Do 14-3-3 Proteins Interact with the F-box Stress Induced Protein

Family in Arabidopsis thaliana?

by

Ryan Apathy

This thesis is submitted to the faculty of the Biology Department

of the University of Puget Sound in partial fulfillment of the requirements

for the Coolidge Otis Chapman Honors Program

April 16, 2018

Approved by:

Dr. Bryan Thines

Thesis Advisor

Dr. Leslie Saucedo

Reader

Dr. Greg Johnson

Reader

2

Table of Contents

Abstract ......................................................................................................................................................... 3

Introduction ................................................................................................................................................... 4

The Ubiquitin 26S Proteasome System .................................................................................................... 4

Figure 1. Ubiquitin 26S Proteasome System ........................................................................................ 6

Figure 2. Structure of the SCF complex ............................................................................................... 7

Figure 3. FBX protein domain architecture .......................................................................................... 9

14-3-3 Proteins ........................................................................................................................................ 11

Figure 4. Functional roles of 14-3-3 proteins...................................................................................... 11

Figure 5. Phylogenic classification of 14-3-3 proteins ....................................................................... 12

14-3-3 Proteins and the UPS ................................................................................................................... 12

Figure 6. FBS1 and 14-3-3 proteins interact via BiFC in N. benthamiana ......................................... 13

Methods ...................................................................................................................................................... 15

Gene amplification .................................................................................................................................. 15

Cloning .................................................................................................................................................... 16

Subcloning and Y2H binary vectors ....................................................................................................... 16

Yeast strains and transformations ........................................................................................................... 17

Results ......................................................................................................................................................... 18

Figure 7. FBS1-4 multiple sequence alignment .................................................................................. 19

Figure 8. Schematic representation of Yeast 2-Hybrid constructs ...................................................... 19

Table 1. FBS Gal4 BD construct status .............................................................................................. 20

Table 2. 14-3-3 Gal4 AD construct status ........................................................................................... 20

Figure 9. Yeast 2-Hybrid results. ........................................................................................................ 21

Figure 10. FBS1 Gal4 BD yeast colony PCR ..................................................................................... 22

Discussion ................................................................................................................................................... 22

Figure 11. Multiple sequence alignment of No-0 and Col-0 FBS1 .................................................... 24

Acknowledgements ..................................................................................................................................... 26

References ................................................................................................................................................... 28

Supplemental Information .......................................................................................................................... 34

SI A. Primer sequences and restriction sites ....................................................................................... 34

SI B. Cloning and binary Y2H vector maps ....................................................................................... 35

3

Abstract

One of the most important abilities that eukaryotic cells possess is the capacity to

undergo intracellular change. Two families of regulatory protein that function to facilitate this

change in the model plant Arabidopsis thaliana are F-box (FBX) and 14-3-3 proteins. FBX

proteins serve as variable substrate adaptors for the Ubiquitin 26S Proteasome System (UPS),

which selectively tags proteins with ubiquitin (Ub) for degradation by the 26S proteasome. FBX

proteins, of which >700 have been identified and classified in Arabidopsis, provide the SCF

complex (SKP, Cullin, F-box) with extreme specificity in its protein degradation capabilities. 14-

3-3s subunits bind to each other to form homo- or heterodimers to bind phosphorylated residues

in targets to regulate subcellular localization, inhibit protein interactions, or act as a scaffold to

facilitate protein interactions. 14-3-3 proteins interact with the Ubiquitin 26S Proteasome System

in only a select few instances, including with F-box Stress Induced 1 (FBS1). However, both the

extent and biological consequences of this interaction are unknown. We hypothesize that FBS1

and closely related proteins FBS2-4 interact with non-epsilon 14-3-3 proteins, a plant-specific

subset of 14-3-3 isoforms. A Yeast 2-Hybrid assay is developed to assess the interactions

between FBS1 and non-ε 14-3-3 φ, ψ, λ, κ, and ω protein constructs. Full length and amino-

termini deletions (ΔNT) protein constructs are being developed to probe the degree of interaction

between these two protein families. This ongoing research examines the extent of this 14-3-3-

FBS1 interaction as well as the broader regulatory mechanisms and implications.

4

Introduction

As sessile organisms, plants have evolved to possess powerful mechanisms for responding to

biotic and abiotic stress conditions (1–3). Each form of stress, from pathogenic invasions (4) to

drought and cold (5) initiates a large-scale transcriptome response necessary for cellular survival.

For eukaryotic species, stress responses are predominately regulated on the molecular level, as

environmental conditions trigger an extensive array of stress-induced pathways (6). Often these

induced responses regulate proteins that are critical to the maintenance of cellular homeostasis.

One such example is the regulation of proteins called transcription factors (TFs), which bind to a

DNA sequence upstream of tens to thousands of genes to control genetic transcription rates (7).

The regulation of TFs can have a large impact on the activity and abundance of many

downstream genetic processes (8). Stress-induced molecular responses can also regulate rate-

limiting enzymes in critical cellular processes (e.g. cell division), resulting in the decreased

function of those respective pathways and overall metabolic processes (9). This system of

intracellular protein regulation is largely controlled by the ubiquitin 26S proteasome system

(UPS), a complex and highly organized system of protein degradation (6, 10–12).

The Ubiquitin 26S Proteasome System

The UPS facilitates selective protein degradation, or proteolysis. This system participates in

regulating a diverse array of essential cellular functions, including cell division and development

(11, 12), DNA replication (13), hormone signaling (14), circadian clock regulation (15, 16), and

disease response (17–19), as well as general cellular homeostasis (11, 12, 20). So critical is

proper UPS function that malfunctions in the system have been associated with numerous human

diseases, including neurodegenerative and age-related disorders such as Alzheimer's,

5

Parkinson’s, and Huntington's disease (21), stroke (22), diabetic nephropathy (23), multiple

myeloma (24), and progeroid syndromes (25). The UPS has also been implicated in cancer, with

roles in tumor suppression (26), carcinogenesis (27), as well as in the diagnosis and treatment of

multiple forms of cancer (28–33). The role of the UPS is critical to cellular survival and the

coordination of each component of the system is essential for its proper function. In Arabidopsis

thaliana, a model plant, this system involves the concerted function and regulation of nearly

1,400 proteins, or more than 5% of its entire genome (10, 12).

Selective proteolysis is accomplished by tagging target proteins with ubiquitin (Ub), a 76-

amino acid peptide that is absolutely conserved among higher order plants and vertebrates (34).

Even among animals, plants, and fungi, Ub sequences only differ by two or three residues (34).

Ub tagging and subsequent proteolysis is accomplished through a sequential enzyme cascade via

E1, E2, and E3 enzymes, respectively, followed by degradation by the 26S proteasome (Fig. 1)

(10, 35). This cascade begins with the activation of Ub by the E1 Ub-activating enzyme (34) and

the transfer of this activated Ub to the E2 Ub-conjugating enzyme (34). Ub is then delivered to

the E3 Ub ligase enzyme complex which is bound to the protein targeted for degradation (39). In

the final step, the E3 Ub ligase acts as a bridge between the E2 conjugating enzyme and the

substrate and covalently binds the activated Ub to the target protein (34, 36). This ubiquitination

cascade occurs many times, resulting in the construction of a polyUb chain on the target protein

(35). A chain length of four Ubs through Lys48 is considered the minimum chain length for the

protein to be degraded by the 26S proteasome (35). The 26S proteasome, a ~65 subunit, 2.1 MDa

compex, degrades proteins by disrupting peptide bonds and recycles the digested amino acids

and Ub for further use (34–36).

