(CANCER RESEARCH57. 4177—4182,October 1, 1997]

Advances in Brief

Human Mitogen-activated Protein Kinase Kinase 4 as a CandidateTumor Suppressor

David H-F. 2 William L. Perry ifi,' James K. Hogan, Michelle Baumgard, Russell Bell, Simm Berry,

ThaylonDavis,David Frank, CherylFrye, ThomasHattier,Rong Hu, SrikanthJammulapati,TeresaJanecki,AmberLeavitt,JeffreyT. Mitchell,RalphPero, David Sexton,MarianneSchroeder,Pi-HsiaSu, Brad Swedlund,John M. KyJ'IakIS,JosephAvruch,Paul Bartel,AlexanderK. C. Wong,ArnoldOliphant,Alun Thomas,Mark H. Skolnick,and Sean V. TavtigianMyriadGenetics,Inc.,SaltLakeCity, Utah84108[D.H-F.T., W.LP.,M.B.,R.B.,S.B., T.D.,D.F., CF., T.H., RH., S.f., T.J..A.L,J.T.M., R.P., D.S..M.S., P-H.S.,B. S., P. B., A. K. C. W., A. 0., A. T., M. H. S., S. V. Ti, and Department of Medicine, MassachusettsGeneral Hospital, Diabetes Unit and Medical Services,and Harvard MedicalSchool, Boston Massachusetts 02129 Ii. K. H., J. M. K., J. A.]

Abstract

Mitogen-activated protein kinases function in signal transduction path.ways that are involved in controffing key cellular processes in manyorganisms. A mammalian member of this kinase family, MKK4/JNKK1/SEK1, has been reported to link upstream MEKK1 to downstream stressactivated protein kinase/JNK1 and p38 mitogen-activated protein kinase.This mitogen-activated protein kinase pathway has been implicated in thesignal transduction of cytokine- and stress.induced apoptosis in a varietyof cell types. Here, we report that two human tumor cell lines, derivedfrom pancreatic carcinoma and lung carcinoma, harbor homozygousdeletions that eliminate coding portions of the MKK4 locus at l7p, locatedapproximately 10 cM centromeric ofp53. In addition, in a set ofSS human

cancer cell lines prescreened for loss of heterozygosity, we detected twononsense and three missense sequence variants of MKK4 in cancer celllines derived from human pancreatic, breast, colon, and testis cells. Invitro biochemical assays revealed that, when stimulated by MEKK1, fourof the five altered MKK4 proteins lacked the ability to phosphorylatestress-activated protein kinase. Thus, the incidence of coding mutations ofMKK4 in the set ofcell lines is 6 of213 (—3%).These findings suggest thatMKK4 may function as a suppressor of tumorigenesis or metastasis incertain types of cells.

Introduction

The inactivation of tumor suppressor genes is a hallmark of cancerprogression. A cell takes a genetic step toward oncogenic transformation when one allele of a tumor suppressor gene is inactivated dueto inheritance of a germ-line lesion or acquisition of a somaticmutation. Inactivation of the other allele of the gene usually involvesa somatic micromutation or chromosomal alleic deletion that resultsin LOH.3 Another mechanism by which tumor suppressor genes areinactivated is homozygous deletion. Whereas LOH events commonlyinvolve chromosomal deletions spanning many megabases of DNA,homozygous deletions are relatively small in size, probably due to thepresence of essential genes in their proximity.

The identification of tumor suppressor genes has been facilitated bythe discovery of homozygous deletions present within the genomes ofcancer cell lines and xenografts; examples include P16 (1), BRCA2 (2,

Received 717/97;accepted 8/13/97.The costs of publication of this article were defrayed in part by the payment of page

charges. This article must therefore be hereby marked advertisement in accordance with18 U.S.C. Section 1734 solely to indicate this fact.

I These authors are equal contributors.

2 To whom requests for reprints should be addressed, at Myriad Genetic, Inc., 390

Wakara Way, Salt Lake City, UT 84108. Phone: (801) 584-3676; Fax: (801) 584-3650;E-mail: tengd@myriad.com.

3 The abbreviations used are: LOH, loss of heterozygosity; STS, sequence-tagged site;

HA, hemagglutinin; SAPK, stress-activated protein kinase; BAC, bacterial artificialchromosome; WT, wild type; MAPK(KK), mitogen-activated protein kinase (kinasekhiase).

3), and MMACIIPTEN (4, 5). In the case of MMACJ, Steck et al. (4)and Li et a!. (5) detected multiple homozygous deletion events inhuman cell lines and xenografts derived from glioblastomas andbreast and prostate cancers within the 10q23 region. In contrast, thepath leading to the discovery ofBRCA2 was guided by the observationof Wooster et a!. (2) and Schutte et a!. (6) of a single —250—300-kbhomozygous deletion in a pancreatic xenograft. No other homozygousdeletions affecting BRCA2 have been reported in any other tumorxenografts, cell lines, or specimens to date.

Given the prior success of localizing tumor suppressor genes bydelineating deletion breakpoints, we initiated a search for novel homozygous deletion events in human cancer cell lines. In this study, wereport the detection of a homozygous deletion in a pancreatic tumor

cell line when we used the D17S969 marker. D17S969 is locatedapproximately 10 cM centromeric of the P53 locus, in a regiondisplaying a high incidence of LOH in multiple cancers (7). Using thisSTS as an entry point, we performed a positional cloning effort thatlead to the identification of three candidate genes, one of which wasMKK4 (8, 9). Subsequent analyzes revealed that of the 213 tumor celllines screened, seven displayed alterations in MKK4.

