Ia

J

a

Mb

c

a

ARRAA

KIAEIC

1

si

p4fsdmptl

MrT

0d

Molecular Immunology 49 (2011) 253– 259

Contents lists available at SciVerse ScienceDirect

Molecular Immunology

jo u rn al hom epa ge: www.elsev ier .com/ locate /mol imm

DO expression by human B lymphocytes in response to T lymphocyte stimulind TLR engagement is biologically inactive

essica Godin-Ethiera, Laïla-Aïcha Hanafia, Jean-Baptiste Duvignaudb,c, Denis Leclercb, Réjean Lapointea,∗

Research Centre, Centre hospitalier de l’Université de Montréal (CRCHUM) – Hôpital Notre-Dame, Department of Medicine, Université de Montréal, Institut du cancer de Montréal,ontréal, Québec, CanadaCentre de Recherche en Infectiologie, Centre Hospitalier de l’Université Laval (CHUL), Université Laval, Québec, Québec, CanadaPROTEO, Université Laval, Québec, Québec, Canada

r t i c l e i n f o

rticle history:eceived 25 July 2011eceived in revised form 24 August 2011ccepted 25 August 2011vailable online 19 September 2011

eywords:mmunosuppressionmino acid metabolismnzymeFN-�

a b s t r a c t

The immune system must be under tight control to avoid undesired responses. The enzyme indoleamine2,3-dioxygenase (IDO) can exert necessary regulating effects by catabolizing tryptophan, leading to thesuppression of immune responses in different settings, such as pregnancy and tumor growth. IDO’simmuno-suppressive actions are mediated by tryptophan starvation and the accumulation of toxic tryp-tophan metabolites, resulting in T cell anergy, inhibition of clonal expansion or apoptosis. IDO activity inhuman macrophages and dendritic cells has been observed after interaction with T lymphocytes, and istriggered by interferon-gamma (IFN-�) as well as CD40-ligand (CD40L). However, it is unclear whetherIDO activity is present in B lymphocytes, which have been identified as having suppressive propertiesinvolved in anti-tumor immunity inhibition. In this study, we investigated whether IDO expression isinduced in human B cells after exposure to T lymphocyte stimuli and TLR ligands. We report IDO1 and

D40L IDO2 mRNA up-regulation by exogenous stimulation with CD40L and IFN-�. IDO is also upregulated byimiquimod, a TLR 7/8 agonist. In addition, IDO protein is detected after treatment with these exogenousfactors or with supernatant from activated CD4+ T cells. We, however, report weak or absent enzymaticactivity from these IDO-expressing cells, as assessed by tryptophan consumption. We conclude thatIDO may not be a counter-regulatory mechanism utilized by B lymphocytes to down-regulate immuneresponses, although its expression is inducible.

. Introduction

Counter-regulatory mechanisms are necessary in the immuneystem to avoid inappropriate or excessive responses (reviewedn Kyewski and Klein, 2006) and promote contraction phases.

Abbreviations: 1MT, 1-methyl-tryptophan; Ab, antibody; APC, antigen-resenting cells; CD40L, CD40-ligand; CTLA4-Ig, cytotoxic T lymphocyte antigen--immunoglobulin; DAPI, 4′ ,6′-diamidino-2-phenylindole; DC, dendritic cells; FBS,etal bovine serum; FITC, fluorescein isothiocyanate; HBSS, Hank’s balanced saltolution; HPLC, high-performance liquid chromatography; IDO, indoleamine 2,3-ioxygenase; IFN-�, interferon-gamma; IL, interleukin; LPS, lipopolysaccharide;RNA, messenger ribonucleic acid; MHC, major histocompatibility complex; PBMC,

eripheral blood mononuclear cells; PBS, phosphate buffered saline; RT-PCR, reverseranscriptase-polymerase chain reaction; TCR, T cell receptor; Tregs, regulatory Tymphocytes.∗ Corresponding author at: Research Centre, Centre hospitalier de l’Université deontréal (CRCHUM) – Hôpital Notre-Dame, Pavillon J.A. DeSève, Local Y-5605, 2099

ue Alexandre DeSève, Montréal, Québec, Canada H2L 2W5.el.: +1 514 890 8000x25489/25504; fax: +1 514 412 7591.

E-mail address: rejean.lapointe@umontreal.ca (R. Lapointe).

161-5890/$ – see front matter © 2011 Elsevier Ltd. All rights reserved.oi:10.1016/j.molimm.2011.08.017

© 2011 Elsevier Ltd. All rights reserved.

By limiting the intensity and extent of immune responses, theseinhibitory mechanisms prevent further damage to the host. Suchfunctions can be fulfilled by the tryptophan-catabolizing enzymeindoleamine 2,3-dioxygenase (IDO). Degradation of the essentialamino acid tryptophan by IDO, depleting tryptophan from the intra-cellular pool or local microenvironment, was first described as adefense mechanism against intracellular pathogens (Pfefferkorn,1984; Taylor and Feng, 1991). Its role was thereafter extended tofetal protection against maternal T cells, when Munn et al. (1998)demonstrated that administration of the IDO inhibitor 1-methyl-tryptophan (1MT) to pregnant mice led to fetal rejection. Thispivotal study ascribed a new immunosuppressive function to theenzyme, and prompted an intense search for its contribution intumor escape (Friberg et al., 2002; Uyttenhove et al., 2003). In fact,enzymatically active IDO and the recently identified IDO2 proteins(Ball et al., 2007; Metz et al., 2007) lead to tryptophan starva-

tion and downstream metabolite accumulation. This culminatesin multiple effects on immune cells, such as T lymphocyte prolif-erative arrest (Munn et al., 1999; Frumento et al., 2002; Ternesset al., 2002), anergy (Munn et al., 2004a), apoptosis (Fallarino et al.,

