
DNA extraction and voucher retrieval for small soft-bodied arthropods in a
high throughput context: the example of Collembola. Mol. Ecol. Res. 10, 942-
945.
Chapter 7 References
153
Pozzer, L., Bezerra, I.C., Kormelink, R., Prins, M., Peters, D., Resende, R.O., de
Avila, A.C., 1999. Characterization of a tospovirus isolate of Iris yellow spot
virus associated with a disease in onion fields in Brazil. Plant Dis. 83, 345-
350.
Pramual, P., Kuvangkadilok, C., 2012. Integrated cytogenetic, ecological, and DNA
barcode study reveals cryptic diversity in Simulium (Gomphostilbia)
angulistylum (Diptera: Simuliidae). Genome 55, 447-458.
Prasad, K., Axdal, V.A., Yu, M., Raney, B.L., 1995. Antioxidant activity of allicin, an
active principle in garlic. Mol. Cell. Biochem. 148, 183-189.
Premachandra, W.T.S.D., Borgemeister, C., Maiss, E., Knierim, D., Poehling, H.M.,
2005. Ceratothripoides claratris, a new vector of a Capsicum chlorosis virus
isolate infecting tomato in Thailand. Phytopathology 95, 659-663.
Priesner, H., 1961. Das system der Tubulifera (Thysanoptera). Anzeiger
mathematisch-naturwissenschafitliche kiasse, Osterreichische Akademie der
winsenschaften, 13, 283-296.
Priesner, H., 1964. A monograph of the Thysanoptera of the Egyptian deserts. Publ.
Inst. Des. Egyp. 13, 1-549.
Priesner, H., 1968. On the genera allied to Liothrips of the Oriental fauna.ii (Insecta-
thysanoptera). Treubia 27, 175-285.
Puillandre, N., Lambert, A., Brouillet, S., Achaz, G., 2012. ABGD, Automatic
Barcode Gap Discovery for primary species delimitation. Mol. Ecol. 21, 1864-
1877.
Qiu, W.P., Geske, S.M., Hickey, C. M., Moyer, J.W., 1998. Tomato Spotted Wilt
Tospovirus Genome Reassortment and Genome Segment-Specific
Adaptation. Virology 244, 186-194.
Quilang, J.P., Santos, B.S., Ong, P.S., Basiao, Z.U., Fontanilla, I.K.C., Cao, E.P.,
2011. DNA barcoding of the Philippine endemic freshwater sardine Sardinella
Chapter 7 References
154
tawilis (Clupeiformes: Clupeidae) and its marine relatives. Philip. Agricu.
Scient. 94.
Rangel, E., Alfaro-Fernandez, A., Font-San-Ambrosio, M., Luis-Arteaga, M., Rubio,
L., 2011. Genetic variability and evolutionary analyses of the coat protein
gene of Tomato mosaic virus. Virus Genes 43, 435-438.
Rangarao, G.V., VijayaLakshmi, K., 1993, Thrips and bud necrosis disease in
groundnut. In Collaborative research in India on breeding groundnuts for
resistance to bud necrosis disease: proceedings of the meeting, ICRlSAT
Center, Patancheru Andhra Pradesh, India, 28 Sep 1992. pp 12-20.
Ratnasingham, S., Hebert, P.D.N., 2007. BOLD: the Barcode of Life Data System
(www.barcodinglife.org). Mol. Ecol. Notes 7, 355-364.
Ratnasingham, S., Hebert, P.D.N., 2013. A DNA-based registry for all animal species:
The Barcode Index Number (BIN) System. PLoS One 8, e66213.
Ravi, K.S., Kitkaru, A.S., Winter, S., 2006. Iris yellow spot virus in onions: a new
tospovirus record from India. Plant Path. 55, 288.
Reitz, S.R., 2009. Biology and ecology of the western flower thrips (Thysanoptera:
Thripidae): The making of a pest. Fla. Entomol. 92, 7-13.
Riley, D.G., Joseph, S.V., Srinivasan, R., Diffie, S., 2011. Thrips vectors of
tospoviruses. J. Int. Pest Manag. 2, 1-10.
Robène-Soustrade, I., Hostachy, B., Roux-Cuvelier, M., Minatchy, J., Hédont, M.,
Pallas, R., Couteau, A., Cassam, N., Wuster, G., 2006. First report of Iris
yellow spot virus in onion bulb- and seed-production fields in Réunion Island.
Plant Pathol. 55, 288.
Roggero, P., Masenga, V., Tavella, L., 2002. Field isolates of Tomato spotted wilt
virus overcoming resistance in pepper and their spread to other hosts in
Italy. Plant Dis. 86, 950-954.
Chapter 7 References
155
Rosales, M., Pappu, H.R., Mora, R., Aljaro, A., 2005. Iris yellow spot virus in onion
in Chile. Plant Dis. 89, 1245.
Rosen, D., 1986. The role of taxonomy in effective biological control programs.
Agric. Ecosyst. Environ. 15, 121-129.
Rueda, A., Badenes-Perez, F.R., Shelton, A.M., 2007. Developing economic
thresholds for onion thrips in Honduras. Crop Protec. 26, 1099-1107.
Rugman-Jones, P.F., Hoddle, M.S., Mound, L.A., Stouthamer, R., 2006. Molecular
identification key for pest species of Scirtothrips (Thysanoptera: Thripidae). J.
Econ. Entomol. 99, 1813-1819.
Rugman-Jones, P.F., Hoddle, M.S., Stouthamer, R., 2010. Nuclear-mitochondrial
barcoding exposes the global pest Western flower thrips (Thysanoptera:
Thripidae) as two sympatric cryptic species in its native California. J. Econ.
Entomol. 103, 877-886.
Saeed, M., Yousuf, M., 1994. Checklist of Thysanoptera of the Punjab (Pakistan).
Pak. Entomol. J. 16, 59-61.
Saeed, M., Yousuf, M., Zafar, M.H., 1994. Genus Scirtothrips Shull (Thripidae:
Thysanoptera) with description of a new species from Punjab, Pakistan. Pak.
Entomol. J. 16, 33-36.
Sakimura, K., 1947. Thrips in relation to gall-forming and plant transmission – A
review; P. Hawaii. Entomol. Soc. 13, 59-96.
Sakimura, K., 1961. Field observations on the thrips species of tomato spotted wilt
virus in the San Paolo area. Calif. Plant Dis. Rep. 45, 772-776.
Sakimura, K., 1963. Frankliniella fusca, an additional vector for the Tomato spotted
wilt virus, with notes on thrips tabaci, another vector. Phytopathology 53, 412.
Sakimura, K., 1967a. A preliminary note on a review of the genus Chaetisothrips
Priesner (Thysanoptera: Thripidae). Fla. Entomol. 50, 165-168
Chapter 7 References
156
Sakimura, K., 1967b. A preliminary review of the genus Isoneurothrips and the
subgenus Thrips (Isothrips). Pac. Insects 9, 429-436.
Sakimura, K., 1967c. Preliminary note on a review of subgenus Taeniothrips
(Isochaetothrips). Pac. Insects 9, 721-726.
Sambrook, J., Russell, D.W., 2006. Purification of nucleic acids by extraction with
phenol: chloroform. Cold Spring Harbor Protocols 2006, pdb. prot4455.
Sampangi, R.K., Mohan, S.K., Pappu, H.R., 2007. Identification of new alternative
weed hosts for Iris yellow spot virus in the Pacific Northwest. Plant Dis. 91,
1683.
Sanger, F., Nicklen, S., Coulson, A.R., 1977. DNA sequencing with chain-terminating
inhibitors. P. Natl. Acad. Sci. USA. 74, 5463-5467.
Savolainen, V., Cowan, R.S., Vogler, A.P., Roderick, G.K., Lane, R., 2005. Towards
writing the encyclopaedia of life: an introduction to DNA
barcoding. Philosophical Transactions of the Royal Society B: Biol. Sci. 360,
1805-1811.
Scheffer, S.J., Lewis, M.L., Joshi, R.C., 2006. DNA barcoding applied to invasive
leafminers (Diptera: Agromyzidae) in the Philippines. Ann. Entomol. Soc.
Am. 99, 204-210.
Schiffer, M., Carew, M.E., Hoffmann, A.A., 2004. Molecular, morphological and
behavioural data reveal the presence of a cryptic species in the widely studied
Drosophila serrata species complex. J. Evol. Biol. 17, 430-442.
Schwartz, H.F., Mohan., S.K., 2007. Compendium of onion and garlic diseases and
pests. Am. Phytopathol. Soc., St. Paul, MN. Ed. 2. pp. 127.
Schwartz, H.F., Otto., K., Pappu, H.R., 2007. First report of Iris yellow spot virus in
commercial leek (Allium porrum) in the United States. Plant Dis. 91, 113.
Chapter 7 References
157
Selhorst, T., Söndgerath, D., Weigand, S., 1991. A model describing the predator-
prey interaction between Scolothrips longicornis and Tetranychus
cinnabarinus based upon the Leslie theory. Ecol. Model. 59, 123-138.
Sen, S., Pramanik, N.K., Sen Gupta, C.K., 1988. Thysanoptera fauna of north-eastern
India. Zool. Survey India, Pub. In: Records of the zoological surveys of India.
ASIN: B0006ERT0O
Sengonca, C., Gerlach, S., 1984. Einfluss der Blattoberfläche auf die Wirksamkeit
des Räuberischen Thrips, Scolothrips longicornis (Thysanoptera: Thripidae).
Entomophaga 29, 55-61.
Sether, D.M., Borth, W.B., Shimabuku, R.S., Pappu, H.R., Melzer, M.J., Hu, J.S.,
2010. First report of Iris yellow spot virus in onion in Hawaii. Plant Dis. 94,
1508.
Sherwood, J.L., German, T.L., Moyer, J.W., Ullman, D.E., Whitfield, A.E., 2000.
Tomato spotted wilt virus. In: Maloy, O.C., Murray, T.D., (Eds) Encyclopedia
of plant pathology, John Wiley & Sons, NewYork, NY.
Simon, C., Frati, F., Beckenbach, A., Crespi, B., Liu, H., Flook, P., 1994. Evolution,
weighting, and phylogenetic utility of mitochondrial gene sequences and a
compilation of conserved polymerase chain reaction primers. Ann. Entomol.
Soc. Am. 87, 651-701.
Sin, S.H., McNulty, B.C., Kennedy, G.G., Moyer, J.W., 2005. Viral genetic
determinants for thrips transmission of Tomato spotted wilt virus. P. Nat.
Acad. Sci. USA. 102, 5168-5173.
Singh, S.J., 1947. Studies of the Indian Thysanoptera. Rec. Indian Mus. 40, 201.
Singh, S.J., Krishanareddy, M., 1996. Watermelon bud necrosis: A new tospovirus
disease. Acta Hort. 431, 68-77
Smith, K.M., 1931. Studies on potato virus diseases VIII. On a ringspot virus
affecting solanaceous plants. Ann. Appl. Biol. 18, 1-15.
Chapter 7 References
158
Smith, M.A., Rodriguez, J.J., Whitfield, J.B., Deans, A.R., Janzen, D.H., Hallwachs,
W., Hebert, P.D.N., 2008. Extreme diversity of tropical parasitoid wasps
exposed by iterative integration of natural history, DNA barcoding,
morphology, and collections. P. Nat. Acad. Sci. USA. 105, 12359-12364.
Sourakov, A., Zakharov, E.V., 2011. “Darwin’s butterflies”? DNA barcoding and the
radiation of the endemic Caribbean butterfly genus Calisto (Lepidoptera,
Nymphalidae, Satyrinae). Comp. Cytogenet. 5, 191.
Srinivasan, R., Sundaraj, S., Pappu, H.R., Diffie, S., Riley, D.G., Gitaitis, R.D., 2012.
Transmission of Iris yellow spot virus by Frankliniella fusca and Thrips
tabaci (Thysanoptera: Thripidae). J. Econ. Entomol. 105, 40-47.
Stannard, L.J., 1957. The phylogeny and classification of the North American genera
of the suborder Tubulifera (Thysanoptera). Ill. Biol. Monogr. 25, 1-200.