Materials and Methods

Homozygous Deletion Search. Total genomic DNA was purified fromcancer cell lines using the Easy-DNA kit (Invitrogen). Using the cell lineDNAs as templates, 20 p3 of PCR amplifications were performed with either

TaqPlus (Stratagene) or AmpliTaq Gold (Perkin-Elmer) and subsequentlyfractionated on 2—3%Nu Sieve (FMC Bioproducts) agarose gels. In general,the PCR conditions used were an initial denaturation step at 95°Cfor 1 mm(TaqPlus) or 10 mm (Amplilaq Gold), followed by 35 cycles of denaturationat 96°C (12 s), annealing at 55°C (15 s), and extension at 72°C (45 s). The

homozygous deletion in ASPC-l observed with D17S969 was confirmed byPCR amplifications using several flanking 51St, one of which was D17S969Ashown in Fig. 1A.The sequences ofthe primer pair of the D17S969ASTS (173bp amplicon) are 5'-GAGCCTCAATFCCAGTITFCC and 5'-TATGATG

CAGCACTGCAGTF.Physical Mapping. BAC DNA was purified and directly sequenced as

described (10). DNA sequences at the SP6 and Ti ends of isolated BAC cloneswere used to develop STSs that were used for mapping. To obtain greater than90% sequence coverage of BACs 9512 and 66111, plasmid sublibraries gencrated from these clones were sequenced using ABI 377 machines. Thesequence data obtained were assembled into contiguous segments using Acem

bly version 4.3 (U. Sauvage, D. Thierry-Mieg, and J. Thierry-Mieg; CentreNational de la Recherche Scientifique, France). The generation of cDNAs andhybrid selection were done as described previously (10). Hybrid selection was

performed on a pool of cDNAs from normal human lymphocytes, pancreas,prostate, thymus, and fetal brain tissues.

LOll Studies. LOH analysis was performedusing fluorescently taggedshort tandem repeat markers as described previously (1 1). By radiation hybrid

4177

on April 22, 2021. © 1997 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

MKK4 MUTATIONS IN HUMAN CANCER CELL LINES

A

B

MKK4Exon B Exon C Exon D Exon E

II 1 1 II7 8 91011121314151617181920212223

V———— ——

50 kbDl 7S969

I

Fig. 1. Physical map of the genomic area including DI 7S969 and evidence of a homozygous ddetion in a tumor cell line. A, detection of a homozygous deletion in the pancreatic cancer cell line,ASPC-l . Shown is the D17S969A STS (see “Materials and Methods―)when it was used to examinegenomic DNAs from the following: Lane 2, controlhuman (Promega); Lane 3, ASPC-l; Lane 4, COLO587, a pancreatic cancer cell line; Lane 5. HPAF-II,a pancreatic cancer cell line; and Lane 6. negativecontrol (tacking template). In addition, mutationscreening primers designed to amplify exons B, C,D, and E of the MKK4gene (Table I) were used toexamine genomic DNA from ASPC-l (Lanes 7, 11,16, and 20), CAPAN-l (Lanes 8, /2, /7, and 21),control human (Promega; Lanes 9, 13, 18, and 22),and a control without template (Lanes 10, 14, 19,and 23). Lanes I and 15 show a l00-bp DNA ladder(Life Technologies, Inc.). B, physical map of theD17S969 genomic region. Shown are the BACclones and candidate genes isolated for this region.Sizes of the BAC clones, as well as their corresponding T7 (arrowhead) and SP6 ends, are mdicated. The three candidate genes were localized onBACs, and their directions of transcription weredetermined by STS mapping and DNA sequencing.The dashed line in the 5' portion of CG3 indicatesthat the gene extends upstream into a genomic areanot characterized in this study. The extent of thehomozygous deletion in the ASPC-l pancreatic carcinoma cell line is shown.

BAC clones

1<AASPC-1.@@1*'@ 19512 I 1 63G5

162kb

@ 55M111

160kb@ -- 661j11147G20

73kb

c@andldategenes

mapping, we determined that D17S786, D17S952, D17S520, and D17S969

were 74, 8 1, 89, and 94 cR, respectively, from the p telomere of chromosome

17. Two of the cancer cell lines examined, breast BT-474 and thyroid SW579,

were heterozygous for D17S786 and appeared to be hemizygous for D17S952,

D17S969, and D17S520, suggesting that they had a LOH breakpoint between

the P53 and MKK4 loci. To test this inference, we used four additional

polymorphic markers (D17S503, D17S945, D17S1159, and Dl7S947) to cx

amine the two cell lines. Based on the radiation hybrid mapping, the markers

were placed along Yip in the following order: telomere-P53-D17S503-D17S786-D17S952-D17S945-D17S520-D17S1159-D17S969-D17S947-cen

tromere. Both BT-474 and SW579 appeared to be heterozygous from D17S503to D17S945 and hemizygous from D17S520 to centromere, consistent with anLOH breakpoint occurring between the P53 and MKK4 loci.

Mutation Screening. Using genomic DNAs of cell lines as templates,nested PCR amplifications were performed to generate amplicons of thecandidate genes that were screened for mutations. The primers listed in Table1 were used to produce the amplicons of MKK4. Using the outer FA-RP primerpair, 1—10ng of genomic DNA were subjected to a 25-cycle primary amplification, after which the PCR products were diluted 60-fold and reamplifiedusing nested M13-tailed FB-RQ primers for another 22—25cycles; eitherTaqPlus or Amplilaq Gold was used in the reactions. The PCR conditionsused were an initial denaturation step at 95°Cfor 1 mm (TaqPlus) or 10 mm(AmpliTaq Gold), followed by cycles ofdenaturation at 96°C(12 s), annealing

at 55°C(15 s), and extension at 72°C(60 s). DNA sequencing and mutationscreening were performed as described previously (1 1) with the followingmodification: Ml 3 forward or reverse fluorescent energy transfer dye-labeled

primers were used in the sequencing reactions. Greater than 95% double

stranded coverage of the coding sequence of MKK4 was obtained for every

tumor cell line screened. All detected mutations were confirmed by sequencinga newly amplified product.