2 ar Imm

2(T

da(oombcc

itpcImcamealaBo(Bi

eIcHeDbeerwohwtk

2

2

d(mHpi

Cr(

54 J. Godin-Ethier et al. / Molecul

002a), conversion of naive CD4+ T cells to regulatory T cells (Tregs)Fallarino et al., 2006), and activation of mature CD4+CD25+Foxp3+

regs (Sharma et al., 2007).Active IDO is induced in human macrophages and monocyte-

erived dendritic cells (DC) upon interaction with T lymphocytes,nd this induction is dependent not only on interferon-gammaIFN-�) production, but also on CD40-ligand (CD40L) up-regulationn these T cells (Munn et al., 1999; Hwu et al., 2000). More-ver, a subtype of IDO+ plasmacytoid DC, co-expressing a B-lineagearker, can be found in tumor-draining lymph nodes of tumor-

earing mice or patients, creating a suppressive environment andulminating in a profound anergic state of anti-tumor T lympho-ytes (Munn et al., 2004a).

In the course of an effective humoral response, B lymphocytesnteract closely with T lymphocytes, and signals are exchangedhrough cell-cell contacts involving major histocompatibility com-lex/T cell receptor (MHC/TCR) and CD40/CD40L interactions, andytokines such as IFN-� are released. Based on what is known aboutDO induction in macrophages and DC, this counter-regulatory

echanism also possibly arises in B lymphocytes after T lympho-yte encounter. B cell-deficient mice have been shown to mount

more effective anti-tumor response in comparison to wild typeice, suggesting that B cells hamper anti-tumor immunity (Inoue

t al., 2006; Shah et al., 2005). Such suppressive activity has beenssociated with interleukin (IL)-10 production by B cells after CD40igation, leading to decreased IFN-� production by T lymphocytes,t least in vitro (Inoue et al., 2006). However, it is not clear whether

lymphocyte inhibitory effects depend on the same mechanismf action, to prevent anti-tumor responses effectiveness in vivoRosenblatt et al., 2007). Some other mechanism orchestrated by

cells might participate in the inhibition of anti-tumor responsesn vivo.

A recent study demonstrated the existence of a murine PDCA-xpressing B lymphocyte subpopulation, in which IFN-� andDO1/IDO2 are induced at the mRNA level upon stimulation withytotoxic T lymphocyte antigen-4-immunoglobulin (CTLA4-Ig).owever, neither protein expression nor enzymatic activity wasvaluated (Vinay et al., 2010). Also, a B-lymphoid population withC attributes (CD19+, CD11c+) was able to induce Treg activationy IDO expression upon CpG oligonucleotide stimulation (Johnsont al., 2010). In the present work, we investigated whether IDOxpression could be up-regulated in human B lymphocytes inesponse to T cell signals. In addition, we sought to determinehether this induction would beget a functional enzyme capable

f metabolizing tryptophan. We found that IDO was produced byuman B cells at the mRNA and protein levels after stimulationith IFN-�, CD40L and imiquimod (TLR 7/8 ligand), but in an inac-

ive form, indicated by the lack of tryptophan consumption andynurenine accumulation.

. Materials and methods

.1. Healthy donors and cells

Heparinized blood obtained by leukapheresis from healthyonors was centrifuged on lymphocyte separation mediumWisent, St-Bruno, Québec, Canada) to isolate peripheral blood

ononuclear cells (PBMC). Donors were recruited by the Division ofematology and Immunodeficiency Service of Royal Victoria Hos-ital. The study was approved by the local ethics committee, and

nformed consent was obtained from each donor.

All cell lines were procured from the American Type Culture

ollection (Manassas, VA). U937 and KTCL cells were culturedespectively in RPMI 1640 and Dulbecco’s modified Eagle’s mediumDMEM) supplemented with 10% fetal bovine serum (FBS), 2 mM

unology 49 (2011) 253– 259

l-glutamine, 100 U/ml penicillin, 100 �g/ml streptomycin, and10 �g/ml gentamicin (all from Wisent).

B lymphocytes were purified from PBMC by negative selection,with an EasySep human B cell enrichment kit (StemCell Technolo-gies Inc., Vancouver, BC, Canada), according to the manufacturer’sinstructions. Briefly, PBMC were incubated with 10 �l/107 totalcells of antibody cocktail containing a combination of monoclonalantibodies (Abs) against human CD2, CD3, CD14, CD16, CD36, CD43,CD56 and glycophorin A. Magnetic nanoparticles were added at10 �l/107 total cells for 10 min at room temperature, before thetest tube was placed into the magnet for 5 min. Isolated B cell purityreached >95%.

Monocyte-derived DC were generated from PBMC of healthydonors (Leclerc et al., 2007), followed by 24 h of stimulation with500 ng/ml soluble trimeric CD40L (Immunex Corporation, Seattle,WA) and/or 103 U/ml IFN-� (Pierce Endogen, Rockford, IL) and/or5 �g/ml lipopolysaccharide (LPS, Sigma–Aldrich, St. Louis, MO).

2.2. Reagents

l-Tryptophan and kynurenine were prepared as a 20-mMstock solution in water. These reagents were all obtained fromSigma–Aldrich.