Strassen, R.Z., 1960. Catalogue of known species of the South African Thysanoptera.
J. Entomol. Soc. South. Afr. 23, 144-176.
Strutzenberger, P., Brehm, G., Fiedler, K., 2011. DNA barcoding‐based species
delimitation increases species count of Eois (Geometridae) moths in a
well‐studied tropical mountain forest by up to 50%. Insect Sci. 18, 349-362.
Suh, H.J., Lee, J.M., Cho, J.S., Kim, Y.S., Chung, S.H., 1999. Radical scavenging
compounds in onion skin. F. Res. Int., 32, 659-664.
Sundaraj, S., Srinivasan, R., Culbreath, A.K., Riley, D.G., Pappu, H.R., 2014. Host
plant resistance against Tomato spotted wilt virus in peanut (Arachis
hypogaea) and its impact on susceptibility to the virus, virus population
genetics, and vector feeding behavior and Survival. Phytopathology 104, 202–
210.
Tajima, F., 1989. Statistical method for testing the neutral mutationhypothesis by
DNA polymorphism. Genetics 123, 585-595.
Chapter 7 References
159
Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011.
MEGA5: molecular evolutionary genetics analysis using maximum likelihood,
evolutionary distance, and maximum parsimony methods. Mol. Boil. Evol. 28,
2731-2739.
Tamura, K., Stecher, G., Peterson, D., Filipski, A., Kumar, S., 2013. MEGA6:
Molecular Evolutionary Genetics Analysis version 6.0. Mol. Biol. Evol. 30,
2725-2729
Teacher, A.G.F., Griffiths, D.J., 2011. HapStar: automated haplotype network layout
and visualization. Mol. Ecol. Res. 11, 1512153.
Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W: improving the
sensitivity of progressive multiple sequence alignment through sequence
weighting, position-specific gap penalties and weight matrix choice. Nucl.
acids Res. 22, 4673-4680.
ThripsWiki, 2014. ThripsWiki - providing information on the World’s thrips.
Available from: http://thrips.info/wiki/ (Accessed 3March 2014).
Tillekaratne, K., Mound, L.A., Strassen, R.Z., Edirisinghe, J.P., 2007. List of thrips
(Thysanoptera) recorded from Sri Lanka. J. Nat. Sci. Found. Sla. 35, 197-205.
Tillekaratne, K., Edirisinghe, J.P., Gunatilleke, C.V.S., Karunaratne, W.A.I.P., 2011.
Survey of thrips in Sri Lanka: A checklist of thrips species, their distribution
and host plants. Ceylon J. Sci. (Biol. Sci.), 40, 89-108.
Timm, A.E., Stiller, M., Frey, J.E., 2008. A molecular identification key for
economically important thrips species (Thysanoptera: Thripidae) in southern
Africa. Afr. Entomol. 16, 68-75.
Toda, S., Komazaki, S., 2002. Identification of thrips species (Thysanoptera:
Thripidae) on Japanese fruit trees by polymerase chain reaction and restriction
fragment length polymorphism of the ribosomal ITS2 region. Bull. Entomol.
Res. 92, 359-363.
Chapter 7 References
160
Tommasini, M., Maini, S., 1995. Frankliniella occidentalis and other thrips harmful
to vegetable and ornamental crops in Europe. Wageningen Agric. Uni. Papers
(95-1): iii+ 1-42.
Trichilo, P.J., Leigh, T.F., 1986. Predation on spider mite eggs by the western flower
thrips, Frankliniella occidentalis (Thysanoptera: Thripidae), an opportunist in
a cotton agroecosystem. Environ. Entomol. 15, 821-825.
Trkulja, V., Mihic Salapura, J., Kovacic, D., Stankovic, I., Bulajic, A., Vucurovic, A.,
Krstic, B., 2013. First report of Iris yellow spot virus infecting onion in Bosnia
and Herzegovina. Plant Dis. 97, 430.
Trochoulias, T., Wright, W.E., Loebel, M.R., 1984. Use of insecticides to reduce
corky scab injury in bananas. Trop. Agric. (Trinidad), 61, 193-195.
Trontelj, P., Fišer, C., 2009. Cryptic species diversity should not be trivialised. Syst.
Biodivers. 7, 1-3
Tsompana, M., Moyer, J.W., 2008. Tospoviruses. In Mahy, B.W.J., Van
Regenmortel, M.H.V., (Eds.), Encyclopedia of Virology. Elsevier Ltd, Oxford,
UK. pp. 157-162.
Tunc, I., 1998. Thrips infestations of field crops in Turkey. Proc. 6th Intl. Sym.
Thysanoptera, 27 April-1 May 1998, Antalya, Turkey, pp. 145-150.
Turina, M., Tavella, L., Ciuffo, M., 2012. Tospoviruses in the Mediterranean Area.
Adv. Virus Res. 84, 403-437.
Ullman, D.E., Cho, J.J., Mau, R.F., Hunter, W.B., Westcot, D.M., Custer, D.M., 1992.
Thrips-tomato spotted wilt virus interactions: morphological, behavioral and
cellular components influencing thrips transmission. In: Harris, K.F.,
(ed.) Adv. Dis. vector Res. 9, 195-240.
Ullman, D.E., German, T.L., Sherwood, J.L., Westcot, D.M., Cantone, F.A., 1993.
Tospovirus replication in insect vector cells: immunocytochemical evidence
Chapter 7 References
161
that the non-structural protein encoded by the sRNA of Tomato spotted wilt
tospovirus is present in thrips vector cells. Phytopathology 83, 456-463.
Ullman, D.E., Westcot, D.M., Chenault, K.D., Sherwood, J.L., German, T.L., Bandla,
M.D., Cantone, F.A., Duer, H.L., 1995a. Compartmentalization, intracellular
transport and autophagy of tomato spotted wilt tospovirus proteins in infected
thrips cells. Phytopathology 85, 644-654.
Ullman, D.E., German, T.L., Sherwood, J.L., Westcot, D.M., 1995b. Thrips
transmission of Tospoviruses: future possibilities for management. In: Parker,
B.L., Skinner, M., Lewis, T., (Eds) Thrips Biology and Management. Plenum
Press, New York, pp. 135-151.
Ullman, D.E., 1996. Thrips and Tospoviruses: Advances and Future Directions. Acta
Horticulture 431, 310-324
Ullman, D.E., Sherwood, J.L., German, T.L., Lewis, T., 1997. Thrips as vectors of
plant pathogens. In: Thrips as crop pests. pp. 539-565.
Ullman, D.E., Meideros, R., Campbell, L.R., Whitfield, A.E., Sherwood, J.L.,
German, T.L., 2002. Thrips as vectors of tospoviruses. Adv. Bot. Res. 36,
113-140.
Umar, M., Akram, W., Choi, J.K., Lee, J.J., 2004. Description of Neolimothrips
binervis (Kobus) (Thysanoptera: Thripidae: Chirothripini) from Pakistan, with
a New Locality Record. Entomol. Res. 34, 55-58.
Vaglia, T., Haxaire, J., Kitching, I.J., Meusnier, I., Rougerie, R., 2008. Morphology
and DNA barcoding reveal three cryptic species within the Xylophanes
neoptolemus and loelia species-groups (Lepidoptera: Sphingidae).
Zootaxa 1923, 18-36.
Valentini, A., Pompanon, F., Taberlet, P., 2009. DNA barcoding for
ecologists. Trends Ecol. Evol. 24, 110-117.
Chapter 7 References
162
Vanhaecke, D., de Leaniz, C.G., Gajardo, G., Young, K., Sanzana, J., Orellana, G.,
Fowler, D., Howes, P., Monzon-Arguello, C., Consuegra, S., 2012. DNA
barcoding and microsatellites help species delimitation and hybrid
identification in endangered galaxiid fishes. PloS One 7, e32939.
Veer, V., 1978. Thrips flavus (Schrank) as pollinating agent. Indian J. Forest. 1, 278.
Velasquez-Valle, R., Reveles-Hernandez, M., 2011. Iris yellow spot virus detection
in the onion cultivation of Zacatecas, Mexico. Revista Mexicana de Ciencias
Agricolas 2, 971-978.
Vidyavati, H.G., Manjunatha, H., Hemavathy, J., Srinivasan, K., 2010. Hypolipidemic
and antioxidant efficacy of dehydrated onion in experimental rats. J. Food Sci.
Tech. 47, 55-60.
Vitousek, P.M., D’Antonio, C.M., Loope, L.L., Westbrooks, R., 1996. Biological
invasions as global environmental change. Am. Sci. 84, 468-478.
Virgilio, M., Backeljau, T., Nevado, B., Meyer, M.D., 2010. Comparative
performances of DNA barcoding across insect orders. BMC Bioinformatics,
11, 206.
Walia, J.J., Willemsen, A., Elci, E., Caglayan, K., Falk, B.W., Rubio, L., 2014.
Genetic variation and possible mechanisms driving the evolution of worldwide
Fig mosaic virus Isolates. Phytopathology 104, 108-114.
Walsh, K., Boonham, N., Barker, I., Collins, D.W., 2005. Development of a
sequence-specific real-time PCR to the melon thrips Thrips palmi (Thysan.,
Thripidae). J. Appl. Entomol. 129, 272-279.
Ward, L.I., Perez-Egusquiza, Z., Fletcher, J.D., Ochoa Corona, F.M., Tang, J.Z.,
Liefting, L.W., Martin, E.J., Quinn, B.D., Pappu, H.R., Clover, G.R.G., 2008.
First Report of Iris yellow spot virus on Allium cepa in New Zealand. New
Dis. Rep. 58, 406.
Chapter 7 References
163
Webb, S., Tsai, J., Mitchell, F., 1998. Bionomics of Frankliniella bispinosa and its
transmission of Tomato spotted wilt virus. In: Peters, D., Goldbach, R. (Eds.),
Recent Progress in Tospovirus and Thrips Research. Wageningen, pp. 67.
Webb, J.M., Jacobus, L.M., Funk, D.H., Zhou, X., Kondratieff, B., Geraci, C.J.,
DeWalt, R.E., Baird, D.J., Richard, B., Phillips, L., Hebert, P.D.N., 2012. A
DNA barcode library for North American Ephemeroptera: progress and
prospects. PloS One 7, e38063.
Westmore, G.C., Poke, F.S., Allen, G.R., Wilson, C.R., 2013. Genetic and host-
associated differentiation within Thrips tabaci Lindeman (Thysanoptera:
Thripidae) and its links to Tomato spotted wilt virus-vector
competence. Heredity 111, 210-215.
Whiteman, J.A., Rao, G.V.R., 1994, Groundnut Pests. In: Groundnut (Smart, J., eds)
London, UK: Chapman and Hall. pp 349-473.
Whitfield, A.E., Ullman, D.E., German, T.L., 2005. Tospovirus-thrips
interactions. Annu. Rev. Phytopathol., 43, 459-489.
Whitfield, A.E., Kumar, N.K.K., Rotenberg, D., Ullman, D.E., Wyman, E.A.,
Zietlow, C., Willis, D.K., German, T.L., 2008. A soluble form of the Tomato
spotted wilt virus (TSWV) glycoprotein GN (GN-S) inhibits transmission of
TSWV by Frankliniella occidentalis. Phytopathology 98, 45-50.
Wijkamp, I., Peters, D., 1993a. Determination of the median latent period of two
tospoviruses in Frankliniella occidentalis, using a novel leaf disk assay.
Phytopathology 83, 986-991.
Wijkamp, I., van Lent, J., Kormelink, R., Goldbach, R., Peters, D., 1993b.
Multiplication of tomato spotted wilt virus in its insect vector, Frankliniella
occidentalis. J. Gen. Virol. 74, 341-349.
Chapter 7 References
164
Wijkamp, I., Almarza, N., Goldbach, R., Peters, D., 1995. Distinct levels of
specificity in thrips transmission of tospoviruses. Phytopathology 85, 1069-
1074.
Widana Gamage, S.M.K., Hassani-Mehraban, A., Peters, D., 2010. Identification of
Iris yellow spot virus on Leek (Allium porrum) in Sri Lanka. Plant Dis. 94,
1070.