In Vitro Assays of MKK4 Activity. The five variants of MKK4 weregenerated by a PCR-based mutagenesis strategy using reverse-transcribed

cDNA from normal pancreatic tissue as template. The HA epitope was designed into the following PCR primer, with Hindill and SacII sites at the 5'

end, such that the tag would be fused in-frame to the NH2 terminus of theMKK4 polypeptide: 5'AAGCTfCCGCGGGCCACCATGTATCCATACGATGTfCCAGATFACGCAGCGGCTCCGAGCCCGA (HA-MKK4.Fl primer). The downstream primer used in combination with HA-MKK4.Fl toamplify the entire coding region of MKK4, along with an XbaI site present incDNA sequence 3 â€of the translational stop codon, was S‘-TTDTTACGTCTTGCTTCCTCTC (MKK4.R50 primer). The amplified coding fragment ofMKK4 was digested with Hindill and XbaI, cloned into pcDNA3 (Invitrogen),

and transformed into DH5a cells. These plasmid constructs in these cells wereisolated using the Maxi-DNA preparation protocols from Qiagen and then

sequenced to confirm the presence of the desired alteration in MKK4 andabsence of any other sequence artifacts.

Using the calcium phosphate precipitation method, 5 X 106 human kidney293 cells were cotransfected with 3 @xgof pcDNA3-Flag-MEKKli@ (12) and15 @xgofpcDNA-HA-MKK4 construct or pcDNA3 vector and then cultured inDMEM containing 10% FCS on a 10-cm2plate. After 32 h, the cells wereharvested, resuspended in ice-cold PBS, and centrifuged at@1000 X g for 5 mmat 4°C.The pelleted cells were lysed in I .5 ml of ice cold buffer I [50 mMTris-HC1 (pH 7.4), 150 mM NaCl, 10% glycerol, I% Triton X-lOO, 5 mMEDTA, 1 mM Dli', 50 mM f3-glycerophosphate, 1 mrviEGTA, and Completeprotease inhibitors (Boehringer Mannheim)] per six 10-cm2 plates and thencentrifuged at 15,000 x g for 10 mm. Fifteen @xlaliquots of the supernatant and

4178

D17S969AI

1 2 34 5 6

I@. ..

.@ 162kbi -@ 200@cb

121M18 142E@7@ 86A8@95kb@ 95k'b 72kb I

CG3 I CG1I )@ I

on April 22, 2021. © 1997 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

Table 1 Primers usedfor mutation screening the MKK4geneElevenexons, shown as exons A—K,were defined for this gene. Exon A contains the 5-end of the MKK4 cDNAs reported by Derijard ci al. (8) and Lin ci al. (9). AmpliconKcovers

the 5' splice-junction, coding sequence, and translational stop codon of the last exon of thegene.Exon

Primer NucleotidesequenceA

CG2exA.FAGCTGTCTGCTTCACAGGTCGCCG2exA.RPCGGGGAGGGAGAGAGGGAGACG2exA

.FBGTTTTCCCAGTCACGACGCGGTTCTGCAGCTCAGCATCTCG2exA

.RQAGGAAACAGCTATGACCATCGGCTGCCGTGGCTTCCTCAB

CG2exB.FATTGAGAAATTCCTCATTGCCCG2exB.RPCAATATTCCCAGAGAGTTTACG2exB

.FBGTTTTCCCAGTCACGACGTTGCCTTTTGGTGTGACTTTCG2exB

. RQAGGAAACAGCTATGACCATACTGACATCTCATAATTGGACCG2exC.FACCTGGAGGTCAGACTATTTTCG2exC

.RPAAAGGAGTTGGAGAAACAATCG2exC

.FBGTTTTCCCAGTCACGACGAACATTTTTCCCACACATTACG2exC

. RQAGGWCAGCTATGACCATAGGAACACAACAACAGTGGTDCG2exD . FACTTGTGAAGTATAAGGAAAGATGCG2exD

.RPTGGTTAAACACTAAGATACTGAGCG2exD .FBGTTTTCCCAGTCACGACGTCGTAACGGTTTTTCTCTACCACG2

exD . RQAGGAAACAGCTATGACCATAAGAATAGAATCGAATCCTGCCECG2exE . FATGGGGAAAATTGGCTTTAACTACCG2exE

.RPCGAGACCATTATGACCTATTGTGCG2exE

.FBGTTTTCCCAGTCACGACGCTAGTTTGACATTTGAAATAAGCACG2exE

.RQAGGAAACAGCTATGACCATCAGAAGTGACTTTGTCTCTGGTFCG2exF.FACG2exF

.RPCCAGAGAGAAAAATAGCAGTCG2exF

.FBGTTTTCCCAGTCACGACGCTTGTGATAAACTGTTGTGCCG2exF

.RQAGGAAACAGCTATGACCATCACTGTAATTTTCAATAACCGCG2exG.FATCTGAATTTAAGGACTTGACCG2exG

.RPAGCAAAGTTTCATGGAGAGGCG2exG

.FBGTTTTCCCAGTCACGACGCTTAAAGTGAAGCCTTATGTCG2exG . RQAGGAAACAGCTATGACCATGGTAAAACCGTATGACTAATGH

CG2exH .FACG2exH.RPAGCAACTTAAAACCATAGTGCG2exH

.FBGTTTTCCCAGTCACGACGGTTGCTTCCATTTGCCTATTCG2

exH . RQAGGAAACAGCTATGACCATCGAACGGGGAAGTCTGATTAICG2exI.FACG2exI

.RPGCTTGAAAAGTAGGGTGATGCG2exI

.FEGTTTTCCCAGTCACGACGTTTTGCTTGTAGTTTAGATTTCG2exI

.RQAGGAAACAGCTATGACCATTCCTCCATGTAAAGTACCAAJCG2exJ.FAGGCTGTCTGCGTTGTTACTTCG2exJ

. RPTAACAAAAAACACTCAATAAACG2exJ

.FBGTTTTCCCAGTCACGACGTGTGAAAAGAAAAATACTTAGGCG2exJ

.RQAGGAAACAGCTATGACCATGTTTGTTTATGACAGAGAGGKCG2exK.FACG2exK

.RPGGGAAGGGAAAGAGATTCGGCG2exK

.FBGTTTTCCCAGTCACGACGTTGGAAAATGTTCAGTTTGGCG2exK

.RQ AGGAAACAGCTATGACCATCGTTCTAGGTGACAGGAGTA

MKK4 MUTATIONS IN HUMAN CANCER CELL LINES

pellet fractions were mixed with 15 @lof Laemmli SDS sample buffer, run ona 15% SDS-polyacrylamide gel, and transferred onto Immobilon-P membrane(Millipore). To detect HA-tagged MKK4, these filters were blocked, probedwith mouse anti-HA antibodies (Boehringer Mannheim), washed, and probedwith peroxidase-labeled goat anti-mouse IgG antibodies (Amersham). Afterextensive washing, the blots were developed using enhanced chemiluminescence (ECL kit; Amersham). To detect Flag-tagged MEKK1& Western blots

were performed as above except that anti-Flag antibodies (Kodak) and peroxidase-labeled goat anti-rabbit IgG antibodies (Amersham) were used.