B lymphocytes were stimulated with 500 ng/ml soluble trimericCD40L (Immunex Corporation), 250 U/ml recombinant humanIL-4 (Peprotech, Rocky Hill, NJ), 103 U/ml IFN-�, 5 �g/ml LPS,5 �g/ml Poly I:C, 4 �g/ml CpG ODN2006 or 5 �g/ml imiquimod(all from Invivogen, San Diego, CA) in Iscove’s Modified Dul-becco’s Medium (Invitrogen, Carlsbad, CA) supplemented with7.5% heat-inactivated human serum (from normal donors), 2 mMl-glutamine, 100 U/ml penicillin/streptomycin and 10 �g/ml gen-tamicin.

2.3. Reverse transcriptase-polymerase chain reaction (RT-PCR)

RNA from cell lines, lymphocytes and DC was extracted withRNeasyTM mini or micro kits (Qiagen, Hilden, Germany), accordingto the manufacturer’s instructions. For classical and quantita-tive RT-PCR analyses, cDNA was first synthesized from mRNA(500 ng) with oligo-dt and random hexamers (both from AppliedBiosystems, Carlsbad, CA), using an Omniscript reverse transcrip-tase kit (Qiagen). The sequences of PCR primers spanning distinctexons were: IDO (5′: CGCTGTTGGAAATAGCTTCTTGC; 3′: CTTC-CCAGAACCCTTCATACACC, amplicon 167-bp), IDO2 (5′: CGTCATAG-CAAGGAAAGTGGTGAC; 3′: CCCTCAGGGAAGGTGCTGAG, amplicon106-bp), and 18S ribosomal subunit (5′: ATCAACTTTCGATG-GTAGTCG; 3′: TCCTTGGATGTGGTAGCCG, amplicon 111-bp), asdescribed previously (Morse et al., 2005). Classical RT-PCR amplifi-cation was undertaken with HotStartTaq DNA polymerase (Qiagen).The cycling conditions were 15 min at 95 ◦C, 22 (18S), 30 (IDO1), or32 (IDO2) cycles of 45 s at 94 ◦C, 45 s at 55 ◦C, 1 min at 72 ◦C, with afinal extension of 10 min at 72 ◦C, in a T3 ThermocyclerTM (Biome-tra, Goettingen, Germany). Amplification was detected by ethidiumbromide staining after electrophoresis migration in agarose gel (1.5or 2%, with equipment from Bio-Rad, Hercules, CA).

Quantitative real-time RT-PCR amplifications were performedwith a Rotorgene 3000 thermal cycler (Corbett Life Science, Sydney,Australia) and revealed with QuantitectTM SYBR Green PCR (Qia-gen). Real-time quantitative RT-PCR was carried out in reactionscontaining 0.5 �M of each IDO, IDO2 or 18S primers, 10 �l of 2×SYBR Green mix (Qiagen), 4 �l of cDNA (1/20 dilution), and water.The cycling conditions were 10 min at 95 ◦C, then 35 cycles of 30 s at

94 ◦C, 45 s at 60 ◦C, 30 s at 72 ◦C for 18S, and 40 cycles of 30 s at 94 ◦C,60 s at 55 ◦C, 30 s at 72 ◦C for IDO, and a final melting curve from72 to 95 ◦C. Fluorescence was measured at the end of each exten-sion step. The gain was adjusted automatically on the first tube at

ar Imm

tndmgr(

2

pfBwBar(C

2

lUtiwaIppFfwIr1brBwd4g4mTE

2

camatarncwwa

J. Godin-Ethier et al. / Molecul

he end of the first cycle (channel FAM/Sybr, 470-nm source, 510-m detector, readings between 2FI and 5FI). The absence of primerimers and the specificity of the PCR products were documented byelting curve analysis and electrophoresis migration in 2% agarose

el stained with ethidium bromide. IDO expression was quantifiedelative to the housekeeping gene 18S, according to Pfaffl’s methodPfaffl, 2001).

.4. Western blotting

Protein extracts were prepared from the above-mentionedelleted cells, measured, resolved by 10% SDS-PAGE, and trans-erred to polyvinylidene difluoride membranes (Immun-BlotTM,io-Rad) (Turcotte et al., 2007). The membranes were incubatedith sheep polyclonal anti-human IDO antibody 1/100 (Hycultiotechnology, Uden, The Netherlands) or mouse �-actin-specificntibody (1/10,000, Chemicon, Temecula, CA) for 1 h, washed ande-incubated for 1 h with secondary peroxidase-conjugated Abs1:20,000 rabbit anti-sheep or 1:40,000 goat anti-mouse, both fromhemicon), before detection (Turcotte et al., 2007).

.5. Immunofluorescence microscopy

B lymphocytes were isolated from healthy donor PBMC, as out-ined above. IDO expression was induced in B cells and control937 cells respectively by IFN-�/CD40L and IFN-�/LPS stimula-

ion. After 24 h, the cells were harvested, washed and re-suspendedn RPMI/50% FBS for cytospin. For each condition, 5 × 105 cells

ere cytospun on glass slides for 4 min at 27 × g for B cells, ort 40 × g for control U937 cells, in a Statspin Cytofuge 2 (IRISnternational Inc., Chatsworth, CA). The cells were then fixed andermeabilized in methanol/50% acetone, dried, and rehydrated inhosphate buffered saline (PBS). Slides were blocked in PBS/5%BS for 1 h. Dual-color immunofluorescence stainings were per-ormed in a humidified chamber by sequential 1-h incubationsith each Ab. For IDO staining, a polyclonal sheep anti-human