Wilson, T.H., 1975. A monograph of the sub family panchaetothripinae
(Thysanoptera: Thripidae). J. Entomol. Soc. South. Afr. 23, 1-354.
Wilson, L.J., Bauer, L.R., Walter, G.H., 1996. ‘Phytophagous’ thrips are facultative
predators of two spotted spider mites (Acari: Tetranychidae) on cotton in
Australia. Bull. Entomol. Res. 86, 297-305.
Witt, J.D., Hebert, P.D.N., 2000. Cryptic species diversity and evolution in the
amphipod genus Hyalella within central glaciated North America: a molecular
phylogenetic approach. Can. J. Fish. Aquat. Sci. 57, 687-698.
Yamasaki, T., Li, L., Lau, B.H.S., 1994. Garlic compounds protect vascular
endothelial cells from hydrogen peroxide-induced oxidant injury. Phytother.
Res. 8, 408-412.
Young, M.R., Behan-Pelletier, V.M., Hebert, P.D.N., 2012. Revealing the
hyperdiverse mite fauna of subarctic Canada through DNA barcoding. PLoS
One 7, e48755.
Zahiri, R., Lafontaine, J.D., Schmidt, B.C., deWaard, J.R., Zakharov, E.V., Hebert,
P.D.N., 2014. A transcontinental challenge - A test of DNA barcode
performance for 1,541 species of Canadian Noctuoidea (Lepidoptera). PLoS
One 9, e92797.
Zawirska, I., 1976. Untersuchungen u¨ ber zwei biologische Typen von Thrips tabaci
Lind. Thysanoptera, Thripidae) in der VR Polen. Arch. Phytopathol.
Pflanzenschutz 12, 411-422.
Chapter 7 References
165
Zen, S., Okuda, M., Ebihara, K., Uematsu, S., Hanada, K., Iwanami, T., Nakashima,
S., 2005. Genetic characterization of Iris yellow spot virus on onion (Allium
cepa) and pathogenicity of two IYSV strains on onion and leaf onion (A.
schoenoprasum). Jpn. J. Phytopathol. 71, 123-126
Zhang, J.B., Hanner, R., 2011. DNA barcoding is a useful tool for the identification of
marine fishes from Japan. Biochem. Syst. Ecol. 39, 31-42.
Zherikhin, V.V., 2002. Order Thripida. History of Insects (Ed. By A.P. Rasnitsyn and
D.L.J. Quicke), Kluwer Academic Publishers, Norwell, Massachusetts, pp.
133-143.
Zhou, X., Robinson, J.L., Geraci, C.J., Parker, C.R., Flint, Jr, O.S., Etnier, D.A.,
Ruiter, D., DeWalt, R.E., Jacobus, L.M., Hebert, P.D.N., 2011. Accelerated
construction of a regional DNA-barcode reference library: caddisflies
(Trichoptera) in the Great Smoky Mountains National Park. J. N. Am.
Benthol. Soc. 30, 131-162.
Zur Strassen, R., 2003. Die terebranten Thysanopteren Europas und des Mittelmeer-
Gebietes. Tierw. Deutschl. 74, 1‒277.
Appendices
166
APPENDICES
Appendix 1
Buffer Formulations
Coating Buffer (1X) Dissolve in distilled water to 1000 ml:
Sodium carbonate (anhydrous) 1.59 g
Sodium bicarbonate 2.93 g
Sodium azide 0.2 g
Adjust pH to 9.6. Store at 4° C.
Wash Buffer (1X-PBST) Dissolve in distilled water to 1000 ml:
Sodium chloride 8.0 g
Sodium phosphate, dibasic (anhydrous) 1.15 g
Potassium phosphate, monobasic (anhydrous) 0.2 g
Potassium chloride 0.2 g
Tween-20 0.5 g
Adjust pH to 7.4
Extract Buffer (EB 1X) Dissolve in 1000 ml of 1X PBST:
Sodium sulfite (anhydrous) 1.3 g
Polyvinylpyrrolidone (PVP) MW 24-40,000 20.0 g
Sodium azide 0.2 g
Powdered egg (chicken) albumin, Grade II 2.0 g
Tween-20 20.0 g
Adjust pH to 7.4. Store at 4°C.
Antibody dilution buffer (1X) Add to 1000 ml 1X PBST:
Bovine serum albumin (BSA) 2.0 g
Polyvinylpyrrolidone (PVP) MW 24-40,000 20.0 g
Sodium azide 0.2 g
Adjust pH to 7.4. Store at 4° C.
Substrate Buffer (1X) Dissolve in 800 ml distilled water:
Magnesium chloride hexahydrate 0.1 g
Sodium azide 0.2 g
Diethanolamine 97.0 ml
Appendices
167
Adjust pH to 9.8 with hydrochloric acid. Adjust final volume to
1000 ml with distilled water. Store at 4° C.
Appendix 2
RNA isolation from plant leaf
Plant tissue samples (100-300 mg) were ground in liquid nitrogen using pestle and
mortar and subsequently mixed in 450 µl buffer (445 µl RLT+ 5 µl βME). The
mixtures were transferred to eppendorf tubes and incubated at 56°C for 3 minutes for
lysis. The lysate was transferred into QIA spin shedder (Lilac column) and
centrifuged at 13000 rpm for 2 minutes. The supernatant of the flow through was
transferred to a new eppendorf tube and 0.5 volume of 100% ethanol was added to the
clear lysate in each tube and mixed immediately by pipetting or inverting the tubes 6-
8 times. Samples were then transferred to an RNeasy spin column (Pink column) in a
2 ml collection tube and centrifuged for 1 minute at 13000 rpm. The flow through was
discarded and 700 µl buffer RW1 was added to these RNeasy spin column and
centrifuged for 1 minute at 13000 rpm. Flow through was discarded and 500 µl buffer
RPE was added to the RNeasy spin column and centrifuged for 1 minute at 13000
rpm. Flow through was discarded again and 500 µl buffer RPE was added to the
RNeasy spin column and centrifuged for 2 minute at 13000 rpm. After discarding the
flow through, the RNeasy spin columns were placed into the new 1.5ml eppendorf
tubes and 30-50 µl RNeasy free water was added to the spin column membrane and
placed on ice for 2 minutes. The RNA was eluted for 1 minute at 13000 rpm.
RNA isolation from plant leaf
Plant leaf less than 0.5 gm was ground to fine powder in liquid N2 and added to
it 750 µL RNA extraction buffer and 750 μL phenol:water (3.75:1) and mixed
by vortexing
Centrifuge for 5 min at RT at 13000 rpm
Aqueous phase was collected into new eppendorf tube
Added to it 1/10 NaAc 3M+2 Volumes of 100% ethanol
Incubate O/N or 2 h at -20°C
Appendices
168
Centrifuge 30 min at 4°C
Wash the pellet with 70% ethanol
Aspirate liquid carefully
Air dry 10 min
Suspend in 50 µL DEPC treated SDW
Put on 37°C for 2-3 min to completely dissolve the pellet
Vortex briefly
Spin @12000rpm for 2min
Take supernatant (RNA) leaving behind debris if any.
RNA extraction buffer for plant RNA extraction
200mM Tris HCl pH 8
100mM LiCl
5mM EDTA pH8
1% SDS
2.5 mg/ml bentonite
Appendix 3
cDNA synthesis
RNA template 5 μL (1-1.5 μg)
Oligodt primer (or Gene specific reverse primer) 1 μL
DEPC treated SDW 6 μL
Mix by pipetting up and down and spin down for 3-5 sec.
Incubate at 70°C for 5 min
Chill on ice
1X 10X
Add 5X reaction buffer 4 μL 40 μL
Add Ribonuclease inhibitor 1 μL 10 μL
dNTP 2 μL 20 μL
Appendices
169
Mix, spin and incubate at 37°C for 5 min
Add Revert Aid reverse transcriptase enzyme 1 μL 10 μL
Incubate at 42°C for 60 min
Finally incubate at 70°C for 10 min
Chill on ice briefly.
Now this cDNA can be used as template for amplification of desired gene by PCR.
Appendix 4
Fermentas, 1 kb DNA ladder
50X Tris-acetate EDTA buffer (TAE)
For 1 liter 50X TAE add:
Tris base 242.0 g
0.5 M EDTA (pH 8.0) 100.0 ml
Glacial acetic acid 57.1 ml
Make up the final volume with distilled water to 1000 ml.
6X Gel loading buffer
Bromophenol blue 0.25% (w/v)
Xylene cyanol FF. 0.25% (w/v)
Glycerol 30.0% (v/v)
Appendices
170
Dissolve in distilled water.
Appendix 5
pGEM®-T Easy vector map
Appendix 6
LB (Luria-Bertini) liquid
Tryptone 1.0 %
Yeast extract 0.5 %
NaCl 0.5 %
Dissolve in dH2O. Adjust pH to 7.5 and autoclave.
Appendix 7
LB (Luria-Bertini) agar medium
Tryptone 1.0 %
Yeast extract 0.5 %
NaCl 0.5 %
Adjust pH 7.5 then add
Bacto agar 1.5 %
Appendices
171
Dissolve in dH2O and autoclave, then cool down to 40-45°C and add appropriate
antibiotic in desired concentration. Mix well and pour into the plates.
Appendix 8
X-Gal
Dissolve 200 mg X-Gal (5-bromo-4-chloro-3-3indolyl-B-D- alactopyranoside)
in 10 ml N, N-dimethylformamide (DMF). Store at -20°C and protect from light. Use
20 µL per plate.
IPTG
Dissolve 1.2 g IPTG (isopropyl- B-D- thiogalactopyranoside) in 50 ml of
deionized water. Filter-sterilize, aliquot and store at -20°C. Use 20 µL per plate.
Appendix 9
Preparation of heat shock competent cells of E. coli strain Top 10
50 ml LB media was inoculated with a single fresh grown colony of E. coli top
10 strain in 250 ml flask and incubated with vigorous shaking overnight at 37°C. Next
day 200 ml fresh LB media was inoculated with 2 ml of previous culture in 1 liter
flask and incubate at 37°C with vigorous shaking until OD of culture reaches to 1.
Normally it takes 3-4 h. Cool down the cells by putting on ice for 30 min. Transfer the
culture to sterile 50 ml falcon tubes and centrifuge for 10 min at 4000 rpm and 4°C.
Discard supernatant and dissolve the pellet in 15 ml of 0.1M CaCl2. Cells were
incubated on ice for 30 min and then centrifuged again as previously for 8 min. Again
pellet was re-suspended in 5 ml of 0.1M CaCl2. 100% glycerol was added dissolved
properly and make aliquots to save on -70°C.
Appendix 10
Plasmid isolation from E. coli by alkaline lysis method
Miniprep Solutions
Solution A (Suspension solution)
Appendices
172
Tris (pH 7.4-7.6) 50 mM
EDTA 1 mM
RNase 100 μg/ml
Store at 4°C
Solution B (Lysis solution)
NaOH 0.2 N
SDS 1 %
Keep it in sterile plastic bottle. In glass bottle it precipitates.
Solution C (Neutralization solution)
Potassium acetate 3 M
Glacial acetic acid 11.5 ml/100 ml
(pH 4.8-5.0)
A single transformed E. coli colony was grown overnight at 37°C in 3 ml liquid
LB medium containing required antibiotic.
The above culture was centrifuged in 1.5 ml eppendorf tube for 1 min.
The supernatant was decanted.
Pellet was re-suspended in 150 μL of re-suspension solution.
250 μL of lysis solution was added to eppendorf tube and mixed well by inverting
gently for 5-6 times.
250 μL of neutralization solution was added to eppendorf tube mixed well and
then centrifuged for 5 min.
