JOURNAL OFAvailable online at www.sciencedirect.com

PSYCHIATRIC

RESEARCHJournal of Psychiatric Research 43 (2009) 24–29

www.elsevier.com/locate/jpsychires

Dopaminergic receptor D5 mRNA expression is increasedin circulating lymphocytes of Tourette syndrome patients

Marco Ferrari a,1, Cristiano Termine b,c,1, Diego Franciotta d, Elisabetta Castiglioni b,Alessandra Pagani c, Giovanni Lanzi e, Franca Marino a, Sergio Lecchini a,

Marco Cosentino a,*, Umberto Balottin c

a Department of Clinical Medicine, Section of Experimental and Clinical Pharmacology, University of Insubria,

Via Ottorino Rossi n. 9, 21100 Varese VA, Italyb Child Neuropsychiatry Unit, Department of Clinical and Biological Sciences, University of Insubria and ‘Macchi Foundation’ Hospital, Varese, Italy

c Department of Child Neurology and Psychiatry, IRCCS ‘‘C. Mondino’’, Pavia, Italyd Laboratory of Neuroimmunology, IRCCS Neurological Institute, ‘‘C. Mondino’’, University of Pavia, Pavia, Italy

e Dosso Verde Institute and University of Pavia, Pavia, Italy

Received 22 September 2007; received in revised form 12 January 2008; accepted 29 January 2008

Abstract

Tourette syndrome (TS) is a neuropsychiatric disorder in which dopaminergic dysfunction and immune system abnormalities seem tocoexist. Using real-time PCR, we determined mRNA expression of dopamine receptors (DRs) D1-5 in peripheral blood lymphocytes(PBLs) from 15 TS patients and 15 sex- and age-matched healthy controls (HCs). DRD5 mRNA levels in cells from TS were higher thanin cells from HCs. In TS patients with obsessive–compulsive disorder, DRD5 mRNA levels in PBLs showed a highly positive correlationwith the severity of compulsive symptoms. DRD5 mRNA upregulation in PBLs from TS patients may represent a peripheral marker ofdopaminergic dysfunction and supports the involvement of the immune system in TS.� 2008 Elsevier Ltd. All rights reserved.

Keywords: Tourette syndrome; Dopamine receptors; Peripheral blood lymphocytes; Real-time PCR; Peripheral marker

1. Introduction

Tourette syndrome (TS) is a neuropsychiatric disordercharacterized by multiple motor tics plus one or more vocaltics (DSM-IV), high prevalence of obsessive–compulsivedisorder (OCD) (Carter et al., 1994; Kurlan et al., 2002;Termine et al., 2006) and of attention-deficit hyperactivitydisorder (ADHD) (Carter et al., 1994; Spencer et al., 2001).Genetic factors, perinatal injuries, psychological factorsand organic substrate involving neural basal ganglia aresupposed to play a role in TS aetio-pathogenesis (Albinand Mink, 2006).

0022-3956/$ - see front matter � 2008 Elsevier Ltd. All rights reserved.

doi:10.1016/j.jpsychires.2008.01.014

* Corresponding author. Tel.: +39 0332 217410; fax: +39 0332 217409.E-mail address: marco.cosentino@uninsubria.it (M. Cosentino).

1 The first two authors contributed equally to the study.

Dopamine is one of the main neurotransmitters in thecentral nervous system (CNS), where it plays a critical rolein motor control and cognitive function through its interac-tions with dopaminergic receptors (DRs) D1 to 5. Theinvolvement of dopaminergic circuits in TS is supportedby: (a) the beneficial effect of DR antagonists on tics (Fitz-gerald et al., 2000), (b) the worsening of symptoms inducedby direct and indirect dopaminergic agents (Bruggemanet al., 2001), and (c) the increased number of neuronaldopamine uptake sites and DRD2 in TS patients’ brain,in both caudate nucleus (Wong et al., 1997; Black et al.,1997; Singer et al., 2002) and prefrontal cortex (Minzeret al., 2004). Based upon these findings, the ‘dopaminergictheory’ of TS assumes the occurrence of a disruption(hyperactivity) of central dopaminergic circuits (Albinand Mink, 2006).