DO (1/200, Hycult Biotechnology) primary Ab was followed by aabbit anti-sheep Ab coupled to fluorescein isothiocyanate (FITC,/500, Millipore, Temecula, CA). CD20 expression was revealedy a mouse anti-human CD20 primary Ab (1/200, Dako, Carpinte-ia, CA) and Rhodamine-conjugated donkey anti-mouse Ab (1/500,io/Can Scientific, Mississauga, Ontario, Canada). The slides wereashed with PBS after each staining, rinsed in distilled water,ried and mounted with ProLong® Gold antifade reagent with′,6′-diamidino-2-phenylindole (DAPI, Molecular Probes, Invitro-en), allowing nuclei visualization, followed by overnight drying at◦C. They were observed under a Nikon Eclipse E600 fluorescenceicroscope equipped with a CoolSNAP HQ2 camera (Photometrics,

ucson, AZ), using a 40× objective. Images were processed by NISlement AR 3.0 software (Nikon Instruments, Inc., Melville, NY).

.6. IDO activity assay

To assess IDO activity, B lymphocytes were plated at 5 × 105

ells/well in 96-well plates and stimulated with 1000 U/ml IFN-�nd 500 ng/ml CD40L or TLR ligands as above described. Approxi-ately 24 h after activation, B cells and control cells were washed

nd re-suspended in Hank’s balanced salt solution (HBSS) con-aining 50 �M l-tryptophan. They were then incubated for andditional 4 h, followed by harvesting of the supernatant andemoval of cell debris by centrifugation. Tryptophan and kynure-ine quantification was undertaken by high-performance liquid

hromatography (HPLC) on a Hewlett Packard HP1050 equippedith a DAD detector (Agilent), and analyzed with ChemStation soft-are. For each quantification, 25 �l of sample was injected into

n analytic Vydac 218TP C18 column and eluted with KH2PO4

unology 49 (2011) 253– 259 255

buffer (0.01 M KH2PO4 and 0.15 mM EDTA, pH 5.0) containing5% methanol HPLC grade at a flow rate of 1.0 ml/min. The spec-trophotometer was set at 254 nm to measure both kynurenineand tryptophan elution. Retention time was determined previouslywith standard solutions of kynurenine (6.6 min) and tryptophan(11.2 min). IDO activity was expressed as the micromolar concen-tration of kynurenine in samples, converted from tryptophan byIDO.

3. Results

3.1. IDO mRNA expression in B lymphocytes in response toexogenous cytokines

To determine whether stimuli from activated T cells could up-regulate IDO expression in B lymphocytes, we treated isolatedhuman B cells with either soluble trimeric CD40L or IFN-� orboth. We evaluated IDO expression in B lymphocytes from multipledonors, and observed that single or combined treatment inducedIDO, as detected by standard RT-PCR (Fig. 1A). Quantitative PCRallowed us to determine that IDO mRNA was expressed at com-parable levels in CD40L- and IFN-�-activated B cells (Fig. 1B).Combination of both factors increased the expression level by morethan 5-fold in comparison to single treatment.

An IDO-like protein termed IDO2 was recently identified as atryptophan-catabolizing enzyme, but its biological role is still notwell defined. We thus investigated whether IDO2 was also inducedin response to the previous stimuli. IDO2 mRNA expression byactivated B lymphocytes was evaluated by standard RT-PCR, andcompared to IDO1 (Fig. 1C). IDO2 was found in control DC stimu-lated with CD40L/LPS/IFN-�. However, it was barely detectable inIFN-�-treated DC and LPS/IFN-�-treated U937 cells in contrast toIDO1 expression. In B lymphocytes, IDO2 mRNA was induced bythe same stimulations as for IDO1.

3.2. Up-regulation of IDO protein expression in B lymphocytes

We then sought to determine whether IDO protein expres-sion in B cells was consistent with the transcriptional inductionobserved. Considering that the strongest IDO mRNA expressionwas seen after stimulation with both CD40L and IFN-�, this com-bination was adopted to activate isolated B lymphocytes underdifferent incubation times. Western blotting revealed that IDO pro-tein was expressed in human B lymphocytes in response to CD40Land IFN-�. Maximal protein expression was apparent between 24and 48 h, depending on the donor (Fig. 2A). This time point was thusretained to further investigate IDO protein induction by other stim-uli. Fig. 2B illustrates that IDO protein was up-regulated by IFN-�alone or in combination with CD40L, whereas CD40L with IL-4 hadno inducing effect on IDO expression. To study IDO expression inB cells in a more physiological context, supernatants from anti-CD3-pre-activated or isotype-matched control-stimulated CD4+

T lymphocytes were added to B lymphocytes for 24 h. IDOprotein was detected on exposure to CD4+-activated T cell super-natant, whereas no expression was induced by control supernatant(Supplemental Fig. 1). However, IDO protein induction was weakerin response to this activated T cell supernatant compared to stimu-lation with exogenous CD40L/IFN-�, indicating that soluble factorsproduced by activated T cells were not optimal, and the signal pro-vided by CD40L must be important.