6

Figure 1. Ubiquitin 26S Proteasome System. Ubiquitin (Ub) molecules are activated, conjugated

and covalently linked to the target substrate by E1, E2 and E3 enzymes, respectively. Proteins are

targeted for degradation through polyubiquitylation via the E3 Ub-ligase enzyme component.

Following polyubiquitylation, proteins are degraded by the 26S proteasome. Ub and substrate

amino acids are recycled for further use in the cell (Figure adapted from Rahimi, 2012).

Protein target selectivity for the UPS to conferred by the E3 Ub ligases enzyme complex.

There exist three primary E3 ligase families, each defined by their protein components and by

their mode of Ub transfer (37). These families include complexes with the motifs Really

Interesting New Gene (RING) (38), RING-between-RING (RBR) (39), and homologous to the

E6AP carboxyl terminus (HECT) (40). RING E3s are the largest family of Ub ligases and are

characterized by the presence of either a zinc-binding RING motif or a RING-like U-box motif

(41). Several RING E3s exist, including mono-, homo-, and heterodimeric RINGs, mono- and

homodimeric U-boxes, and Cullin-RING Ligases (CRLs) (38, 41). Regardless of their E3 family

classification, all E3 complexes are modular structures composed of several more specific

protein members. The modular character of E3 ligases, combined with the size of each

Protein

peptides

7

component protein family suggests that a vast number of putative E3s that can be synthesized in

vivo, demonstrating the necessity for these complexes to perform highly regulated and specific

tasks (46).

The SKP-Cullin-F-box (SCF) complex is the

largest E3 ligase subfamily within CRLs (20). Target

specificity is provided to SCFs via variable F-box

(FBX) proteins, which are defined by the presence of

conserved F-box domains (Fig. 2) (20, 43). The F-

box domains connect the FBX protein to the SCF

complex by binding one of 21 different Arabidopsis

SKP-like proteins in the core complex (ASKs) (44).

Unique domains in the FBX amino-terminus (NT)

bind to target substrates and initiate the

ubiquitination process (42). In Arabidopsis, nearly

700 putative FBX proteins have been identified and

classified based on their unique domain architecture

(42). This large number of FBX proteins is common

among other plants and is an order of magnitude

larger than the number of FBX proteins found in

humans, yeast, and Drosophila, to name a few (42).

The fact that so many SCFFBX combinations can be

constructed in Arabidopsis suggests that SCFs

provide the UPS with extraordinary specificity in their regulatory capabilities.

Figure 2. Structure of the SCF

complex. The SCF-type E3 Ubiquitin

ligase is comprised of SKP, Cullin and

F-box proteins. R-box (RBX) proteins

bind the Ub-loaded E2 ligase and

transfer Ub to the target protein.

Generally, FBX proteins interact with

SKP proteins via an F-Box domain in

the amino-terminus and with target

substrates via interaction domains in

the carboxy-terminus. The ribbon

model (A) and 3-dimentional depiction

(B) of the SCF complex demonstrate

its modular structure (Figure adapted

from Hua and Vierstra, 2011).

8

The FBX protein superfamily is tremendously diverse in function and domain composition.

Most FBX proteins contain a ~60-aa amino-terminal F-box motif that is responsible for

interacting with the core SCF complex by binding to a SKP subunit (42). Several different

carboxy-terminal domains have been identified in Arabidopsis FBX proteins that interact with

variable targets (Fig. 3A). FBX proteins most commonly contain either leucine-rich repeats

(LRRs) and Kelch domains (42). LRRs are small (~20-aa) motifs that contain positionally

conserved leucine residues (45). Multiple LRRs associate with one another to create a curved

docking structure for target substrates (45). Canonical Arabidopsis FBX proteins Transport

Inhibitor Response-1 (TIR1) and Coronatine Insensitive-1 (COI1) both contain LRRs in their

substrate recognition C-termini. Of the ~700 identified F-box proteins, 202 contain LRRs or a

plant-specific LRR derivative (42). Another 100 FBX proteins contain Kelch domain repeats, in

which β-sheets assemble to create a substrate-binding β-propeller tertiary structure (42, 46).

Additional substrate recognition F-box domains include WD-40, Armadillo, and tetratricopeptide

repeats, as well as Tub, actin, DEAD-like helicase and jumonji C domains (42). Such variability

in target recognition capabilities allow single FBX protein targets to range from single other

proteins (15) to entire protein families (14, 47).

This characteristic domain architecture is not found in all FBX proteins. One such example

of proteins with noncanonical architectures is the F-box Stress Induced family (FBS1-4). Much

about this protein family is unknown and their domain structure differs from that of other well-

classified FBX proteins, including COI1 and TIR1 (Fig. 3A, B). Like other FBX proteins, the

FBS family interacts with targets in via carboxy-terminus. Unlike other FBX proteins, however,

the F-box domain in appears in the center of the gene, rather than the amino-terminus (48). This

F-box domain architecture is not the only of its kind; three additional F-box proteins exist with

9

N-terminal domains, including LKP2, ZTL, and FKF1 (15, 16, 49). The N-terminal domain

(PAS/LOV) in these proteins is hypothesized to function as flavin-containing photoreceptors, as

all three proteins are required for regulating flowering and circadian rhythm (42). The

significance of this N-terminal domain in FBS1-4 domain architecture has yet to be elucidated.

Figure 3. FBX protein domain architecture. (A) The domain architecture of all 694 FBX

proteins, listed in order from most common to least. In general, the F-box domain occurs in the

protein N-term. and the substrate interaction domain in the C-term. (B) The domain architecture

of FBS1 differs from others in the F-box superfamily as the F-box domain is found in the protein

center (Figure adapted from Gagne, 2012).

As its name indicates, FBS1 is implicated in Arabidopsis abiotic stress response (44). FBS1

mRNA accumulates in response to several stress factors, including general wounding and NaCl

(50). Additionally, FBS1 mRNA accumulates in the presence of growth regulators such as

10

jasmonic acid (JA), ethylene biosynthesis precursor ACC, salicyclic acid (SA), and absiscic acid

(ABA) (50). FBS1 expression levels were shown to increase in response to cold and drought

stress (51). Additionally, fbs1-1 knock-out lines reveal that FBS1 is required for elevation of JA

genes, and a more complicated expression profile was observed for ABA genes (51). This

correlation between abiotic stress and FBS1 mRNA accumulation suggests that FBS1

participates in plant stress response. Much less is known about the biological function of the rest

of the FBS family, FBS2-4. These proteins are similar in their domain architecture to FBS1 and

share a high degree of homology in their N-, F-Box and C-terminal domains. Little is known

about the biological function of FBS2-4 as their specific roles have not been the subject of much

research.

Since little is known of the FBS family regarding their biological function, these proteins can

be used as a unique tool for investigating modes of UPS regulation. Similar investigations of

UPS regulation and interactions with additional regulatory protein families in humans has led to

the increased understanding and treatment of a variety of diseases (52–54) and additional

research can provide novel information regarding native UPS function. One clue for

understanding the biological function of the FBS family is provided by the observation of an

unique interaction between FBS1 and 14-3-3 proteins, another well-studied family of regulatory

proteins in Arabidopsis (48, 50). 14-3-3 proteins are highly conserved among eukaryotes and

perform extremely diverse regulatory roles, though very little is known about the significance of

this novel interaction.

