![Page 1: DNA Technology Genetic Engineering. DNA Technology DNA Technology – science involved in the ability to manipulate genes/DNA Purpose: ◦Cure disease (Cystic](https://reader031.vdocuments.net/reader031/viewer/2022032201/56649cfd5503460f949cdf26/html5/thumbnails/1.jpg)
DNA Technology
Genetic Engineering
![Page 2: DNA Technology Genetic Engineering. DNA Technology DNA Technology – science involved in the ability to manipulate genes/DNA Purpose: ◦Cure disease (Cystic](https://reader031.vdocuments.net/reader031/viewer/2022032201/56649cfd5503460f949cdf26/html5/thumbnails/2.jpg)
DNA TechnologyDNA Technology – science involved
in the ability to manipulate genes/DNA
Purpose:◦Cure disease (Cystic Fibrosis)◦Treat genetic disorders (Hemophilia, diabetes)
◦Improve food crops (better tasting, longer shelf life, fungus resistance…)
◦Improve human life in general◦Helps us ID genes for traits
![Page 3: DNA Technology Genetic Engineering. DNA Technology DNA Technology – science involved in the ability to manipulate genes/DNA Purpose: ◦Cure disease (Cystic](https://reader031.vdocuments.net/reader031/viewer/2022032201/56649cfd5503460f949cdf26/html5/thumbnails/3.jpg)
I. How could you get a desired trait without directly manipulating the organisms’ DNA?
A. Selective Breeding - choosing organisms with
desired traits to produce the next generation
Breeding the winners of a horse race (Smarty Jones)
Taking the seeds from the Great Pumpkin
![Page 4: DNA Technology Genetic Engineering. DNA Technology DNA Technology – science involved in the ability to manipulate genes/DNA Purpose: ◦Cure disease (Cystic](https://reader031.vdocuments.net/reader031/viewer/2022032201/56649cfd5503460f949cdf26/html5/thumbnails/4.jpg)
B. Hybridization Crossing organisms with different
traits to produce a hardier productEx. A mule is a cross of a horse and a donkey – Sturdy and surefooted
Hybrid corn – tastes good and is more resistant to disease.
![Page 5: DNA Technology Genetic Engineering. DNA Technology DNA Technology – science involved in the ability to manipulate genes/DNA Purpose: ◦Cure disease (Cystic](https://reader031.vdocuments.net/reader031/viewer/2022032201/56649cfd5503460f949cdf26/html5/thumbnails/5.jpg)
C. Inbreeding
Maintaining the present genes by breeding only within the population
Ex. Pedigree animalsRisk with dipping into the same gene
pool and recessive traits showingup that may be lethal or harmful.
![Page 6: DNA Technology Genetic Engineering. DNA Technology DNA Technology – science involved in the ability to manipulate genes/DNA Purpose: ◦Cure disease (Cystic](https://reader031.vdocuments.net/reader031/viewer/2022032201/56649cfd5503460f949cdf26/html5/thumbnails/6.jpg)
D. Inducing mutations
By using known mutagens, attempt to force mutations to occur
Radiation & ChemicalsNot a sure bet nor do you know what
you are going to getPolyploidy (3N or 4N) plants have
resulted from this – larger & hardier
![Page 7: DNA Technology Genetic Engineering. DNA Technology DNA Technology – science involved in the ability to manipulate genes/DNA Purpose: ◦Cure disease (Cystic](https://reader031.vdocuments.net/reader031/viewer/2022032201/56649cfd5503460f949cdf26/html5/thumbnails/7.jpg)
II. Manipulating Genes by altering an organisms DNA
DNA Technology PurposeCure DiseasesTreat Genetic DisorderImprove Food CropImprove Human Life (reproduce
desired traits)
![Page 8: DNA Technology Genetic Engineering. DNA Technology DNA Technology – science involved in the ability to manipulate genes/DNA Purpose: ◦Cure disease (Cystic](https://reader031.vdocuments.net/reader031/viewer/2022032201/56649cfd5503460f949cdf26/html5/thumbnails/8.jpg)
III. Practical Uses of DNA Technology (positive)
Pharmacutical ProductsGenetically engineered vaccineIncreasing Agricultural Yields
(negative)AllergiesGMO (genetically Modified
Organisms)Supperweeds
![Page 9: DNA Technology Genetic Engineering. DNA Technology DNA Technology – science involved in the ability to manipulate genes/DNA Purpose: ◦Cure disease (Cystic](https://reader031.vdocuments.net/reader031/viewer/2022032201/56649cfd5503460f949cdf26/html5/thumbnails/9.jpg)
CloningGrowing a population of genetically identical
cells from a single cell
Let’s discuss the positives and negatives of m cloning…..