To simulate IDO induction during an infection, we added stim-

ulation with TLR ligands to B lymphocytes with or without theCD40L/IFN-�. LPS, Poly I:C, oligonucleotides CpG and imiquimod forTLR4, 3, 9 and 7/8 activation were performed respectively. LPS andPoly I:C had no effect on neither RNA or protein expression of IDO

256 J. Godin-Ethier et al. / Molecular Immunology 49 (2011) 253– 259

Fig. 1. IDO mRNA induction in human B lymphocytes by T cell stimuli. B cells wereisolated from healthy donor PBMC and treated with either IFN-� (1000 U/ml) orCD40L (500 ng/ml), alone or in combination, for 24 h. RNA was extracted, cDNAwas prepared, and IDO and 18S gene expression was analyzed by (A) standard or (B)quantitative PCR. (B) Quantification was relative to untreated control B lymphocytes,a(h

auhIs

Fig. 3. IDO mRNA transcription and protein expression in human B lymphocytesexposed to TLR ligands. Isolated B lymphocytes were treated with TLR ligands withor without CD40L and IFN-� for 24 h. (A) RNA was extracted, cDNA was preparedand IDO gene and 18S RNA expression was analyzed by standard PCR. (B) Proteins

Foe

nd IDO expression was normalized with 18S RNA, according to Pfaffl’s methodPfaffl, 2001). (C) IDO1 and IDO2 expression was assessed by standard PCR for 2ealthy donors.

lone or in combination with CD40L and IFN-� (Fig. 3). TLR9 stim-

lation reduced the protein expression in CD40L/IFN-� activateduman B lymphocytes, without affecting the mRNA level. Finally,

DO mRNA and protein expression were observed with imiquimodtimulation alone and in combination with CD40L and IFN-�.

ig. 2. IDO protein expression in B lymphocytes. (A) Isolated B lymphocytes and monocyr (B) either left untreated or treated with IFN-� alone, IFN-� + CD40L or IL-4 + CD40L, foxtracted, and IDO and �-actin expression levels were measured by Western blotting.

were extracted and IDO and �-actin expression levels were measured by Westernblotting.

To exclude the possibility that detected IDO resulted fromcontaminating cells after B lymphocyte magnetic selection, we pro-ceeded to double immunofluorescence staining to confirm that IDOoriginated from B cells. Intracellular IDO and the surface markerCD20, specific to B lymphocytes, were stained with primary Abs andrevealed with fluorescence-conjugated secondary Abs. As depictedin Fig. 4A (upper left panel), no IDO signal was apparent in untreatedCD20+ B cells, whereas weak expression was observed in IFN-�and CD40L + IL-4-stimulated B lymphocytes (Fig. 4, upper middlepanels). However, elevated IDO staining was detected in CD20-expressing cells treated with a combination of CD40L and IFN-�(Fig. 4A, right panel). These findings reflect the results obtained byquantitative PCR, and confirm that IDO expression, measured byWestern blotting, did not originate from non-B cells.

3.3. IDO produced by B cells is functionally inactive

To examine whether the IDO produced by B lymphocyteswas functionally active, we assessed tryptophan consumption andkynurenine production by untreated or CD40L/IFN-�-stimulated Bcells. After 4 h in tryptophan-containing HBSS medium, IFN-� + LPS-

treated U937 cells, serving as positive control, degraded around40% of the initial tryptophan (Fig. 5A). This observation was sup-ported by a corresponding increase in kynurenine concentration.However, no tryptophan disappearance or kynurenine production

te-derived DC were treated with CD40L + IFN-� for the indicated incubation timesr 24 h. U937 cells served as controls. (A and B) Cells were harvested, proteins were

J. Godin-Ethier et al. / Molecular Immunology 49 (2011) 253– 259 257

Fig. 4. IDO and CD20 co-expression. (A) Healthy donor B lymphocytes were untreated or stimulated with IFN-�, IL-4 + CD40L, or IFN-� + CD40L, for 24 h. Dual-color immunoflu-o with sw 7 cells

wslodco

4

hfcsmbCpI

Ffsor

rescence staining was performed with primary Abs specific to IDO and CD20, and

ith DAPI. The results obtained with 1 representative donor are illustrated. (B) U93taining.

as detected in untreated or CD40L/IFN-�-treated B lymphocyteupernatants (Fig. 5A). Finally, B lymphocytes stimulated with TLRigands with or without CD40L/IFN-� stimulation had no effectn tryptophan consumption (Fig. 5B). This absence of tryptophanegradation indicates that IDO expression by stimulated B lympho-ytes is not functionally active, and may have no biological effectn the immune system.

. Discussion

Cellular cross-talk between B and T lymphocytes is central toumoral responses. After antigen recognition by B cell receptors,

ollowed by processing and presentation of this antigen, B lympho-ytes must receive signals from CD4+ helper T cells specific to theame antigen to start antibody production. These include contact-ediated signals through MHC/TCR, B7/CD28 and CD40/CD40L,

ut also cytokines secreted by CD4+ T cells (reviewed in Mills andambier, 2003). It has been known for over a decade that antigen-resenting cells (APC), such as macrophages and DC, can produce

DO, after interaction with T cells, and mediate inhibition of T cell

ig. 5. Functional assessment of IDO produced by B cells. (A) B lymphocytes were isolatedor 24 h to induce IDO expression. The U937 cell line used as control was treated with IFNerum-free HBSS medium, and 50 �M l-tryptophan. Levels of tryptophan and its degradaf two is shown. (B) B lymphocytes were stimulated by 4 different TLR ligands with or wepresentative experiment is shown.