M. Ferrari et al. / Journal of Psychiatric Research 43 (2009) 24–29 25

DRs are also expressed on human peripheral blood lym-phocytes (PBLs) (see e.g. McKenna et al., 2002), wherethey may be dysregulated in different neuropsychiatric dis-orders involving CNS dopaminergic circuits, e.g. schizo-phrenia, Alzheimer’s disease, Parkinson’s disease andmajor depression (Nagai et al., 1996; Barbanti et al.,2000; Ilani et al., 2001; Rocca et al., 2002). Since no infor-mation exists on DR expression in PBLs in TS, the aim ofthe present study was to compare DR mRNA expression inPBLs from healthy subjects and TS patients, and to assessin cells from TS patients the possible association betweenDR mRNA expression and the main TS comorbidities.

2. Patients and methods

2.1. Patients

We recruited 15 children and adolescents with TS (diag-nosed according to the DSM-IV criteria) and 15 matchedcontrols (HCs) (Table 1). The protocol was conductedaccording to the principles stated in the Declaration of Hel-sinky (www.wma.net/e/policy/b3.htm) and was approvedby the Ethics Committee of the Neurological Institute‘‘Casimiro Mondino” of Pavia. After complete descriptionof the study, written informed consent was obtained fromparents. CRS-R:L (Conners, 1997) and CBCL (Achen-bach, 1991) were used to diagnose ADHD and OCD. Ticsand OCD severity were assessed by the Yale-Global TicSeverity Scale (Y-GTSS) (Leckman et al., 1989) and theChildren’s Yale-Brown Obsessive Compulsive Scale (CY-BOCS) (Scahill et al., 1997). Patients and controls weredrug free for at least 3 months before the recruitment, withthe exception of five TS patients on neuroleptics alone (2),SSRIs alone (2) or neuroleptics with SSRIs (1).

2.2. PBL separation and DR mRNA quantification by Real-

Time PCR

All subjects participating in the study underwent a 3 mLvenous blood sampling, between 9 and 10 a.m., after anovernight fasting. PBLs were separated by standard den-sity-gradient centrifugation and 1 � 106 cells were resus-pended in Perfect RNA lysis buffer (Eppendorf,Hamburg, Germany). Total mRNA was extracted with

Table 1Demographic and clinical characteristics of Tourette syndrome (TS)patients and healthy controls (HCs)

TS patients HCs

Age (years, mean ± SD) 12.6 ± 0.2 12.5 ± 0.2Gender (male:female) 11:4 11:4Pure TS 3 n.a.TS + ADHD 2 n.a.TS + OCD 6 n.a.TS + ADHD + OCD 4 n.a.

ADHD = Attention-Deficit Hyperactivity Disorder; OCD = ObsessiveCompulsive Disorder; n.a. = not applicable.

Perfect RNA Eukaryotic Mini kit (Eppendorf), quanti-tated by spectrophotometry at 260 nm, and reverse tran-scribed using the High-capacity cDNA Archive Kit(Applied Biosystems, Foster City, USA).

DR mRNA was analysed by use of an ABI Prism 7700and FAM dye-labeled TaqMan MGB probes (Applied Bio-systems). Primers were designed using Primer express 2.0(Applied Biosystems) and gene sequence data obtained fromthe Reference Sequence collection (RefSeq; www.ncbi.nlm.nih.gov/projects/RefSeq). Primers, probes, melting pointsand amplicon lengths are shown in Table 2. Human brainwas used as positive control and Saccharomyces cerevisiae

was used as negative control. Linearity of real-time PCRassays was tested by constructing standard curves by use ofserial twofold dilutions of a human brain cDNA and regres-sion coefficients (r2) were always > 0.900 (data not shown).Expression data were obtained from Ct values. DR mRNAlevels (Ct1) were normalized to 18s rRNA (Ct2) andexpressed as 2�DCt, where DCt = Ct1–Ct2.