For the kinase assays, soluble cell extracts were normalized to within a3-fold range for MKK4 content prior to immunoprecipitation. One ml ofnormalized lysate was incubated with 5 p.1 of anti-HA ascites and 20 @lofprotein A/G Sepharose for 2 h at 4°C.Beads were subsequently washed oncein buffer I, once in buffer I with 0.5 M NaC1, twice in buffer I with 1 M NaCl,and finally twice in buffer II [25 msi Tris-HC1 (pH 7.4), 0. 1 mM EDTA, 10 msiMgCl2, and 1 mr@iDli']. Twenty @gof kinase dead SAPK-@3K55R (13) werethen added to each aliquot of beads, and the final volume was made to 100 @lwith buffer H containing 100 @tMAlP (—2000cpm 32Pper pmol AlP). Tubeswere incubated at 30°Cfor 30 mm and stopped with 100 @lof Laemmli SDSsample buffer. Thirty @&lof each reaction were fractionated on a 15% SDSpolyacrylamide gel, transferred onto Immobilon-P membrane, and autoradiographed. The SAPK bands were subsequently excised, and 32Pincorporationwas quantitated by scintillation counting.

Results

Using the D17S969 marker, we detected a homozygous deletion ina pancreatic carcinoma cell line, ASPC-l (Fig. lA). Beginning at

D17S969, we assembled a contig of BAC clones that spanned theASPC-l deletion (Fig. lB). STS mapping revealed that the homozygous deletion minimally extended from the T7 STS of BAC 86A8 toD17S969,withanestimatedsizeof200kb,andwasentirelycontamed within two Bacs: 9512 and 66111.

To identify genes that were located within the genomic regionaround D17S969, we used DNA from BACs 9512 and 661 11 to hybridselect from a pool of cDNAs prepared from multiple normal tissues.Genomic sequences generated from BACs 9512 and 6611 1 were usedto identify hybrid selected clones that represented multi-exon cDNAs,as well as to screen sequence databases for homologous genes. Threecandidate genes spanned the deleted region of ASPC-l: CG1, whichencodes a novel zinc-finger protein;4 CG2, which encodes MKK4(Refs. 8 and 9; GenBank accession nos. L36870 and Ul7743); andCG3, which codes for a protein homologous to sea urchin axonemaldynein heavy chain subunit (GenBank accession nos. X59603 andX99947). Using STSs developed from intron sequences of thesecandidate genes, we determined that CG1 was completely deleted inASPC-1, whereas only the 5' region of CG2 and the 3' region of CG3were absent in that cell line. Specifically, we found that the threeexons on the 5' end of the MKK4 gene, designated exons A, B, and C,were homozygously deleted in ASPC-l (Fig. lA). Comparison of thecDNA sequence of MKK4 with genomic sequences from BACs 9512

4 Unpublished data.

4179

on April 22, 2021. © 1997 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

Table 2 LOH analyses of cancer cell linesThe polymorphic markers used to examine LOH were D17S786, D17S952, D17S969,

and Dl 7S520; these markers had heterozygosity indices of 0.78, 0.69, 0.71, and 0.79,respectively. LOH was assessed from the combined apparent hemizygosity of these fourshort tandem repeat markers. The probability that a tumor cell line does not have LOH inthis region and is homozygous for all four markers is approximately 0.0042. Thepercentage of LOH was only calculated for cancer types with a sample size greater than10. The number of cell lines of each cancer type screened for candidate gene mutationsby sequencing is shown. The two cell lines, ASPC-l and NCI-H774, with homozygousdeletions affecting MKK4 were not sequenced.

Type of cell line LOH/screened Sequenced

Astrocytoma 2/3 2Bladder 5/10 3Breast 18/22 (82%) 17Cecum 2/7 2Colon 13/25 (52%) 12Duodenum 0/1 0Glioma 12/22 (55%) 10Lung 10/26 (38%) 7Leukemia/Lymphoma 9/28 (32%) 8Melanoma 7/24 (29%) 4Neuroblastoma 2/9 2Ovarian 4/8 4Pancreatic 12/13 (92%) 11Prostate 2/4 2Renal 0/3 0Submaxillary 0/I 0Testis 3/5 3Thyroid 1/2 1Total 102/213 (48%) 88

and 6611 1 revealed that the coding sequence of MKK4 was entirelywithin 6611 1, and that the gene was comprised of at least 11 exons;exon A was located in a CpG island.

The initial observation of a homozygous deletion in one pancreaticcancer cell line suggested two possibilities: (a) inactivation of a gene

by the ASPC- 1 lesion caused tumor progression; or (b) the homozygous deletion was a random event irrelevant to the transformed stateof the cells. To distinguish between these possibilities, we identifieda set of human cancer cell lines that exhibited LOH within this regionand then examined the three candidate genes for mutations. If theASPC- 1 lesion was causal, one would expect to find mutations of theresponsible gene in the remaining allele of some of the tumor celllines with LOH. Altogether, 213 cell lines derived from various typesof cancer were examined for LOH (Table 2). In these lines, LOH thatincluded the genomic area around Dl 7S969 was assessed on the basisof the combined apparent hemizygosity of four polymorphic shorttandem repeat markers: Dl 7S786, D17S952, Dl 7S520, and D17S969.By this criterion, 102 of the 2 13 tumor cell lines tested exhibitedLOH. This overall LOH frequency of 48% is not unexpected giventhat P53 is located roughly 10 cM from D17S969.