econdary Abs coupled respectively with FITC and Rhodamine. Nuclei were staineds untreated or treated with LPS/IFN-� were considered as positive controls for IDO

proliferation. Despite the fact that human CD40-activated B cellshave previously been shown to be effective APC (Lapointe et al.,2003), no such IDO activity has been investigated in these cells.Kai et al. (2004) examined IDO gene expression in different cellu-lar subsets from human PBMC. Though IDO mRNA has been foundin isolated B lymphocytes, the poor purity of this cellular popula-tion rendered these data questionable. In addition, neither proteinexpression nor tryptophan degradation was evaluated. A recentreport demonstrated that upon stimulation with CTLA4-Ig, IDO1and IDO2 mRNA levels increased in murine PDCA-expressing B lym-phocytes. However, it is still unknown whether this cellular subsetexpresses IDO at the protein level and in a functional state (Vinayet al., 2010). CTLA4-Ig has been previously demonstrated to induceIDO expression in DC when high concentration of IFN-� is presentin the microenvironment (Munn et al., 2004b). However the IFN-�is not required in CD8− DC compared to CD8+ DC (Orabona et al.,

2006). This IDO induction by CTLA4-Ig can occur only when DCwere activated by LPS, but not by CD40L ligation, which is prevent-ing tolerogenic properties onset in human dendritic cells (Vaccaet al., 2005). In the present study, we noted IDO1 and IDO2 mRNA

from healthy donor PBMC and were either untreated or treated with IFN-� + CD40L-� and LPS for 24 h to stimulate IDO expression. The cells were incubated for 4 h intion product kynurenine were quantified by HPLC. One representative experiment

ithout CD40L + IFN-� for 24 h. The same experiment as in A was performed. One

2 ar Imm

uape

aiiedeiamc2atrcwscnaIrw

itbhCfaIbbitf2Mwm

cBiw

C

A

S2Ms

R

58 J. Godin-Ethier et al. / Molecul

p-regulation in human B lymphocytes in response to stimuli fromctivated T lymphocytes. While this up-regulation translated intorotein expression, tryptophan was not degraded by these IDO-xpressing cells.

To investigate whether IDO could be a counter-regulatory mech-nism deployed by B lymphocytes, we sought to mimic possiblenteraction with activated T cells. We thus tested the previouslydentified IDO inducers CD40L and IFN-� (Munn et al., 1999). How-ver, by combining CD40L with IL-4, IDO expression could not beetected from human B lymphocytes. This is not surprising, consid-ring the reported effects of the Th2 cytokine IL-4 on IDO expressionn other cell types. It has indeed been demonstrated that IL-4 hasn inhibitory impact on IDO expression and activity in humanonocytes (Musso et al., 1994). Furthermore, CpG oligodeoxynu-

leotides are known to elicit IDO expression in DC (Mellor et al.,005), and, when administered systemically as adjuvant therapy in

murine model, they induce IDO expression in the spleen, leadingo T lymphocyte suppression (Wingender et al., 2006). TLR9, whichecognizes CpG motifs, is constitutively expressed by B lympho-ytes. In our study, we stimulated enriched human B lymphocytesith TLR ligands; CpG alone cannot stimulate IDO expression, but

urprisingly seems to down-regulate the protein expression whenombined to CD40L and IFN-�. However, imiquimod a TLR7/8 ago-ist was able to induce IDO expression in human B lymphocytes,nd amplify CD40L/IFN-� response at mRNA and protein level. ThisDO activation by imiquimod can be an explanation of the immuneesponse down-regulation observed in sheep PBMC and B cellshen TLR7/8 agonists are added (Booth et al., 2010).

In this study, we report that IDO, expressed by B lymphocytesn response to different T cell stimuli or TLR engagement, does notranslate into tryptophan degradation. In mice, the situation haseen encountered in other cell types, such as DC. IDO expressionas been observed in 2 different DC subsets, namely CD8�+ andD8�−. However, no kynurenine accumulation had been quantified

rom the latter subset, indicating an inactive state of IDO in the CD8lpha-negative DC subset (Fallarino et al., 2002b). More recently,DO1 and IDO2 expression was detected in monocyte-derived DC,ut enzymatic activity was only exerted by IDO1, as demonstratedy siRNA and the use of 2 different 1MT isomers specifically inhibit-

ng IDO1 or IDO2 (Löb et al., 2008). These investigations highlighthe fact that when expressed, IDO is not necessarily in an activeorm. This finding supports our results showing that neither of the

IDO genes was expressed in a functional state in human B cells.ore mechanistic experiments have to be conducted to determinehy the IDO expressed in human B cells is inactive or if anotherechanism inhibits IDO enzymatic activity.In conclusion, despite the observation that the tryptophan-

atabolizing enzyme IDO is induced by IFN-� and CD40L in human lymphocytes, it may not have a biological impact in limit-

ng immune responses. Further studies are needed to determinehether other factors could prompt functional IDO in B cells.

onflicts of interest

The authors have no financial conflicts of interest.

cknowledgments

This work was supported by operating grants from the Naturalciences and Engineering Research Council [grant number 340955-010]; the Canadian Institutes of Health Research [grant number

OP-89727]; and by a fellowship from Fonds de la recherche en

anté du Québec to [RL].Healthy donor samples were provided by Dr. Jean-Pierre

outy and Dr. Mohamed-Rachid Boulassel from the Division of

unology 49 (2011) 253– 259

Hematology and Immunodeficiency Service of Royal Victoria Hos-pital. The editorial assistance of Ovid Da Silva and logistical supportfrom Bureau d’aide à la recherche (Research Support Office),CRCHUM, is acknowledged.

Appendix A. Supplementary data

Supplementary data associated with this article can be found, inthe online version, at doi:10.1016/j.molimm.2011.08.017.

References

Ball, H.J., Sanchez-Perez, A., Weiser, S., Austin, C.J., Astelbauer, F., Miu, J., McQuillan,J.A., Stocker, R., Jermiin, L.S., Hunt, N.H., 2007. Characterization of an indoleamine2,3-dioxygenase-like protein found in humans and mice. Gene 396, 203–213.

