downloaded from //jb.asm.org/content/jb/early/2014/03/03/jb.01515... · 7 horai 5, naoki umezawa5,...
TRANSCRIPT
![Page 1: Downloaded from //jb.asm.org/content/jb/early/2014/03/03/JB.01515... · 7 Horai 5, Naoki Umezawa5, Tsunehiko Higuchi5, Tairo Oshima6, Yuko Yoshikawa3, 8 Tadayuki Imanaka 3, and Shinsuke](https://reader033.vdocuments.net/reader033/viewer/2022041622/5e3fa36de8199a22ae2e4752/html5/thumbnails/1.jpg)
1
Identification of a novel aminopropyltransferase involved in the synthesis of 1
branched-chain polyamines in hyperthermophiles 2
3
Running title: A novel branched-chain polyamine synthase 4
5
Kazuma Okada1#, Ryota Hidese2#, Wakao Fukuda3, Masaru Niitsu4, Koichi Takao4, Yuhei 6
Horai5, Naoki Umezawa5, Tsunehiko Higuchi5, Tairo Oshima6, Yuko Yoshikawa3, 7
Tadayuki Imanaka3, and Shinsuke Fujiwara1,2* 8
9
1Department of Bioscience, Graduate School of Science and Technology, Kwansei-Gakuin 10
University, 2-1 Gakuen, Sanda, Hyogo 669-1337, Japan. 2Research Center for Environmental 11
Bioscience, Graduate School of Science and Technology, Kwansei-Gakuin University, 2-1 12
Gakuen, Sanda, Hyogo 669-1337, Japan. 3Department of Biotechnology, College of Life 13
Sciences, Ritsumeikan University, Kusatsu, Shiga 525-8577, Japan. 4Faculty of Pharmaceutical 14
Sciences, Josai University, Sakado, Saitama 350-0295, Japan. 5Department of 15
Bioorganic-inorganic Chemistry, Graduate School of Pharmaceutical Science, Nagoya City 16
University, 3-1 Tanabe-dori, Mizuho-ku, Nagoya 467-8603, Japan. 6Institute of Environmental 17
Microbiology, Kyowa-kako Co. Ltd., 2-15-5 Tadao, Machida, Tokyo 194-0035, Japan. 18
JB Accepts, published online ahead of print on 7 March 2014J. Bacteriol. doi:10.1128/JB.01515-14Copyright © 2014, American Society for Microbiology. All Rights Reserved.
on February 8, 2020 by guest
http://jb.asm.org/
Dow
nloaded from
![Page 2: Downloaded from //jb.asm.org/content/jb/early/2014/03/03/JB.01515... · 7 Horai 5, Naoki Umezawa5, Tsunehiko Higuchi5, Tairo Oshima6, Yuko Yoshikawa3, 8 Tadayuki Imanaka 3, and Shinsuke](https://reader033.vdocuments.net/reader033/viewer/2022041622/5e3fa36de8199a22ae2e4752/html5/thumbnails/2.jpg)
2
#: The authors equally contribute to this work. 19
*Corresponding author: Shinsuke Fujiwara, Department of Bioscience, School of Science and 20
Technology, Kwansei-Gakuin University, 2-1 Gakuen, Sanda, Hyogo 669-1337, Japan. 21
Tel: +81-79-565-7829. Fax: +81-79-565-9077. E-mail: fujiwara-s@ kwansei.ac.jp 22
23
Abbreviations used in this manuscript: dcSAM, decarboxylated S-adenosylmethionine; ESI, 24
electro-spray ionization; GC, gas chromatography; HPLC, high performance liquid 25
chromatography; LIT, linear ion trap; MS, mass spectrometry; TOFMS, time of flight mass 26
spectrometry 27
28 on February 8, 2020 by guest
http://jb.asm.org/
Dow
nloaded from
![Page 3: Downloaded from //jb.asm.org/content/jb/early/2014/03/03/JB.01515... · 7 Horai 5, Naoki Umezawa5, Tsunehiko Higuchi5, Tairo Oshima6, Yuko Yoshikawa3, 8 Tadayuki Imanaka 3, and Shinsuke](https://reader033.vdocuments.net/reader033/viewer/2022041622/5e3fa36de8199a22ae2e4752/html5/thumbnails/3.jpg)
3
Abstract 29
Longer/branched-chain polyamines are unique polycations found in thermophiles. 30
N4-aminopropylspermine is considered a major polyamine in Thermococcus kodakarensis. To 31
determine whether a quaternary branched penta-amine, N4-bis(aminopropyl)spermidine, an 32
isomer of N4-aminopropylspermine, was also present, acid-extracted cytoplasmic polyamines 33
were analyzed by HPLC, GC, and GC-MS. N4-bis(aminopropyl)spermidine was an abundant 34
cytoplasmic polyamine in this species. To identify the enzyme that catalyzes 35
N4-bis(aminopropyl)spermidine synthesis, the active fraction was concentrated from the 36
cytoplasm and analyzed by LIT-TOFMS with ESI-trap instrument following analysis by 37
MASCOT database. TK0545, TK0548, TK0967, and TK1691 were identified as candidate 38
enzymes and the corresponding genes were individually cloned and expressed in Escherichia 39
coli. Recombinant forms were purified and their N4-bis(aminopropyl)spermidine synthesis 40
activity was measured. Of the four candidates, TK1691 (BpsA) was found to synthesize 41
N4-bis(aminopropyl)spermidine from spermidine via N4-aminopropylspermidine. Compared 42
with wild-type, the bpsA disrupted strain DBP1 grew at 85°C with a slightly longer lag phase, 43
but was unable to grow at 93°C. HPLC analysis showed that both N4-aminopropylspermidine 44
and N4-bis(aminopropyl)spermidine were absent from the DBP1 strain grown at 85°C, 45
demonstrating that the branched-chain polyamine synthesized by BpsA is important for cell 46
on February 8, 2020 by guest
http://jb.asm.org/
Dow
nloaded from
![Page 4: Downloaded from //jb.asm.org/content/jb/early/2014/03/03/JB.01515... · 7 Horai 5, Naoki Umezawa5, Tsunehiko Higuchi5, Tairo Oshima6, Yuko Yoshikawa3, 8 Tadayuki Imanaka 3, and Shinsuke](https://reader033.vdocuments.net/reader033/viewer/2022041622/5e3fa36de8199a22ae2e4752/html5/thumbnails/4.jpg)
4
growth at 93°C. Sequence comparison with orthologs from various microorganisms indicated 47
that BpsA differed from other known aminopropyltransferases that produce spermidine and 48
spermine. BpsA orthologs were found only in thermophiles, both in archaea and bacteria, but 49
were absent from mesophiles. These findings indicate that BpsA is a novel 50
aminopropyltransferase essential for the synthesis of branched-chain polyamines, enabling 51
thermophiles to grow in high temperature environments. 52
53
on February 8, 2020 by guest
http://jb.asm.org/
Dow
nloaded from
![Page 5: Downloaded from //jb.asm.org/content/jb/early/2014/03/03/JB.01515... · 7 Horai 5, Naoki Umezawa5, Tsunehiko Higuchi5, Tairo Oshima6, Yuko Yoshikawa3, 8 Tadayuki Imanaka 3, and Shinsuke](https://reader033.vdocuments.net/reader033/viewer/2022041622/5e3fa36de8199a22ae2e4752/html5/thumbnails/5.jpg)
5
INTRODUCTION 54
Polyamines are small, positively charged aliphatic molecules containing more than 55
two amine residues present in almost all living organisms. Putrescine [4], spermidine [34], and 56
spermine [343] are polyamines commonly observed in the cells of various living organisms, 57
from viruses to humans (1-4). Polyamines are important in cell proliferation and cell 58
differentiation (5, 6), as well as contributing to adaptation to various stresses (7). Interestingly, 59
in addition to common polyamines, thermophiles contain two types of unusual polyamines as 60
major polyamines. One type consists of long linear polyamines such as caldopentamine [3333] 61
and caldohexamine [33333], and the other consists of branched polyamines such as 62
N4-aminopropylnorspermidine [3(3)3], N4-aminopropylspermidine [3(3)4], 63
tetrakis-(3-aminopropyl)ammonium [3(3)(3)3], and N4-bis(aminopropyl)spermidine [3(3)(3)4], 64
where the numbers in brackets indicate the number of methylene (CH2) units between NH2, NH, 65
N or N+ (8-17). Because the relative amounts of long/branched-chain polyamines in cells of 66
(hyper)thermophiles were found to increase as growth temperatures increased, these unique 67
polyamines are regarded as supporting the growth of thermophilic microorganisms under high 68
temperature conditions (18-20). An in vitro study indicated that long-chain and branched-chain 69
polyamines effectively stabilized DNA and RNA, respectively (21), suggesting that these 70
unique polyamines enhance translation efficiency under high temperature conditions (22, 23). 71
on February 8, 2020 by guest
http://jb.asm.org/
Dow
nloaded from
![Page 6: Downloaded from //jb.asm.org/content/jb/early/2014/03/03/JB.01515... · 7 Horai 5, Naoki Umezawa5, Tsunehiko Higuchi5, Tairo Oshima6, Yuko Yoshikawa3, 8 Tadayuki Imanaka 3, and Shinsuke](https://reader033.vdocuments.net/reader033/viewer/2022041622/5e3fa36de8199a22ae2e4752/html5/thumbnails/6.jpg)
6
Polyamines are generally synthesized from amino acids such as arginine, ornithine, 72
and methionine (1, 5, 24). In most eukaryotes, putrescine is synthesized directly from ornithine 73
by ornithine decarboxylase. Plants and some bacteria possess additional or alternative 74
putrescine biosynthesis pathways, in which putrescine is synthesized from arginine via agmatine 75
(3, 25, 26). In this pathway, agmatine is synthesized by arginine decarboxylase and then 76
converted to putrescine by agmatine ureohydrolase or a combination of agmatine 77
iminohydrolase and N-carbamoylputrescine amidohydrolase. Spermidine and spermine are then 78
produced by the addition of the aminopropyl group from decarboxylated S-adenosylmethionine 79
(dcSAM). In contrast, thermophilic bacteria and archaea possess a unique polyamine 80
biosynthetic pathway, in which spermidine is synthesized from agmatine via 81
N1-aminopropylagmatine by aminopropyltransferase followed by ureohydrolase (18, 20, 27). 82
A sulfur-reducing hyperthermophilic archaeon, Thermococcus kodakarensis KOD1, 83
grows at temperatures between 60°C and 100°C but optimally at 85°C (28-31). Our previous 84
study found that Tk-PdaD (TK0149) catalyzed the synthesis of agmatine, the first step in 85
polyamine biosynthesis, and was essential for cell growth (32). Agmatine is also a precursor in 86
the synthesis of agmatidine, an agmatine-conjugated cytidine found at the anticodon wobble 87
position of archaeal tRNAIle (33). Our genetic study revealed that TK0147 and TK0882 encode 88
N1-aminopropylagmatine synthase and N1-aminopropylagmatine ureohydrolase, respectively, in 89
on February 8, 2020 by guest
http://jb.asm.org/
Dow
nloaded from
![Page 7: Downloaded from //jb.asm.org/content/jb/early/2014/03/03/JB.01515... · 7 Horai 5, Naoki Umezawa5, Tsunehiko Higuchi5, Tairo Oshima6, Yuko Yoshikawa3, 8 Tadayuki Imanaka 3, and Shinsuke](https://reader033.vdocuments.net/reader033/viewer/2022041622/5e3fa36de8199a22ae2e4752/html5/thumbnails/7.jpg)