Take supernatant and add equal volume of phenol:chloroform:isoamylalcohl
(24:24:1)
Mix and centrifuge for 5 min
Take top layer carefully and add 2.5 volume of chilled 95% ethanol
Centrifuge for 10 min discard supernatant carefully leaving behind pellate
Wash pellate with 75% ethanol and air dry pellete
Dissolve the plasmid DNA pellete in appropriate volume of sterile d3H2O
Appendices
173
Appendix 11
Miniprep protocol (Plasmid isolation)
GeneJETTm
Plasmid Miniprep Kit, Fermentas cat no. K0503 was used for
plasmid isolation following the manufacturer’s protocol as under. All centrifugations
were carried out at > 12000Xg at room temperature.
A single transformed E. coli colony was grown overnight at 37°C in 3 ml liquid
LB medium containing required antibiotic.
The above culture was centrifuged in 1.5 ml eppendorf tube for 1 min.
The supernatant was decanted.
Pellet was re-suspended in 250 μL of re-suspension solution.
250 μL of lysis solution was added to eppendorf tube and mixed well by
inverting gently for 5-6 times.
350 μL of neutralization solution was added to eppendorf tube mixed well and
then centrifuged for 5 min.
The supernatant was loaded onto the column and centrifuged for 1 min.
Flow through was discarded and 500 μL wash solution was added to the column
and centrifuge for 1 min. This step was repeated two times.
Empty column was centrifuged for 1 min to dry the column.
Elute the DNA by adding 50 μL of elution buffer to the column and spin the
column for 2 min and store the DNA at-20°C.
Supplementary tables
174
Supplementary Table 1: Process ID of barcoded specimens, country of origin,
code used for each accession in haplotype analysis and Haplotype ID (Fig. 4.8).
a) Thrips tabaci
Sr.no. Process ID Country name My code Haplotype
1 SSWLE9584-13 CANADA CANADA1 Hap-01
2 GBA8566-12 CHINA CHINA1 Hap-01
3 GBMHT126-13 PERU PERU1 Hap-02
4 GBMIN19813-13 TANZANIA TANZANIA1 Hap-03
5 GBMIN19819-13 USA USA1 Hap-04
6 GMGRE2905-13 GERMANY GERMANY1 Hap-04
7 MATHR193-11 PAKISTAN PAKISTAN1 Hap-01
8 MATHR194-11 PAKISTAN PAKISTAN2 Hap-01
9 MATHR199-11 PAKISTAN PAKISTAN3 Hap-01
10 MATHR203-11 PAKISTAN PAKISTAN4 Hap-01
11 NGNA1221-13 CANADA CANADA2 Hap-01
12 NORTH090-11 NORWAY NORWAY1 Hap-04
13 RFTHY112-10 CANADA CANADA3 Hap-04
14 SSJAE4187-13 CANADA CANADA4 Hap-01
15 SSWLD1263-13 CANADA CANADA5 Hap-05
16 SSWLE6938-13 CANADA CANADA6 Hap-01
17 GBMHT133-13 JAPAN JAPAN1 Hap-03
18 GBMHT135-13 JAPAN JAPAN2 Hap-06
19 GBMIN12906-13 USA USA2 Hap-07
20 GBMIN19852-13 MADAGASCAR MG1 Hap-04
21 GBMIN19854-13 TANZANIA TANZANIA2 Hap-03
22 GBMIN21886-13 SERBIA SERBIA1 Hap-02
23 GBMIN21891-13 SERBIA SERBIA2 Hap-08
24 GBMIN39464-13 JAPAN JAPAN3 Hap-08
25 GBMIN40725-13 UNITED KINGDOM UK1 Hap-04
26 GBMIN40854-13 BOSNIA HERZEGOVINA BA1 Hap-04
27 MATHR201-11 PAKISTAN PAKISTAN5 Hap-09
28 MATHR275-11 PAKISTAN PAKISTAN6 Hap-01
29 MATHR313-11 PAKISTAN PAKISTAN7 Hap-01
30 MATHR374-11 PAKISTAN PAKISTAN8 Hap-01
31 NGNAG1524-13 CANADA CANADA7 Hap-04
32 RFTHY051-10 AUSTRALIA AUSTRALIA1 Hap-01
33 RFTHY110-10 CANADA CANADA8 Hap-04
34 SMTPD3379-13 CANADA CANADA9 Hap-01
35 SSJAE4205-13 CANADA CANADA10 Hap-01
36 SSWLE3112-13 CANADA CANADA11 Hap-01
37 GBMHT113-13 USA USA3 Hap-08
38 GBMHT331-13 INDIA INDIA1 Hap-01
39 GBMHT333-13 INDIA INDIA2 Hap-01
40 GBMHT335-13 INDIA INDIA3 Hap-01
41 GBMIN12909-13 USA USA4 Hap-08
42 GBMIN19821-13 MADAGASCAR MG2 Hap-01
43 GBMIN30384-13 CHINA CHINA2 Hap-01
44 GBMIN40730-13 BOSNIA HERZEGOVINA BA2 Hap-08
45 MATHR200-11 PAKISTAN PAKISTAN9 Hap-01
46 MATHR202-11 PAKISTAN PAKISTAN10 Hap-01
47 MATHR206-11 PAKISTAN PAKISTAN11 Hap-01
48 MATHR349-11 PAKISTAN PAKISTAN12 Hap-01
49 MATHR448-12 PAKISTAN PAKISTAN13 Hap-01
Supplementary tables
175
50 MATHR464-12 PAKISTAN PAKISTAN14 Hap-08
51 SIOCA253-10 CANADA CANADA12 Hap-01
52 SSJAF5104-13 CANADA CANADA13 Hap-01
53 SSWLD319-13 CANADA CANADA14 Hap-01
54 RBINA4647-13 CANADA CANADA15 Hap-04
55 SSBAD3516-12 CANADA CANADA16 Hap-01
56 SSWLE6952-13 CANADA CANADA17 Hap-01
57 SSWLE9554-13 CANADA CANADA18 Hap-01
58 SSWLE9751-13 CANADA CANADA19 Hap-04
59 CNBAN620-13 AUSTRALIA AUSTRALIA2 Hap-08
60 GBMHT125-13 PERU PERU2 Hap-02
61 GBMHT336-13 INDIA INDIA4 Hap-01
62 GBMIN12877-13 USA USA5 Hap-07
63 GBMIN21887-13 SERBIA SERBIA3 Hap-04
64 GBMIN21890-13 SERBIA SERBIA4 Hap-04
65 GBMIN40723-13 UNITED KINGDOM UK2 Hap-10
66 GBMIN40848-13 UNITED KINGDOM UK3 Hap-10
67 GBMIN40850-13 UNITED KINGDOM UK4 Hap-04
68 GBMIN40855-13 UNITED KINGDOM UK5 Hap-11
69 GBMIN40856-13 UNITED KINGDOM UK6 Hap-04
70 GMGRG4019-13 GERMANY GERMANY2 Hap-04
71 MATHR191-11 PAKISTAN PAKISTAN15 Hap-01
72 MATHR195-11 PAKISTAN PAKISTAN16 Hap-01
73 MATHR375-11 PAKISTAN PAKISTAN17 Hap-01
74 SSJAE4213-13 CANADA CANADA20 Hap-01
75 SSJAF4380-13 CANADA CANADA21 Hap-01
76 SSWLE9562-13 CANADA CANADA22 Hap-05
77 BBTHW047-10 CANADA CANADA23 Hap-01
78 GBMHT123-13 PERU PERU3 Hap-02
79 GBMHT127-13 PERU PERU4 Hap-07
80 GBMHT334-13 INDIA INDIA5 Hap-01
81 GBMIN40724-13 UNITED KINGDOM UK7 Hap-04
82 GBMIN40851-13 UNITED KINGDOM UK8 Hap-07
83 GBMIN40853-13 UNITED KINGDOM UK9 Hap-07
84 GBMIN40857-13 UNITED KINGDOM UK10 Hap-04
85 MATHR192-11 PAKISTAN PAKISTAN18 Hap-01
86 MATHR198-11 PAKISTAN PAKISTAN19 Hap-01
87 MATHR204-11 PAKISTAN PAKISTAN20 Hap-01
88 MATHR316-11 PAKISTAN PAKISTAN21 Hap-09
89 MATHR380-11 PAKISTAN PAKISTAN22 Hap-08
90 RFTHY043-10 AUSTRALIA AUSTRALIA3 Hap-12
91 SSBAD5358-13 CANADA CANADA24 Hap-04
92 SSJAE5612-13 CANADA CANADA25 Hap-01
93 SSWLE510-13 CANADA CANADA26 Hap-01
94 SSWLF2949-13 CANADA CANADA27 Hap-01
95 CNRMD1595-12 CANADA CANADA28 Hap-01
96 GBMHT129-13 PERU PERU5 Hap-02
97 GBMHT130-13 PERU PERU6 Hap-02
98 GBMHT131-13 PERU PERU7 Hap-07
99 GBMIN12878-13 USA USA6 Hap-01
100 GBMIN12908-13 USA USA7 Hap-08
101 GBMIN19820-13 MADAGASCAR MG3 Hap-01
102 GBMIN19851-13 USA USA8 Hap-01
103 GBMIN30304-13 CHINA CHINA3 Hap-08
104 GBMIN30383-13 CHINA CHINA4 Hap-01
105 GBMIN40734-13 ISRAEL ISRAEL1 Hap-07
Supplementary tables
176
106 GBMIN40852-13 UNITED KINGDOM UK11 Hap-07
107 GBMIN40858-13 ISRAEL ISRAEL2 Hap-03
108 MATHR352-11 PAKISTAN PAKISTAN23 Hap-13
109 NGNAC2366-13 CANADA CANADA29 Hap-01
110 SSWLE9545-13 CANADA CANADA30 Hap-01
111 SSWLF4845-13 CANADA CANADA31 Hap-01
112 GBMHT134-13 JAPAN JAPAN4 Hap-14
113 GBMHT337-13 INDIA INDIA6 Hap-01
114 GBMIN12879-13 USA USA9 Hap-08
115 GBMIN12907-13 USA USA10 Hap-04
116 GBMIN19850-13 USA USA11 Hap-01
117 GBMIN21885-13 SERBIA SERBIA5 Hap-02
118 GBMIN40732-13 UNITED KINGDOM UK12 Hap-04
119 GBMIN40733-13 ISRAEL ISRAEL3 Hap-03
120 GBMIN40849-13 UNITED KINGDOM UK13 Hap-04
121 MATHR208-11 PAKISTAN PAKISTAN24 Hap-01
122 MATHR357-11 PAKISTAN PAKISTAN25 Hap-01
123 MATHR372-11 PAKISTAN PAKISTAN26 Hap-01
124 MATHR465-12 PAKISTAN PAKISTAN27 Hap-08
125 NORTH088-11 NORWAY NORWAY2 Hap-01
126 RBINA4648-13 CANADA CANADA32 Hap-01
127 SSBAD3445-12 CANADA CANADA33 Hap-04
128 SSWLB333-13 CANADA CANADA34 Hap-01
129 SSWLE488-13 CANADA CANADA35 Hap-05
130 SSWLE6948-13 CANADA CANADA36 Hap-05
131 GBMHT124-13 PERU PERU8 Hap-02
132 GBMHT128-13 PERU PERU9 Hap-07
133 GBMHT332-13 INDIA INDIA7 Hap-01
134 GBMIN30303-13 CHINA CHINA5 Hap-08
135 GBMIN40726-13 UNITED KINGDOM UK14 Hap-07
136 GBMIN40727-13 UNITED KINGDOM UK15 Hap-07
137 GBMIN40729-13 UNITED KINGDOM UK16 Hap-01
138 GBMIN40731-13 UNITED KINGDOM UK17 Hap-04