11

14-3-3 Proteins

14-3-3 proteins facilitate and promote intracellular change by forming homo- or heterodimers

and binding client substrates to regulate post-translational activity (55–57). Such dimers function

in four primary categories: they directly interact with clients to alter their structure and modify

that client’s activity (58); they act as a scaffold to facilitate protein-protein interactions (59); they

physically occlude clients, preventing interactions from occurring (60); and promoting the

subcellular localization of clients (Fig. 4) (61–63). Examples of biochemical regulation include

14-3-3 protein association with the Ras-Raf signaling pathway, cell death agonist BAD, and

hypothesized localization of cell cycle mediator cdc25 (60).

Figure 4. Functional roles of 14-

3-3 proteins. 14-3-3 monomers

dimerize and modify a broad range

of targets. Their function ranges

from modulating the structure of

proteins to increase or decrease

their efficiency, inhibit of promote

the interaction of two proteins, and

increase or decrease proteins

stability (Figure adapted from

Obsil and Obsilova, 2011).

In Arabidopsis, 14-3-3 proteins isoforms are divided into two phylogenic groups: epsilon,

which contains epsilon (ε), iota (ι), mu (μ), omicron (ο), and pi (π) isoforms; and non-epsilon,

which contains lambda (λ), upsilon (υ), omega (ω), kappa (κ), phi (φ), psi (ψ), chi (χ), and nu (ν)

12

isoforms (Fig. 5) (64). Epsilon 14-3-3s are located across humans and other eukaryotes, while

non-epsilon 14-3-3s are absent from the human genome (64). Further phylogenic classification

within non-epsilon and epsilon families is accomplished through intron and exon composition

(64). Additionally, the subcellular localization of each 14-3-3 protein can be used to provide

further classification: χ, ν, κ, and λ are active within the chloroplast; λ, ω, κ, and φ in the nucleus;

and λ in the vacuolar membrane, among other distinct locations (50). Regardless of epsilon or

non-epsilon designation, isoforms all share a high degree of homology, particularly within client

interaction domains.

Figure 5. Phylogenic

classification of 14-3-3 proteins.

Thirteen 14-3-3 isoforms are

expressed in Arabidopsis

thaliana. Epsilon and non-epsilon

classification is determined by the

number of exons and introns

within a given protein. Further

classification is provided by the

subcellular localization of

individual proteins (Figure

adapted from DeLille et al., 2001).

14-3-3 Proteins and the UPS

14-3-3 proteins interact with and regulate the UPS in a variety of ways. Recently, F-box

proteins AtSKIP18 and AtSKIP31 were shown to degrade 14-3-3 proteins in Arabidopsis to

regulate primary root growth in nitrogen deficiency (65). 14-3-3s are also degraded by ubiquitin

13

ligases ATL31 and ATL6 to control signaling for carbon and nitrogen metabolisms and C/N

balance response (66). In humans, the treatment of cells with the proteasome inhibitor MG132

caused a downregulation of 14-3-3 isoforms ε and ϴ/τ, with implications in cancer development

and treatment (67). More relevantly, FBS1 directly interacts with non-epsilon 14-3-3 proteins λ,

κ, ω, φ and ψ, though the exact biological significance of this interaction is unknown (48).

Bimolecular Fluorescence Complementation results verify an interaction between FBS1 and 14-

3-3 κ and ψ (Fig. 6). This research serves to probe the extent and relevance of the interaction

between FBS1 and 14-3-3 non-epsilon isoforms.

Figure 6. FBS1 and 14-3-3 proteins interact via BiFC in N. benthamiana. Confocal imaging of

(A) YFPn-FBS1 and YFPc-14-3-3 and (B) YFPn-FBS1 and YFPc-14-3-3 . Images were taken

with a 10x objective and 512x512 pixel resolution (Figure adapted from M. Bacher, unpublished).

14-3-3s interact with phosphorylated residues contained in canonical recognition motifs in

target proteins. One such recognition motif is the amphipathic grooves that result from conserved

A B

14

amino acid sequences in protein targets (62). Such conserved sites include RxRSxpSx, Rx1-2Sx2-

3S, and related derivatives (68, 69). FBS1 was not found to contain any such derivatives (48).

However, 14-3-3 proteins ζ and ε interact with the KATP channel α subunit, Kir6.2, in way that is

differs significantly from the amphipathic groves described above. 14-3-3 proteins ζ and ε

interact with Kir6.2 via a unique RKR arginine-based endoplasmic reticulum (ER) localization

signal in the protein C-terminal tail (70). An identical tri-basic motif exists in the N-terminal tails

of FBS1-4. This motif thus provides a putative means in which non-epsilon F-box proteins

interact with 14-3-3s (48).

One function of this observed interaction could be the FBS1-medicated degradation of 14-3-3

proteins. However, two primary pieces of evidence suggest that 14-3-3s are not targets of FBS1.

The first piece of evidence is that specific target recognition capabilities for the SCF complex are

conferred via interaction domains contained in the FBS1 carboxy-terminus (48). FBS1 and 14-3-

3s, however, interact via the FBS1 amino-terminus (48). This N-terminal interaction suggests

that FBS1 does not interact with 14-3-3s in the same manner as it does with its target(s).

Previous studies indicate that proteasome inhibitor MG132 was not necessary to visualize the 14-

3-3/FBS1 interaction, demonstrating that 14-3-3s are stable upon interaction with FBS1 (48).

Taken together, these results suggest that 14-3-3s are unlikely to be targeted for ubiquitination by

FBS1.

What is the biological function of the interaction between 14-3-3s and FBS1? Currently,

both the extent of this protein family interaction, as well as the specific interaction mechanism(s)

are unknown. It has previously been hypothesized that 14-3-3s help promote the dimerization of

SCFFBS1 (50). This hypothesis is supported by evidence that demonstrates the 14-3-3ε-mediated

dimerization of SCFFBS4 in various forms of human cancer (71). Additionally, it is possible that

15

14-3-3 proteins facilitate proper subcellular localization of F-box proteins. As mentioned above,

the RKR arginine-based endoplasmic reticulum (ER) localization signal and closely related basic

residue motifs in the C-terminal tail of FBS1-4 could prove necessary for the subcellular

localization of the FBS protein family.

This thesis serves to establish a protocol to probe the interaction between 14-3-3 proteins

and FBS1-4 in Arabidopsis. As such, a Yeast 2-Hybrid (Y2H) test was developed to assess the

extent of this 14-3-3/FBS interaction. If such an interaction is observed, then there might exists a

greater, unidentified regulatory function provided to the UPS via 14-3-3 proteins. The current

gap in knowledge about this interaction prevents us from understanding the role played by 14-3-

3s within the UPS. A broad interaction could suggest that 14-3-3 proteins play an important and

previously unrecognized regulatory role within the UPS. I hypothesize that the F-box Stress

Induced protein family interacts with non-epsilon 14-3-3 proteins in Arabidopsis thaliana.

Methods

Gene amplification

F-box and 14-3-3 genes were amplified from pooled Arabidopsis thaliana ecotype

Nossen (No-0) cDNA with gene-specific primers. Primers were designed using Primer3

(http://bioinfo.ut.ee/ primer3) to include restriction sites to facilitate sub-cloning into Yeast 2-

Hybrid (Y2H) binary vectors. Gene constructs were amplified via polymerase chain reaction

(PCR) with Phusion High Fidelity Polymerase (ThermoFisher) and were separated on an 1.5%

weight/volume (w/v) agarose gel. DNA fragments were excised and purified using QIAquick

Gel Extraction Kit for subsequent use according to manufacturer’s guidelines (Qiagen). Detailed

primer and restriction site information can be found in Supplemental Information A.