2.3. Statistical analysis

Data are presented as means ± SD. Statistical signifi-cance of the between-group differences was assessed bytwo-tailed Mann–Whitney test. Regression analysis wasused for correlations. Calculations were performed usinga commercial software (GraphPad Prism version 4.00 forWindows, GraphPad Software, San Diego, CA, USA,www.graphpad.com).

3. Results

In agreement with previous observations (Ricci et al.,1999; Cosentino et al., 2007), PBLs expressed detectablelevels of mRNA for DRD2–5, but not for DRD1.DRD2, 3 and 4 mRNA expression did not differ in cellsfrom HCs and TS patients. On the contrary, DRD5mRNA levels were significantly higher in cells from TSpatients than from HCs (Fig. 1).

No differences in DR mRNA expression were foundwhen subgrouping TS patients according to the presenceof ADHD and/or OCD (Table 3), or to the administrationof drugs (Table 4).

No correlation was found between tic severity, age/gen-der and DR expression (not shown), however compulsionseverity showed a highly positive correlation with DRD5mRNA expression (Fig. 2).

4. Discussion

The main finding of our study is the upregulation ofDRD5 mRNA expression in PBLs from TS patients incomparison with HCs, and its correlation with the severityof compulsion in TS patients with OCD.

It has been suggested that DRs in PBLs may reflect cor-responding DRs in the brain (Nagai et al., 1996; Ilani et al.,2001). Indeed, in TS a defect in CNS dopaminergic systems

Table 2Real-time PCR conditions

Gene Primer sequence Probe sequence Annealingtemperature (�C)

Ampliconlength (bp)

RefSeqcode

DRD1 Forward ACCCCAAGGCAAGGCGTTTGG 60 151 NM000794.3CCCAGCGAAGTCCACATTCC

ReverseTGACAGGAGATTCTCCCCTTCTGA

DRD2 Forward GTCTACCTGGAGGTGGTAGGT 59 150 NM000795.2GCTGTGTCCCGCGAGAAG

ReverseACAGTGAATCCTGCTGAATTTCC

DRD3 Forward CCCCAACAAACCCTCTCCTCC 59 89 U32499.1AGAACAGTCAGTGCAACAGTGTCAReverseGTAGTAACGCTTCAGCTCCAGATG

DRD4 forward CTACTCCGAGGTCCAGGGTGG 58 100 NM000797.2TGGTGCTGCCGCTCTTC

ReverseGAACCTGTCCACGCTGATG

DRD5 Forward CTTCCTCGCTCATCAGCCTTCT 59 97 NM000798.3CTCCAGCCTGAATGCAACCTA

ReverseGCGGTAGATGCGCGTGTAG

18s RNA Forward AGGGCAAGTCTGGTGCCAGCA 59 85 X03205TGAGTCCACTTTAAATCCTTTAACGAReverseCGCTATTGGAGCTGGAATTACC

Fig. 1. DR mRNA expression levels in PBLs from healthy controls(empty boxes) and TS patients (hatched boxes). Median values (horizontalbars), 25th–75th percentiles (boxes), and highest and lowest values areshown. n.d. = not detected.

26 M. Ferrari et al. / Journal of Psychiatric Research 43 (2009) 24–29

has been hypothesized as the etiological defect (Albin andMink, 2006), however available evidence points to a prefer-ential involvement of the inhibitory D2-like subclass, whichincludes the DRD2, DRD3, and DRD4 subtypes, ratherthan the D1-like subclass (including DRD1 and DRD5subtypes), inasmuch as DR antagonists beneficial for ticsact mainly on D2-like DRs (Fitzgerald et al., 2000), andupregulation of DRD2 (but not of other DR subtypes)has been reported in the brain of TS subjects (Wonget al., 1997; Singer et al., 2002). Moreover, the DRD5 genelocus has been studied in TS families, without finding anygenetic linkage (Barr et al., 1997). Our results thus suggestthat DRs on PBLs do not necessarily mirror central DRs,at least in TS.