7
the production of spermidine (20). Interestingly, larger quantities of agmatine accumulated in 90
strain DAT, in which TK0147 is disrupted, than in the parental KU216 strain. An in vitro study 91
also revealed that TK0147 encodes N1-aminopropylagmatine synthase rather than spermidine 92
synthase. Moreover, this pathway by which spermidine is synthesized via 93
N1-aminopropylagmatine is also found in a thermophilic bacterium Thermus thermophilus, 94
suggesting that this pathway is characteristic of (hyper)thermophiles (18). The mechanism 95
underlying the synthesis of further branched-chain polyamines is unclear, although these 96
branched-chain polyamines are likely functionally important at higher temperatures. Slight 97
amounts of branched-chain polyamines were produced by the TK0147 disruptant strain DAT, 98
with these amounts increased by the addition of spermidine, suggesting that branched-chain 99
polyamines are synthesized in vivo by an as yet unidentified aminopropyltransferase other than 100
TK0147. Based on sequence similarity with known aminopropyltransferases, including 101
spermidine and thermospermine synthases, no suitable candidates other than TK0147 were 102
found in T. kodakarensis. In this study, we identified a novel aminopropyltransferase that 103
produced branched-chain polyamines from a T. kodakarensis extract. As 104
N4-bis(aminopropyl)spermidine cannot be distinguished from N4-aminopropylspermine [3(3)43] 105
by HPLC analysis (17), the conditions were modified to separate these two isomers by HPLC. 106
In addition, cytoplasmic polyamines were reanalyzed by GC and GC-MS to determine whether 107
on February 8, 2020 by guest
http://jb.asm.org/
Dow
nloaded from
![Page 8: Downloaded from //jb.asm.org/content/jb/early/2014/03/03/JB.01515... · 7 Horai 5, Naoki Umezawa5, Tsunehiko Higuchi5, Tairo Oshima6, Yuko Yoshikawa3, 8 Tadayuki Imanaka 3, and Shinsuke](https://reader033.vdocuments.net/reader033/viewer/2022041622/5e3fa36de8199a22ae2e4752/html5/thumbnails/8.jpg)
8
the quaternary branched penta-amine N4-bis(aminopropyl)spermidine, an isomer of 108
N4-aminopropylspermine, was present in T. kodakarensis. 109
on February 8, 2020 by guest
http://jb.asm.org/
Dow
nloaded from
![Page 9: Downloaded from //jb.asm.org/content/jb/early/2014/03/03/JB.01515... · 7 Horai 5, Naoki Umezawa5, Tsunehiko Higuchi5, Tairo Oshima6, Yuko Yoshikawa3, 8 Tadayuki Imanaka 3, and Shinsuke](https://reader033.vdocuments.net/reader033/viewer/2022041622/5e3fa36de8199a22ae2e4752/html5/thumbnails/9.jpg)
9
MATERIALS AND METHODS 110
Microorganisms and media. T. kodakarensis KOD1 (28) and its derivatives were cultivated 111
anaerobically in a nutrient-rich medium (ASW-YT) containing 2.0 g l-1 elemental sulfur 112
(ASW-YT-S0) or pyruvate (ASW-YT-Pyr) (29). For solid medium, 1% Gelrite (Wako, Osaka, 113
Japan) was added. The stains used in this study are summarized in Table 1. E. coli strains were 114
routinely cultivated at 37°C in Luria-Bertani (LB) medium, with ampicillin (50 µg ml-1) and/or 115
chloramphenicol (25 µg ml-1) added to the medium when needed. 116
117
Polyamine analysis. T. kodakarensis strain KU216 (∆pyrF) (34) was cultivated in ASW-YT-S0 118
medium at 85°C until log-phase, and harvested. Cells were disrupted in cold 1.5 M perchloric 119
acid (PCA) by sonication for HPLC, GC, and GC-MS analyses. For HPLC analysis, 120
caldohexamine [33333] was added to the mixture (final concentration 3 mM) as an internal 121
standard to control for extraction and separation losses. The mixture was centrifuged, and the 122
supernatant was filtered with a 0.45 µm Millex-LH Filter (Millipore, Bedford, MA). Each 123
supernatant (100 µl) was analyzed by HPLC on a CK-10S cation-exchange column (6.0 mm I.D. 124
×50 mm) (GL Science, Tokyo, Japan). The column was equilibrated with a modified elution 125
buffer [100 mM potassium citrate monohydrate, 2.0 M KCl, 650 mM 2-propanol, and 2.4 mM 126
Brij 35 (Wako, Osaka, Japan), pH 3.2 adjusted by adding 65.0 ml 3M HCl per liter] at a flow 127
on February 8, 2020 by guest
http://jb.asm.org/
Dow
nloaded from
![Page 10: Downloaded from //jb.asm.org/content/jb/early/2014/03/03/JB.01515... · 7 Horai 5, Naoki Umezawa5, Tsunehiko Higuchi5, Tairo Oshima6, Yuko Yoshikawa3, 8 Tadayuki Imanaka 3, and Shinsuke](https://reader033.vdocuments.net/reader033/viewer/2022041622/5e3fa36de8199a22ae2e4752/html5/thumbnails/10.jpg)
10
rate of 1.0 ml min-1 at 70°C. The eluted polyamines were automatically mixed with a detection 128
buffer composed of 400 mM boric acid, 400 mM NaOH, 4.9 mM Brij35, 7.5 mM 129
o-phthalaldehyde, 171 mM ethanol, and 28 mM 2-mercaptoethanol at a flow rate of 0.5 ml min-1 130
at 70°C and monitored with a fluorescence detector (GL-7453A) (GL Science). Decarboxylated 131
S-adenosylmethionine (dcSAM) was kindly provided by Professor Dr. Akira Shirahata, Faculty 132
of Pharmaceutical Sciences, Josai University. 133
Polyamines were analyzed by GC and GC-MS as described, with slight 134
modifications (17). PCA-extracts were loaded onto a Dowex 50WX8 column to concentrate 135
polyamines. Following heptafluorobutyrization of the purified polyamine samples, GC was 136
performed on a Shimadzu GC-17A equipped with a capillary column of Inert Cap 1MS (0.32 137
mm I.D. × 30m; GL Sciences), and GC-MS was performed on a JEOL JMS-700 equipped with 138
a capillary column of Inert Cap 1MS. The heptafluorobutyryl derivatives of the polyamines 139
were identified by GC-MS. Spermidine [34] and spermine [343] were purchased from Sigma 140
(St. Louis, MO). Caldohexamine [33333] and N4-aminopropylspermidine [3(3)4] were 141
synthesized as described previously (35, 36). N4-Bis(aminopropyl)spermidine [3(3)(3)4] was 142
synthesized with a slight modification of the previous procedure (36). N4-Aminopropylspermine 143
[3(3)43] was prepared using a similar protocol reported in the literature (37). Detailed synthesis 144
on February 8, 2020 by guest
http://jb.asm.org/
Dow
nloaded from
![Page 11: Downloaded from //jb.asm.org/content/jb/early/2014/03/03/JB.01515... · 7 Horai 5, Naoki Umezawa5, Tsunehiko Higuchi5, Tairo Oshima6, Yuko Yoshikawa3, 8 Tadayuki Imanaka 3, and Shinsuke](https://reader033.vdocuments.net/reader033/viewer/2022041622/5e3fa36de8199a22ae2e4752/html5/thumbnails/11.jpg)
11
of the latter two polyamines will be published elsewhere. Polyamines were analyzed by HPLC 145
as reported, with slight modifications. 146
Measurement of aminopropyltransferase activity. Aminopropyltransferase activity was 147
measured as described with slight modifications (20), with the products of enzymatic reactions 148
analyzed by HPLC. Each reaction mixture (200 µl) contained 100 mM acceptor substrate 149
(spermidine, spermine, and N4-aminopropylspermidine), 100 mM donor substrate 150
decarboxylated S-adenosylmethionine and a crude extract of T. kodakarensis KU216 in 10 mM 151
CHES-NaOH buffer (pH 9.0). Following incubation at 70°C for 5 min, 200 µl of each reaction 152
mixture was filtered using a 0.45 µm Millex-LH filter and analyzed by HPLC, using the 153
procedure described above for analyzing polyamines. The quantities of enzyme products were 154
calculated by measuring the peak areas on the chromatograms. As standards, various amounts of 155
spermidine [34], spermine [343], N1-aminopropylagmatine, N4-aminopropylspermidine [3(3)4], 156
N4-aminopropylspermine [3(3)43], and N4-bis(aminopropyl)spermidine [3(3)(3)4] were 157
analyzed by HPLC and peak areas on the chromatograms were measured. 158
159
Protein fractionation for Nano-LC/MS/MS analysis. T. kodakarensis KU216 was cultivated 160
in 15 L of ASW-YT-S0 liquid medium at 85°C until log-phase. The harvested cells were 161
suspended in 20 ml of buffer A [20 mM Tris-HCl (pH7.5), 1 mM EDTA, 0.2 mM PMSF, and 1 162
on February 8, 2020 by guest
http://jb.asm.org/
Dow
nloaded from
![Page 12: Downloaded from //jb.asm.org/content/jb/early/2014/03/03/JB.01515... · 7 Horai 5, Naoki Umezawa5, Tsunehiko Higuchi5, Tairo Oshima6, Yuko Yoshikawa3, 8 Tadayuki Imanaka 3, and Shinsuke](https://reader033.vdocuments.net/reader033/viewer/2022041622/5e3fa36de8199a22ae2e4752/html5/thumbnails/12.jpg)
12
mM 2-mercaptoethanol], and disrupted by sonication on ice. After the supernatant was obtained 163
by centrifugation, ammonium sulfate was added to 40% saturation. The supernatant was 164
obtained by centrifugation and ammonium sulfate was added to 60% saturation. The precipitate 165
was collected by centrifugation, dissolved in buffer A, and dialyzed against buffer A. The 166
solution was applied to a 100 ml Super Q anion-exchange column (TOSOH, Tokyo, Japan), 167
followed by elution with a stepwise gradient of 250 mM, 300 mM, 350 mM, 400 mM, 450 mM, 168
and 500 mM NaCl in Tris-HCl buffer (pH 7.5). The fractions eluted by 250 mM NaCl with 169
enzymatic activity for the production of N4-bis(aminopropyl)spermidine from dcSAM and 170
spermidine were collected and dialyzed against buffer A. This sample was applied to a 5 ml 171
Hitrap Q anion-exchange column (GE Healthcare, WI), followed by elution with a linear 172
gradient of NaCl (0 to 1.0 M). The fractions with enzymatic activity were collected, dialyzed 173
against buffer A, re-applied to the same Hitrap Q column, and eluted with a linear gradient of 174
NaCl (200 to 400 mM). Fractions with N4-bis(aminopropyl)spermidine synthesis activity were 175
collected, dialyzed against 20 mM phosphate buffer (pH 6.5), and applied to a 5 ml Hitrap SP 176
cation-exchange column (GE Healthcare). The unbound flow-through fractions were collected, 177
concentrated with an Amicon Ultra-3K device (Millipore), applied to a Superdex 200 HR 10/30 178
gel filtration column (GE Healthcare), and eluted with buffer A containing 200 mM NaCl. 179