Using PCR and DNA sequencing methodologies, we screened 89 of

the tumor cell lines that displayed LOH for sequence variations in theexon and flanking splice-consensus regions of the candidate genes. Inthe course of mutation screening, we detected a second homozygousdeletion event in a lung carcinoma cell line, NCI-H774. In these lungcells, exons C—Kof MKK4 were deleted; therefore, one breakpoint ofthe homozygous deletion was located between exons B and C of thisgene (data not shown). By comparing the wild-type sequences of

Table 3 MKK4 variants in human tumor celllinesCell

lineTypeAlterationExonCodonPredictedeffectASPC-lPancreasHomozygousdeletionA—CNoexpressionNCI-H774LungHomozygousdeletionC—KProteintruncationMDA-MB-134-IVBreastTCG

> TFG at nuc―551E184Ser -+LeuCAPAN-lPancreasGAA> TAA at nuc 661F221ProteintruncationSW

1417ColonAGA > GGA at nuc 820H274Arg —@GlyMDA-MB-415BreastTCA> TAA at nuc 839H280ProteintruncationNCCITTestisAAG> AAC at nuc 9271309Lys —@Asna

nuc, nucleotide.

MKK4 MUTATIONS IN HUMAN CANCER CELL LINES

candidate genes to the corresponding DNA sequences of tumor celllines, we detected two nonsense and three missense variants of MKK4in the cell lines examined (Table 3); thus far, no sequence variantshave been observed in the other candidate genes. The nonsensemutations found in the CAPAN-l pancreatic carcinoma cell line andMDA-MB-415 breast carcinoma cell line were located at codonpositions 221 and 280 of MKK4, respectively. The nonsense mutationof CAPAN-l eliminates subdomains VI—XIof MKK4, which areessential for the catalytic activity of both SERJ@FHRand TYR proteinkinases (14), whereas the truncated MKK4 product of MDA-MB-415lacks subdomains IX—XI,which contain three residues at positionsthat are almost invariant in all protein kinases. The three missensesequence variants of MKK4 were observed in cancer cell lines derived

from breast (MDA-MB-l34-VI; S184L), colon (SW 1417; R274G),and testis (NCCIT; K309N); none of these three missense changesresults in a conservative substitution (Table 3).

To ascertain if the five MKK4 variants identified were biochemically active, we expressed the variants in cultured mammalian cellsand then performed in vitro kinase assays on the altered proteins.Human kidney 293 cells were transfected with Flag-tagged MEKK1L@,a truncated form of MEKK1 that constitutively activates WT-MKK4(12), in combination with HA-tagged WT or mutant MKK4; bothconstructs were placed under the control of the cytomegaloviruspromoter in pcDNA3 expression vector. The fractionation of transfected cell lysates revealed that although S 184L-MKK4, R274G-MKK4, and K309N-MKK4 behaved similarly to WT-MKK4, thesoluble quantities of the two variants (NON221-MKK4 and N0N280-MKK4), truncated as a result of the nonsense mutations, were severely reduced (Fig. 2, A and B). Using anti-HA antibodies, thesoluble epitope-tagged proteins were immunoprecipitated and thenexamined for MKK4 activity by assaying the phosphorylation ofSAPK-f3 K55R, a catalytically inactive form of SAPK (13). In theseassays, whereas the activity of K309N-MKK4 was comparable to that

of WT-MKK4, each of the other four variant MKK4 proteins exhibited less than 5% of WT activity (Fig. 2, D and E). The relativeactivities of these MKK4 variants correlate well with the degree ofconservation of the residues at these altered sites. As predicted, thetruncated N0N221-MKK4 and N0N280-MKK4 proteins were catalytically inactive. The S 184L-MKK4 and R274G-MKK4 variants,which failed to exhibit kinase activity in these assays, had pointmutations at residues strictly conserved among the six known members of the MAPKK family (8, 9, 15—17).In contrast, the K309N-MKK4 variant, which appears to have WT activity, has a missensealteration at a site that is divergent among the MAPKKS. The absenceof a substantial effect caused by the K309N change in these assays,however, does not preclude a functional defect in vivo that is maskedby coexpression with MEKK1A or is not reflected by in vitro phosphorylation of SAPK-@3K55R.

Discussion

We have discovered several human cancer cell lines harboringmutations in MKK4. Of 90 cancer cell lines with LOH in this region,

4180

on April 22, 2021. © 1997 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

MKK4 MUTATIONS IN HUMAN CANCER CELL LINES

proximity of the P53 locus. However, the lack of detection of additional sequence variants by our screen for cancer cell line mutations ingenes within this l7p region, as well as of BRCA2 previously (1 1),suggests that intragenic alterations that cause clonal selection areextremely rare. We interpret these findings to suggest that the MKK4lesions conferred a growth advantage in these cells that resulted inselection.

Given our discovery of MKK4 mutations in cancer cell lines, it isimportant to determine ifMKK4 lesions occur in primary or metastatictumors. Thus far, we have examined 45 human primary breast tumorspecimens, prescreened for LOH, for coding alterations in MKK4; nosequence variants were detected in these tumor DNAs. However,because MKK4 is mutated at —3%frequency in our panel of cell lines,we did not expect to observe MKK4 lesions in this set of 45 primarybreast tumor specimens. Moreover, homozygous deletion is a mechanism used to inactivate this gene; it is highly improbable that wewould have detected such deletion events in primary tumors by ourscreen because these specimens are heterogeneous and invariablycontaminated with normal cells. Overall, our observation of a lowincidence of MKK4 mutations in cancer cell lines suggests at least oneof the following possibilities: (a) MKK4 can function as a tumor ormetastatic suppressor in certain cell types but is not commonly tar

geted for mutation during cellular transformation in vivo; (b) thesignaling pathway that MKK4 is involved in may be inactivated by

mutagenesis of one of its other components (e.g., MEKK1); or (c) theMKK4 mutations in these lines were generated while these cells werecultured in vitro.