The present results of course do not exclude that dysreg-ulation of DRs of the D2-like subclass may occur in TS.Rather, they point to an involvement of the D1-like sub-class and in particular of the DRD5 subtype. In particular,the strong correlation between DRD5 mRNA expressionand compulsion severity merits consideration. DRD5 areinvolved in anti-oxidant and anti-hypertensive responses(Yang et al., 2006), and in the modulation of hippocampalACh release (Hersi et al., 2000), although the behavioralrelevance of the latter finding remains to be established.In any case, the therapeutic efficacy of DR antagonists,which are used for tics, correlates with the affinity forDRD2, but not DRD5. Nevertheless, in animal models(a) the D1-like subclass in the prefrontal cortex is criticallyinvolved in cocaine-seeking behavior (reviewed in Rebec

and Sun, 2005), and (b) D1-like agonists seem to potentiategrooming chains (super-stereotypy), which are consideredto be analogous to complex tics or OCDs (Berridge et al.,2005), an observation which seems to agree with our find-ings regarding the correlation between DRD5 mRNAexpression and compulsion severity.

DRs expressed on immune cells mediate the immuno-modulating effects of dopamine (reviewed in Basu and

Table 3DR mRNA expression levels in PBLs from Tourette syndrome (TS) patients, without (pure) or with obsessive–compulsive disorder (OCD), attention-deficit hyperactivity disorder (ADHD), or both

DRD1 DRD2 DRD3 DRD4 DRD5

Pure TS (3) n.d. 2.13 ± 1.98 0.24 ± 0.15 0.36 ± 0.38 4.07 ± 0.55TS + OCD (6) n.d. 1.62 ± 1.96 0.30 ± 0.34 0.59 ± 1.06 5.25 ± 0.67TS + ADHD (2) n.d. 0.10 ± 0.01 0.10 ± 0.09 0.11 ± 0.01 6.40 ± 0.60TS + OCD + ADHD (4) n.d. 2.38 ± 2.13 0.55 ± 0.85 0.16 ± 0.03 5.03 ± 0.50

Data are means ± SD. Numbers in parentheses indicate subjects in each group. n.d. = not detected.

Table 4DR mRNA expression levels in PBLs from TS patients without or with drug treatments

DRD1 DRD2 DRD3 DRD4 DRD5

No drugs (10) n.d. 1.38 ± 1.73 0.40 ± 0.57 0.14 ± 0.09 5.35 ± 0.77On drugs (5) n.d. 2.41 ± 2.10 0.18 ± 0.05 0.79 ± 1.12 4.61 ± 0.93

NLs only (2) n.d. 2.90 ± 3.68 0.13 ± 0.00 0.13 ± 0.02 4.76 ± 1.78SSRIs only (2) n.d. 2.67 ± 1.12 0.21 ± 0.04 0.49 ± 0.44 4.43 ± 0.46NLs + SSRIs (1) n.d. 0.91 0.21 2.73 4.66

Data are means ± SD. Numbers in parentheses indicate subjects in each group. NLs = neuroleptics; SSRIs = selective serotonin reuptake inhibitors;n.d. = not detected.

M. Ferrari et al. / Journal of Psychiatric Research 43 (2009) 24–29 27

Dasgupta, 2000), and interestingly in TS subjects immuneabnormalities have been reported, such as increased circu-lating B lymphocytes (Weisz et al., 2004), overexpressednatural killer cell genes (Lit et al., 2007), and decreasedCD4+CD25+ regulatory T cells (Kawikova et al., 2007),a specialized subset of T lymphocytes which play a crucialrole in immune homeostasis by suppressing the activity ofCD4+ T lymphocytes (Sakaguchi, 2004). We recentlyshowed that activation of DRD5 by endogenous dopamineresults in profound reduction of the function of humanCD4+CD25+ regulatory T cells (Cosentino et al., 2007),thus the present finding concerning overexpressed DRD5in PBLs seems in line with the reported reduction of

Fig. 2. Correlation between DRD5 mRNA expression in PBLs andcompulsion severity (assessed by CY-BOCS) in TS patients. One patientwas missed at the evaluation.