Fractions with enzymatic activity were collected and concentrated. Chromatography on the gel 180
on February 8, 2020 by guest
http://jb.asm.org/
Dow
nloaded from
![Page 13: Downloaded from //jb.asm.org/content/jb/early/2014/03/03/JB.01515... · 7 Horai 5, Naoki Umezawa5, Tsunehiko Higuchi5, Tairo Oshima6, Yuko Yoshikawa3, 8 Tadayuki Imanaka 3, and Shinsuke](https://reader033.vdocuments.net/reader033/viewer/2022041622/5e3fa36de8199a22ae2e4752/html5/thumbnails/13.jpg)
13
filtration column was repeated twice under the same conditions. The active fractions were 181
concentrated and applied to an SDS-PAGE preparatory gel. The thick bands were cut out, 182
dehydrated in acetonitrile and alkylated by incubation with 55 mM iodoacetamide for 90 min. 183
The product was digested with trypsin (Trypsin Gold, Promega, WI) overnight at 37°C, desalted 184
by Zip-Tip (Millipore), and applied to a LIT-TOFMS, Nano Frontier LD (Hitachi High 185
Technologies, Tokyo, Japan) with an ESI-trap instrument. The results were analyzed by the 186
MASCOT database (Matrix Science, SC) using the following criteria: database: T. kodakarensis 187
genome; enzyme: Trypsin, missed cleavage: 1; fixed modification: carbamideomethyl; protein 188
mass: no restriction; peptide mass tolerance: ± 0.5 Da; fragment mass tolerance: ± 0.5 Da. 189
190
Expression and purification of the candidate proteins. The genes examined in this study are 191
located at the following sites on the T. kodakarensis genome: tk0545, 465,352–466,569 (+) bp; 192
tk0548, 467,635–468,804 bp (−); tk0967, 844,599–845,645 (+) bp; and tk1691, 193
1,488,064–1,489,119 bp (−). The Tk0545, Tk0548, Tk0967, and Tk1691 genes were amplified 194
using the primers tk0545-Fw and tk0545-Rv, tk0548-Fw and tk0548-Rv, tk0967-Fw and 195
tk0967-Rv, and tk0967-Fw and tk0967-Rv, respectively (Table 1). These amplified fragments 196
were separately cloned into the NdeI/EcoRI sites of pET21a, yielding the plasmids pTK0545, 197
pTK0548, pTK0967, and pTK1691, respectively. These plasmids were used to transform 198
on February 8, 2020 by guest
http://jb.asm.org/
Dow
nloaded from
![Page 14: Downloaded from //jb.asm.org/content/jb/early/2014/03/03/JB.01515... · 7 Horai 5, Naoki Umezawa5, Tsunehiko Higuchi5, Tairo Oshima6, Yuko Yoshikawa3, 8 Tadayuki Imanaka 3, and Shinsuke](https://reader033.vdocuments.net/reader033/viewer/2022041622/5e3fa36de8199a22ae2e4752/html5/thumbnails/14.jpg)
14
Escherichia coli BL21-CodonPlus (DE3)-RIL cells, which were grown in LB medium 199
containing 100 µg ml-1 of ampicillin at 37°C for 6 h. After induction with 1 mM 200
isopropyl-β-D-thiogalactopyranoside for 4 h, the cells were harvested by centrifugation, 201
resuspended in buffer A, and disrupted by sonication. Cell debris was removed by 202
centrifugation, and each supernatant was incubated at 70°C for 30 min and then centrifuged 203
again. Each resultant supernatant was applied to a 5 ml Hitrap Q anion-exchange column and 204
eluted with a linear gradient of NaCl (0 to 1.0 M) in buffer A. Each purified protein was 205
dialyzed against buffer A. To purify TK1691, ammonium sulfate was added to the soluble 206
fraction to give 70% saturation. The precipitate was collected by centrifugation, dissolved in 207
buffer A, dialyzed against the same buffer, and applied to a 5 ml Hitrap Q anion-exchange 208
column. The column was eluted with a linear gradient of NaCl (0 to 1.0 M) in buffer A. 209
Fractions containing TK1691 (in 500 to 550 mM NaCl) were collected and applied to a 210
Superdex 200 HR 10/30 gel filtration column (GE Healthcare) in buffer A containing 200 mM 211
NaCl. Protein concentration was determined by the Bradford dye-binding assay, using bovine 212
serum albumin as a standard (38). 213
214
Construction of a TK1691 deletant. The principles underlying the disruption of specific 215
genes in T. kodakarensis have been described (Fig. 5A) (39). The vector for disrupting the 216
on February 8, 2020 by guest
http://jb.asm.org/
Dow
nloaded from
![Page 15: Downloaded from //jb.asm.org/content/jb/early/2014/03/03/JB.01515... · 7 Horai 5, Naoki Umezawa5, Tsunehiko Higuchi5, Tairo Oshima6, Yuko Yoshikawa3, 8 Tadayuki Imanaka 3, and Shinsuke](https://reader033.vdocuments.net/reader033/viewer/2022041622/5e3fa36de8199a22ae2e4752/html5/thumbnails/15.jpg)
15
TK1691 gene through double-crossover homologous recombination was constructed using the 217
following procedures. Using T. kodakarensis genomic DNA as a template, the Tk1691 gene, 218
along with its 5�- and 3�-flanking regions (ca. 1,000 bp each), was polymerase chain 219
reaction (PCR) amplified using the primers tk1691-up1000-Fw and tk1691-down1000-Rv. 220
The resulting DNA fragment was cloned into the EcoRV/XbaI sites of pUD2, resulting in the 221
plasmid pUD2-TK1691. Similarly, the pdaD gene along with 100 bp of its 5�-franking region 222
was PCR amplified from T. kodakarensis genomic DNA using the primers tkpdaD-Fw1 and 223
tkpdaD-Rv1. The region encoding TK1691 in pUD2-TK1691 was removed by inverse PCR 224
with the primers inv-tk1691-Fw and inv-tk1691-Rv, and the resultant PCR-amplified DNA 225
fragment was cloned into the SpeI/BamHI sites of the PCR-amplified DNA fragment 226
containing the pdaD gene and its 5�-flanking region. 227
The resulting disruption vector, pUD2-∆tk1691::pdaD, was used to delete the 228
TK1691 gene from the host strain, yielding T. kodakarensis DAD (∆pdaD, ∆pyrF) (32). Gene 229
deletion was confirmed by nucleotide sequencing. 230
on February 8, 2020 by guest
http://jb.asm.org/
Dow
nloaded from
![Page 16: Downloaded from //jb.asm.org/content/jb/early/2014/03/03/JB.01515... · 7 Horai 5, Naoki Umezawa5, Tsunehiko Higuchi5, Tairo Oshima6, Yuko Yoshikawa3, 8 Tadayuki Imanaka 3, and Shinsuke](https://reader033.vdocuments.net/reader033/viewer/2022041622/5e3fa36de8199a22ae2e4752/html5/thumbnails/16.jpg)
16
RESULTS 231
Composition of intracellular polyamines in T. kodakarensis 232
Since previous HPLC analysis was unable to distinguish N4-aminopropylspermine 233
from its quaternary branched penta-amine isomer, N4-bis(aminopropyl)spermidine (17), the 234
latter may be present in T. kodakarensis cells. N4-bis(aminopropyl)spermidine and 235
N4-aminopropylspermine, however, were clearly separated with a modified buffer, which had a 236
more acidic pH and higher KCl concentration than the previous buffer (20) (Fig. 1A). Using 237
these conditions, N4-bis(aminopropyl)spermidine was found to be a major polyamine of T. 238
kodakarensis (Fig. 1B); however, a peak corresponding to N4-aminopropylspermine was not 239
detected. To confirm that N4-bis(aminopropyl)spermidine is a major polyamine in T. 240
kodakarensis, acid-extracted cytoplasmic polyamines were analyzed by GC and GC-MS. Two 241
major peaks, corresponding to N4-aminopropylnorspermidine and N4-aminopropylspermidine, 242
were detected (Fig. 2A). Since N4-bis(aminopropyl)spermidine is converted to 243
N4-aminopropylnorspermidine and N4-aminopropylspermidine during GC and GC-MS analyses 244
(40), peaks 1 and 2 in Figure 2A correspond to N4-aminopropylnorspermidine and 245
N4-aminopropylspermidine (Fig. 2B), respectively, indicating that 246
N4-bis(aminopropyl)spermidine is a major polyamine in T. kodakarensis, whereas 247
N4-aminopropylspermine is not. Peak identification in the previous study was incorrect. The 248
on February 8, 2020 by guest
http://jb.asm.org/
Dow
nloaded from
![Page 17: Downloaded from //jb.asm.org/content/jb/early/2014/03/03/JB.01515... · 7 Horai 5, Naoki Umezawa5, Tsunehiko Higuchi5, Tairo Oshima6, Yuko Yoshikawa3, 8 Tadayuki Imanaka 3, and Shinsuke](https://reader033.vdocuments.net/reader033/viewer/2022041622/5e3fa36de8199a22ae2e4752/html5/thumbnails/17.jpg)
17
amounts of major intracellular polyamines, spermidine [34] (shown as peak P2 in Fig. 1b), 249
N4-aminopropylspermidine [3(3)4] (peak P3), spermine [343] (peak P4) and 250
N4-bis(aminopropyl)spermidine [3(3)(3)4] (peak P6) were 2.19, 1.00, 0.91, and 3.32 µmol g-1 in 251
wet cells, respectively. 252
253
Identification of N4-bis(aminopropyl)spermidine synthase 254
To identify the enzyme that catalyzes N4-bis(aminopropyl)spermidine synthesis, T. 255
kodakarensis KU216 cells cultivated at 85°C were disrupted by sonication, and the cytoplasmic 256
fraction was concentrated by ammonium sulfate precipitation, anion or cation-exchange 257
chromatography, and gel filtration. The fractions containing the enzyme were identified by 258
monitoring N4-bis(aminopropyl)spermidine synthesis activity on HPLC. These fractions were 259
applied to SDS-PAGE, and protein bands were sliced out. The stained gel particles were 260
dehydrated in acetonitrile and then alkylated, desalted, and digested with trypsin. The fractions 261
were applied to LIT-TOFMS with an ESI-trap instrument, with the results analyzed by 262
MASCOT relative to the T. kodakarensis genome database. We identified four proteins, TK0545 263
as S-adenosylmethionine synthetase, TK0548 as aspartate aminotransferase, TK1691 as a 264
hypothetical protein, and TK0967 as Xaa-Pro aminopeptidase with Mascot database. Mascot 265
scores of TK0545, TK0548, TK1691, and TK0967 proteins were 334, 300, 256, and 145, 266
on February 8, 2020 by guest
http://jb.asm.org/
Dow
nloaded from
![Page 18: Downloaded from //jb.asm.org/content/jb/early/2014/03/03/JB.01515... · 7 Horai 5, Naoki Umezawa5, Tsunehiko Higuchi5, Tairo Oshima6, Yuko Yoshikawa3, 8 Tadayuki Imanaka 3, and Shinsuke](https://reader033.vdocuments.net/reader033/viewer/2022041622/5e3fa36de8199a22ae2e4752/html5/thumbnails/18.jpg)
18
respectively. To determine the protein with N4-bis(aminopropyl)spermidine synthase activity, 267
the four genes were separately cloned into the expression plasmid pET21a and the recombinant 268