Booth, J.S., Buza, J.J., Potter, A., Babiuk, L.A., Mutwiri, G.K., 2010. Co-stimulation withTLR7/8 and TLR9 agonists induce down-regulation of innate immune responsesin sheep blood mononuclear and B cells. Dev. Comp. Immunol. 34, 572–578.

Fallarino, F., Grohmann, U., Vacca, C., Bianchi, R., Orabona, C., Spreca, A., Fioretti,M.C., Puccetti, P., 2002a. T cell apoptosis by tryptophan catabolism. Cell DeathDiffer. 9, 1069–1077.

Fallarino, F., Vacca, C., Orabona, C., Belladonna, M.L., Bianchi, R., Marshall, B., Keskin,D.B., Mellor, A.L., Fioretti, M.C., Grohmann, U., Puccetti, P., 2002. Functionalexpression of indoleamine 2,3-dioxygenase by murine CD8 alpha(+) dendriticcells. Int. Immunol. 14, 65–68.

Fallarino, F., Grohmann, U., You, S., McGrath, B.C., Cavener, D.R., Vacca, C., Orabona, C.,Bianchi, R., Belladonna, M.L., Volpi, C., Santamaria, P., Fioretti, M.C., Puccetti, P.,2006. The combined effects of tryptophan starvation and tryptophan catabolitesdown-regulate T cell receptor zeta-chain and induce a regulatory phenotype innaive T cells. J. Immunol. 176, 6752–6761.

Friberg, M., Jennings, R., Alsarraj, M., Dessureault, S., Cantor, A., Extermann, M.,Mellor, A.L., Munn, D.H., Antonia, S.J., 2002. Indoleamine 2,3-dioxygenase con-tributes to tumor cell evasion of T cell-mediated rejection. Int. J. Cancer 101,151–155.

Frumento, G., Rotondo, R., Tonetti, M., Damonte, G., Benatti, U., Ferrara, G.B., 2002.Tryptophan-derived catabolites are responsible for inhibition of T and naturalkiller cell proliferation induced by indoleamine 2,3-dioxygenase. J. Exp. Med.196, 459–468.

Hwu, P., Du, M.X., Lapointe, R., Do, M., Taylor, M.W., Young, H.A., 2000. Indoleamine2,3-dioxygenase production by human dendritic cells results in the inhibitionof T cell proliferation. J. Immunol. 164, 3596–3599.

Inoue, S., Leitner, W.W., Golding, B., Scott, D., 2006. Inhibitory effects of B cells onantitumor immunity. Cancer Res. 66, 7741–7747.

Johnson III, B.A., Kahler, D.J., Baban, B., Chandler, P.R., Kang, B., Shimoda, M., Koni,P.A., Pihkala, J., Vilagos, B., Busslinger, M., Munn, D.H., Mellor, A.L., 2010. B-lymphoid cells with attributes of dendritic cells regulate T cells via indoleamine2,3-dioxygenase. Proc. Natl. Acad. Sci. U.S.A. 107, 10644–10648.

Kai, S., Goto, S., Tahara, K., Sasaki, A., Tone, S., Kitano, S., 2004. Indoleamine 2,3-dioxygenase is necessary for cytolytic activity of natural killer cells. Scand. J.Immunol. 59, 177–182.

Kyewski, B., Klein, L., 2006. A central role for central tolerance. Annu. Rev. Immunol.24, 571–606.

Lapointe, R., Bellemare-Pelletier, A., Housseau, F., Thibodeau, J., Hwu, P., 2003. CD40-stimulated B lymphocytes pulsed with tumor antigens are effective antigen-presenting cells that can generate specific T cells. Cancer Res. 63, 2836–2843.

Leclerc, D., Beauseigle, D., Denis, J., Morin, H., Pare, C., Lamarre, A., Lapointe, R.,2007. Proteasome-independent major histocompatibility complex class I cross-presentation mediated by papaya mosaic virus-like particles leads to expansionof specific human T cells. J. Virol. 81, 1319–1326.

Löb, S., Konigsrainer, A., Schafer, R., Rammensee, H.G., Opelz, G., Terness, P., 2008.Levo- but not dextro-1-methyl tryptophan abrogates the IDO activity of humandendritic cells. Blood 111, 2152–2154.

Mellor, A.L., Baban, B., Chandler, P.R., Manlapat, A., Kahler, D.J., Munn, D.H., 2005. Cut-ting edge: CpG oligonucleotides induce splenic CD19+ dendritic cells to acquirepotent indoleamine 2,3-dioxygenase-dependent T cell regulatory functions viaIFN Type 1 signaling. J. Immunol. 175, 5601–5605.

Metz, R., DuHadaway, J.B., Kamasani, U., Laury-Kleintop, L., Muller, A.J., Prendergast,G.C., 2007. Novel tryptophan catabolic enzyme IDO2 is the preferred biochemicaltarget of the antitumor indoleamine 2,3-dioxygenase inhibitory compound d-1-methyl-tryptophan. Cancer Res. 67, 7082–7087.

Mills, D.M., Cambier, J.C., 2003. B lymphocyte activation during cognate interactionswith CD4+ T lymphocytes: molecular dynamics and immunologic consequences.Semin. Immunol. 15, 325–329.

Morse, D.L., Carroll, D., Weberg, L., Borgstrom, M.C., Ranger-Moore, J., Gillies, R.J.,2005. Determining suitable internal standards for mRNA quantification of

increasing cancer progression in human breast cells by real-time reverse tran-scriptase polymerase chain reaction. Anal. Biochem. 342, 69–77.