CD4+CD25+ regulatory T cells in TS (Kawikova et al.,2007). Decreased frequency and activity of CD4+CD25+

regulatory T lymphocytes is a common finding in autoim-mune diseases (see e.g. Levings et al., 2006), and autoim-mune mechanisms have been suggested to represent acommon trigger for both TS and the TS-related PaediatricAutoimmune Neuropsychiatric Disorders Associated withStreptococcal infections (PANDAS) (Swedo et al., 1998;Tucker et al., 1996).

In conclusion, our findings regarding overexpressionof DRD5 mRNA in PBLs of TS patients add to currentknowledge regarding immune dysregulation in TS, andgive further support to the hypothesis of the occurrencean autoimmune ‘‘trait” in the syndrome. Whether upegu-lation of DRD5 mRNA levels is exclusively related toTS or is also affected by the presence of ADHD and/or OCD warrants further investigation, also in view ofthe high prevalence of such comorbidities in thesepatients. Nonetheless, the present results give furthersupport to the hypothesis that in TS a link occursbetween immune dysregulation and neuropsychiatric dis-turbances. At least in animal models evidence exists thatT lymphocytes in the CNS are essential for neural devel-opment, maintenance and repair, under the control ofCD4+CD25+ regulatory T cells (Kipnis et al., 2004 and2005). Further studies are warranted to establish the clin-ical implications of such basic findings, we propose how-ever, at least as a working hypothesis, that theoccurrence of immunological abnormalities in neuropsy-chiatric disorders such as TS may indicate the involve-ment of neuroimmunologic mechanisms in thepathogenesis of the disturbances: in the future, clarifica-tion of such issue could allow better understanding ofdisease pathophysiology and possibly also offer novelclues for more effective therapeutic interventions.

28 M. Ferrari et al. / Journal of Psychiatric Research 43 (2009) 24–29

Conflict of Interest

The authors declare no competing interests.

Contributors

M.F., C.T., U.B. and M.C. designed the study; C.T.,E.C., A.P. and G.L. were in charge of the patient recruit-ment and evaluation; C.T. and M.F. collected, preparedand analyzed the samples; D.F., M.F., C.T. and M.C. per-formed the statistical analysis of the data; D.F., M.F.,C.T., F.M., S.L., U.B. and M.C. contributed to the inter-pretation and discussion of results; M.F., C.T., D.F. andM.C. wrote the paper, and all the authors revised andfinally approved the manuscript.

Role of funding source

The study was supported by a grant from the Universityof Insubria (FAR 2006) to MC. The University of Insubriahad no further role in study design; in the collection, anal-ysis and interpretation of data; in the writing of the report;and in the decision to submit the paper for publication.

Acknowledgement

The helpful assistance of Dr. Marta Monti in perform-ing some of the assays is gratefully acknowledged.

Appendix A. Supplementary data

Supplementary data associated with this article can befound, in the online version, at doi:10.1016/j.jpsychires.2008.01.014.

References

Achenbach TM. Manual for the Child Behavior Checklist/4–18 andProfile. Burlington, VT: University of Vermont, Department ofPsychiatry; 1991.

Albin RL, Mink JW. Recent advances in tourette syndrome research.Trends in Neurosciences 2006;29:175–82.

Barbanti P, Fabbrini G, Ricci A, Bruno G, Cerbo R, Bronzetti E, et al.Reduced density of dopamine D2-like receptors on peripheral bloodlymphocytes in Alzheimer’s disease. Mechanisms of Ageing andDevelopment 2000;120:65–75.

Barr CL, Wigg KG, Zovko E, Sandor P, Tsui L-C. Linkage study of thedopamine D5 receptor gene and Gilles de la tourette syndrome.American Journal of Medical Genetics 1997;74:58–61.

Basu S, Dasgupta PS. Dopamine, a neurotransmitter, influences theimmune system. Journal of Neuroimmunology 2000;102:113–24.