139 MATHR196-11 PAKISTAN PAKISTAN28 Hap-01
140 MATHR205-11 PAKISTAN PAKISTAN29 Hap-09
141 MATHR207-11 PAKISTAN PAKISTAN30 Hap-01
142 MATHR211-11 PAKISTAN PAKISTAN31 Hap-15
143 MATHR311-11 PAKISTAN PAKISTAN32 Hap-01
144 MATHR312-11 PAKISTAN PAKISTAN33 Hap-01
145 NORTH091-11 NORWAY NORWAY3 Hap-04
146 RFTHY106-10 CANADA CANADA37 Hap-04
147 RFTHY107-10 CANADA CANADA38 Hap-04
148 SSJAD3291-13 CANADA CANADA39 Hap-01
149 SSWLB1342-13 CANADA CANADA40 Hap-05
150 SSWLE6943-13 CANADA CANADA41 Hap-04
151 GBMIN40728-13 UNITED KINGDOM UK18 Hap-07
152 MATHR197-11 PAKISTAN PAKISTAN34 Hap-01
b) Thrips palmi
Sr. no. Process ID Country name My code Haplotype
1 GBMIN31962-13 CHINA CHINA1 Hap-01
2 GBMIN31947-13 CHINA CHINA2 Hap-01
3 GBMIN40735-13 THAILAND THAILAND1 Hap-02
4 GBMIN40373-13 INDIA INDIA1 Hap-03
Supplementary tables
177
5 GBMIN40738-13 INDIA INDIA2 Hap-04
6 GBMIN40740-13 UNITED KINGDOM UK1 Hap-01
7 GBMIN40861-13 DOMINICAN REPUBLIC DO1 Hap-05
8 GBMIN40865-13 JAPAN JAPAN1 Hap-01
9 MATHR178-10 PAKISTAN PAKISTAN1 Hap-01
10 MATHR182-10 PAKISTAN PAKISTAN2 Hap-01
11 MATHR184-10 PAKISTAN PAKISTAN3 Hap-06
12 MATHR185-10 PAKISTAN PAKISTAN4 Hap-01
13 MATHR338-11 PAKISTAN PAKISTAN5 Hap-01
14 MATHR356-11 PAKISTAN PAKISTAN6 Hap-04
15 GBMIN19847-13 INDIA INDIA3 Hap-07
16 GBMIN39470-13 JAPAN JAPAN2 Hap-01
17 GBMIN40736-13 DOMINICAN REPUBLIC DO2 Hap-08
18 GBMIN40742-13 JAPAN JAPAN3 Hap-09
19 GBMIN40864-13 DOMINICAN REPUBLIC DO3 Hap-01
20 MATHR179-10 PAKISTAN PAKISTAN7 Hap-01
21 MATHR358-11 PAKISTAN PAKISTAN8 Hap-01
22 GBA8454-12 INDIA INDIA4 Hap-10
23 GBMHT261-13 INDIA INDIA5 Hap-10
24 GBMHT265-13 INDIA INDIA6 Hap-10
25 GBMHT277-13 INDIA INDIA7 Hap-10
26 GBMHT296-13 INDIA INDIA8 Hap-10
27 GBMHT301-13 INDIA INDIA9 Hap-10
28 GBMHT308-13 INDIA INDIA10 Hap-10
29 GBMHT309-13 INDIA INDIA11 Hap-10
30 GBMHT326-13 INDIA INDIA12 Hap-10
31 GBMHT330-13 INDIA INDIA13 Hap-10
32 GBMIN19815-13 INDIA INDIA14 Hap-11
33 GBMIN19818-13 INDIA INDIA15 Hap-11
34 GBMIN19849-13 INDIA INDIA16 Hap-12
35 GBMIN40862-13 INDIA INDIA17 Hap-11
36 MAIMB471-09 PAKISTAN PAKISTAN9 Hap-11
37 MAIMB472-09 PAKISTAN PAKISTAN10 Hap-11
38 MAIMB483-09 PAKISTAN PAKISTAN11 Hap-11
39 MATHR347-11 PAKISTAN PAKISTAN12 Hap-11
40 MATHR369-11 PAKISTAN PAKISTAN13 Hap-11
41 GBMHT264-13 INDIA INDIA18 Hap-10
42 GBMHT270-13 INDIA INDIA19 Hap-10
43 GBMHT271-13 INDIA INDIA20 Hap-10
44 GBMHT272-13 INDIA INDIA21 Hap-10
45 GBMHT274-13 INDIA INDIA22 Hap-10
46 GBMHT280-13 INDIA INDIA23 Hap-10
47 GBMHT289-13 INDIA INDIA24 Hap-10
48 GBMHT295-13 INDIA INDIA25 Hap-10
49 GBMHT303-13 INDIA INDIA26 Hap-10
50 GBMHT304-13 INDIA INDIA27 Hap-10
51 GBMHT312-13 INDIA INDIA28 Hap-13
52 GBMHT313-13 INDIA INDIA29 Hap-10
53 GBMHT317-13 INDIA INDIA30 Hap-10
54 GBMIN19828-13 INDIA INDIA31 Hap-11
55 GBMIN19845-13 INDIA INDIA32 Hap-11
56 GBMIN19846-13 INDIA INDIA33 Hap-11
57 MAIMB460-09 PAKISTAN PAKISTAN14 Hap-11
58 MAIMB463-09 PAKISTAN PAKISTAN15 Hap-11
59 MAIMB466-09 PAKISTAN PAKISTAN16 Hap-11
60 MATHR079-10 PAKISTAN PAKISTAN17 Hap-11
Supplementary tables
178
61 MATHR213-11 PAKISTAN PAKISTAN18 Hap-11
62 MATHR366-11 PAKISTAN PAKISTAN19 Hap-11
63 GBMHT260-13 INDIA INDIA34 Hap-10
64 GBMHT263-13 INDIA INDIA35 Hap-14
65 GBMHT266-13 INDIA INDIA36 Hap-10
66 GBMHT268-13 INDIA INDIA37 Hap-10
67 GBMHT281-13 INDIA INDIA38 Hap-10
68 GBMHT283-13 INDIA INDIA39 Hap-10
69 GBMHT284-13 INDIA INDIA40 Hap-10
70 GBMHT285-13 INDIA INDIA41 Hap-10
71 GBMHT294-13 INDIA INDIA42 Hap-15
72 GBMHT298-13 INDIA INDIA43 Hap-10
73 GBMHT299-13 INDIA INDIA44 Hap-10
74 GBMHT310-13 INDIA INDIA45 Hap-10
75 GBMHT311-13 INDIA INDIA46 Hap-10
76 GBMHT314-13 INDIA INDIA47 Hap-10
77 GBMHT319-13 INDIA INDIA48 Hap-10
78 GBMHT320-13 INDIA INDIA49 Hap-10
79 GBMHT321-13 INDIA INDIA50 Hap-10
80 MAIMB476-09 PAKISTAN PAKISTAN20 Hap-11
81 MATHR068-10 PAKISTAN PAKISTAN21 Hap-11
82 MATHR353-11 PAKISTAN PAKISTAN22 Hap-11
83 GBMHT267-13 INDIA INDIA51 Hap-10
84 GBMHT273-13 INDIA INDIA52 Hap-10
85 GBMHT275-13 INDIA INDIA53 Hap-10
86 GBMHT279-13 INDIA INDIA54 Hap-10
87 GBMHT287-13 INDIA INDIA55 Hap-10
88 GBMHT291-13 INDIA INDIA56 Hap-10
89 GBMHT292-13 INDIA INDIA57 Hap-10
90 GBMHT302-13 INDIA INDIA58 Hap-16
91 GBMHT305-13 INDIA INDIA59 Hap-10
92 GBMHT315-13 INDIA INDIA60 Hap-10
93 GBMHT318-13 INDIA INDIA61 Hap-10
94 GBMHT329-13 INDIA INDIA62 Hap-10
95 MAIMB470-09 PAKISTAN PAKISTAN23 Hap-11
96 MAIMB480-09 PAKISTAN PAKISTAN24 Hap-11
97 MATHR011-10 PAKISTAN PAKISTAN25 Hap-11
98 MATHR082-10 PAKISTAN PAKISTAN26 Hap-11
99 MATHR345-11 PAKISTAN PAKISTAN27 Hap-11
100 MATHR362-11 PAKISTAN PAKISTAN28 Hap-11
101 GBMHT269-13 INDIA INDIA63 Hap-10
102 GBMHT276-13 INDIA INDIA64 Hap-10
103 GBMHT278-13 INDIA INDIA65 Hap-10
104 GBMHT282-13 INDIA INDIA66 Hap-10
105 GBMHT288-13 INDIA INDIA67 Hap-10
106 GBMHT290-13 INDIA INDIA68 Hap-10
107 GBMHT293-13 INDIA INDIA69 Hap-10
108 GBMHT297-13 INDIA INDIA70 Hap-10
109 GBMHT300-13 INDIA INDIA71 Hap-10
110 GBMHT307-13 INDIA INDIA72 Hap-10
111 GBMHT322-13 INDIA INDIA73 Hap-10
112 GBMHT323-13 INDIA INDIA74 Hap-10
113 GBMHT324-13 INDIA INDIA75 Hap-10
114 GBMHT328-13 INDIA INDIA76 Hap-10
115 GBMIN40739-13 INDIA INDIA77 Hap-10
116 MAIMB462-09 PAKISTAN PAKISTAN29 Hap-11
Supplementary tables
179
117 MATHR350-11 PAKISTAN PAKISTAN30 Hap-11
118 MATHR351-11 PAKISTAN PAKISTAN31 Hap-11
119 MATHR365-11 PAKISTAN PAKISTAN32 Hap-17
120 MATHR376-11 PAKISTAN PAKISTAN33 Hap-11
121 MATHR378-11 PAKISTAN PAKISTAN34 Hap-11
122 GBMHT262-13 INDIA INDIA78 Hap-10
123 GBMHT286-13 INDIA INDIA79 Hap-10
124 GBMHT306-13 INDIA INDIA80 Hap-10
125 GBMHT316-13 INDIA INDIA81 Hap-10
126 GBMHT325-13 INDIA INDIA82 Hap-10
127 GBMHT327-13 INDIA INDIA83 Hap-18
128 GBMIN40859-13 INDIA INDIA84 Hap-11
129 GBMIN40860-13 INDIA INDIA85 Hap-11
130 GBMIN40863-13 INDIA INDIA86 Hap-11
131 MAIMB461-09 PAKISTAN PAKISTAN35 Hap-11
132 MAIMB469-09 PAKISTAN PAKISTAN36 Hap-11
133 MAIMB474-09 PAKISTAN PAKISTAN37 Hap-11
134 MATHR013-10 PAKISTAN PAKISTAN38 Hap-11
135 MATHR047-10 PAKISTAN PAKISTAN39 Hap-11
136 MATHR048-10 PAKISTAN PAKISTAN40 Hap-11
137 MATHR077-10 PAKISTAN PAKISTAN41 Hap-11
138 MATHR078-10 PAKISTAN PAKISTAN42 Hap-11
139 MATHR355-11 PAKISTAN PAKISTAN43 Hap-11
140 MATHR363-11 PAKISTAN PAKISTAN44 Hap-11
c) Scirtothrips dorsalis
S. no. Process ID Country name My code Haplotype
1 GBMHT258-13 INDIA INDIA1 Hap-01
2 GBMIN19816-13 INDIA INDIA2 Hap-02
3 GBMIN19817-13 INDIA INDIA3 Hap-03
4 GBMHT257-13 INDIA INDIA4 Hap-01
5 GBMIN19825-13 INDIA INDIA5 Hap-04
6 GBMIN19826-13 INDIA INDIA6 Hap-05
7 GBMIN19830-13 INDIA INDIA7 Hap-06
8 GBMIN19831-13 INDIA INDIA8 Hap-02
9 GBMIN19855-13 INDIA INDIA9 Hap-07
10 GBMIN19860-13 INDIA INDIA10 Hap-08
11 GBMIN19861-13 INDIA INDIA11 Hap-09
12 GBMIN19862-13 INDIA INDIA12 Hap-10
13 GBMIN40785-13 INDIA INDIA13 Hap-02
14 GBA8455-12 INDIA INDIA14 Hap-01
15 GBMHT255-13 INDIA INDIA15 Hap-01
16 GBMHT256-13 INDIA INDIA16 Hap-01
17 GBMHT259-13 INDIA INDIA17 Hap-01
18 GBMIN19827-13 INDIA INDIA18 Hap-16
19 GBMIN19829-13 INDIA INDIA19 Hap-17
20 GBMIN19856-13 INDIA INDIA20 Hap-18
21 GBMIN19857-13 INDIA INDIA21 Hap-19
22 GBMIN19858-13 INDIA INDIA22 Hap-20
23 GBMIN19859-13 INDIA INDIA23 Hap-02
24 GBMIN40786-13 INDIA INDIA24 Hap-02
25 GBMIN40911-13 INDIA INDIA25 Hap-02
26 MATHR370-11 PAKISTAN PAKISTAN1 Hap-13
27 MATHR379-11 PAKISTAN PAKISTAN2 Hap-02