Several MAPKKK-MAPKK-MAPK pathways have been identifiedin mammals (20). Stimulation of these MAPK pathways by different

extracellular factors or environmental stresses results in the downstream regulation of transcription factors that elicit appropriate cellular responses. Accumulated evidence implicates the MAPK pathwayinvolving MEKKI, MKK4, and SAPK, in signaling apoptosis induced by inflammatory cytokines and environmental stresses in avariety of mammalian cell types (21—26).This apoptotic signalingpathway appears to be mediated by the second messenger ceramideand attenuated by sphingosine-l-phosphate (24, 25); however, theidentity of the upstream regulator(s) of MEKK1 has not been elucidated. Johnson et a!. (26) demonstrate that although MEKKI activation facilitates programmed cell death in Swiss 3T3 cells, stimulationof SAPK is apparently not required for the process. Of interest, workby Liu et a!. (27) also supports the notion that SAPK activation is notrequired for inducing apoptosis in MCF-7 cells, leading them topropose that MEKK-MKK4-SAPK is not involved in programmedcell death. The complexity of mammalian MAPK signal transductioncascades is further reflected by the recent discovery of ASK- I, ahuman MAPKKK that induces apoptosis when overexpressed inMvlLu cells and phosphorylates MKK3, MKK6, and MKK4 in vitro(28). Thus, definition of the pathways by which MAPKs signalapoptosis remains unclear.

The tumongenic state of a cell is affected by mechanisms thatcontrol proliferation and apoptosis. Several well-characterized cancergenes regulate programmed cell death, including BCL2, P53, andc-MYC (29). Studies on these genes reveal that inactivation of biochemical pathways that normally stimulate apoptosis can result in anincrease in the tumongenic potential of a cell. Current evidencelinking MKK4 to programmed cell death signaling is based on correlations of kinase activation with the apoptotic induction of mammalian cells cultured in vitro (21—26,28). Our discovery of severalinactivating MKK4 mutations suggests that it may function as a tumorsuppressor in certain cell types. The cancer cell lines characterized inthis report should be useful for investigating the specific role(s) ofMKK4 in cellular growth, stress response, apoptosis, and tumorigen

@ø—35kD

-0@-@ 27 kD

—‘—21kD

-“--35kD—‘—27kD-“--21kD

@.@@8OkD(MEKK1i@)

-ø--8OkD

—@—55kD (SAPK)

.,ø—35 kD

A ____

B __

C

w@.

Fig. 2. Expression and activity of the MKK4 variants. Human kidney 293 cells werecotransfected with pcDNA3-Flag-MEKK 1i@and pcDNA3-HA-MKK4 (WT or altered), orpeDNA3-Hag-MEKKl@ and pcDNA3 vector as a control. The variant forms investigatedare S184L-MKK4 of breast MDA-MB-I34-VT,N0N22 1-MKK4 of pancreatic CAPAN- 1,R274G-MKK4 ofcolon SWI4I7, N0N280-MKK4 ofbreast MDA-MB-4l5, and K309N-MKK4 of testis NCCIT. Shown are Western blots of the pellet (insoluble; A) andsupematant (soluble; B) fractions of the transfected cell lysates probed with anti-HAantibodies; a nonspecific immunoreactive band is observed at M@ 37,000 1t1the supernatant fraction. C, the supematant fractions were also probed with anti-Flag antibodies toconfirm equivalent expression of MEKK1A among the different transfected cells. D,autoradiograph of kinase inactive SAPK-@3K55R (13) after phosphorylation by HAMKK4 immunoprecipitates; these differentially expressed altered MKK4 products werenormalized prior to assay. E, the 32P-labeled SAPK-f3 K55R bands were excised andquantified by scintillation counting. The data shown are expressed as a percentage ofWT-MKK4 (taken to be 100%) and reflect the average of two independent sets of kinaseassays.

4181

‘- 0 C')c!,1 m

U) Z@ Z@

-@ ,@ t;@ a@ @:. (:). e'a @; m@ @.<@ C'4 @% C@1@@@- z C'4 Z c'coo@

z z

six lines derived from pancreatic, breast, lung, and colon carcinomasdo not appear to express functional MKK4 protein; the NCCIT testisline had a missense change that did not perturb kinase activity in ourin vitro assays. Of interest, mutations in P53 have been reported in thetwo pancreatic carcinoma cell lines, ASPC-l and CAPAN-l (18, 19),which have deleterious MKK4 lesions. In addition, CAPAN-15 waspreviously determined to carry the 6l74delT mutation in BRCA2 (1 1).These correlations suggest that inactivation of independent pathwaysdefined by these tumor suppressor genes contributed to the transformation process of these pancreatic cells. The frequency of MKK4mutations in cancer cell lines is low (6 of 213 tumor cell lines withLOH, —3%),due in part to the high incidence of LOH caused by

5 CAPAN- 1 is cancer cell line 4G3 in the BRCA2 study (1 1).

on April 22, 2021. © 1997 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

MKK4 MUTATIONS IN HUMAN CANCER CELL LINES

Miki, Y., Peng, Y., Samson, C., Schroeder, M., Snyder. S. C., Stringfellow, M.,Stroup, C., Swedlund, B., Swensen, J., Teng, D., Thakur, S., Tran, T., Tranchant, M.,Weaver-Feldhaus, J., Wong, A. K. C., Shizuya, H., Labrie, F., Skolnick, M. H.,Goldgar, D. E., Kamb, A., Weber, B. L., Tavtigian, S. V., and Simard, J. Generationof an integrated transcription map of the BRCA2 region on chromosome 13ql2—ql3.Genomics, 36: 86—99,1996.