Berridge KC, Aldridge JW, Houchard KR, Zhuang X. Sequential super-stereotypy of an instinctive fixed action pattern in hyper-dopaminergicmutant mice: a model of obsessive compulsive disorder and tourette’s.BMC Biology 2005;3:4.

Black KJ, Gado MH, Perlmutter JS. PET measurement of dopamine D2receptor-mediated changes in striatopallidal function. Journal ofNeuroscience 1997;17:3168–77.

Bruggeman R, van der Linden C, Buitelaar JK, Gericke GS, HawkridgeSM, Temlett JA. Risperidone versus pimozide in tourette’s disorder: a

comparative double-blind parallel-group study. Journal of ClinicalPsychiatry 2001;62:50–6.

Carter AS, Pauls DL, Leckman JF, Cohen DJ. A prospective longitudinalstudy of Gilles de la tourette’s syndrome. Journal of AmericanAcademy of Child and Adolescent Psychiatry 1994;33:377–85.

Conners CK. Conners’ rating scales-revised (CRS-R). Technical man-ual. New York: MHS Ed; 1997.

Cosentino M, Fietta AM, Ferrari M, Rasini E, Bombelli R, Carcano E,et al. Human CD4+CD25+ regulatory T cells selectively expresstyrosine hydroxylase and contain endogenous catecholamines sub-serving an autocrine/paracrine inhibitory functional loop. Blood2007;109:632–42.

Fitzgerald PB, Kapur S, Remington G, Roy P, Zipursky RB. Predictinghaloperidol occupancy of central dopamine D2 receptors from plasmalevels. Psychopharmacology 2000;149:1–5.

Hersi AI, Kitaichi K, Srivastava LK, Gaudreau P, Quirion R. DopamineD-5 receptor modulates hippocampal acetylcholine release. BrainResearch. Molecular Brain Research 2000;76:336–40.

Ilani T, Ben-Shachar D, Strous RD, Mazor M, Sheinkman A, Kotler M,et al. A peripheral marker for schizophrenia: increased levels of D3dopamine receptor mRNA in blood lymphocytes. Proceedings ofNational Academy Sciences of the United States of America2001;98:625–8.

Kawikova I, Leckman JF, Kronig H, Katsovich L, Bessen DE, Ghebre-michael M, et al. Decreased numbers of regulatory T cells suggestimpaired immune tolerance in children with tourette syndrome: apreliminary study. Biological Psychiatry 2007;61:273–8.

Kipnis J, Cohen H, Cardon M, Ziv Y, Schwartz M. T cell deficiency leadsto cognitive dysfunction: implications for therapeutic vaccination forschizophrenia and other psychiatric conditions. Proceedings of theNational Academy of Sciences of the United States of America2004;101:8180–5.

Kipnis J, Schwartz M. Controlled autoimmunity in CNS maintenance andrepair: naturally occurring CD4+CD25+ regulatory T-cells at thecrossroads of health and disease. Neuromolecular Medicine2005;7:197–206.

Kurlan R, Como PG, Miller B, Palumbo D, Deeley C, Andresen EM,et al. The behavioral spectrum of tic disorders: a community-basedstudy. Neurology 2002;59:414–20.

Leckman JF, Riddle MA, Hardin MT, Ort SI, Swartz KL, Stevenson J,et al. The Yale Global Tic Severity Scale: initial testing of a clinician-rated scale of tic severity. Journal of the American Academy of Childand Adolescent Psychiatry 1989;28:566–73.

Levings MK, Allan S, d’Hennezel E, Piccirillo CA. Functional dynamicsof naturally occurring regulatory T cells in health and autoimmunity.Advances in Immunology 2006;92:119–55.

Lit L, Gilbert DL, Walker W, Sharp FR. A subgroup of tourette’s patientsoverexpress specific natural killer cell genes in blood: a preliminaryreport. American Journal of Medicine Genetics Part B: Neuropsychi-atric Genetics 2007;144:958–63.