proteins expressed in E. coli and purified (Fig. 3). Assessment of their 269
N4-bis(aminopropyl)spermidine synthase activities by HPLC showed that TK1691 catalyzed the 270
synthesis of N4-bis(aminopropyl)spermidine from spermidine (Fig. 4D). In contrast, the three 271
other purified proteins, TK0545, TK0548, and TK0967, did not show 272
N4-bis(aminopropyl)spermidine synthesis activity (Figs. 4A and B). HPLC showed that, when 273
spermidine was the substrate, most of the product was N4-bis(aminopropyl)spermidine, with a 274
slight amount of N4-aminopropylspermidine. When N4-aminopropylspermidine was used, the 275
substrate, N4-bis(aminopropyl)spermidine was produced. The specific activity of enzyme using 276
either spermidine or N4-aminopropylspermidine as substrate was approximately 0.34 µmol min-1 277
mg-1. These findings indicated that TK1691 catalyzed the production of 278
N4-bis(aminopropyl)spermidine via N4-aminopropylspermidine. In contrast, when spermine was 279
the substrate, only N4-aminopropylspermine was produced, with the specific activity of enzyme 280
using spermine being approximately 0.12 µmol min-1 mg-1. Taken together, these findings 281
indicate that TK1691 is a bifunctional enzyme, which acts on linear tri- and tetraamines, as well 282
as on tertiary tetraamines. 283
284
on February 8, 2020 by guest
http://jb.asm.org/
Dow
nloaded from
![Page 19: Downloaded from //jb.asm.org/content/jb/early/2014/03/03/JB.01515... · 7 Horai 5, Naoki Umezawa5, Tsunehiko Higuchi5, Tairo Oshima6, Yuko Yoshikawa3, 8 Tadayuki Imanaka 3, and Shinsuke](https://reader033.vdocuments.net/reader033/viewer/2022041622/5e3fa36de8199a22ae2e4752/html5/thumbnails/19.jpg)
19
Effect of Tk-bpsA disruption on cell growth 285
To examine the physiological roles of the TK1691 gene, which we termed the bpsA 286
(branched-chain polyamine synthase A) gene, in T. kodakarensis, a bpsA deletion mutant 287
(disruptant) DBP1 (ΔpyrF, ∆pdaD, ∆bpsA::pdaD) was constructed by replacing the bpsA gene 288
with the pdaD gene (Fig. 5A). A pdaD gene encodes arginine decarboxylase which catalyzes 289
the synthesis of agmatine and agmatine is essential for the growth of T. kodakarensis (32).The 290
plasmid pUD2-∆bpsA::pdaD was introduced into the strain DAD (ΔpyrF, ∆pdaD). Candidate 291
mutants which showed agmatine prototrophy were isolated following pop-in recombination of 292
the pdaD gene and pop-out recombination of the pyrF marker gene. The mutant genotype was 293
confirmed by PCR amplification with the primers tk1691_out_1 and tk1691_out_2, which 294
annealed outside the target region, confirming the expected change in length (2.6 bp) of the 295
amplified DNA fragments (Fig. 5Ba). The internal primers tk1691_in_1 and tk1691_in_2, 296
which annealed within the bpsA coding region, amplified a 1.1 kb fragment in wild-type (WT), 297
but not in mutant, DNA (Fig. 5Bb), indicating that bpsA had been successfully disrupted. 298
Disruptions in the genes encoding the enzymes agmatine ureohydrolase (TK0882) and 299
spermidine synthase (TK0147), both of which are involved in spermidine biosynthesis, 300
decreased the rate of T. kodakarensis growth at 85°C, and severely decreased growth at 93°C 301
compared with wild-type (20), suggesting that branched polyamines and spermidine support T. 302
on February 8, 2020 by guest
http://jb.asm.org/
Dow
nloaded from
![Page 20: Downloaded from //jb.asm.org/content/jb/early/2014/03/03/JB.01515... · 7 Horai 5, Naoki Umezawa5, Tsunehiko Higuchi5, Tairo Oshima6, Yuko Yoshikawa3, 8 Tadayuki Imanaka 3, and Shinsuke](https://reader033.vdocuments.net/reader033/viewer/2022041622/5e3fa36de8199a22ae2e4752/html5/thumbnails/20.jpg)
20
kodakarensis growth at higher temperatures. To assess the effect of bpsA disruption on cell 303
growth at different temperatures, the parental host strain KU216 and the disruptant strain 304
DBP1 were cultivated at 85°C and 93°C. At 85°C, the growth curve of DBP1 showed a 305
slightly extended lag phase compared with that of KU216 (Fig. 6A). By contrast, at 93°C, 306
there was no cell growth of the disruptant strain DBP1 (Fig. 6B), indicating that the bpsA gene 307
is required for growth at the higher temperature. The growth defect of DBP1 at 93°C was 308
partially restored by the addition of 1 mM of N4-bis(aminopropyl)spermidine to the medium 309
(Fig. 6B). The obtained results show that N4-bis(aminopropyl)spermidine is required for cell 310
growth of T. kodakarensis at higher temperature environment. 311
312
Composition of cytoplasmic polyamines in strain DBP1 313
To analyze the changes in polyamine composition resulting from disruption of the 314
bpsA gene, DBP1 cells were cultivated at 85°C and extracted with PCA, and the extracted 315
fraction was analyzed by HPLC. N4-bis(aminopropyl)spermidine and 316
N4-aminopropylspermidine were both absent from the DPB1 cell extract (Fig. 7), indicating that 317
the synthesis of these branched-chain polyamines is catalyzed by BpsA in vivo. Two major 318
peaks corresponding to spermidine and spermine were observed at retention times of 7.1 min 319
and 11.5 min, respectively. Interestingly, the amount of spermidine was approximately 2.5-fold 320
on February 8, 2020 by guest
http://jb.asm.org/
Dow
nloaded from
![Page 21: Downloaded from //jb.asm.org/content/jb/early/2014/03/03/JB.01515... · 7 Horai 5, Naoki Umezawa5, Tsunehiko Higuchi5, Tairo Oshima6, Yuko Yoshikawa3, 8 Tadayuki Imanaka 3, and Shinsuke](https://reader033.vdocuments.net/reader033/viewer/2022041622/5e3fa36de8199a22ae2e4752/html5/thumbnails/21.jpg)
21
higher in DPB1 than in KU216 cells (5.63 vs. 2.25 µmol g-1 in wet cells) (Fig. 7). By contrast, 321
both cell types contained similar amounts of spermine (ca. 1.15 µmol g-1 in wet cells). These 322
results indicated that N4-bis(aminopropyl)spermidine was produced from spermidine by the 323
sequential reactions catalyzed by BpsA via N4-aminopropylspermidine. 324
on February 8, 2020 by guest
http://jb.asm.org/
Dow
nloaded from
![Page 22: Downloaded from //jb.asm.org/content/jb/early/2014/03/03/JB.01515... · 7 Horai 5, Naoki Umezawa5, Tsunehiko Higuchi5, Tairo Oshima6, Yuko Yoshikawa3, 8 Tadayuki Imanaka 3, and Shinsuke](https://reader033.vdocuments.net/reader033/viewer/2022041622/5e3fa36de8199a22ae2e4752/html5/thumbnails/22.jpg)
22
Discussion 325
Polyamines are organic polycations present in the cells of various living organisms. 326
Generally, polyamines interact with nucleic acids (21, 41, 42) and are involved in cell 327
proliferation and differentiation (5, 6). Common polyamines include putrescine, spermidine and 328
spermine (1, 5, 24). In addition, thermophiles including hyperthermophiles have unique 329
polyamines, including long- and/or branched-chain polyamines (8-17). Although T. 330
kodakarensis was found to contain the branched-chain polyamine N4-aminopropylspermine (20), 331
it was unclear whether these cells also contained its isomer, N4-bis(aminopropyl)spermidine. 332
Both of these isomers were reported to appear at the same position on HPLC, suggesting that 333
these molecules cannot be distinguished by HPLC (17). Using HPLC analysis performed with 334
modified separation conditions, together with precise GC and GC-MS analyses, we found that 335
N4-bis(aminopropyl)spermidine is a major polyamine in T. kodakarensis. 336
The T. kodakarensis enzyme TK0147 was found to be a N1-aminopropylagmatine 337
synthase, catalyzing the transfer of an aminopropyl group from dcSAM to agmatine. However, 338
TK0147 was unable to synthesize N4-aminopropylspermidine or 339
N4-bis(aminopropyl)spermidine from spermidine in vitro (20). Both of these polyamines were 340
synthesized by the TK0147 deletant in vivo (20), however, indicating that other, as yet unknown, 341
aminopropyltransferases catalyze the production of branched-chain polyamines in T. 342
on February 8, 2020 by guest
http://jb.asm.org/
Dow
nloaded from
![Page 23: Downloaded from //jb.asm.org/content/jb/early/2014/03/03/JB.01515... · 7 Horai 5, Naoki Umezawa5, Tsunehiko Higuchi5, Tairo Oshima6, Yuko Yoshikawa3, 8 Tadayuki Imanaka 3, and Shinsuke](https://reader033.vdocuments.net/reader033/viewer/2022041622/5e3fa36de8199a22ae2e4752/html5/thumbnails/23.jpg)
23
kodakarensis. Indeed, the results presented here showed that the TK1691 gene encodes an as yet 343
unidentified novel aminopropyltransferase, which was found to act as a branched-chain 344
polyamine synthase (BpsA). Biochemical and genetic studies showed that BpsA is a 345
bifunctional enzyme, which catalyzes the sequential condensation of spermidine with the 346
aminopropyl groups of dcSAMs to produce N4-bis(aminopropyl)spermidine via 347
N4-aminopropylspermidine. This result was confirmed by the polyamine composition of DBP1, 348
which showed the accumulation of spermidine in the cytoplasm. The TK1691 gene is therefore 349
essential for the production of branched-chain polyamines in T. kodakarensis. The 350
N4-bis(amionopropyl)spermidine biosynthetic pathway predicted in this study is outlined in 351
Figure 8. 352
We found that disruption of the bpsA gene caused a severe growth defect in T. 353
kodakarensis at 93°C. However, the growth rate and final cell yield at 85°C were similar in 354
DBP1 and KU216 strains. By contrast, our previous study showed that disruption of the TK0882 355
gene in the DUH8 strain, and disruption of the TK0147 gene in the DAT strain, led to their 356
decreased growth rate at 85°C when compared with the parental strain. The differences in 357
growth properties at 85°C may be explained by the intracellular polyamine compositions of 358
these strains. Spermidine and spermine were identified as major polyamines in DBP1 cells 359
grown at 85°C. The amount of spermidine was 2.5-fold greater in the DBP1 than in the WT 360
on February 8, 2020 by guest