II. Teng, D. H. F., Bogden, R., Mitchell, J., Baumgard, M., Bell, R., Berry, S., Davis, T.,Ha, P. C., Kehrer, R., Jammulapati, S., Chen, Q., Offit, K., Skolnick, M. H.,Tavtigian, S. V., Thanwar, S., Swedlund, B., Wong, A. K. C., and Kamb, A. Lowincidence of BRCA2mutation in breast carcinoma and other cancers. Nat. Genet., 13:241—248,1996.

12. Hirai, S., Izawa, M., Osada, S., Spyrou, G., and Ohno, S. Activation of the iNKpathway by distantly related protein kinases, MEKK and MUK. Oncogene, 12:641—650,1996.

13. Sanchez, I., Hughes, R. T., Mayer, B. I., Yee, K., Woodgett, J. R., Avruch, J.,Kyriakis, J. M., and Zon, L. I. Role of SAPK/ERK kinase-l in the stress-activatedpathway regulating transcription factor c-Jun. Nature (Land.), 372: 794—798,1994.

14. Hanks, S. K., Quinn, A. M., and Hunter, T. The protein kinase family: conservedfeatures and deduced phylogeny of the catalytic domains. Science (Washington DC),241: 42—52,1988.

15. Zheng, C. F., and Guan, K. L. Cloning and characterization of two distinct humanextracellular signal-regulated kinase activator kinases, MEKI and MEK2. J. Biol.Chem.,268: 11435—11439,1993.

16. English, I. M., Vanderbilt, C. A., Xu, S., Marcus, S., and Cobb, M. H. Isolation ofMEKS and differential expression of alternatively spliced forms. J. Biol. Chem., 270:28897—28902,1995.

17. Moriguchi, T., Kuroyanagi, N., Yamaguchi, K., Gotoh, Y., Ide, K., Kano, T.,Shirakabe, K., Muro, Y., Shibuya, H., Matsumoto, K., Nishida, E., and Hagiwara, M.A novel kinase cascade mediated by mitogen-activated protein kinase kinase 6 andMKK3. I. Biol. Chem., 271: 13675—13679,1996.

18. Ruggeri, B., Zhang, S. Y., Caamano, J., DiRado, M., Flynn, S. D., and Klein-Szanto,A. J. Human pancreatic carcinomas and cell lines reveal frequent and multiplealterations in the p53 and Rb-I tumor-suppressor genes. Oncogene, 7: 1503—1511,1992.

19. Redston, M. S., Caldas, C., Seymour, A. B., Hniban, R. H., da Costa, L., Yeo, C. J.,and Kern, S. E. p53 mutations in pancreatic carcinoma and evidence of commoninvolvement of homocopolymer tracts in DNA microdeletions. Cancer Rca., 54:3025—3033,1994.

20. Waskiewicz, A. J., and Cooper, J. Mitogen and stress response pathways: MAP kinasecascades and phosphatase regulation in mammals and yeast. Curr. Opin. Cell Biol., 7:798—805,1995.

21. Kyriakis, I. M., and Avruch, J. Sounding the alarm: protein kinase cascades activatedby stress and inflammation. J. Biol. Chem., 271: 24313—24316, 1996.

22. Xia, Z., Dickens, M., Raingeaud, J., Davis, R. J., and Greenberg, M. E. Opposingeffects of ERK and JNK-p38 MAP kinases on apoptosis. Science (Washington DC),270: 1326—1331,1995.

23. Chen, Y-R., Meyer, C. F., and Tan, T-H. Persistent activation of c-Jun N-terminalkinase 1 (JNKI) in ‘yradiation-induced apoptosis. J. Biol. Chem., 271: 631—634,1996.

24. Verheij, M., Bose, R., Lin, X. H., Yao, B., Jarvis, W. D., Grant, S., Birrer, M. J.,Szabo, E., Zon, L. I., Kyriakis, I. M., Haimovitz-Friedman, A., Fuks, Z., andKolesnick, R. N. Requirement for ceramide-initiated SAPK/JNK signalling in stressinduced apoptosis. Nature (Land.), 380: 75—79,1996.

25. Cuvillier, 0., Pirianov, G., Kleuser, B., Vanek, P. G., Coso, 0. A., Gutkind, S., andSpiegel, S. Suppression ofceramide-mediated programmed cell death by sphingosineI-phosphate. Nature (Land.), 381: 800—803,1996.

26. Johnson, N. L., Gardner, A. M., Diener, K. M., Lange-Carter, C. A., Gleavy, J., Jarpe,M. B., Minden, A., Karmn,M., Zon, L. I., and Johnson, G. L. Signal transductionpathways regulated by mitogen-activated/extracellular response kinase kinase kinaseinduce cell death. J. Biol. Chem., 271: 3229—3237, 1996.

27. Liu, Z-G., Hsu, H., Goeddel, D. V., and Karin, M. Dissection of TNF receptor 1effector functions: JNK activation is not linked to apoptosis while NF-KBactivationprevents cell death. Cell, 87: 565—576,1996.

28. Ichijo,H.,Nishida,E., Irie,K.,ten Dijke,P., Saitoh,M.,Moriguchi,T., Takagi,M.,Matsumoto, K., Miyazono, K., and Gotoh, Y. Induction of apoptosis by ASK1, amammalianMAPKKKthatactivatesSAPK/JNKand p38signallingpathways.Srience (Washington DC), 275: 90—94,1997.

29. Chiarugi, V., and Ruggiero, M. Role of thee cancer “mastergenes―p13, bcl-2, andc-myc on the apoptotic process. Tumori, 82: 205—209,1996.

4182

esis. Confirmation of MKK4 involvement in signaling cellular growthor apoptosis would be another step taken toward defining the pathways that transduce and integrate signals that culminate in the dccision by a cell to proliferate or commit suicide. Definition of theseregulatory pathways should lead to the identification of significanttargets for antitumor therapeutic development.

Acknowledgments

We are indebted to A. Bush, J. Chung, E. Gomez, P. Ha, A-M. Jensen, T.Le, C. McBride, J. Pradham, S. Richards, H. Rojeski, C. Smith, S. Terry, T.Iran, and D. Woodland for providing excellent technical assistance. We aregrateful to X. Y. Yang and V. del Ia Cruz for performing radiation-hybridmapping. We thank A. Kamb and N. Chamberlain for comments on the

manuscript.