Let’s do a little research first……
Lab Bio: Read Pros and Cons of CloningHonors Bio: Read The Real Face of Cloning
![Page 10: DNA Technology Genetic Engineering. DNA Technology DNA Technology – science involved in the ability to manipulate genes/DNA Purpose: ◦Cure disease (Cystic](https://reader031.vdocuments.net/reader031/viewer/2022032201/56649cfd5503460f949cdf26/html5/thumbnails/10.jpg)
DNA Technology: ex: Gene Therapy Treatment of a genetic disorder (like
cystic fibrous) by correcting a defective gene that causes a deficiency of an enzyme.
Nasal spray that carries normal enzyme gene. Body makes enzyme and patient breathes normally. Regular treatments necessary
Has not been proven to be successful in the long term
![Page 11: DNA Technology Genetic Engineering. DNA Technology DNA Technology – science involved in the ability to manipulate genes/DNA Purpose: ◦Cure disease (Cystic](https://reader031.vdocuments.net/reader031/viewer/2022032201/56649cfd5503460f949cdf26/html5/thumbnails/11.jpg)
How do we copy a piece of DNA…..The Tools:
DNA Extraction – Chemical procedure (we’ll do this)
Restriction enzymes – molecular scissors that cut DNA at specific nucleotide sequences
Gel Electrophoresis – method to analyze fragments of DNA cut by restriction enzymes through a gel made of agarose (molecular sieve)
DNA Ligase – molecular glue that puts pieces of DNA together
Polymerase Chain Reaction (PCR)- molecular copy machine. Makes millions of copies of DNA/hr
![Page 12: DNA Technology Genetic Engineering. DNA Technology DNA Technology – science involved in the ability to manipulate genes/DNA Purpose: ◦Cure disease (Cystic](https://reader031.vdocuments.net/reader031/viewer/2022032201/56649cfd5503460f949cdf26/html5/thumbnails/12.jpg)
Let’s suppose that you are a diabetic and can not make your own insulin. What are you to do?
Inject insulin of course but from what source?
Old method was to use sheep insulin. Costly and labor intensive
New method: Let bacteria with a human insulin producing gene make it for you
![Page 13: DNA Technology Genetic Engineering. DNA Technology DNA Technology – science involved in the ability to manipulate genes/DNA Purpose: ◦Cure disease (Cystic](https://reader031.vdocuments.net/reader031/viewer/2022032201/56649cfd5503460f949cdf26/html5/thumbnails/13.jpg)
The Method: Transformation of a bacterium to produce human insulin1. Extract the insulin producing gene from a healthy human
2. Using a restriction enzyme, cut the insulin producing gene out of a the DNA
![Page 14: DNA Technology Genetic Engineering. DNA Technology DNA Technology – science involved in the ability to manipulate genes/DNA Purpose: ◦Cure disease (Cystic](https://reader031.vdocuments.net/reader031/viewer/2022032201/56649cfd5503460f949cdf26/html5/thumbnails/14.jpg)
What are restriction enzymes? Bacterial enzymes – used to cut
bacteriophage DNA (viruses that invade bacteria).