http://jb.asm.org/
Dow
nloaded from
![Page 24: Downloaded from //jb.asm.org/content/jb/early/2014/03/03/JB.01515... · 7 Horai 5, Naoki Umezawa5, Tsunehiko Higuchi5, Tairo Oshima6, Yuko Yoshikawa3, 8 Tadayuki Imanaka 3, and Shinsuke](https://reader033.vdocuments.net/reader033/viewer/2022041622/5e3fa36de8199a22ae2e4752/html5/thumbnails/24.jpg)
24
strain, whereas the amount of spermine in the two strains was similar. By contrast, the amounts 361
of spermidine were about 100-fold lower in the DUH8 and DAT than in the DBP1 stain. The 362
addition of 1 mM spermidine to the medium partially restored the growth rates of the DUH8 363
and DAT strains (20). In addition, the amounts of spermine in the DUH8, DAT and DBP1 364
strains were similar. Taken together, these finding suggests that the accumulation of larger 365
amounts of spermidine in the DBP1 strain enables these cells to grow at 85°C. It is noteworthy 366
that growth defect of DBP1 at 93°C was partially restored by the addition of 367
N4-bis(aminopropyl)spermidine (Fig. 6B). This result suggests that T. kodakarensis possesses a 368
transport system for N4-bis(aminopropyl)spermidine. 369
Since branched-chain polyamines are unique to thermophiles, the distribution of 370
Tk-BpsA orthologs was expected to be limited to thermophiles. The phylogenetic tree of 371
Tk-BpsA orthologs constructed with known spermidine, spermine, and thermospermine 372
synthases over all domains of life showed that the BpsA orthologs were conserved only in 373
(hyper)thermophiles in the phylum Euryarchaeota and bacteria (Fig. 9). No BpsA orthologs 374
were not found in hitherto known members of the phylum Crenarchaeota, consisting with the 375
fact that the occurrence of branched polyamines has never been reported in Crenarchaeota (16). 376
By contrast, aminopropyltransferases that produce spermidine, thermospermine, and spermine 377
synthase homologs, including E. coli SpeE (43), Arabidopsis thaliana At5g19530 (44), and T. 378
on February 8, 2020 by guest
http://jb.asm.org/
Dow
nloaded from
![Page 25: Downloaded from //jb.asm.org/content/jb/early/2014/03/03/JB.01515... · 7 Horai 5, Naoki Umezawa5, Tsunehiko Higuchi5, Tairo Oshima6, Yuko Yoshikawa3, 8 Tadayuki Imanaka 3, and Shinsuke](https://reader033.vdocuments.net/reader033/viewer/2022041622/5e3fa36de8199a22ae2e4752/html5/thumbnails/25.jpg)
25
kodakarensis TK0147 (20), have been identified in various organisms of bacteria and plants. 379
Furthermore, Tk-BpsA and its orthologs were distinct from other known 380
aminopropyltransferases that produce the linear polyamines, thermospermine, spermidine, and 381
spermine. The Tk-BpsA orthologs, previously designated S-adenosylmethionine-dependent 382
methyltransferases, lack the dcSAM- and general polyamine-binding motifs found in E. coli 383
SpeE (45) and Thermotoga maritima PAPT (46). The conserved GGG(E/D)G motif has been 384
reported in known aminopropyltransferases that synthesize the production of linear polyamines 385
(46, 47). The carboxy group of the (E/D) residue of GGG(E/D)G interacts with the amino group 386
of dcSAM, preventing S-adenosylmethionine (SAM) binding by steric and electrostatic 387
interference with the carboxy group of SAM. Indeed, the GGG(E/D)G motif is found in 388
TK0147 and its orthologs but not in Tk-BpsA and its orthologs. While Tk-BpsA accepts linear 389
chains (e.g. spermidine and spermine), dcSAM, and branched-chains (e.g., 390
N4-aminopropylspermidine) polyamines as substrates, the conserved amino acid residues 391
essential for aminopropyltransferase activity were not present in Tk-BpsA and its orthologs, 392
suggesting that the branched-chain polyamines are synthesized by a novel catalytic mechanism 393
involving aminopropyl transfer. 394
Phylogenetically, aminopropyltransferases can be classified into four groups. One 395
group (Group A) includes the thermophilic Tk-BpsA orthologs (PF1111 from P. furiosus, 396
on February 8, 2020 by guest
http://jb.asm.org/
Dow
nloaded from
![Page 26: Downloaded from //jb.asm.org/content/jb/early/2014/03/03/JB.01515... · 7 Horai 5, Naoki Umezawa5, Tsunehiko Higuchi5, Tairo Oshima6, Yuko Yoshikawa3, 8 Tadayuki Imanaka 3, and Shinsuke](https://reader033.vdocuments.net/reader033/viewer/2022041622/5e3fa36de8199a22ae2e4752/html5/thumbnails/26.jpg)
26
Metig0730 from Methanotorris igneus and TTHC0171 from T. thermophilus). A second group 397
(Group B) consists of the TK0147 orthologs including Escherichia coli SpeE (43) and P. 398
furiosus PF0127 (48). Group C consists of several other aminopropyltransferases, which act as 399
thermospermine synthases, including PAE1203 from Pyrobaculum aerophilum (49), Hbut0057 400
and Hbut0383 from Hyperthermus butylicus (49), and At5g19530 from Arabidopsis thaliana 401
(44). Tk-BpsA orthologs (Group A) are unique to thermophiles, whereas branched molecules 402
are also present in mesophiles (Group D in Fig. 9). Moreover, M. jannaschii, an archaeal 403
hyperthermophile, has two Tk-BpsA orthologs, MJ1273 and MJ0675. MJ1273 is highly 404
homologous to Tk-BpsA and belongs to aminopropyltransferase Group A. MJ1273 is regarded 405
as the enzyme responsible for the synthesis of branched-chain polyamines. Indeed, 406
N4-bis(aminopropyl)spermidine was found to be synthesized in an M. jannaschii extract (16). 407
By contrast, MJ0675 is located on a different branch of the phylogenetic tree and has been 408
tentatively designated as belonging to Group D. Methanococcus maripaludis MMP1657 is 409
homologous to MJ0675, with both predicted to be RNA methylases. Methyltransferases transfer 410
a methyl group from SAM to an acceptor; these enzymes and aminopropyltransferases are 411
thought to be derived from a common ancestor. The apparent lack of any branched-chain 412
polyamines in M. maripaludis extract (16) suggests that enzymes, including MMP1657, 413
belonging to aminopropyltransferase Group D are not likely to be responsible for the synthesis 414
on February 8, 2020 by guest
http://jb.asm.org/
Dow
nloaded from
![Page 27: Downloaded from //jb.asm.org/content/jb/early/2014/03/03/JB.01515... · 7 Horai 5, Naoki Umezawa5, Tsunehiko Higuchi5, Tairo Oshima6, Yuko Yoshikawa3, 8 Tadayuki Imanaka 3, and Shinsuke](https://reader033.vdocuments.net/reader033/viewer/2022041622/5e3fa36de8199a22ae2e4752/html5/thumbnails/27.jpg)
27
of branched-chain polyamines. 415
Primitive hyperthermophiles likely require long- and/or branched-chain polyamines to 416
stabilize DNA and/or RNA at high temperatures (21). A universal phylogenetic tree based on 417
16S and 18S rDNA, and theoretical studies, suggest that life originated with 418
(hyper)thermophiles (50-52). By adapting to lower temperature environments, these 419
microorganisms may have lost their ability to synthesize group A enzymes during the course of 420
evolution, because branched-chain polyamines are not required for cell growth at lower 421
temperatures. Thus, branched-chain polyamines appear to be molecules key for survival in high 422
temperature environments. 423
424
Acknowledgments 425
This study was mainly supported by grants of Japan Society for the Promotion of Science 426
(JSPS) KAKENHI (23580121). Bioinformatic analysis was supported by Grant for Individual 427
Special Research provided by Kwansei Gakuin University. 428
429
Reference 430
1. Casero RA, Pegg AE. 2009. Polyamine catabolism and disease. Biochem J. 421:323-338. 431 2. Cohen SS, McCormick FP. 1979. Polyamines and virus multiplication. Adv. Virus Res. 432
24:331-387. 433 3. Tabor CW, Tabor H. 1985. Polyamines in microorganisms. Microbiol. Rev. 49:81-99. 434
on February 8, 2020 by guest
http://jb.asm.org/
Dow
nloaded from
![Page 28: Downloaded from //jb.asm.org/content/jb/early/2014/03/03/JB.01515... · 7 Horai 5, Naoki Umezawa5, Tsunehiko Higuchi5, Tairo Oshima6, Yuko Yoshikawa3, 8 Tadayuki Imanaka 3, and Shinsuke](https://reader033.vdocuments.net/reader033/viewer/2022041622/5e3fa36de8199a22ae2e4752/html5/thumbnails/28.jpg)
28
4. Tabor CW, Tabor H. 1976. 1,4-Diaminobutane (putrescine), spermidine, and spermine. Annu. 435 Rev. Biochem. 45:285-306. 436
5. Wallace HM, Fraser AV, Hughes A. 2003. A perspective of polyamine metabolism. Biochem J. 437 376:1-14. 438
6. Jänne J, Alhonen L, Keinänen TA, Pietilä M, Uimari A, Pirinen E, Hyvönen MT, Järvinen 439 A. 2005. Animal disease models generated by genetic engineering of polyamine metabolism. J. 440 Cell Mol. Med. 9:865-882. 441
7. Groppa MD, Benavides MP. 2008. Polyamines and abiotic stress: recent advances. Amino Acids 442 34:35-45. 443
8. Oshima T, Kawahata S. 1983. Homocaldopentamine: a new naturally occurring pentaamine. J. 444 Biochem. 93:1455-1456. 445
9. Hamana K, Niitsu M, Samejima K, Matsuzaki S. 1991. Polyamine distributions in 446 thermophilic eubacteria belonging to Thermus and Acidothermus. J. Biochem. 109:444-449. 447
10. Hamana K, Niitsu M, Matsuzaki S, Samejima K, Igarashi Y, Kodama T. 1992. Novel linear 448 and branched polyamines in the extremely thermophilic eubacteria Thermoleophilum, Bacillus 449 and Hydrogenobacter. Biochem J. 284 ( Pt 3):741-747. 450
11. Hamana K, Hamana H, Niitsu M, Samejima K, Sakane T, Yokota A. 1993. Tertiary and 451 quaternary branched polyamines distributed in thermophilic Saccharococcus and Bacillus. 452 Microbios 75:23-32. 453
12. Hamana K, Hamana H, Niitsu M, Samejima K, Sakane T, Yokota A. 1994. Occurrence of 454 tertiary and quaternary branched polyamines in thermophilic archaebacteria. Microbios 455 79:109-119. 456
13. Hamana K, Niitsu M, Samejima K, Itoh T. 2001. Polyamines of the thermophilic eubacteria 457 belonging to the genera Thermosipho, Thermaerobacter and Caldicellulosiruptor. Microbios 458 104:177-185. 459