Supplementary tables
180
28 MATHR386-12 PAKISTAN PAKISTAN3 Hap-14
29 MATHR387-12 PAKISTAN PAKISTAN4 Hap-15
30 MAIMB465-09 PAKISTAN PAKISTAN5 Hap-02
31 MAIMB467-09 PAKISTAN PAKISTAN6 Hap-02
32 MAIMB475-09 PAKISTAN PAKISTAN7 Hap-07
33 MATHR071-10 PAKISTAN PAKISTAN8 Hap-22
34 MATHR215-11 PAKISTAN PAKISTAN9 Hap-02
35 MATHR381-12 PAKISTAN PAKISTAN10 Hap-23
36 GBMIN40909-13 THAILAND THAILAND1 Hap-02
37 GBMIN40912-13 THAILAND THAILAND2 Hap-12
38 GBMIN40913-13 THAILAND THAILAND3 Hap-12
39 GBMIN40784-13 THAILAND THAILAND4 Hap-02
40 GBMIN40787-13 THAILAND THAILAND5 Hap-12
41 GBMIN31912-13 USA USA1 Hap-11
42 GBA8577-12 CHINA CHINA Hap-11
43 GBMIN39465-13 JAPAN JAPAN1 Hap-21
d) Thrips flavus
Sr. no. Process ID Country name My code Haplotype
1 GBA8569-12 CHINA CHINA1 Hap-01
2 GBA8572-12 CHINA CHINA2 Hap-02
3 GBA8575-12 CHINA CHINA3 Hap-03
4 MATHR036-10 PAKISTAN PAKISTAN1 Hap-04
5 MATHR176-10 PAKISTAN PAKISTAN2 Hap-05
6 MATHR189-10 PAKISTAN PAKISTAN3 Hap-06
7 MATHR218-11 PAKISTAN PAKISTAN4 Hap-06
8 MATHR220-11 PAKISTAN PAKISTAN5 Hap-06
9 MATHR227-11 PAKISTAN PAKISTAN6 Hap-06
10 MATHR235-11 PAKISTAN PAKISTAN7 Hap-06
11 MATHR237-11 PAKISTAN PAKISTAN8 Hap-06
12 MATHR239-11 PAKISTAN PAKISTAN9 Hap-06
13 MATHR240-11 PAKISTAN PAKISTAN10 Hap-06
14 MATHR241-11 PAKISTAN PAKISTAN11 Hap-06
15 MATHR340-11 PAKISTAN PAKISTAN12 Hap-06
16 MATHR394-12 PAKISTAN PAKISTAN13 Hap-06
17 MATHR401-12 PAKISTAN PAKISTAN14 Hap-06
18 MATHR433-12 PAKISTAN PAKISTAN15 Hap-06
19 MATHR445-12 PAKISTAN PAKISTAN16 Hap-06
20 MATHR450-12 PAKISTAN PAKISTAN17 Hap-06
21 MATHR467-12 PAKISTAN PAKISTAN18 Hap-05
22 MATHR469-12 PAKISTAN PAKISTAN19 Hap-06
23 MATHR470-12 PAKISTAN PAKISTAN20 Hap-06
24 MATHR472-12 PAKISTAN PAKISTAN21 Hap-06
25 MAMTJ1058-12 PAKISTAN PAKISTAN22 Hap-06
26 MATHR028-10 PAKISTAN PAKISTAN23 Hap-07
27 MATHR064-10 PAKISTAN PAKISTAN24 Hap-06
28 MATHR065-10 PAKISTAN PAKISTAN25 Hap-06
29 MATHR070-10 PAKISTAN PAKISTAN26 Hap-06
30 MATHR161-10 PAKISTAN PAKISTAN27 Hap-06
31 MATHR173-10 PAKISTAN PAKISTAN28 Hap-04
32 MATHR216-11 PAKISTAN PAKISTAN29 Hap-06
33 MATHR222-11 PAKISTAN PAKISTAN30 Hap-06
34 MATHR223-11 PAKISTAN PAKISTAN31 Hap-06
35 MATHR226-11 PAKISTAN PAKISTAN32 Hap-06
Supplementary tables
181
36 MATHR232-11 PAKISTAN PAKISTAN33 Hap-06
37 MATHR238-11 PAKISTAN PAKISTAN34 Hap-06
38 MATHR242-11 PAKISTAN PAKISTAN35 Hap-06
39 MATHR246-11 PAKISTAN PAKISTAN36 Hap-06
40 MATHR250-11 PAKISTAN PAKISTAN37 Hap-06
41 MATHR281-11 PAKISTAN PAKISTAN38 Hap-06
42 MATHR322-11 PAKISTAN PAKISTAN39 Hap-06
43 MATHR326-11 PAKISTAN PAKISTAN40 Hap-06
44 MATHR437-12 PAKISTAN PAKISTAN41 Hap-06
45 MATHR440-12 PAKISTAN PAKISTAN42 Hap-06
46 MATHR457-12 PAKISTAN PAKISTAN43 Hap-06
47 MATHR461-12 PAKISTAN PAKISTAN44 Hap-06
48 MATHR462-12 PAKISTAN PAKISTAN45 Hap-06
49 MATHR471-12 PAKISTAN PAKISTAN46 Hap-06
50 GBA8570-12 CHINA CHINA4 Hap-08
51 MATHR032-10 PAKISTAN PAKISTAN47 Hap-09
52 MATHR046-10 PAKISTAN PAKISTAN48 Hap-06
53 MATHR168-10 PAKISTAN PAKISTAN49 Hap-06
54 MATHR180-10 PAKISTAN PAKISTAN50 Hap-06
55 MATHR181-10 PAKISTAN PAKISTAN51 Hap-02
56 MATHR219-11 PAKISTAN PAKISTAN52 Hap-06
57 MATHR221-11 PAKISTAN PAKISTAN53 Hap-06
58 MATHR224-11 PAKISTAN PAKISTAN54 Hap-06
59 MATHR225-11 PAKISTAN PAKISTAN55 Hap-06
60 MATHR228-11 PAKISTAN PAKISTAN56 Hap-06
61 MATHR229-11 PAKISTAN PAKISTAN57 Hap-06
62 MATHR233-11 PAKISTAN PAKISTAN58 Hap-06
63 MATHR236-11 PAKISTAN PAKISTAN59 Hap-06
64 MATHR245-11 PAKISTAN PAKISTAN60 Hap-04
65 MATHR249-11 PAKISTAN PAKISTAN61 Hap-06
66 MATHR253-11 PAKISTAN PAKISTAN62 Hap-06
67 MATHR321-11 PAKISTAN PAKISTAN63 Hap-06
68 MATHR344-11 PAKISTAN PAKISTAN64 Hap-06
69 MATHR359-11 PAKISTAN PAKISTAN65 Hap-06
70 MATHR436-12 PAKISTAN PAKISTAN66 Hap-06
71 MATHR456-12 PAKISTAN PAKISTAN67 Hap-06
72 MATHR460-12 PAKISTAN PAKISTAN68 Hap-06
73 MATHR475-12 PAKISTAN PAKISTAN69 Hap-06
74 GBA8571-12 CHINA CHINA5 Hap-02
75 GBA8573-12 CHINA CHINA6 Hap-10
76 GBA8574-12 CHINA CHINA7 Hap-11
77 GBMIN30378-13 CHINA CHINA8 Hap-02
78 MAMTH1053-12 PAKISTAN PAKISTAN70 Hap-06
79 MATHR030-10 PAKISTAN PAKISTAN71 Hap-02
80 MATHR150-10 PAKISTAN PAKISTAN72 Hap-06
81 MATHR154-10 PAKISTAN PAKISTAN73 Hap-06
82 MATHR164-10 PAKISTAN PAKISTAN74 Hap-06
83 MATHR172-10 PAKISTAN PAKISTAN75 Hap-06
84 MATHR217-11 PAKISTAN PAKISTAN76 Hap-12
85 MATHR230-11 PAKISTAN PAKISTAN77 Hap-06
86 MATHR231-11 PAKISTAN PAKISTAN78 Hap-06
87 MATHR234-11 PAKISTAN PAKISTAN79 Hap-06
88 MATHR244-11 PAKISTAN PAKISTAN80 Hap-06
89 MATHR247-11 PAKISTAN PAKISTAN81 Hap-06
90 MATHR251-11 PAKISTAN PAKISTAN82 Hap-13
91 MATHR252-11 PAKISTAN PAKISTAN83 Hap-06
Supplementary tables
182
92 MATHR324-11 PAKISTAN PAKISTAN84 Hap-06
93 MATHR414-12 PAKISTAN PAKISTAN85 Hap-06
94 MATHR441-12 PAKISTAN PAKISTAN86 Hap-06
95 MATHR442-12 PAKISTAN PAKISTAN87 Hap-06
96 MATHR444-12 PAKISTAN PAKISTAN88 Hap-14
97 MATHR446-12 PAKISTAN PAKISTAN89 Hap-06
98 MATHR463-12 PAKISTAN PAKISTAN90 Hap-06
99 MATHR031-10 PAKISTAN PAKISTAN91 Hap-07
100 MATHR067-10 PAKISTAN PAKISTAN92 Hap-06
101 MATHR093-10 PAKISTAN PAKISTAN93 Hap-06
102 MATHR212-11 PAKISTAN PAKISTAN94 Hap-15
103 MATHR243-11 PAKISTAN PAKISTAN95 Hap-06
104 MATHR276-11 PAKISTAN PAKISTAN96 Hap-06
105 MATHR327-11 PAKISTAN PAKISTAN97 Hap-06
106 MATHR342-11 PAKISTAN PAKISTAN98 Hap-06
107 MATHR382-12 PAKISTAN PAKISTAN99 Hap-06
108 MATHR417-12 PAKISTAN PAKISTAN100 Hap-06
109 MATHR438-12 PAKISTAN PAKISTAN101 Hap-06
110 MATHR439-12 PAKISTAN PAKISTAN102 Hap-06
111 MATHR466-12 PAKISTAN PAKISTAN103 Hap-06
Supplementary tables
183
Supplementary Table 2: Initial Partition of thrips species using molecular data
of barcode region (COI-5 end sequences)
Group Species No. of
specimen
Process ID
1 Aeolothrips PK01 1 MATHR092-10 2 Aeolothrips PK02 3 MATHR304-11; MATHR449-12; MATHR301-11 3 Aeolothrips intermedius 13 MATHR302-11; MATHR305-11; MATHR426-12;
MATHR420-12; MATHR107-10; MATHR290-11;
MATHR297-11; MATHR298-11; MATHR431-12;
MATHR299-11; MATHR300-11; MATHR296-11;
MATHR303-11
4 Ananthakrishnana euphorbiae 1 MATHR454-12
5 Anaphothrips sudanensis 1 MATHR306-11 6 Apterygothrips pellucidus 2 MATHR287-11; MATHR273-11 7 Arorathrips mexicanus 3 MATHR188-10; MATHR003-10; MATHR187-10
8 Chaetanaphothrips orchidii 4 MATHR430-12; MATHR165-10; MATHR429-12;
MATHR166-10
9 Chirothrips meridionalis 4 MATHR004-10; MATHR434-12; MAMTJ1057-12;
MAMTJ1059-12 10 Dendrothripoides innoxius 8 MATHR001-10; MATHR277-11; MATHR081-10;
MATHR009-10; MATHR007-10; MATHR083-10;
MATHR005-10; MATHR008-10
11 Frankliniella schultzei 22 MATHR062-10; MATHR364-11; MATHR367-11;
MATHR368-11; MATHR377-11; MATHR171-10;
MAIMB477-09; MAIMB478-09; MAIMB479-09;
MAIMB481-09; MAIMB482-09; MATHR010-10;
MATHR012-10; MATHR016-10; MATHR017-10;
MATHR018-10; MATHR019-10; MATHR094-10;
MATHR341-11; MATHR348-11; MATHR061-10;
MATHR361-11
12 Haplothrips andresi 6 MATHR121-10; MATHR095-10; MATHR054-10;
MATHR055-10; MATHR056-10; MATHR336-11
13 Haplothrips bagrolis 1 MATHR314-11
14 Haplothrips ciliatus 5 MATHR120-10; MATHR118-10; MATHR117-10;
MATHR119-10; MATHR123-10
15 Haplothrips ganglbaueri 39 MATHR256-11; MATHR255-11; MATHR254-11;
MATHR059-10; MATHR060-10; MATHR391-12;
MATHR390-12; MATHR388-12; MATHR339-11;
MATHR334-11; MATHR331-11; MATHR330-11;
MATHR319-11; MATHR318-11; MATHR317-11;
MATHR295-11; MATHR294-11; MATHR293-11;