16

Cloning

Amplified gene constructs were A-tailed with GoTaq DNA Polymerase (Promega) at 72

°C for 30 min. and ligated into cloning vector pGEM-T with T4 DNA Ligase overnight at 4 °C,

according to manufacturer protocol (Promega). Following ligation, plasmids were transformed

into One Shot™ Top10 chemically competent E. coli cells according to manufacturer guidelines

(ThermoFisher) and were then plated on Lysogeny broth (LB) media containing carbenicillin

(100 μg/mL), X-Gal (50 μg/mL), and IPTG (1mM) and incubated overnight at 37 °C. White

colonies indicating insertion of product were selected and cultured in LB overnight at 37 °C for

plasmid isolation. Plasmids were prepared using QIAprep Spin Miniprep Kit according to

manufacture guidelines (Qiagen) and sequenced using T4 and SP6 forward and reverse primers

by EuroFins Genomics and mapped to reference sequences with Geneious software. CDS

reference sequences were obtained from the Arabidopsis Information Resource (TAIR). Detailed

plasmid maps can be found in Supplemental Information B.

Subcloning and Y2H binary vectors

Yeast 2-Hybrid vectors pGADT7-Rec and pGBKT7 were linearized with appropriate

restriction enzymes at 37 °C, 1hr. Restriction digest products were separated on 1.5% w/v

agarose gel. Gene constructs and linearized Y2H plasmids were extracted via QIAquick Gel

Extraction Kit according to manufacturer’s protocol (Qiagen). Digested products and plasmids

were mixed at a 3:1 molar ratio with T4 DNA Ligase at 16 °C, 24 hrs. Ligation reactions were

inactivated at 65 °C for 20 min. DNA (2 μL) was transformed into One Shot™ Top10

chemically competent E. coli cells. Cells were plated on LB media and grown at 37 °C, 12 hrs.

17

Vector-specific antibiotics (kanamycin or carbenicillin) were used to select transformed DNA.

Colonies were cultured in LB at 37 °C, 12 hrs for plasmid isolation. Detailed information

regarding vector sequences and restriction enzymes can be found in Supplementary Information

A and B.

Yeast strains and transformations

Saccharomyces cerevisiae yeast strains Y187 (genotype MATα, ura3-52, his3-200, ade2-

101, trp1-901, leu2-3, 112, gal4Δ, met–, gal80Δ, MEL1, URA3::GAL1UAS -GAL1TATA-lacZ) and

Y2HGold (genotype MATa, trp1-901, leu2-3, 112, ura3-52, his3-200, gal4Δ, gal80Δ,

LYS2::GAL1UAS–Gal1TATA–His3, GAL2UAS–Gal2TATA–Ade2 URA3::MEL1UAS–Mel1TATA AUR1-C

MEL1) were utilized as complementary mating pairs (Clontech). DNA (1 μg) was transformed

into yeast cells (50 μL) with 50% w/v polyethylene glycol (PEG), 1.0 M LiAc, and 2.0 mg/mL

single-stranded carrier DNA (salmon sperm) and incubated in a 42 °C water bath, 20-180 min.

Cells were resuspended in 400 μL H2O and plated on appropriate yeast extract, peptone, adenine,

and glucose (YPAD) media containing 1% w/v yeast extract, 2% w/v polypeptone, and 2% w/v

glucose. Diploid strains were developed by combining opposite yeast mating types in 500 μL

and incubated at 30 °C, 12-16 hrs. Serial dilutions (1/10, 1/100, 1/1000) from OD600 = 1.0 were

spotted on synthetic drop-out (SD) nutrient-minus media at three levels of stringency: double

drop-out (DDO; SD/–Leu/–Trp); triple drop-out (TDO; SD/–Leu/-Trp/–His/); and quadruple

drop-out (QDO; SD/–Leu/–Trp/-His/-Ala). Reporter genes AUR1-C, HIS3, ADE2, and MEL1

were used to assess interaction results.

18

Results

To test the hypothesis that FBS1-4 interact with non-epsilon 14-3-3 proteins in

Arabidopsis, a Yeast 2-Hybrid assay was developed. This hypothesis is informed by the

relatively high degree of homology shared between FBS1 and the remaining three members of

the FBS family (Fig. 7A, B) (72, 73). A multiple sequence alignment reveals a highly conserved

domain in the amino-termini of FBS1-4, Mystery Domain 1 (MD1) (Fig. 7A). We hypothesize

that MD1 interacts with 14-3-3 proteins. Within MD1 exists a tri-basic motif that is conserved

among all four FBS proteins (Fig. 7B). This RKR motif, or KKR in FBS4, serves as a putative

14-3-3 interaction domain. An interaction between FBS1 and non-epsilon 14-3-3 proteins exists

in Arabidopsis (48), but it is not known if the same 14-3-3 proteins interact with FBS2-4.

A Yeast 2-Hybrid assay was developed to probe the FBS/14-3-3 interaction using full-

length (FL) FBS proteins in combination with FL and amino-terminus deletion (ΔNT) 14-3-3

protein constructs (Fig. 8A, B). To comprehensively assess the extent of this hypothesized

interaction, all FL and ΔNT 14-3-3 constructs are to be tested against FBS1-4. Progress thus far

has been to develop a library of experimental tools and to optimize the Y2H assay for future

work. FBS and 14-3-3 constructs exist at various stages of development (Table 1, 2). The FBS1

Gal4 Binding Domain (BD) construct is confirmed in yeast strain Y2HGold and is thus ready for

Y2H experimentation (Table 1). 14-3-3 Gal4 Activation Domain (AD) ω, ψ, ω ΔNT, and ψ ΔNT

constructs have also been successfully transformed into yeast strain Y187 (Table 2).

19

Figure 7. FBS1-4 multiple sequence alignment. F-box proteins FBS1-4 were aligned. (A) FBS1-

4 amino-termini were aligned. Sequences were truncated at the F-box domain (72). (B) WeboLogo

alignment reveals that a tri-basic motif (RKR or KKR) within MD1 is functionally conserved

across all four FBS proteins. Black = non-polar residue; Red = acidic residue; Blue = basic residue;

letter size corresponds with relative residue frequency (73).

Figure 8. Schematic representation of Yeast 2-Hybrid constructs. (A) FBS and (B) 14-3-3

constructs. Nt = Amino-terminus; F-Box = F-Box domain; Ct = Carboxy-terminus; Gal4 BD =

Gal4 DNA Binding Domain; and Gal4 AD = Gal4 Activation Domain.

20

Table 1. FBS Gal4 BD construct status. FBS Y2H constructs exist at various stages of

development. FBS1 is confirmed in the appropriate yeast strain Y2HGold and is thus ready for

Y2H experimentation. FBS2-4 constructs have yet to be successfully transformed into Y2HGold.

Table 2. 14-3-3 Gal4 AD construct status. 14-3-3 Y2H constructs exist at various stages of

development. 14-3-3 ω, ψ, ω ΔNT, and ψ ΔNT are confirmed in the appropriate yeast strain Y187

and are thus ready for Y2H experimentation. All other 14-3-3 constructs have yet to be successfully

transformed into Y187.

21

Cell growth was observed for all diploid yeast cells on nutrient-minus DDO media,

indicating that all diploid strains contained appropriate reporter genes (Fig. 9, Col. 1). Growth

was observed for diploid yeast cells containing protein interaction positive control pGADT7-T

(SV40 large T-antigen) and pGBKT7-53 (Murine p53) across all nutrient-minus media (DDO,

TDO, and QDO) (Fig. 9, Row A). Negative controls consist of AD or BD experimental

constructs mated with an empty Y2H binary vector containing the opposite Gal4 domain (Fig. 9,

Col. 2 and 3, Rows B and C). Yeast cell growth was not observed for experimental protein

interaction diploid yeast strains containing FBS4 and 14-3-3 κ FL Y2H constructs on nutrient-

minus media (TDO and QDO) (Fig. 9, Col. 2 and 3, Row D).