14. Hamana K, Tanaka T, Hosoya R, Niitsu M, Itoh T. 2003. Cellular polyamines of the 460 acidophilic, thermophilic and thermoacidophilic archaebacteria, Acidilobus, Ferroplasma, 461 Pyrobaculum, Pyrococcus, Staphylothermus, Thermococcus, Thermodiscus and Vulcanisaeta. J. 462 Gen. Appl. Microbiol. 49:287-293. 463
15. Hosoya R, Hamana K, Niitsu M, Itoh T. 2004. Polyamine analysis for chemotaxonomy of 464 thermophilic eubacteria: Polyamine distribution profiles within the orders Aquificales, 465 Thermotogales, Thermodesulfobacteriales, Thermales, Thermoanaerobacteriales, Clostridiales 466 and Bacillales. J. Gen. Appl. Microbiol. 50:271-287. 467
16. Hamana K, Hosoya R, Itoh T. 2007. Polyamine analysis of methanogens, thermophiles and 468 extreme halophiles belonging to the domain Archaea. J. Jpn. Soc. Extremophiles 6:25-31. 469
17. Hamana K, Hayashi H, Niitsu M, Sugata D, Higuchi K, Itoh T. 2011. Cellular distribution of 470
on February 8, 2020 by guest
http://jb.asm.org/
Dow
nloaded from
![Page 29: Downloaded from //jb.asm.org/content/jb/early/2014/03/03/JB.01515... · 7 Horai 5, Naoki Umezawa5, Tsunehiko Higuchi5, Tairo Oshima6, Yuko Yoshikawa3, 8 Tadayuki Imanaka 3, and Shinsuke](https://reader033.vdocuments.net/reader033/viewer/2022041622/5e3fa36de8199a22ae2e4752/html5/thumbnails/29.jpg)
29
unusual long linear and branched polyamiens within the newly validated thermophiles belonging 471 to the bacterial orders Thermoanaerobacterales and Clostridiales. J. Jpn. Soc. Extremophiles 472 10:83-89. 473
18. Ohnuma M, Terui Y, Tamakoshi M, Mitome H, Niitsu M, Samejima K, Kawashima E, 474 Oshima T. 2005. N1-Aminopropylagmatine, a new polyamine produced as a key intermediate in 475 polyamine biosynthesis of an extreme thermophile, Thermus thermophilus. J. Biol. Chem. 476 280:30073-30082. 477
19. Oshima T, Hamasaki N, Senshu M, Kakinuma K, Kuwajima I. 1987. A new naturally 478 occurring polyamine containing a quaternary ammonium nitrogen. J. Biol. Chem. 479 262:11979-11981. 480
20. Morimoto N, Fukuda W, Nakajima N, Masuda T, Terui Y, Kanai T, Oshima T, Imanaka T, 481 Fujiwara S. 2011. Dual biosynthesis pathway for longer-chain polyamines in the 482 hyperthermophilic archaeon Thermococcus kodakarensis. J. Bacteriol. 192:4991-5001. 483
21. Terui Y, Ohnuma M, Hiraga K, Kawashima E, Oshima T. 2005. Stabilization of nucleic acids 484 by unusual polyamines produced by an extreme thermophile, Thermus thermophilus. Biochem J. 485 388:427-433. 486
22. Uzawa T, Hamasaki N, Oshima T. 1993. Effects of novel polyamines on cell-free polypeptide 487 synthesis catalyzed by Thermus thermophilus HB8 extract. J. Biochem. 114:478-486. 488
23. Uzawa T, Yamagishi A, Nishikawa K, Oshima T. 1994. Effects of unusual polyamines on 489 phenylalanyl-tRNA formation. J. Biochem. 115:830-832. 490
24. Rhee HJ, Kim EJ, Lee JK. 2007. Physiological polyamines: simple primordial stress molecules. 491 J. Cell Mol. Med. 11:685-703. 492
25. Yang J, Zhang J, Liu K, Wang Z, Liu L. 2007. Involvement of polyamines in the drought 493 resistance of rice. J. Exp. Bot. 58:1545-1555. 494
26. Imai A, Matsuyama T, Hanzawa Y, Akiyama T, Tamaoki M, Saji H, Shirano Y, Kato T, 495 Hayashi H, Shibata D, Tabata S, Komeda Y, Takahashi T. 2004. Spermidine synthase genes 496 are essential for survival of Arabidopsis. Plant Physiol. 135:1565-1573. 497
27. Ohnuma M, Ganbe T, Terui Y, Niitsu M, Sato T, Tanaka N, Tamakoshi M, Samejima K, 498 Kumasaka T, Oshima T. 2011. Crystal structures and enzymatic properties of a 499 triamine/agmatine aminopropyltransferase from Thermus thermophilus. J. Mol. Biol. 500 408:971-986. 501
28. Morikawa M, Izawa Y, Rashid N, Hoaki T, Imanaka T. 1994. Purification and 502 characterization of a thermostable thiol protease from a newly isolated hyperthermophilic 503 Pyrococcus sp. Appl. Environ. Microbiol. 60:4559-4566. 504
29. Atomi H, Fukui T, Kanai T, Morikawa M, Imanaka T. 2004. Description of Thermococcus 505 kodakaraensis sp. nov., a well studied hyperthermophilic archaeon previously reported as 506
on February 8, 2020 by guest
http://jb.asm.org/
Dow
nloaded from
![Page 30: Downloaded from //jb.asm.org/content/jb/early/2014/03/03/JB.01515... · 7 Horai 5, Naoki Umezawa5, Tsunehiko Higuchi5, Tairo Oshima6, Yuko Yoshikawa3, 8 Tadayuki Imanaka 3, and Shinsuke](https://reader033.vdocuments.net/reader033/viewer/2022041622/5e3fa36de8199a22ae2e4752/html5/thumbnails/30.jpg)
30
Pyrococcus sp. KOD1. Archaea 1:263-267. 507 30. Fujiwara S, Aki R, Yoshida M, Higashibata H, Imanaka T, Fukuda W. 2008. Expression 508
profiles and physiological roles of two types of molecular chaperonins from the hyperthermophilic 509 archaeon Thermococcus kodakarensis. Appl. Environ. Microbiol. 74:7306-7312. 510
31. Fukui T, Atomi H, Kanai T, Matsumi R, Fujiwara S, Imanaka T. 2005. Complete genome 511 sequence of the hyperthermophilic archaeon Thermococcus kodakaraensis KOD1 and comparison 512 with Pyrococcus genomes. Genome Res. 15:352-363. 513
32. Fukuda W, Morimoto N, Imanaka T, Fujiwara S. 2008. Agmatine is essential for the cell 514 growth of Thermococcus kodakaraensis. FEMS Microbiol. Lett. 287:113-120. 515
33. Ikeuchi Y, Kimura S, Numata T, Nakamura D, Yokogawa T, Ogata T, Wada T, Suzuki T. 516 2010. Agmatine-conjugated cytidine in a tRNA anticodon is essential for AUA decoding in 517 archaea. Nat. Chem. Biol. 6:277-282. 518
34. Sato T, Fukui T, Atomi H, Imanaka T. 2005. Improved and versatile transformation system 519 allowing multiple genetic manipulations of the hyperthermophilic archaeon Thermococcus 520 kodakaraensis. Appl. Environ. Microbiol. 71:3889-3899. 521
35. Oshima T, Moriya T, Terui Y. 2011. Identification, chemical synthesis, and biological functions 522 of unusual polyamines produced by extreme thermophiles. Methods Mol. Biol. 720:81-111. 523
36. Niitsu M, Sano H, Samejima K. 1992. Syntheses of Tertiary Tetraamines and Quaternary 524 Pentaamines with Three and Four Methylene Chain Units. Chem. Pharm. Bull. 40:2958-2961. 525
37. Lamarche F, Mével M, Montier T, Burel-Deschamps L, Giamarchi P, Tripier R, Delépine P, 526 Le Gall T, Cartier D, Lehn P, Jaffrès PA, Clément JC. 2007. Lipophosphoramidates as lipidic 527 part of lipospermines for gene delivery. Bioconjug. Chem. 18:1575-1582. 528
38. Bradford MM. 1976. A rapid and sensitive method for the quantitation of microgram quantities 529 of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72:248-254. 530
39. Sato T, Fukui T, Atomi H, Imanaka T. 2003. Targeted gene disruption by homologous 531 recombination in the hyperthermophilic archaeon Thermococcus kodakaraensis KOD1. J. 532 Bacteriol. 185:210-220. 533
40. Niitsu M, Samejima K, Matsuzaki S, Hamana K. 1993. Systematic analysis of naturally 534 occurring linear and branched polyamines by gas chromatography and gas 535 chromatography—mass spectrometry. J. Chromatogr. 641:115-123. 536
41. Deng H, Bloomfield VA, Benevides JM, Thomas GJ, Jr. 2000. Structural basis of 537 polyamine-DNA recognition: spermidine and spermine interactions with genomic B-DNAs of 538 different GC content probed by Raman spectroscopy. Nucleic Acids Res. 28:3379-3385. 539
42. Higashibata H, Fujiwara S, Ezaki S, Takagi M, Fukui K, Imanaka T. 2000. Effect of 540 polyamines on histone-induced DNA compaction o hyperthermophilic archaea. J. Biosci. Bioeng. 541 89:103-106. 542
on February 8, 2020 by guest
http://jb.asm.org/
Dow
nloaded from
![Page 31: Downloaded from //jb.asm.org/content/jb/early/2014/03/03/JB.01515... · 7 Horai 5, Naoki Umezawa5, Tsunehiko Higuchi5, Tairo Oshima6, Yuko Yoshikawa3, 8 Tadayuki Imanaka 3, and Shinsuke](https://reader033.vdocuments.net/reader033/viewer/2022041622/5e3fa36de8199a22ae2e4752/html5/thumbnails/31.jpg)
31
43. Tabor CW, Tabor H, Xie QW. 1986. Spermidine synthase of Escherichia coli: localization of 543 the speE gene. Proc. Natl. Acad. Sci. U. S. A. 83:6040-6044. 544
44. Knott JM, Römer P, Sumper M. 2007. Putative spermine synthases from Thalassiosira 545 pseudonana and Arabidopsis thaliana synthesize thermospermine rather than spermine. FEBS 546 Lett. 581:3081-3086. 547
45. Zhou X, Chua TK, Tkaczuk KL, Bujnicki JM, Sivaraman J. 2010. The crystal structure of 548 Escherichia coli spermidine synthase SpeE reveals a unique substrate-binding pocket. J. Struct. 549 Biol. 169:277-285. 550
46. Korolev S, Ikeguchi Y, Skarina T, Beasley S, Arrowsmith C, Edwards A, Joachimiak A, 551 Pegg AE, Savchenko A. 2002. The crystal structure of spermidine synthase with a multisubstrate 552 adduct inhibitor. Nat. Struct. Biol. 9:27-31. 553
47. Ikeguchi Y, Bewley MC, Pegg AE. 2006. Aminopropyltransferases: function, structure and 554 genetics. J. Biochem. 139:1-9. 555
48. Cacciapuoti G, Porcelli M, Moretti MA, Sorrentino F, Concilio L, Zappia V, Liu ZJ, Tempel 556 W, Schubot F, Rose JP, Wang BC, Brereton PS, Jenney FE, Adams MW. 2007. The first 557 agmatine/cadaverine aminopropyl transferase: biochemical and structural characterization of an 558 enzyme involved in polyamine biosynthesis in the hyperthermophilic archaeon Pyrococcus 559 furiosus. J. Bacteriol. 189:6057-6067. 560
49. Knott JM. 2009. Biosynthesis of long-chain polyamines by crenarchaeal polyamine synthases 561 from Hyperthermus butylicus and Pyrobaculum aerophilum. FEBS Lett. 583:3519-3524. 562
50. Akanuma S, Nakajima Y, Yokobori S, Kimura M, Nemoto N, Mase T, Miyazono K, 563 Tanokura M, Yamagishi A. 2013. Experimental evidence for the thermophilicity of ancestral life. 564 Proc. Natl. Acad. Sci. U. S. A. 110:11067-11072. 565
51. Woese CR. 1987. Bacterial evolution. Microbiol Rev. 51:221-271. 566 52. Groussin M, Gouy M. 2011. Adaptation to environmental temperature is a major determinant of 567
molecular evolutionary rates in archaea. Mol. Biol. Evol. 28:2661-2674. 568 569
Figure legends 570
Figure 1. Intracellular polyamines in T. kodakarensis analyzed by HPLC. 571