MATHR292-11; MATHR291-11; MATHR289-11;
MATHR286-11; MATHR285-11; MATHR283-11;
MATHR274-11; MATHR272-11; MATHR271-11;
MATHR270-11; MATHR269-11; MATHR268-11;
MATHR266-11; MATHR265-11; MATHR264-11;
MATHR263-11; MATHR262-11; MATHR261-11;
MATHR260-11; MATHR258-11; MATHR257-11
16 Haplothrips gowdeyi 1 MATHR050-10
17 Haplothrips PK01 1 MATHR458-12
18 Haplothrips reuteri 8 MATHR423-12; MATHR452-12; MATHR422-12;
MATHR453-12; MATHR397-12; MATHR421-12;
MATHR459-12;MATHR455-12
19 Haplothrips stylatus 1 MATHR126-10
20 Haplothrips tenuipennis 25 MATHR052-10; MATHR053-10; MATHR057-10;
MATHR058-10; MATHR080-10; MATHR124-10;
MATHR125-10; MATHR063-10; MATHR447-12;
MATHR443-12; MATHR333-11; MATHR332-11;
MATHR473-12; MATHR122-10; MATHR393-12;
MATHR400-12; MATHR051-10; MATHR091-10;
MATHR090-10; MATHR089-10; MATHR088-10;
MATHR087-10; MATHR116-10; MATHR329-11;
Supplementary tables
184
MATHR468-12
21 Hydatothrips atactus 1 MATHR002-10
22 Lefroyothrips lefroyi 1 MAMTX200-14
23 Liothrips infrequens 1 MATHR432-12
24 Megalurothrips pecularis 10 MATHR108-10; MATHR027-10; MATHR102-10;
MATHR112-10; MATHR101-10; MATHR105-10;
MATHR035-10; MATHR106-10; MATHR100-10;
MATHR034-10
25 Megalurothrips usitatus 5 MATHR084-10; MATHR015-10; MATHR099-10;
MATHR141-10; MATHR114-10
26 Microcephalothrips
abdominalis 15 MATHR039-10; MATHR041-10; MATHR042-10;
MATHR043-10; MATHR115-10; MATHR267-11;
MATHR025-10; MATHR024-10; MATHR023-10;
MATHR022-10; MATHR096-10; MATHR109-10;
MATHR110-10; MATHR113-10; MATHR040-10
27 Mycterothrips nilgiriensis 1 MATHR427-12
28 Neohydatothrips samayunkur 7 MATHR143-10; MATHR144-10; MATHR145-10;
MATHR142-10; MATHR140-10; MATHR138-10;
MATHR104-10 29 Phlaeothripidae PK01 1 MAMTI1553-12
30 Phlaeothripidae PK02 6 MAMTF1456-12; MAMTI1556-12; MAMTF1455-12;
MAMTF1457-12; MAMTI1551-12; MAMTF1461-12
31 Plicothrips apicalis 15 MATHR337-11; MATHR026-10; MAMTJ1056-12;
MAMTN1009-13; MAMTO609-13; MAMTN1010-
13; MAMTN1007-13; MAMTN1013-13;
MAMTN1011-13; MAMTI1550-12; MAMTN1012-
13; MAMTN1014-13; MAMTN1016-13;
MAMTN1008-13; MAMTO608-13
32 Pseudodendrothrips bhattii 1 MATHR049-10 33 Scirtothrips dorsalis 10 MATHR387-12; MATHR386-12; MATHR381-12;
MATHR370-11; MATHR379-11; MATHR071-10;
MAIMB475-09; MATHR215-11; MAIMB465-09;
MAIMB467-09 34 Scirtothrips oligochaetus 1 MATHR360-11 35 Scolothrips rhagebianus 1 MATHR354-11 36 Taeniothrips major 4 MATHR103-10; MATHR021-10; MATHR033-10;
MATHR111-10 37 Thripidae PK01 3 MATHR399-12; MATHR408-12; MATHR412-12
38 Thripidae PK02 5 MATHR098-10; MATHR097-10; MATHR139-10;
MATHR128-10; MATHR146-10
39 Thripidae PK03 1 MAMTW356-14
40 Thrips alatus 2 MATHR029-10; MATHR175-10 41 Thrips apicatus 5 MATHR325-11; MATHR248-11; MATHR278-11;
MATHR279-11; MATHR214-11 42 Thrips carthami 7 MATHR162-10; MATHR159-10; MATHR149-10;
MATHR155-10; MATHR151-10; MATHR152-10;
MATHR163-10 43 Thrips coloratus 15 MATHR132-10; MATHR392-12; MATHR066-10;
MATHR398-12; MATHR069-10; MATHR130-10;
MATHR177-10; MATHR186-10; MATHR131-10;
MATHR396-12; MATHR174-10; MATHR403-12;
MATHR170-10; MATHR135-10; MATHR134-10 44 Thrips decens 1 MATHR137-10 45 Thrips flavus 104 MATHR243-11; MATHR244-11; MATHR245-11;
MATHR246-11; MATHR247-11; MATHR249-11;
MATHR250-11; MATHR251-11; MATHR252-11;
MATHR253-11; MATHR460-12; MATHR457-12;
MATHR456-12; MATHR450-12; MATHR446-12;
MATHR445-12; MATHR444-12; MATHR442-12;
MATHR441-12; MATHR440-12; MATHR439-12;
MATHR472-12; MATHR189-10; MATHR471-12;
MATHR470-12; MATHR469-12; MATHR467-12;
MATHR181-10; MATHR438-12; MATHR180-10;
MATHR437-12; MATHR276-11; MATHR466-12;
Supplementary tables
185
MATHR281-11; MATHR463-12; MATHR436-12;
MATHR176-10; MATHR433-12; MATHR173-10;
MATHR172-10; MATHR217-11; MATHR164-10;
MATHR161-10; MATHR154-10; MATHR028-10;
MATHR030-10; MATHR031-10; MATHR150-10;
MATHR032-10; MATHR417-12; MATHR321-11;
MATHR322-11; MATHR323-11; MATHR324-11;
MATHR326-11; MATHR327-11; MATHR328-11;
MATHR168-10; MATHR218-11; MATHR401-12;
MATHR219-11; MATHR220-11; MATHR221-11;
MATHR222-11; MATHR046-10; MATHR223-11;
MATHR359-11; MATHR224-11; MATHR225-11;
MATHR226-11; MATHR227-11; MATHR228-11;
MATHR229-11; MATHR394-12; MATHR230-11;
MATHR231-11; MATHR064-10; MATHR065-10;
MATHR067-10; MATHR232-11; MATHR233-11;
MATHR070-10; MATHR382-12; MATHR234-11;
MATHR235-11; MATHR236-11; MATHR237-11;
MATHR238-11; MATHR239-11; MATHR240-11;
MATHR241-11; MATHR242-11; MATHR342-11;
MATHR036-10; MATHR344-11; MATHR461-12;
MATHR216-11; MATHR416-12; MATHR462-12;
MATHR093-10; MATHR212-11; MATHR414-12;
MATHR340-11; MATHR475-12 46 Thrips florum 2 MATHR153-10; MATHR158-10 47 Thrips hawaiiensis 2 MATHR315-11; MATHR385-12 48 Thrips palmi 36 MATHR213-11; MAIMB460-09; MATHR345-11;
MATHR347-11; MATHR082-10; MATHR350-11;
MATHR351-11; MATHR353-11; MATHR079-10;
MATHR355-11; MATHR078-10; MATHR077-10;
MATHR362-11; MATHR363-11; MATHR365-11;
MATHR366-11; MATHR369-11; MATHR376-11;
MATHR378-11; MATHR068-10; MATHR048-10;
MATHR047-10; MATHR013-10; MATHR011-10;
MAIMB483-09; MAIMB480-09; MAIMB476-09;
MAIMB474-09; MAIMB472-09; MAIMB471-09;
MAIMB470-09; MAIMB469-09;MAIMB466-09;
MAIMB463-09; MAIMB462-09; MAIMB461-09 49 Thrips palmi 8 MATHR185-10; MATHR184-10; MATHR182-10;
MATHR179-10; MATHR178-10; MATHR338-11;
MATHR356-11; MATHR358-11 50 Thrips PK01 1 MATHR160-10 51 Thrips PK02 7 MATHR072-10; MATHR044-10; MATHR045-10;
MATHR076-10; MATHR075-10; MATHR074-10;
MATHR073-10 52 Thrips tabaci 36 MATHR199-11; MATHR352-11; MATHR349-11;
MATHR202-11; MATHR316-11; MATHR313-11;
MATHR312-11; MATHR311-11; MATHR201-11;
MATHR211-11; MATHR210-11; MATHR464-12;
MATHR275-11; MATHR191-11; MATHR192-11;
MATHR193-11; MATHR194-11; MATHR465-12;
MATHR195-11; MATHR196-11; MATHR209-11;
MATHR448-12; MATHR208-11; MATHR197-11;
MATHR207-11; MATHR206-11; MATHR205-11;
MATHR198-11; MATHR380-11; MATHR204-11;
MATHR375-11; MATHR374-11; MATHR372-11;
MATHR203-11; MATHR200-11; MATHR357-11 53 Thrips trehernei 4 MATHR402-12; MATHR424-12; MATHR425-12;
MATHR451-12
Supplementary tables
186
Supplementary Table 3: Recursive Partition of thrips species using molecular
data of barcode region (COI-5 end sequences)
Group Species BOLD ID No. of
specimen
Process ID
1 Aeolothrips intermedius BOLD:
AAZ8618
10 MATHR302-11; MATHR305-11;
MATHR107-10; MATHR290-11;
MATHR297-11; MATHR298-11;
MATHR299-11; MATHR300-11;
MATHR296-11; MATHR303-11
2 Aeolothrips intermedius BOLD:
AAU0572
3 MATHR426-12; MATHR420-12;
MATHR431-12
3 Aeolothrips PK01 BOLD:
AAN6626
1 MATHR092-10
4 Aeolothrips PK02 BOLD:
AAZ8619
3 MATHR304-11; MATHR449-12;
MATHR301-11
5 Ananthakrishnana
euphorbiae BOLD:
ACA2783
1 MATHR454-12
6 Anaphothrips sudanensis BOLD:
AAV3388
1 MATHR306-11
7 Apterygothrips pellucidus BOLD:
AAY6328
2 MATHR287-11; MATHR273-11
8 Arorathrips mexicanus BOLD:
AAN5064
3 MATHR188-10; MATHR003-10;
MATHR187-10
9 Chaetanaphothrips
orchidii
BOLD:
AAP7685
4 MATHR430-12; MATHR165-10;
MATHR429-12; MATHR166-10
10 Chirothrips meridionalis BOLD:
AAN5797
4 MATHR004-10; MATHR434-12;
MAMTJ1057-12; MAMTJ1059-12
11 Dendrothripoides
innoxius
BOLD:
AAN5065
8 MATHR001-10; MATHR277-11;
MATHR081-10; MATHR009-10;
MATHR007-10; MATHR083-10;
MATHR005-10; MATHR008-10
12 Frankliniella schultzei BOLD:
AAN6620
22 MATHR062-10; MATHR364-11;
MATHR367-11; MATHR368-11;
MATHR377-11; MATHR171-10;
MAIMB477-09; MAIMB478-09;
MAIMB479-09; MAIMB481-09;