Figure 9. Yeast 2-Hybrid results. Serial dilutions (1/10, 1/100, 1/1000) were spotted on synthetic

drop-out (SD) media minus Leu (L) and Trp (W), and His (H), or minus L, W, H, and Ala (A).

pGADT7-T (SV40 large T-antigen) and pGBKT7-53 (Murine p53) are used as a positive protein

interaction control (Row A). Negative controls consist of AD or BD experimental constructs mated

with an empty vector containing the opposite Gal4 domain (Rows B and C). Cell growth is not

observed for the FBS4 + 14-3-3 κ FL diploid strains on nutrient-minus media (Col. 2 and 3, Row

D).

To assess the validity of all Y2H experimental results, a yeast colony PCR protocol was

developed. Yeast strains Y2HGold and Y187 were probed for the presence of appropriate

22

constructs both before and after mating (Fig. 10). To assess whether the FBS1 Gal4 BD Y2H

construct was present in both haploid Y2HGold and diploid cells post-mating, yeast plasmids

were used as DNA templates for a PCR amplification reaction using FBS1 BD gene-specific

primers (SI A). Yeast colony PCR of FBS1 BD reveals the presence of the expected construct at

558 base pairs (Bps) in haploid Y2HGold cells (Fig. 10, Lane 1), but not in diploid cells (Fig.

10, Lane 2). This result indicates that the yeast strain did not confer the contained construct to

diploid cells.

Figure 10. FBS1 Gal4 BD yeast colony PCR. PCR amplification using gene-specific primers

suggests that the FBS1 Y2H construct is present in haploid yeast strains (Lane 1) but not in diploid

strains (Lane 2). Expected band size is 558 Bp.

Discussion

The UPS is extremely important in regulating cellular survival, both in response to

various biotic and abiotic stresses and in the maintenance of intracellular homeostasis (6, 11). In

particular, the regulation of the E3 ubiquitin ligase component is critical, as it provides

specificity to the entire UPS (38). As a diverse form of E3 ligases, SCFs receive their specificity

through FBX proteins. As only ~15% of the known Arabidopsis FBX proteins have been

biologically characterized, investigating unknown FBX proteins can help elucidate new forms of

A B A B

23

UPS regulation. Here, I develop methods to investigate the interaction of the F-box Stress

Induced proteins family FBS1-4 and 14-3-3s proteins in Arabidopsis.

FBS1 interacts with 14-3-3 λ, ψ, κ, φ, and ω (48). These results were first observed in

yeast (48) and confirmed in N. benthamiana (M. Bacher, unpublished) (Fig. 6). Curiously, only

the results of the interaction between 14-3-3 λ and FBS1 were described in detail (48). As such,

it is especially important to validate the results reported previously in a similar Y2H system.

However, difficulties in the Y2H experiment have prevented the substantive analysis of the

protein interactions described above. The inability to observe an FBS/14-3-3 interaction thus far

is indicative of problems within our Y2H experimental protocol. This is indicated by the lack of

the FBS1 construct in diploid yeast strains after mating (Fig. 9, Lane 2). Mating experiment will

be repeated under optimized conditions and the presence of desired constructs will be further

assessed. Furthermore, both Gal4 bait and prey hybrid constructs will be swapped to increase the

confidence of any observed interaction. As the interaction was first identified in a Y2H system, it

is expected that an optimized experimental set-up will result in a visualization of the published

protein interactions.

There are several additional reasons that Y2H experimentation has not revealed expected

protein-protein interactions. First, the cDNA pooled for initial PCR amplification of all

constructs originated from the Arabidopsis thaliana Nossen ecotype (No-0). The interaction

previously observed utilized FBS1 from a different Arabidopsis thaliana ecotype, Columbia

(Col-0) cDNA (48). While it is unlikely that the difference between No-0 and Col-0 is enough to

yield a difference in protein interaction in vivo, it is possible that No-0 FBS1 does not interact

with 14-3-3s in the same manner as Col-0 FBS1. A multiple sequence alignment of FBS1 from

No-0 and Col-0 reveals slight difference in residue composition (Fig. 11). In the coding DNA

24

region corresponding to MD1 a single base pair mutation is observed. This change, adenine to

thymine, occurs in the third position of the codon and does not result in a change in the final

amino acid residue at that position. Both ATA in No-0 and ATT in Col-0 code for the amino acid

isoleucine.

Figure 11. Multiple sequence alignment of No-0 and Col-0 FBS1. The alignment of the FBS1

coding DNA sequence from two Arabidopsis thaliana ecotypes, Col-0 and No-0. No-0 FBS1

template cDNA was used for construct amplification for Y2H experimentation. The underlined

region corresponds with MD1. A single base pair mutation occurs in this domain (A to T) but does

not confer a change in final protein residue. Maroon = conserved residues; Red = SNPs (72).

25

It is possible that protein interactions cannot be observed in a Y2H assay. This result

could be due to either improper protein folding as a result of the Gal4 construct hybrid or the

absence of an additional factor required for the protein interaction in vivo. Previous interactions

were reported in yeast between full-length FBS1 and residues 32-248 of 14-3-3 λ (48). It is not

clear why the deletion of the amino-terminus of 14-3-3 λ is required for an interaction to be

observed in yeast (48). Explanations include the possibility that residues 1-32 physically occlude

interaction domain(s), prevent proper 14-3-3 protein folding, or several additional possibilities.

We are developing both full length and amino-termini deletions (ΔNTs) of all non-epsilon 14-3-

3s to understand the role 14-3-3 NTs play in the interaction with FBS1. Additionally, Gal4

construct hybrids can prevent native protein folding and, as such, Y2H assays often require

constructing multiple derivations of test proteins to observe a native interaction. This could

explain why ΔNT constructs were required to visualize the interaction. Furthermore, Y2H

hybrids differ from constructs used to visualize interactions via BiFC, as BiFC utilizes yellow

fluorescent protein rather than the Gal4 transcriptional activation protein (Fig. 6). These

alternative constructs could result in alternative folding and therefore conflicting observations

across systems.

Additionally, a Y2H assay could not contain all the necessary factors required for a

protein interaction to occur. Techniques such as Yeast 3-Hybrid assays function in the same way

as the Y2H assay with the addition of a third protein component required for interaction. A Y3H

assay with a third, unknown protein could be necessary to observe 14-3-3/FBS interactions, but

this is unlikely as evidence suggests that only the two protein families in question are required

for the interaction to occur (48). Protein interactions that require native biological conditions

26

may not be visualized in a Y2H assay but can be observed via BiFC. If specific biological

conditions and/or factors are required to facilitate a protein interaction, those factors might be

absent in the in vitro system of yeast but are present in heterologous systems such as N.

benthamiana. We anticipate the Y2H assay to yield meaningful results, however, as this system

was used to demonstrate the existence of the interaction in the first place (48).

We hypothesize that the same 14-3-3 proteins demonstrated to interact with FBS1 – λ, ψ,

κ, φ, and ω – will also interact with FBS2-4. The high degree of sequence similarity among the

FBS family suggests that functional similarities among FBS1-4 can be expected in vivo. The

function of the conserved tri-basic motif observed in MD1 (Fig. 7B) is unknown; FBS RKR

derivatives (ΔRKR) are in development to prove the relevance of this motif in the FBS/14-3-3

interaction. Since little is known regarding the function of FBS1 in Arabidopsis, future research

is required to characterize the native function of this protein. In particular, the identity of the

protein targets needs to be elucidated, as well as the subcellular localization of FBS1 protein-

protein interactions. These questions are the subject of further research in the Thines lab, and the

answers obtained will help clarify the role of FBS1 in Arabidopsis. By illuminating the role of

the FBS family in vivo, we can further elucidate the function of their unique interaction with 14-

3-3 proteins.