(A) Peak standard; (B) Intracellular polyamines in T. kodakarensis. The T. kodakarensis KU216 572
strain was cultivated in ASW-YT-S0 medium at 85°C until reaching mid-logarithmic phase. The 573
intracellular composition of polyamines in the trichloroacetic acid was analyzed by HPLC. 574
on February 8, 2020 by guest
http://jb.asm.org/
Dow
nloaded from
![Page 32: Downloaded from //jb.asm.org/content/jb/early/2014/03/03/JB.01515... · 7 Horai 5, Naoki Umezawa5, Tsunehiko Higuchi5, Tairo Oshima6, Yuko Yoshikawa3, 8 Tadayuki Imanaka 3, and Shinsuke](https://reader033.vdocuments.net/reader033/viewer/2022041622/5e3fa36de8199a22ae2e4752/html5/thumbnails/32.jpg)
32
Abbreviations: P1, putrescine [4]; p2, spermidine [34]; P3, N4-aminopropylspermidine [3(3)4]; 575
P4, spermine [343]; P5, N4-aminopropylspermine [3(3)43]; P6, N4-bis(aminopropyl)spermidine 576
[3(3)(3)4]; P7, Caldohexamine [33333]. The numbers in brackets represent the number of 577
methylene CH2 chain units between NH2, NH, N and N+. Asterisk shows unknown peak. 578
579
Figure 2. GC and GC-MS analyses of a T. kodakarensis. (A) GC of a T. kodakarensis KU216 580
cell extract after derivatization to heptafluorobutyl compounds. (B) GC-MS analysis of peaks 1 581
(upper panel) and 2 (lower panel), eluted at 11.5 min and 11.9 min, respectively. Polyamines 582
identified by GC-MS are indicated in abbreviated forms by the numbers of methylene chain 583
units. The molecular weights of the heptafluorobutylated polyamine, [M-F]+, [M-C3F7]+, and 584
two other fragments corresponding to major MS peaks are shown in each panel. 585
586
Figure 3. SDS-PAGE with CBB staining of purified recombinant proteins. 587
Purified recombinant proteins, TK0545, TK0548, TK0967, and TK1691 are shown in their 588
respective lanes. Lane M, molecular mass markers. 589
590
Figure 4. Aminopropyltransferase activity of recombinant proteins. 591
Enzymatic assays were performed at 70°C using purified proteins (1.6 ug) as described in 592
on February 8, 2020 by guest
http://jb.asm.org/
Dow
nloaded from
![Page 33: Downloaded from //jb.asm.org/content/jb/early/2014/03/03/JB.01515... · 7 Horai 5, Naoki Umezawa5, Tsunehiko Higuchi5, Tairo Oshima6, Yuko Yoshikawa3, 8 Tadayuki Imanaka 3, and Shinsuke](https://reader033.vdocuments.net/reader033/viewer/2022041622/5e3fa36de8199a22ae2e4752/html5/thumbnails/33.jpg)
33
Materials and methods. HPLC profiles of reaction mixtures of each purified recombinant 593
enzyme, TK0545, TK0548, TK0967, and TK1691, using substrates spermidine [34] (A) and 594
spermine [343] (B). Abbreviations: P2, spermidine [34]; P3, N4-aminopropylspermidine [3(3)4]; 595
P6, N4-bis(aminopropyl)spermidine [3(3)(3)4]; P7, caldohexamine [33333]. Asterisks indicate 596
unknown peaks. 597
598
Figure 5. Strategy for the targeted disruption of the bpsA gene by homologous 599
recombination. 600
(A) Construction of a bpsA-disruptant of T. kodakarensis. Introduction of a disruption plasmid, 601
pUD2-∆bpsA::pdaD, into the parental DAD strain resulted in the disruption of the chromosomal 602
bpsA by homologous recombination. The positions of the primer-annealing sites on PCR are 603
indicated with arrows. (B) Agarose gel electrophoresis of PCR products from genomic DNA of 604
strains DBP1 and DAD. PCR amplification, using the primers tk1691_out_1 and tk1691_out_2, 605
of fragments obtained from the 5′- and 3′- flanking regions of bpsA yielded DNA fragments of 606
3.1 kbp for DAD and 2.6 kbp for DBP1 (a). PCR fragments (1 kbp) were obtained from the 607
genomic DNA of DAD, but not of DBP1 (b). DNA size markers are shown in lane M. 608
609
on February 8, 2020 by guest
http://jb.asm.org/
Dow
nloaded from
![Page 34: Downloaded from //jb.asm.org/content/jb/early/2014/03/03/JB.01515... · 7 Horai 5, Naoki Umezawa5, Tsunehiko Higuchi5, Tairo Oshima6, Yuko Yoshikawa3, 8 Tadayuki Imanaka 3, and Shinsuke](https://reader033.vdocuments.net/reader033/viewer/2022041622/5e3fa36de8199a22ae2e4752/html5/thumbnails/34.jpg)
34
Figure 6. Representative growth phenotypes of KU216 and DBP1 strains at two different 610
temperatures. Wild type (black lines) and DBP1 (gray lines) were separately cultivated at 611
85°C (A) and 93°C (B) in an ASW-YT-S0 medium. Broken line in B represents the growth 612
curve of DBP1 strain grown in the presence of 1 mM of N4-bis(aminopropyl)spermidine 613
[3(3)(3)4]. Error bars represent standard deviations from three independent experiments. 614
615
Figure 7. Polyamine composition in T. kodakarensis DBP1 cells. T. kodakarensis strains 616
KU216 and DBP1 were separately cultivated in ASW-YT-S0 media at 85°C until 617
mid-logarithmic phase. The intracellular polyamine composition of each perchloroacetic 618
acid-precipitated extract of these cells was analyzed by HPLC. 619
620
Figure 8. Proposed pathway for the biosynthesis of polyamines in T. kodakarensis. 621
The proposed biosynthetic pathway in T. kodakarensis is shown, along with the enzymes 622
pyruvoyl-dependent arginine decarboxylase proenzyme (TK0149), agmatine ureohydrolase 623
(TK0882), pyruvoyl-dependent S-adenosylmethionine decarboxylase proenzyme (TK1592), and 624
aminopropyltransferases (TK0147 and TK1691). The solid arrows represent the major reaction 625
pathway for producing N4-bis(aminopropyl)spermidine [3(3)(3)4]. The broken arrows show a 626
pathway confirmed by in vitro studies. 627
on February 8, 2020 by guest
http://jb.asm.org/
Dow
nloaded from
![Page 35: Downloaded from //jb.asm.org/content/jb/early/2014/03/03/JB.01515... · 7 Horai 5, Naoki Umezawa5, Tsunehiko Higuchi5, Tairo Oshima6, Yuko Yoshikawa3, 8 Tadayuki Imanaka 3, and Shinsuke](https://reader033.vdocuments.net/reader033/viewer/2022041622/5e3fa36de8199a22ae2e4752/html5/thumbnails/35.jpg)
35
628
Figure 9. Phylogenetic tree of aminopropyltransferases involved in polyamine synthesis. 629
Phylogenetic analysis was performed using the neighbor-joining method of the ClustalX 630
program. A Gonnet-series protein weight matrix was used with a gap opening penalty of 10.0 631
and a gap extension penalty of 0.05. The scale bar represents one substitution per ten amino 632
acids. Bootstrap values of more than 50 to more than 100 trials are shown. BpsA orthologs are 633
shown in shaded square. Swiss-Prot accession numbers for the sequences are: Clostridium 634
thermocellum (Cthe0694: A3DDA0); Geobacillus thermodenitrificans (GTNG3350: A4ITN3); 635
Thermotoga maritima (PAPT (TM0654): Q9WZC2); Arabidopsis thaliana (At5g53120: 636
Q94BN2, At5g19530: Q9S7X6); Aspergillus nidulans (AN0687.2: G5EAU1); Escherichia coli 637
(SpeE: P09158); Pyrococcus abyssi (PYRAB01970: Q9V277); Hyperthermus butylicus 638
(Hbut0057: A2BIX4; Hbut0383: A2BJU2); Metallosphaera sedula (Msed2253: A4YIY9); 639
Ignicoccus hospitalis (Igni0633: A8AA63); Thermofilum pendens (Tpen0120: A1RWF0); 640
Aeropyrum pernix (APE0767.1: Q9YE02); Pyrobaculum arsenaticum (Pars0284: A4WHN0); P. 641
aerophilum (PAE1203: Q8ZXM4); Thermococcus kodakarensis (TK1691 (BpsA): Q5JIZ3; 642
TK0147: Q5JFG9); Pyrococcus furiosus (PF1111: Q8U1U4; ACAPT (PF0127): Q8U4G1); 643
Methanotorris igneus (Metig0730: F6BCR9_METIK); Thermotoga thermarum (Theth1513: 644
F7YTY4); Methanocaldococcus jannaschii (MJ1273, Q58669; MJ0675: Q58088); 645
on February 8, 2020 by guest
http://jb.asm.org/
Dow
nloaded from
![Page 36: Downloaded from //jb.asm.org/content/jb/early/2014/03/03/JB.01515... · 7 Horai 5, Naoki Umezawa5, Tsunehiko Higuchi5, Tairo Oshima6, Yuko Yoshikawa3, 8 Tadayuki Imanaka 3, and Shinsuke](https://reader033.vdocuments.net/reader033/viewer/2022041622/5e3fa36de8199a22ae2e4752/html5/thumbnails/36.jpg)
36
Desulfurobacterium thermolithotrophum (Dester0229: F0S1F5); Thermovirga lienii (Tlie1345: 646
G7V6G1); Aquifex aeolicus (aq1754: O67635; aq062: O66473); Thermoanaerobacter 647
tengcongensis (TTE1898: Q8R8U3); Caladicellulosiruptor bescii (Athe2198: B9MM50); 648
Rhodothermus marinus (Rmar0533: D0MEY5); Thermus thermophilus (TTHC0171: Q72L89; 649
SpeE: Q72K55); Archaeoglobus fulgidus (AF1611: O28662); Ferroglobus placidus (Ferp1880: 650
D3RZV7); Archaeoglobus profundus (Arcpr0370: D2RGL4); Methanococcus maripaludis 651
(MMP1657: Q6LWQ1); Methanococcus aeolicus (Maeo0142: A6UTB2); Rhodopseudomonas 652
palustris (RPB2044: Q2IYF9); Clostridium cellulovorans (Clocel1945: D9SLV8); and Bacillus 653
cereus (IGE05445: J9BN53). 654
655 on February 8, 2020 by guest
http://jb.asm.org/
Dow
nloaded from
![Page 37: Downloaded from //jb.asm.org/content/jb/early/2014/03/03/JB.01515... · 7 Horai 5, Naoki Umezawa5, Tsunehiko Higuchi5, Tairo Oshima6, Yuko Yoshikawa3, 8 Tadayuki Imanaka 3, and Shinsuke](https://reader033.vdocuments.net/reader033/viewer/2022041622/5e3fa36de8199a22ae2e4752/html5/thumbnails/37.jpg)
100
50
0
Sig
na
l in
ten
sity
100
50
00 20 404 8 12 16 24 28 32 36
Retention time [min]
P7
P6
P5P4
P3P2
P1
P6
P7P3
*
P2
A
B
Fig. 1. Okada et al.
Sig
na
l in
ten
sity
P4
on February 8, 2020 by guest
http://jb.asm.org/
Dow
nloaded from
![Page 38: Downloaded from //jb.asm.org/content/jb/early/2014/03/03/JB.01515... · 7 Horai 5, Naoki Umezawa5, Tsunehiko Higuchi5, Tairo Oshima6, Yuko Yoshikawa3, 8 Tadayuki Imanaka 3, and Shinsuke](https://reader033.vdocuments.net/reader033/viewer/2022041622/5e3fa36de8199a22ae2e4752/html5/thumbnails/38.jpg)
100
50
00 10 202 4 6 8 12 14 16 18
Retention time [min]S
ign
al in
ten
sity
0 500 1000100 200 300 400 600 700 800 900
[m/z]
50
100
0
Sig
na
l in
ten
sity
550
536
771
254
226
0 500 1000100 200 300 400 600 700 800 900
[m/z]
50
100
0
Sig
na
l in
ten
sity
757
536254
226
Peak 1
Peak 1
Peak 2
Peak 2
621
NHCOC3F
7
C3F
7CONH
C3F
7CONH N
NHCOC3F
7
C3F
7CONH
C3F
7CONH N
536
550 536
[C3F
7CONH(CH
2)
3]+: 254
[C3F
7CONHCH
2]+: 226
[M-F]+: 771[M-C
3F
7]+: 621
[M]+: 790
[C3F
7CONH(CH
2)
3]+: 254
[C3F
7CONHCH
2]+: 226
[M-F]+: 757[M-C
3F
7]+: 607
[M]+: 776
607
3(3)3
3(3)4
Fig. 2. Okada et al.