ReferencesI. Kamb, A., Gruis, N. A., Weaver-Feldhaus, J., Liu, Q., Harshman, K., Tavtigian, S. V.,

Stockert, E., Day, R. S., III, Johnson, B. E., and Skolnick, M. H. A ceilcycle regulatorpotentially involved in genesis of many tumor types. Science (Washington DC), 264:436—440,1994.

2. wooster, R., Bignell, G., Lancaster, J., Swift, S., Seal, S., Mangion, J., Collins, N.,Gregory. S., Gumbs, C., Micklem, G., Barfoot, R., Hamoudi, R., Patel, S., Rice, C.,Biggs, P., Hashim, Y., Smith, A., Connor, F., Arason, A., Gudmundsson, J., Ficenec,D., Kelsell, D., Ford, D., Tonin, P. Bishop, D. T., Spurr, N. K., Ponder, B., Eeles, R.,Peto, J., Devilee, P., Corneisse, C., Lynch, H., Narod, S., Lenior, G., Eglisson, V.,Barkadottir, R. B., Easton, D. F., Bentley, D. R., Futreal, P. A., Ashworth, A., andStratton, M. R. Identification of the breast cancer susceptibility gene, BRCA2.Nature(Lond.),378: 789—792,1995.

3. Tavtigian, S. V., Simard, J., Rommens, J., Couch, F., Shattuck-Eidens, D.,Neuhausen, S., Merajver, S., Thorlacius, S., Offit, K., Stoppa-Lyonnet, D., Belanger,C., Bell, R., Berry, S., Bogden, R., Chen, Q., Davis, T., Dumont, M., Frye, C., Hattier,T., Jammulapati, S., Janecki, T., Jiang, P., Kehrer, R., Leblanc, J. F., Mitchell, J. T.,McArthur-Momson, J., Nguyen, K., Peng, Y., Samson, C., Schroeder, M., Snyder,S. C., Steele, L., Stringfellow, M., Stroup, C., Swedlund, B., Swensen, J., Teng, D.,Thomas, A., Tran, T., Tranchant, M., Weaver-Feldhaus, J., wong, A. K. C., Shizuya,H., Eyfjord, J. E., Cannon-Albright, L., Labrie, L., Skolnick, M. H., Weber, B., Kamb,A., and Goldgar, D. E. The complete BRCA2 gene and mutations in chromosomel3q-linked kindreds. Nat. Genet., 12: 333—337,1996.

4. Steck, P. A., Pershouse, M. A., Jasser, S. A., Yung, W. K. A., Lin, H., Ligon, A. H.,Langford, L. A., Baumgard, M. L., Hauler, T., Davis, T., Fyre, C., Hu, R., Swedlund,B., Teng, D. H. F., and Tavtigian, S. Identification of a candidate tumor suppressorgene, MMACJ, at chromosome l0q23.3 that is mutated in multiple advanced cancers.Nat. Genet., 15: 356—362,1997.

5. Li, J. Yen, C., Liaw, D., Podsypanina,K., Bose, S., Wang, S. I., Puc, J., Miliaresis,C., Rodgers, L.. McCombie, R., Bigner, S. H., Giovanella, B. C., Ittmann, M., Tycko,B., Hibhoosh, H., Wigler, M. H., and and Parsons, R. PTEN, a putative proteintyrosine phosphatase gene mutated in human brain, breast, and prostate cancer.Science (Washington DC), 275: 1943—1947. 1997.

6. Schutte, M., tin Costa, L. T., Hahn, S. A., Moskaluk, C., Hoque, A. T., Rozenblum,E., Weinstein, C. L., Bittner, M., Meltzer, P. 5., Trent, J. M., Yeo, C. J., Hruban,R. H., and Kern, S. E. Identification by representational difference analysis of ahomozygous deletion in pancreatic carcinoma that lies within the BRCA2 region.Proc. NatI. Aced. Sci. USA, 92: 5950—5954, 1995.

7. Vogelstein, B., Fearon, E. R., Kem, S. E., Hamilton, S. R., Preisinger, A. C.,Nakamura, Y., and White, R. Allelotype of colorectal carcinomas. Science (Washington DC), 244: 207—211, 1989.

8. Derijard, B., Raingeaud, J., Barrett, T., Wu, I. H., Han, J., Ulevitch, R. J., and Davis,R. J. Independent human MAP kinase signal transduction pathways defined by MEKand MKK isoforms. Science (Washington DC), 267: 682—685, 1995.

9. Lin, A., Minden, A., Martinetto, H., Claret, F. X., Lange-Carter, C., Mercurio, F.,Johnson, 0. L., and Karin, M. Identification of a dual specificity kinase that activatesthe Jun kinases and p38-Mpk2. Science (Washington DC), 268: 286—290,1995.

10. Couch, F. J., Rommens, J. M., Neuhausen, S. L., Belanger, C., Dumont, M., Abel, K.,Bell, R., Berry, S., Bogden, R., Cannon-Albright, L., Farid, L., Frye, C., Hauler, T.,Janecki,T., Jiang,P., Kehrer,R.,Leblanc,J. F.,McArthur-Momson,J., Meney,D.,

on April 22, 2021. © 1997 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

1997;57:4177-4182. Cancer Res   David H-F. Teng, William L. Perry III, James K. Hogan, et al.   Candidate Tumor SuppressorHuman Mitogen-activated Protein Kinase Kinase 4 as a

  Updated version

  http://cancerres.aacrjournals.org/content/57/19/4177

Access the most recent version of this article at:

   

   

   

  E-mail alerts related to this article or journal.Sign up to receive free email-alerts

  Subscriptions

Reprints and

  .pubs@aacr.orgDepartment at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

  Permissions

  Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://cancerres.aacrjournals.org/content/57/19/4177To request permission to re-use all or part of this article, use this link

on April 22, 2021. © 1997 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from