Acknowledgements

First and foremost, I want to thank my mentor and advisor Dr. Bryan Thines for his

exceptional guidance and patience. I also want to thank Dr. Leslie Saucedo and Dr. Greg

Johnson for their invaluable feedback and support. This research would not be possible without

the financial support provided by the University of Puget Sound University Enrichment

27

Committee (UEC) and the M.J. Murdock Charitable Trust. Many thanks to the Coolridge Otis

Chapman Honors Program, especially George Erving and Ti Allshouse. Additionally, I want to

thank the Biology Department at UPS, especially Michal Morrison-Kerr and Laura Strong, as

well as the entire Thines lab, including Tina Chapman, Lily O’Connor, Megan Tegman, Elena

Fulton, Anneke Flemming, and Megan Bacher; I am constantly inspired by their intelligence,

hard work, and creativity.

28

References

1. Chinnusamy V, Schumaker K, Zhu J (2004) Molecular genetic perspectives on cross-talk

and specificity in abiotic stress signalling in plants. J Exp Bot 55(395):225–236.

2. Mahalingam R, Gomez-Buitrago A, Eckardt N, Shah N, Guevara-Garcia A, Day P, Raina

R, Fedoroff N (2003) Characterizing the stress/defense transcriptome of Arabidopsis.

Genome Biol 4(3):R20.

3. Singh K, Foley R, Oñate-Sánchez L (2002) Transcription factors in plant defense and stress

responses. Curr Opin Plant Biol 5(5):430–436.

4. Baker B, Zambryski P, Staskawicz B, Dinesh-Kumar SP (1997) Signaling in Plant-Microbe

Interactions. Science 276(5313):726–733.

5. Seki M, Narusaka M, Abe H, Kasuga M, Yamaguchi-Shinozaki K, Carninci P, Hayashizaki

Y, Shinozaki K (2001) Monitoring the Expression Pattern of 1300 Arabidopsis Genes under

Drought and Cold Stresses by Using a Full-Length cDNA Microarray. Plant Cell 13(1):61–

72.

6. Flick K, Kaiser P (2012) Protein Degradation and the Stress Response. Semin Cell Dev Biol

23(5):515–522.

7. Marino D, Froidure S, Canonne J, Khaled S, Khafif M, Pouzet C, Jauneau A, Roby D,

Rivas S. (2013) Arabidopsis ubiquitin ligase MIEL1 mediates degradation of the

transcription factor MYB30 weakening plant defence. Nat Commun 4:1476.

8. Zhai Q, Yan L, Tan D, Chen R, Sun J, Gau L, Dong M, Wang Y, Li C (2013)

Phosphorylation-Coupled Proteolysis of the Transcription Factor MYC2 Is Important for

Jasmonate-Signaled Plant Immunity. PLoS Genet 9(4). doi:10.1371/journal.pgen.1003422.

9. Planchais S, Samland A, Murray J (2004) Differential stability of Arabidopsis D-type

cyclins: CYCD3;1 is a highly unstable protein degraded by a proteasome-dependent

mechanism. Plant J 38(4):616–625.

10. Vierstra R (2003) The ubiquitin/26S proteasome pathway, the complex last chapter in the

life of many plant proteins. Trends Plant Sci 8(3):135–142.

11. Hellmann H, Estelle M (2002) Plant Development: Regulation by Protein Degradation.

Science 297(5582):793–797.

12. Smalle J, Vierstra R (2004) The Ubiquitin 26s Proteasome Proteolytic Pathway. Annu Rev

Plant Biol 55(1):555–590.

13. Abbas T, Dutta A (2017) Regulation of Mammalian DNA Replication via the Ubiquitin-

Proteasome System. Adv Exp Med Biol 1042:421–454.

29

14. Gray WM, Kepinski S, Rouse D, Leyser O, Estelle M (2001) Auxin regulates SCFTIR1-

dependent degradation of AUX/IAA proteins. Nature 414(6861):271–276.

15. Somers D, Schultz T, Milnamow M, Kay S (2000) ZEITLUPE Encodes a Novel Clock-

Associated PAS Protein from Arabidopsis. Cell 101(3):319–329.

16. Nelson D, Lasswell J, Rogg L, Cohen M, Bartel B (2000) FKF1, a Clock-Controlled Gene

that Regulates the Transition to Flowering in Arabidopsis. Cell 101(3):331–340.

17. Austin M, Muskett P, Kahn K, Feys B, Jones J, Parker J (2002) Regulatory Role of SGT1

in Early R Gene-Mediated Plant Defenses. Science 295(5562):2077–2080.

18. Azevedo C, Sadanandom A, Kitagawa K, Freialdenhoven A, Shirasu K, Schulze-Lefert P

(2002) The RAR1 Interactor SGT1, an Essential Component of R Gene-Triggered Disease

Resistance. Science 295(5562):2073–2076.

19. Becker F, Buschfeld E, Schell J, Bachmair A (1993) Altered response to viral infection by

tobacco plants perturbed in ubiquitin system. Plant J 3(6):875–881.

20. Hua Z, Vierstra R (2011) The Cullin-RING Ubiquitin-Protein Ligases. Annu Rev Plant Biol

62(1):299–334.

21. Zheng Q, Huang T, Zhang L, Zhou Y, Luo H, Xu H, Wang X (2016) Dysregulation of

Ubiquitin-Proteasome System in Neurodegenerative Diseases. Front Aging Neurosci 8:303.

22. Graham S, Liu H (2017) Life and death in the trash heap: The ubiquitin proteasome

pathway and UCHL1 in brain aging, neurodegenerative disease and cerebral Ischemia.

Ageing Res Rev 34:30–38.

23. Goru S, Kadakol A, Gaikwad A (2017) Hidden targets of ubiquitin proteasome system: To

prevent diabetic nephropathy. Pharmacol Res 120:170–179.

24. Yun Z, Zhichao J, Hao Y, Ou J, Ran Y, Wen D, Qun S (2017) Targeting autophagy in

multiple myeloma. Leuk Res 59:97–104.

25. Chondrogianni N, Voutetakis K, Kapetanou M, Delitsikou V, Papaevgeniou N, Sakellari

M, Lefaki M, Filippopoulou K, Gonos E (2015) Proteasome activation: An innovative

promising approach for delaying aging and retarding age-related diseases. Ageing Res Rev

23(Pt A):37–55.

26. Armstrong S, Wu H, Wang B, Abuetabh Y, Sergi C, Leng R (2016) The Regulation of

Tumor Suppressor p63 by the Ubiquitin-Proteasome System. Int J Mol Sci 17(12).

doi:10.3390/ijms17122041.

27. Abramova E, Sharova N, Karpov V (2002) The proteasome: destroy to live. Mol Biol

(Mosk) 36(5):761–776.

30

28. Huang J, Xie Y, Sun X, Zeh H, Kang R, Totze M, Tang D (2015) DAMPs, ageing, and

cancer: The “DAMP Hypothesis.” Ageing Res Rev 24(Pt A):3–16.

29. Yang J (2007) Emerging roles of deubiquitinating enzymes in human cancer. Acta

Pharmacol Sin 28(9):1325–1330.