A
B
on February 8, 2020 by guest
http://jb.asm.org/
Dow
nloaded from
![Page 39: Downloaded from //jb.asm.org/content/jb/early/2014/03/03/JB.01515... · 7 Horai 5, Naoki Umezawa5, Tsunehiko Higuchi5, Tairo Oshima6, Yuko Yoshikawa3, 8 Tadayuki Imanaka 3, and Shinsuke](https://reader033.vdocuments.net/reader033/viewer/2022041622/5e3fa36de8199a22ae2e4752/html5/thumbnails/39.jpg)
M TK05
45TK
0548
TK09
67TK
1691
45
97
66
30
(kDa)
20
14
Fig. 3. Okada et al.
on February 8, 2020 by guest
http://jb.asm.org/
Dow
nloaded from
![Page 40: Downloaded from //jb.asm.org/content/jb/early/2014/03/03/JB.01515... · 7 Horai 5, Naoki Umezawa5, Tsunehiko Higuchi5, Tairo Oshima6, Yuko Yoshikawa3, 8 Tadayuki Imanaka 3, and Shinsuke](https://reader033.vdocuments.net/reader033/viewer/2022041622/5e3fa36de8199a22ae2e4752/html5/thumbnails/40.jpg)
0 20 404 8 12 16 24 28 32 36
Retention time [min]
A
Sig
na
l in
ten
sity
0 20 404 8 12 16 24 28 32 36
P7P5P6
P3
*
P2
*
*
*
P4
100
50
0100
50
0100
50
0100
50
0
TK0545 TK0545
TK0548 TK0548
TK0967 TK0967
TK1691 TK1691
B
Fig. 4. Okada et al.
P7
P7
P7P7
P7
P7
P7
P4
P4
P4
P2
P2
P2
on February 8, 2020 by guest
http://jb.asm.org/
Dow
nloaded from
![Page 41: Downloaded from //jb.asm.org/content/jb/early/2014/03/03/JB.01515... · 7 Horai 5, Naoki Umezawa5, Tsunehiko Higuchi5, Tairo Oshima6, Yuko Yoshikawa3, 8 Tadayuki Imanaka 3, and Shinsuke](https://reader033.vdocuments.net/reader033/viewer/2022041622/5e3fa36de8199a22ae2e4752/html5/thumbnails/41.jpg)
pUD2-∆bpsA::pdaD
DAD genome (DAD: ∆pyrF, ∆pdaD)
500 bp
A B
M(kbp)
10 -7 -5 -4 -3 -
2 -
1.5 -
1 -
TK1691_out_2 TK1691_out_ 3
TK1691_in_ 1 TK1691_in_ 2
bpsA
bpsA
pyrF
PpyrF
pyrF
Single crossover insertion
bpsA
pyrF
bpsA DAD genome
DBP1 genome
pop-out recombination
pdaD
PpdaD
pdaD
Selection: agmatine prototrophy
Selection: 5-FOA resistance
pdaD
pdaD
0.7 -
(a) (b)
Fig. 5. Okada et al.
on February 8, 2020 by guest
http://jb.asm.org/
Dow
nloaded from
![Page 42: Downloaded from //jb.asm.org/content/jb/early/2014/03/03/JB.01515... · 7 Horai 5, Naoki Umezawa5, Tsunehiko Higuchi5, Tairo Oshima6, Yuko Yoshikawa3, 8 Tadayuki Imanaka 3, and Shinsuke](https://reader033.vdocuments.net/reader033/viewer/2022041622/5e3fa36de8199a22ae2e4752/html5/thumbnails/42.jpg)
0.01
0.1
1
0 4 8 12 16 20 24 28 32
0.01
0.1
1
0 2 4 6 8 10 12 14 16 18 20 22
Time [h]
OD
66
0O
D6
60
A
B
Fig. 6. Okada et al.
on February 8, 2020 by guest
http://jb.asm.org/
Dow
nloaded from
![Page 43: Downloaded from //jb.asm.org/content/jb/early/2014/03/03/JB.01515... · 7 Horai 5, Naoki Umezawa5, Tsunehiko Higuchi5, Tairo Oshima6, Yuko Yoshikawa3, 8 Tadayuki Imanaka 3, and Shinsuke](https://reader033.vdocuments.net/reader033/viewer/2022041622/5e3fa36de8199a22ae2e4752/html5/thumbnails/43.jpg)
500
0
Sig
na
l in
ten
sity
500
250
0
0 20 404 8 12 16 24 28 32 36
Retention time [min]
P7
P2
A
B
Fig. 7. Okada et al.
Sig
na
l in
ten
sity
P7P4
P2
P4
P6
P3
250
on February 8, 2020 by guest
http://jb.asm.org/
Dow
nloaded from
![Page 44: Downloaded from //jb.asm.org/content/jb/early/2014/03/03/JB.01515... · 7 Horai 5, Naoki Umezawa5, Tsunehiko Higuchi5, Tairo Oshima6, Yuko Yoshikawa3, 8 Tadayuki Imanaka 3, and Shinsuke](https://reader033.vdocuments.net/reader033/viewer/2022041622/5e3fa36de8199a22ae2e4752/html5/thumbnails/44.jpg)
Arginine
Agmatine
N1-Aminopropylagmatine
Spermidine [34]
N4-Aminopropylspermidine [3(3)4]
N4-Bis(aminopropyl)spermidine [3(3)(3)4]
N4-Aminopropylspermine [3(3)43]
Spermine [343]
TK1691
TK1691
TK1691
TK0147
TK0882
TK0149
TK0147
TK1592
Decarboxylated S-Adenosylmethionine (dcSAM)
S-Adenosylmethionine
Methylthioadenosine
CO2
H2O
Urea
dcSAM
Methylthioadenosine
dcSAM
Methylthioadenosine
dcSAM
Methylthioadenosine
dcSAM
Methylthioadenosine
CO2
Fig. 8. Okada et al.
COOH
on February 8, 2020 by guest
http://jb.asm.org/
Dow
nloaded from
![Page 45: Downloaded from //jb.asm.org/content/jb/early/2014/03/03/JB.01515... · 7 Horai 5, Naoki Umezawa5, Tsunehiko Higuchi5, Tairo Oshima6, Yuko Yoshikawa3, 8 Tadayuki Imanaka 3, and Shinsuke](https://reader033.vdocuments.net/reader033/viewer/2022041622/5e3fa36de8199a22ae2e4752/html5/thumbnails/45.jpg)
*Clostridium thermocellum (Cthe0694)
*Geobacillus thermodenitrificans (GTNG3350)
*Aquifex aeolicus (aq062)
Arabidopsis thaliana (At5g53120)
Aspergillus nidulans (AN0687.2)
*Thermofilum pendens (Tpen0120)
*Ignicoccus hospitalis (Igni0633)
*Metallosphaera sedula (Msed2253)
*Hyperthermus butylicus (Hbut0383)
*Aeropyrum pernix (APE0767.1)
Escherichia coli (SpeE)
*Pyrococcus abyssi (PYRAB01970)
*Pyrococcus furiosus (PF0127)
*Pyrobaculum arsenaticum (Pars0284)
*Thermococcus kodakarensis (TK0147)
Arabidopsis thaliana (At5g19530)
*Hyperthermus butylicus (Hbut0057)
*Thermotoga maritima (PAPT)
*Pyrobaculum aerophilum (PAE1203)
*Thermus thermophilus (SpeE)
*Archaeoglobus profundus (Arcpr0370)
*Ferroglobus placidus (Ferp1880)
*Archaeoglobus fulgidus (AF1611)
*Thermus thermophilus (TTHC0171)
*Rhodothermus marinus (Rmar0533)
*Thermococcus kodakarensis (TK1691)
*Pyrococcus furiosus (PF1111)
*Methanotorris igneus (Metig0730)
*Thermotoga thermarum (Theth1513)
*Methanocaldococcus jannaschii (MJ1273)
*Desulfurobacterium thermolithotrophum (Dester0229)
*Thermovirga lienii (Tlie1345)
*Aquifex aeolicus (aq1754)
*Thermoanaerobacter tengcongensis (TTE1898)
*Caladicellulosiruptor bescii (Athe2198)
Bacillus cereus (IGE05445)
Clostridium cellulovorans (Clocel1945)
Rhodopseudomonas palustris (RPB2044)
*Methanocaldococcus jannaschii (MJ0675)
Methanococcus aeolicus (Maeo0142)
Methanococcus maripaludis (MMP1657)
Bra
nch
ed
po
lya
min
e s
yn
tha
se
-gro
up
(Gro
up
A)
Sp
erm
ine
/sp
erm
idin
e s
yn
tha
se
-gro
up
(G
rou
p B
)
Un
kn
ow
n
(Gro
up
D)
Th
erm
osp
erm
ine
syn
tha
se
-gro
up
(G
rou
p C
)
0.1
10078
79
59
10067
64
97100
95
52
100100
10060
62
100
6082
93
99 100
100100
69100
100
85100
51
72
Fig. 9. Okada et al.
on February 8, 2020 by guest
http://jb.asm.org/
Dow
nloaded from
![Page 46: Downloaded from //jb.asm.org/content/jb/early/2014/03/03/JB.01515... · 7 Horai 5, Naoki Umezawa5, Tsunehiko Higuchi5, Tairo Oshima6, Yuko Yoshikawa3, 8 Tadayuki Imanaka 3, and Shinsuke](https://reader033.vdocuments.net/reader033/viewer/2022041622/5e3fa36de8199a22ae2e4752/html5/thumbnails/46.jpg)
1
Table 1. Strains and primers used in this study. 1 2 Strain or Primer Relevant characteristic(s) or Sequence (5′ to 3′) Source or reference
Strains
E. coli
DH5α F-, Φ80dlacZΔM15, Δ(lacZYA-argF)U169, deoR, recA1, endA1,
hsdR17(rK-, mK+), phoA, supE44, λ-, thi-1, gyrA96, relA1
Stratagene
BL21-CodonPlus(DE3)
-RIL
E. coli B F- ompT hsdS(rB-mB
-) dcm+ Tetr gal λ(DE3) endA Hte [argU
ileY leuW Camr]
Agilent technologies
T. kodakaraensis
KU216 ∆pyrF (34)
DAD ∆pdaD, ∆pyrF (32)
DBP1 ∆pdaD, ∆bpsA::pdaD, ∆pyrF This study
Primers
tk0545-Fw GGAAAACCATATGATGGCTGGAAAGGTCAG This study
tk0545-Rv GGAATTCTCAGAAGACGTTTACCTTGTCCT This study
tk0548-Fw GGAAAACCATATGATGGCGCTGAGCGACAG This study
tk0548-Rv GGAATTCTTAAACGAGCTTTTTCTCCTTCA This study
tk0967-Fw AAAAAAACATATGATGAGGATCGAAAGGCTGAA This study
tk0967-Rv AGAATTCTCAAATAAGCTCCCTCTCCG This study
tk1691-Fw AAAAAAACATATGATGAGGGAGATAATTGAGAG This study
tk1691-Rv AGAATTCTCAGGTAGTCGAGCTCTCCT This study
tk1691-up1000-Fw TTCCCCTTCTCATCGACATC This study
tk1691-down1000-Rv AATCTAGAACGTCTCCCAGATCAGC This study
tkpdaD-Fw1 AAGGATCCCGAGAATGATGTTTTAGC This study
tkpdaD-Rv2 GACTAGTTCAGTAGGGGAACATGAC This study
inv-TK1691-Fw GACTAGTGCCTTTCTGATTTATTTT This study
inv-TK1691-Rv AAGGATCCATCTCACACCTCCAGAAG This study
tk1691_out_1 GTTCTTATTTTTTTGTTTGT This study
tk1691_out_2 AAAAAAAATTAATTAGCCACGCACCCCCTAGGG This study
tk1691_in_1 GAGGCTCGCGAAGAAGAAGG This study
tk1691_in_1 ACGAATATCGCGCCCTCCTC This study
Underlined sequences indicate restriction enzyme sites. 3 4
on February 8, 2020 by guest
http://jb.asm.org/
Dow
nloaded from