McKenna F, McLaughlin PJ, Lewis BJ, Sibbring GC, Cummerson JA,Bowen-Jones D, et al. Dopamine receptor expression on human T- andB-lymphocytes, monocytes, neutrophils, eosinophils and NK cells: aflow cytometric study. Journal of Neuroimmunology 2002;132:34–40.

Minzer K, Lee O, Hong JJ, Singer HS. Increased prefrontal D2 protein intourette syndrome: a postmortem analysis of frontal cortex andstriatum. Journal of Neurological Science 2004;219:55–61.

Nagai Y, Ueno S, Saeki Y, Soga F, Hirano M, Yanagihara T. Decrease ofthe D3 dopamine receptor mRNA expression in lymphocytes frompatients with Parkinson’s disease. Neurology 1996;46:791–5.

Rebec GV, Sun W. Neuronal substrates of relapse to cocaine-seekingbehavior: role of prefrontal cortex. Journal of the ExperimentalAnalysis of Behavior 2005;84:653–66.

Ricci A, Bronzetti E, Mignini F, Tayebati SK, Zaccheo D, Amenta F.dopamine D1-like receptor subtypes in human peripheral bloodlymphocytes. Journal of Neuroimmunology 1999;96:234–40.

Rocca P, De Leo C, Eva C, Marchiaro L, Milani AM, Musso R, et al.Decrease of the D4 dopamine receptor messenger RNA expression in

M. Ferrari et al. / Journal of Psychiatric Research 43 (2009) 24–29 29

lymphocytes from patients with major depression. Progress in Neuro-psychopharmacology and Biological Psychiatry 2006;26:1155–60.

Sakaguchi S. Naturally arising CD4+ regulatory t cells for immunologicself-tolerance and negative control of immune responses. AnnualReview of Immunology 2004;22:531–62.

Scahill L, Riddle MA, McSwiggin-Hardin M, Ort SI, King RA, GoodmanWK, et al. Children’s yale-brown obsessive compulsive scale: reliabilityand validity. Journal of American Academy of Child and AdolescentPsychiatry 1997;36:844–52.

Singer HS, Szymanski S, Giuliano J, Yokoi F, Dogan AS, Brasic JR,et al. Elevated intrasynaptic dopamine release in tourette’s syndromemeasured by PET. American Journal of Psychiatry2002;159:1329–36.

Spencer T, Biederman J, Coffey B, Geller D, Faraone S, Wilens T.Tourette disorder and ADHD. Advances in Neurology 2001;85:57–77.

Swedo SE, Leonard HL, Garvey M, Mittleman B, Allen AJ, Perlmutter S.Pediatric autoimmune neuropsychiatric disorders associated withstreptococcal infections: Clinical description of the first 50 cases.American Journal of Psychiatry 1998;155:264–71.

Termine C, Balottin U, Rossi G, Maisano F, Salini S, Di Nardo R, et al.Psychopathology in children and adolescents with tourette’s syndrome:a controlled study. Brain and Development 2006;2:69–75.

Tucker DM, Leckman JF, Scahill L, Wilf GE, LaCamera R, Cardona L,et al. A putative poststreptococcal case of OCD with chronic ticdisorder, not otherwise specified. Journal of American Academy ofChild and Adolescent Psychiatry 1996;35:1684–91.

Weisz JL, McMahon WM, Moore JC, Augustine NH, Bohnsack JF, BaleJF, et al. D8/17 and CD19 expression on lymphocytes of patients withacute rheumatic fever and tourette’s disorder. Clinical and DiagnosticLaboratory Immunology 2004;11:330–6.

Wong DF, Singer HS, Brandt J, Shaya E, Chen C, Brown J, et al. D2-likedopamine receptor density in tourette syndrome measured by PET.Journal of Nuclear Medicine 1997;38:1243–7.

Yang Z, Asico LD, Yu P, Wang Z, Jones JE, Escano CS, et al. D5dopamine receptor regulation of reactive oxygen species production,NADPH oxidase, and blood pressure. American Journal of Physiol-ogy-regulatory Integrative and Comparative Physiology2006;290:R96–R104.