30. Driscoll J, Minter A, Driscoll D, Burris J (2011) The ubiquitin+proteasome protein

degradation pathway as a therapeutic strategy in the treatment of solid tumor malignancies.

Anticancer Agents Med Chem 11(2):242–246.

31. Voutsadakis I (2013) Ubiquitination and the ubiquitin - proteasome system in the

pathogenesis and treatment of squamous head and neck carcinoma. Anticancer Res

33(9):3527–3541.

32. Salomè M, Campos J, Keeshan K (2015) TRIB2 and the ubiquitin proteasome system in

cancer. Biochem Soc Trans 43(5):1089–1094.

33. Leithe E (2016) Regulation of connexins by the ubiquitin system: Implications for

intercellular communication and cancer. Biochim Biophys Acta 1865(2):133–146.

34. Callis J (2014) The Ubiquitination Machinery of the Ubiquitin System. Arab Book Am Soc

Plant Biol 12. doi:10.1199/tab.0174.

35. Thrower J, Hoffman L, Rechsteiner M, Pickart C (2000) Recognition of the polyubiquitin

proteolytic signal. EMBO J 19(1):94–102.

36. Ravid T, Hochstrasser M (2008) Degradation signal diversity in the ubiquitin-proteasome

system. Nat Rev Mol Cell Biol 9(9):679–690.

37. Berndsen C, Wolberger C (2014) New insights into ubiquitin E3 ligase mechanism. Nat

Struct Mol Biol 21(4):301–307.

38. Lorick K, Jensen J, Fang S, Ong A, Hatakeyama S, Weissman A (1999) RING fingers

mediate ubiquitin-conjugating enzyme (E2)-dependent ubiquitination. Proc Natl Acad Sci

96(20):11364–11369.

39. Lechtenberg B, Rajput A, Sanishvili R, Dobaczewske M, Ware C, Mace P, Riedl S (2016)

Structure of a HOIP/E2~ubiquitin complex reveals RBR E3 ligase mechanism and

regulation. Nature 529(7587):546–550.

40. Krist D, Park S, Boneh G, Rice S, Statsyuk A (2016) UbFluor: A Mechanism-Based Probe

for HECT E3 Ligases. Chem Sci 7(8):5587–5595.

41. Stone S, Hauksdottir H, Troy A, Herschleb J, Kraft E, Callis J (2005) Functional Analysis

of the RING-Type Ubiquitin Ligase Family of Arabidopsis. Plant Physiol 137(1):13–30.

31

42. Gagne J, Downes B, Shiu S, Durski A, Vierstra R (2002) The F-box subunit of the SCF E3

complex is encoded by a diverse superfamily of genes in Arabidopsis. Proc Natl Acad Sci

99(17):11519–11524.

43. Metzger M, Pruneda J, Klevit R, Weissman A (2014) RING-type E3 ligases: Master

manipulators of E2 ubiquitin-conjugating enzymes and ubiquitination. Biochim Biophys

Acta 1843(1):47.

44. Liu F, Ni W, Griffith M, Huang Z, Chang C, Peng W, Ma H, Xie D (2004) The ASK1 and

ASK2 Genes Are Essential for Arabidopsis Early Development. Plant Cell 16(1):5–20.

45. Kobe B, Deisenhofer J (1994) The leucine-rich repeat: a versatile binding motif. Trends

Biochem Sci 19(10):415–421.

46. Andrade M, Perez-Iratxeta C, Ponting C (2001) Protein Repeats: Structures, Functions, and

Evolution. J Struct Biol 134(2):117–131.

47. Villalobos L, Lee S, Oliveira C, Ivetac A, Brandt W, Armitage L, Sheard L, Tan X, Parry

G, Mao H, Zheng N, Napier R, Kepinski S, Estelle M (2012) A combinatorial TIR1/AFB-

Aux/IAA co-receptor system for differential sensing of auxin. Nat Chem Biol 8(5):477–

485.

48. Sepúlveda-García E, Rocha-Sosa M (2012) The Arabidopsis F-box protein AtFBS1

interacts with 14-3-3 proteins. Plant Sci Int J Exp Plant Biol 195:36–47.

49. Schultz T, Kiyosue T, Yanovsky M, Wada M, Kay SA (2001) A Role for LKP2 in the

Circadian Clock of Arabidopsis. Plant Cell 13(12):2659–2670.

50. Maldonado-Calderón M, Sepúlveda-García E, Rocha-Sosa M (2012) Characterization of

novel F-box proteins in plants induced by biotic and abiotic stress. Plant Sci Int J Exp Plant

Biol 185–186:208–217.

51. Gonzalez L, Keller K, Chan K, Gessel M, Thines B (2017) Transcriptome analysis

uncovers Arabidopsis F-BOX STRESS INDUCED 1 as a regulator of jasmonic acid and

abscisic acid stress gene expression. BMC Genomics 18. doi:10.1186/s12864-017-3864-6.

52. Gumeni S, Trougakos I (2016) Cross Talk of Proteostasis and Mitostasis in Cellular

Homeodynamics, Ageing, and Disease. Oxid Med Cell Longev 2016:4587691.

53. Wojcik S (2013) Crosstalk between autophagy and proteasome protein degradation

systems: possible implications for cancer therapy. Folia Histochem Cytobiol 51(4):249–

264.

54. Liebl M, Hoppe T (2016) It’s all about talking: two-way communication between

proteasomal and lysosomal degradation pathways via ubiquitin. Am J Physiol Cell Physiol

311(2):C166-178.

32

55. Keller C, Radwan O (2015) The functional role of 14-3-3 proteins in plant-stress

interactions. -ACES 1(2):100–110.

56. Sun G, Xie F, Zhang B (2011) Transcriptome-wide identification and stress properties of

the 14-3-3 gene family in cotton (Gossypium hirsutum L.). Funct Integr Genomics

11(4):627–636.

57. Lozano-Durán R, Robatzek S (2015) 14-3-3 proteins in plant-pathogen interactions. Mol

Plant-Microbe Interact MPMI 28(5):511–518.

58. Zhou H, Lin H, Chen S, Becker K, Yang Y, Zhao J, Kudla J, Schumaker K, Guo Y (2014)

Inhibition of the Arabidopsis Salt Overly Sensitive Pathway by 14-3-3 Proteins[C][W].

Plant Cell 26(3):1166–1182.

59. Braselmann S, McCormick F (1995) Bcr and Raf form a complex in vivo via 14‐3‐3

proteins. EMBO J 14(19):4839–4848.

60. Peng C, Graves P, Thoma R, Wu T, Shaw A, Piwnica-Works H (1997) Mitotic and G2

Checkpoint Control: Regulation of 14-3-3 Protein Binding by Phosphorylation of Cdc25C

on Serine-216. Science 277(5331):1501–1505.

61. Xu W, Shi W (2006) Expression Profiling of the 14-3-3 Gene Family in Response to Salt

Stress and Potassium and Iron Deficiencies in Young Tomato (Solanum lycopersicum)

Roots: Analysis by Real-time RT–PCR. Ann Bot 98(5):965–974.

62. Obsil T, Obsilova V (2011) Structural basis of 14-3-3 protein functions. Semin Cell Dev

Biol 22(7):663–672.

63. Takeo K, Ito T (2017) Subcellular localization of VIP1 is regulated by phosphorylation and

14-3-3 proteins. FEBS Lett 591(13):1972–1981.

64. DeLille J, Sehnke P, Ferl R (2001) The Arabidopsis 14-3-3 Family of Signaling Regulators.

Plant Physiol 126(1):35–38.