Munn, D.H., Zhou, M., Attwood, J.T., Bondarev, I., Conway, S.J., Marshall, B., Brown,C., Mellor, A.L., 1998. Prevention of allogeneic fetal rejection by tryptophancatabolism. Science 281, 1191–1193.

ar Imm

M

M

M

M

O

P

P

R

S

J. Godin-Ethier et al. / Molecul

unn, D.H., Shafizadeh, E., Attwood, J.T., Bondarev, I., Pashine, A., Mellor, A.L., 1999.Inhibition of T cell proliferation by macrophage tryptophan catabolism. J. Exp.Med. 189, 1363–1372.

unn, D.H., Sharma, M.D., Hou, D., Baban, B., Lee, J.R., Antonia, S.J., Messina, J.L.,Chandler, P., Koni, P.A., Mellor, A.L., 2004a. Expression of indoleamine 2,3-dioxygenase by plasmacytoid dendritic cells in tumor-draining lymph nodes.J. Clin. Invest. 114, 280–290.

unn, D.H., Sharma, M.D., Mellor, A.L., 2004b. Ligation of B7-1/B7-2 by humanCD4+ T cells triggers indoleamine 2,3-dioxygenase activity in dendritic cells.J. Immunol. 172, 4100–4110.

usso, T., Gusella, G.L., Brooks, A., Longo, D.L., Varesio, L., 1994. Interleukin-4inhibits indoleamine 2,3-dioxygenase expression in human monocytes. Blood83, 1408–1411.

rabona, C., Puccetti, P., Vacca, C., Bicciato, S., Luchini, A., Fallarino, F., Bianchi, R.,Velardi, E., Perruccio, K., Velardi, A., Bronte, V., Fioretti, M.C., Grohmann, U., 2006.Toward the identification of a tolerogenic signature in IDO-competent dendriticcells. Blood 107, 2846–2854.

faffl, M.W., 2001. A new mathematical model for relative quan-tification in real-time RT-PCR. Nucleic Acids Res. 29, 2002–2007.

fefferkorn, E.R., 1984. Interferon gamma blocks the growth of Toxoplasma gondii inhuman fibroblasts by inducing the host cells to degrade tryptophan. Proc. Natl.Acad. Sci. U.S.A. 81, 908–912.

osenblatt, J., Zhang, Y.D., Tadmor, T., 2007. Inhibition of antitumor immunity by Bcells. Cancer Res. 67, 5058–5059.

hah, S., Divekar, A.A., Hilchey, S.P., Cho, H.M., Newman, C.L., Shin, S.U., Nechus-tan, H., Challita-Eid, P.M., Segal, B.M., Yi, K.H., Rosenblatt, J.D., 2005. Increasedrejection of primary tumors in mice lacking B cells: inhibition of anti-tumor CTL and TH1 cytokine responses by B cells. Int. J. Cancer 117,574–586.

unology 49 (2011) 253– 259 259

Sharma, M.D., Baban, B., Chandler, P., Hou, D.Y., Singh, N., Yagita, H., Azuma,M., Blazar, B.R., Mellor, A.L., Munn, D.H., 2007. Plasmacytoid dendritic cellsfrom mouse tumor-draining lymph nodes directly activate mature Tregs viaindoleamine 2,3-dioxygenase. J. Clin. Invest. 117, 2570–2582.

Taylor, M.W., Feng, G.S., 1991. Relationship between interferon-gamma,indoleamine 2,3-dioxygenase, and tryptophan catabolism. FASEB J. 5,2516–2522.

Terness, P., Bauer, T.M., Rose, L., Dufter, C., Watzlik, A., Simon, H., Opelz, G., 2002.Inhibition of allogeneic T cell proliferation by indoleamine 2,3-dioxygenase-expressing dendritic cells: mediation of suppression by tryptophan metabolites.J. Exp. Med. 196, 447–457.

Turcotte, S., Forget, M.A., Beauseigle, D., Nassif, E., Lapointe, R., 2007. Prostate-derived Ets transcription factor overexpression is associated with nodalmetastasis and hormone receptor positivity in invasive breast cancer. Neoplasia9, 788–796.

Uyttenhove, C., Pilotte, L., Theate, I., Stroobant, V., Colau, D., Parmentier, N., Boon, T.,Van den Eynde, B.J., 2003. Evidence for a tumoral immune resistance mechanismbased on tryptophan degradation by indoleamine 2,3-dioxygenase. Nat. Med. 9,1269–1274.

Vacca, C., Fallarino, F., Perruccio, K., Orabona, C., Bianchi, R., Gizzi, S., Velardi, A.,Fioretti, M.C., Puccetti, P., Grohmann, U., 2005. CD40 ligation prevents onsetof tolerogenic properties in human dendritic cells treated with CTLA-4-Ig.Microbes Infect. 7, 1040–1048.

Vinay, D.S., Kim, C.H., Chang, K.H., Kwon, B.S., 2010. PDCA expression by B lympho-cytes reveals important functional attributes. J. Immunol. 184, 807–815.

Wingender, G., Garbi, N., Schumak, B., Jungerkes, F., Endl, E., von, B.D., Steitz, J.,Striegler, J., Moldenhauer, G., Tuting, T., Heit, A., Huster, K.M., Takikawa, O.,Akira, S., Busch, D.H., Wagner, H., Hammerling, G.J., Knolle, P.A., Limmer, A., 2006.Systemic application of CpG-rich DNA suppresses adaptive T cell immunity viainduction of IDO. Eur. J. Immunol. 36, 12–20.