MAIMB482-09; MATHR010-10;
MATHR012-10; MATHR016-10;
MATHR017-10; MATHR018-10;
MATHR019-10; MATHR094-10;
MATHR341-11; MATHR348-11;
MATHR061-10; MATHR361-11
13 Haplothrips andresi BOLD:
AAN5799
6 MATHR121-10; MATHR095-10;
MATHR054-10; MATHR055-10;
MATHR056-10; MATHR336-11
14 Haplothrips bagrolis BOLD:
AAZ8515
1 MATHR314-11
15 Haplothrips ciliatus BOLD:
AAU5460
5 MATHR120-10; MATHR118-10;
MATHR117-10; MATHR119-10;
MATHR123-10
16 Haplothrips ganglbaueri BOLD:
ACF1370
39 MATHR256-11; MATHR255-11;
MATHR254-11; MATHR059-10;
MATHR060-10; MATHR391-12;
MATHR390-12; MATHR388-12;
MATHR339-11; MATHR334-11;
MATHR331-11; MATHR330-11;
MATHR319-11; MATHR318-11;
MATHR317-11; MATHR295-11;
MATHR294-11; MATHR293-11;
MATHR292-11; MATHR291-11;
Supplementary tables
187
MATHR289-11; MATHR286-11;
MATHR285-11; MATHR283-11;
MATHR274-11; MATHR272-11;
MATHR271-11; MATHR270-11;
MATHR269-11; MATHR268-11;
MATHR266-11; MATHR265-11;
MATHR264-11; MATHR263-11;
MATHR262-11; MATHR261-11;
MATHR260-11; MATHR258-11;
MATHR257-11
17 Haplothrips gowdeyi BOLD:
AAN5798
1 MATHR050-10
18 Haplothrips PK01 BOLD:
ACA2828
1 MATHR458-12
19 Haplothrips reuteri BOLD:
ACA2784
7 MATHR423-12; MATHR452-12;
MATHR422-12; MATHR453-12;
MATHR421-12; MATHR459-
12;MATHR455-12
20 Haplothrips reuteri BOLD:
AAI6863
1 MATHR397-12
21 Haplothrips stylatus BOLD:
AAI6863
1 MATHR126-10
22 Haplothrips tenuipennis BOLD:
AAN4488
25 MATHR052-10; MATHR053-10;
MATHR057-10; MATHR058-10;
MATHR080-10; MATHR124-10;
MATHR125-10; MATHR063-10;
MATHR447-12; MATHR443-12;
MATHR333-11; MATHR332-11;
MATHR473-12; MATHR122-10;
MATHR393-12; MATHR400-12;
MATHR051-10; MATHR091-10;
MATHR090-10; MATHR089-10;
MATHR088-10; MATHR087-10;
MATHR116-10; MATHR329-11;
MATHR468-12
23 Hydatothrips atactus BOLD:
AAN9110
1 MATHR002-10
24 Lefroyothrips lefroyi BOLD:
ACI6048
1 MAMTX200-14
25 Liothrips infrequens BOLD:
ACA2829
1 MATHR432-12
26 Megalurothrips pecularis BOLD:
AAN6623
10 MATHR108-10; MATHR027-10;
MATHR102-10; MATHR112-10;
MATHR101-10; MATHR105-10;
MATHR035-10; MATHR106-10;
MATHR100-10; MATHR034-10
27 Megalurothrips usitatus BOLD:
AAM8053
5 MATHR084-10; MATHR015-10;
MATHR099-10; MATHR141-10;
MATHR114-10
28 Microcephalothrips
abdominalis
BOLD:
AAI0410
15 MATHR039-10; MATHR041-10;
MATHR042-10; MATHR043-10;
MATHR115-10; MATHR267-11;
MATHR025-10; MATHR024-10;
MATHR023-10; MATHR022-10;
MATHR096-10; MATHR109-10;
MATHR110-10; MATHR113-10;
MATHR040-10
29 Mycterothrips
nilgiriensis
BOLD:
ACA2806
1 MATHR427-12
30 Neohydatothrips
samayunkur
BOLD:
AAP7680
7 MATHR143-10; MATHR144-10;
MATHR145-10; MATHR142-10;
MATHR140-10; MATHR138-10;
MATHR104-10
Supplementary tables
188
31 Phlaeothripidae PK01 BOLD:
ACA9557
1 MAMTI1553-12
32 Phlaeothripidae PK02 BOLD:
ACK3864
6 MAMTF1456-12; MAMTI1556-
12; MAMTF1455-12;
MAMTF1457-12; MAMTI1551-
12; MAMTF1461-12
33 Plicothrips apicalis BOLD:
AAN6622
15 MATHR337-11; MATHR026-10;
MAMTJ1056-12; MAMTN1009-
13; MAMTO609-13;
MAMTN1010-13; MAMTN1007-
13; MAMTN1013-13;
MAMTN1011-13; MAMTI1550-
12; MAMTN1012-13;
MAMTN1014-13; MAMTN1016-
13; MAMTN1008-13;
MAMTO608-13
34 Pseudodendrothrips
bhattii
BOLD:
ACG8261
1 MATHR049-10
35 Scirtothrips dorsalis BOLD:
AAC9748
10 MATHR387-12; MATHR386-12;
MATHR381-12; MATHR370-11;
MATHR379-11; MATHR071-10;
MAIMB475-09; MATHR215-11;
MAIMB465-09; MAIMB467-09 36 Scirtothrips oligochaetus BOLD:
AAZ8518
1 MATHR360-11
37 Scolothrips rhagebianus BOLD:
AAZ8517
1 MATHR354-11
38 Taeniothrips major BOLD:
AAN6621
4 MATHR103-10; MATHR021-10;
MATHR033-10; MATHR111-10
39 Thripidae PK01 BOLD:
ACA3048
3 MATHR399-12; MATHR408-12;
MATHR412-12
40 Thripidae PK02 BOLD:
AAP7681
5 MATHR098-10; MATHR097-10;
MATHR139-10; MATHR128-10;
MATHR146-10
41 Thripidae PK03 BOLD:
ACP4916
1 MAMTW356-14
42 Thrips alatus BOLD:
AAN6625
2 MATHR029-10; MATHR175-10
43 Thrips apicatus BOLD:
AAY6262
5 MATHR325-11; MATHR248-11;
MATHR278-11; MATHR279-11;
MATHR214-11 44 Thrips carthami BOLD:
AAP7682
7 MATHR162-10; MATHR159-10;
MATHR149-10; MATHR155-10;
MATHR151-10; MATHR152-10;
MATHR163-10 45 Thrips coloratus BOLD:
AAK1804
15 MATHR132-10; MATHR392-12;
MATHR066-10; MATHR398-12;
MATHR069-10; MATHR130-10;
MATHR177-10; MATHR186-10;
MATHR131-10; MATHR396-12;
MATHR174-10; MATHR403-12;
MATHR170-10; MATHR135-10;
MATHR134-10 46 Thrips decens BOLD:
AAP7679
1 MATHR137-10
47 Thrips flavus BOLD:
AAN6624
104 MATHR243-11; MATHR244-11;
MATHR245-11; MATHR246-11;
MATHR247-11; MATHR249-11;
MATHR250-11; MATHR251-11;
MATHR252-11; MATHR253-11;
MATHR460-12; MATHR457-12;
MATHR456-12; MATHR450-12;
Supplementary tables
189
MATHR446-12; MATHR445-12;
MATHR444-12; MATHR442-12;
MATHR441-12; MATHR440-12;
MATHR439-12; MATHR472-12;
MATHR189-10; MATHR471-12;
MATHR470-12; MATHR469-12;
MATHR467-12; MATHR181-10;
MATHR438-12; MATHR180-10;
MATHR437-12; MATHR276-11;
MATHR466-12; MATHR281-11;
MATHR463-12; MATHR436-12;
MATHR176-10; MATHR433-12;
MATHR173-10; MATHR172-10;
MATHR217-11; MATHR164-10;
MATHR161-10; MATHR154-10;
MATHR028-10; MATHR030-10;
MATHR031-10; MATHR150-10;
MATHR032-10; MATHR417-12;
MATHR321-11; MATHR322-11;
MATHR323-11; MATHR324-11;
MATHR326-11; MATHR327-11;
MATHR328-11; MATHR168-10;
MATHR218-11; MATHR401-12;
MATHR219-11; MATHR220-11;
MATHR221-11; MATHR222-11;
MATHR046-10; MATHR223-11;
MATHR359-11; MATHR224-11;
MATHR225-11; MATHR226-11;
MATHR227-11; MATHR228-11;
MATHR229-11; MATHR394-12;
MATHR230-11; MATHR231-11;
MATHR064-10; MATHR065-10;
MATHR067-10; MATHR232-11;
MATHR233-11; MATHR070-10;
MATHR382-12; MATHR234-11;
MATHR235-11; MATHR236-11;
MATHR237-11; MATHR238-11;
MATHR239-11; MATHR240-11;
MATHR241-11; MATHR242-11;
MATHR342-11; MATHR036-10;
MATHR344-11; MATHR461-12;
MATHR216-11; MATHR416-12;
MATHR462-12; MATHR093-10;
MATHR212-11; MATHR414-12;
MATHR340-11; MATHR475-12 48 Thrips florum BOLD:
AAP7683
2 MATHR153-10; MATHR158-10
49 Thrips hawaiiensis BOLD:
AAZ8516
2 MATHR315-11; MATHR385-12
50 Thrips palmi BOLD:
AAN2747
36 MATHR213-11; MAIMB460-09;
MATHR345-11; MATHR347-11;
MATHR082-10; MATHR350-11;
MATHR351-11; MATHR353-11;
MATHR079-10; MATHR355-11;
MATHR078-10; MATHR077-10;
MATHR362-11; MATHR363-11;
MATHR365-11; MATHR366-11;
MATHR369-11; MATHR376-11;
MATHR378-11; MATHR068-10;
MATHR048-10; MATHR047-10;
MATHR013-10; MATHR011-10;
MAIMB483-09; MAIMB480-09;
MAIMB476-09; MAIMB474-09;
MAIMB472-09; MAIMB471-09;
Supplementary tables
190
MAIMB470-09; MAIMB469-09;
MAIMB466-09; MAIMB463-09;
MAIMB462-09; MAIMB461-09 51 Thrips palmi BOLD:
AAE7913
8 MATHR185-10; MATHR184-10;
MATHR182-10; MATHR179-10;
MATHR178-10; MATHR338-11;
MATHR356-11; MATHR358-11 52 Thrips PK01 BOLD:
AAP7684
1 MATHR160-10
53 Thrips PK02 BOLD:
AAN9111
7 MATHR072-10; MATHR044-10;
MATHR045-10; MATHR076-10;
MATHR075-10; MATHR074-10;
MATHR073-10 54 Thrips tabaci BOLD:
AAB3870
32 MATHR199-11; MATHR352-11;
MATHR349-11; MATHR202-11;
MATHR313-11; MATHR312-11;
MATHR311-11; MATHR211-11;
MATHR464-12; MATHR275-11;
MATHR191-11; MATHR192-11;
MATHR193-11; MATHR194-11;
MATHR465-12; MATHR195-11;
MATHR196-11; MATHR209-11;
MATHR448-12; MATHR208-11;
MATHR197-11; MATHR207-11;
MATHR206-11; MATHR198-11;
MATHR380-11; MATHR204-11;
MATHR375-11; MATHR374-11;
MATHR372-11; MATHR203-11;
MATHR200-11; MATHR357-11 55 Thrips tabaci BOLD:
AAB3870
4 MATHR316-11; MATHR201-11;
MATHR210-11; MATHR205-11
56 Thrips trehernei BOLD:
AAN9105
4 MATHR402-12; MATHR424-12;
MATHR425-12; MATHR451-12