65. Hong J, Adams E, Yanagawa Y, Matsui M, Shin R (2017) AtSKIP18 and AtSKIP31, F-box

subunits of the SCF E3 ubiquitin ligase complex, mediate the degradation of 14-3-3

proteins in Arabidopsis. Biochem Biophys Res Commun 485(1):174–180.

66. Sato T, Maekawa S, Yasuda S, Yamaguchi J (2011) Carbon and nitrogen metabolism

regulated by the ubiquitin-proteasome system. Plant Signal Behav 6(10):1465–1468.

67. Yan Y, Xu Y, Gao Y, Zong Z, Zhang Q, Li C, Wang H (2013) Implication of 14-3-3ε and

14-3-3θ/τ in proteasome inhibition-induced apoptosis of glioma cells. Cancer Sci

104(1):55–61.

68. Muslin A, Tanner J, Allen P, Shaw A (1996) Interaction of 14-3-3 with signaling proteins is

mediated by the recognition of phosphoserine. Cell 84(6):889–897.

33

69. Fu H, Subramanian R, Masters S (2000) 14-3-3 Proteins: Structure, Function, and

Regulation. Annu Rev Pharmacol Toxicol 40(1):617–647.

70. Yuan H, Michelsen K, Schwappach B (2003) 14-3-3 Dimers Probe the Assembly Status of

Multimeric Membrane Proteins. Curr Biol 13(8):638–646.

71. Barbash O, Lee E, Diehl J (2011) Phosphorylation-dependent regulation of SCFFbx4

dimerization and activity involves a novel component, 14-3-3ε. Oncogene 30(17):1995–

2002.

72. Notredame C, Higgins D, Heringa J (2000) T-coffee: a novel method for fast and accurate

multiple sequence alignment. J Mol Biol 302(1):205–217.

73. Crooks G, Hon G, Chandonia J, Brenner S (2004) WebLogo: A Sequence Logo Generator.

Genome Res 14(6):1188–1190.

74. pGEM®-T Vector Systems Available at: http://www.promega.com/products/pcr/pcr-

cloning/pgem-t-vector-systems/ [Accessed April 13, 2018].

75. pGADT7-Rec Sequence and Map Available at:

http://www.snapgene.com/resources/plasmid_files/yeast_plasmids/pGADT7-Rec/

[Accessed April 13, 2018].

76. pGBKT7 Sequence and Map Available at:

http://www.snapgene.com/resources/plasmid_files/yeast_plasmids/pGBKT7/ [Accessed

April 13, 2018].

77. Rahimi N (2012) The Ubiquitin-Proteasome System Meets Angiogenesis. Mol Cancer Ther

11(3):538–548.

34

Supplemental Information

SI A. Primer sequences and restriction sites. Optimal primers were designed amplify target

genes and add unique restriction sites to each construct. Restriction sites were added to the 5’

end of each forward and reverse primer*.

FBX Protein Activation Domain Forward Primer Activation Domain Reverse Primer

FBS1 CATATGATGGCATTGGGGAAGAAAAGA GAATTCTCAGTGGAATAGAGCCACTGA

FBS2 CATATGATGATCCATTATCTCCATTTCATCGG GAATTCTCATGTAAACAAAGCCGCAGAG

FBS3 CATATGATGGCGTATTTGAGTGATGGATTTC GAATTCTCATTTAAACAATACCATAGAGATCTTCG

FBS4 CATATGATGGGGAAGGTATCTCCAAAGGAT GAATTCTCAGGTGAGGTTGTTTTGAGCAA

FBX protein DNA Binding Domain Forward Primer DNA Binding Domain Reverse Primer

FBS1 CATATGATGGCATTGGGGAAGAAAAGA GGATTCTCAGTGGAATAGAGCCACTGA

FBS2 CATATGATGATCCATTATCTCCATTTCATCGG GGATTCTCATGTAAACAAAGCCGCAGAG

FBS3 CATATGATGGCGTATTTGAGTGATGGATTTC GGATTCTCATTTAAACAATACCATAGAGATCTTCG

FBS4 CATATGATGGGGAAGGTATCTCCAAAGGAT GGATTCTCAGGTGAGGTTGTTTTGAGCAA

14-3-3 protein Activation Domain Forward Primer Activation Domain Reverse Primer

κ FL CATATGATGGCGACGACCTTAAGCAGAGAT GAATTCTCAATATGCGAGTTTCTGATGATG

ω FL CATATGATGGCGTCTGGGCGTGAAGAGTTC GAATTCTCACTGCTGTTCCTCGGTC

λ FL CATATGATGGCGGCGACATTAGGC GAATTCTTACATAGAGTAGTAATAACTCAGCACAC

χ FL CATATGATGGCGACACCAGGAGCTTC CCATGGTTAGGATTGTTGCTCGTCAGC

φ FL CATATGATGGCGGCACCACCAGCATCATC GGATTCTTAGATCTCCTTCTGTTCTTCAGC

ν FL CATATGATGTCGTCTTCTCGGGAAGA GAATTCTCACTGCCCTGTCTCAGC

ψ FL CATATGATGTCGACAAGGGAAGAGAATGTT GAATTCTTACTCGGCACCATCGGG

υ FL CATATGATGTCTTCTGATTCGTCCCG CCATGGTCACTGCGAAGGTGGTGG

14-3-3 Protein DNA Binding Domain Forward Primer DNA Binding Domain Reverse Primer

κ FL CATATGATGGCGACGACCTTAAGCAGAGAT GGATTCTCAATATGCGAGTTTCTGATGATG

ω FL CATATGATGGCGTCTGGGCGTGAAGAGTTC GGATTCTCACTGCTGTTCCTCGGTC

λ FL CATATGATGGCGGCGACATTAGGC GGATTCTTACATAGAGTAGTAATAACTCAGCACAC

χ FL CATATGATGGCGACACCAGGAGCTTC GGATTCTTAGGATTGTTGCTCGTCAGC

φ FL CATATGATGGCGGCACCACCAGCATCATC GGATTCTTAGATCTCCTTCTGTTCTTCAGC

ν FL CATATGATGTCGTCTTCTCGGGAAGA GGATTCTCACTGCCCTGTCTCAGC

ψ FL CATATGATGTCGACAAGGGAAGAGAATGTT GGATTCTTACTCGGCACCATCGGG

υ FL CATATGATGTCTTCTGATTCGTCCCG CCATGGTCACTGCGAAGGTGGTGG

14-3-3 protein Activation Domain Forward Primer Activation Domain Reverse Primer

κ ΔNT CATATGCAGCTCGTAAGTGGAGC GAATTCTCAATATGCGAGTTTCTGATGATG

ω ΔNT CATATGAAAGTCTCCGCCGCC GAATTCTCACTGCTGTTCCTCGGTC

λ ΔNT CATATGCAGCTCGTTACAGGCG GAATTCTTACATAGAGTAGTAATAACTCAGCACAC

ψ ΔNT CATATGAAAGTTGCGAAAACTGTTGATGTTGAGG CCATGGTTAGGATTGTTGCTCGTCAGC

φ ΔNT CATATGAAAGTCGCTGAAGCCGTTG GGATTCTTAGATCTCCTTCTGTTCTTCAGC

*Restriction site key

CATATG = NdeI

GAATTC = EcoRI CCATGG = NcoI GGATTC = BamHI

35

SI B. Cloning and binary Y2H vector maps. (A) Cloning vector pGEM-T confers ampicillin

resistance and lacZ activity. (B) Y2H subcloning vector pGADT7-Rec confers ampicillin

resistance and contains the GAL4 activation domain. (C) Y2H subcloning vector pGBKT7 confers

kanamycin resistance and contains the GAL4 DNA binding domain (74–76).