Different bacterial strains express different restriction enzymes
Restriction enzymes recognize a specific short nucleotide sequence
For example, Eco RI recognizes the sequence:
5’ - G A A T T C - 3’ 3’ - C T T A A G - 5’
Pandindrones same base pairing forward and backwards
![Page 15: DNA Technology Genetic Engineering. DNA Technology DNA Technology – science involved in the ability to manipulate genes/DNA Purpose: ◦Cure disease (Cystic](https://reader031.vdocuments.net/reader031/viewer/2022032201/56649cfd5503460f949cdf26/html5/thumbnails/15.jpg)
![Page 16: DNA Technology Genetic Engineering. DNA Technology DNA Technology – science involved in the ability to manipulate genes/DNA Purpose: ◦Cure disease (Cystic](https://reader031.vdocuments.net/reader031/viewer/2022032201/56649cfd5503460f949cdf26/html5/thumbnails/16.jpg)
Let’s try some cutting:
Using this piece of DNA, cut it with Eco RI G/AATTC
GACCGAATTCAGTTAATTCGAATTC CTGGCTTAAGTCAATTAAGCTTAAG
GACCG/AATTCAGTTAATTCG/AATTC CTGGCTTAA/GTCAATTAAGCTTAA/G
![Page 17: DNA Technology Genetic Engineering. DNA Technology DNA Technology – science involved in the ability to manipulate genes/DNA Purpose: ◦Cure disease (Cystic](https://reader031.vdocuments.net/reader031/viewer/2022032201/56649cfd5503460f949cdf26/html5/thumbnails/17.jpg)
What results is:
GACCG AATTCAGTTAATTCG AATTCCTGGCTTAA GTCAATTAAGCTTAA G
Sticky end Sticky end - tails of DNA – easily bind to other DNA strands
![Page 18: DNA Technology Genetic Engineering. DNA Technology DNA Technology – science involved in the ability to manipulate genes/DNA Purpose: ◦Cure disease (Cystic](https://reader031.vdocuments.net/reader031/viewer/2022032201/56649cfd5503460f949cdf26/html5/thumbnails/18.jpg)
Blunt & Sticky ends
Sticky ends – Creates an overhang. EcoRI
Blunts- Enzymes that cut at precisely opposite sites without overhangs. SmaI is an example of an enzyme that generates blunt ends
![Page 19: DNA Technology Genetic Engineering. DNA Technology DNA Technology – science involved in the ability to manipulate genes/DNA Purpose: ◦Cure disease (Cystic](https://reader031.vdocuments.net/reader031/viewer/2022032201/56649cfd5503460f949cdf26/html5/thumbnails/19.jpg)
Cloning Vectors
Cloning vector is a carrier that is used to clone a gene and transfer it from one organism to another.
Many bacteria contain a cloning vector called a PLASMID.
PLASMID is a ring of DNA found in a bacterium in addition to its main chromosome
![Page 20: DNA Technology Genetic Engineering. DNA Technology DNA Technology – science involved in the ability to manipulate genes/DNA Purpose: ◦Cure disease (Cystic](https://reader031.vdocuments.net/reader031/viewer/2022032201/56649cfd5503460f949cdf26/html5/thumbnails/20.jpg)
3. Cut cloning vector: Use bacterial plasmids
◦Plasmids will be cut with the same restriction enzyme used to cut the desired gene
![Page 21: DNA Technology Genetic Engineering. DNA Technology DNA Technology – science involved in the ability to manipulate genes/DNA Purpose: ◦Cure disease (Cystic](https://reader031.vdocuments.net/reader031/viewer/2022032201/56649cfd5503460f949cdf26/html5/thumbnails/21.jpg)
4. Ligation - Donor gene (desired gene) is then spliced or annealed into the plasmid using DNA ligase as the glue.
Recombinant DNA - DNA with new piece of genetic information on it
5. Plasmid is then returned to bacterium and reproduces with donor gene in it.
Transgenic organism – organism with foreign DNA incorporated in its genome (genes)
6. Bacterium reproduces and starts producing human insulin gene which we harvest from them.
![Page 22: DNA Technology Genetic Engineering. DNA Technology DNA Technology – science involved in the ability to manipulate genes/DNA Purpose: ◦Cure disease (Cystic](https://reader031.vdocuments.net/reader031/viewer/2022032201/56649cfd5503460f949cdf26/html5/thumbnails/22.jpg)
Recombinant DNA Donor Gene
![Page 23: DNA Technology Genetic Engineering. DNA Technology DNA Technology – science involved in the ability to manipulate genes/DNA Purpose: ◦Cure disease (Cystic](https://reader031.vdocuments.net/reader031/viewer/2022032201/56649cfd5503460f949cdf26/html5/thumbnails/23.jpg)
![Page 24: DNA Technology Genetic Engineering. DNA Technology DNA Technology – science involved in the ability to manipulate genes/DNA Purpose: ◦Cure disease (Cystic](https://reader031.vdocuments.net/reader031/viewer/2022032201/56649cfd5503460f949cdf26/html5/thumbnails/24.jpg)
Expression of Cloned Genes
Sometimes PROMOTERS must also be transferred so the genes will be turned on.
Genes are often turned off until the proteins they code for are needed.
![Page 25: DNA Technology Genetic Engineering. DNA Technology DNA Technology – science involved in the ability to manipulate genes/DNA Purpose: ◦Cure disease (Cystic](https://reader031.vdocuments.net/reader031/viewer/2022032201/56649cfd5503460f949cdf26/html5/thumbnails/25.jpg)