in vitro transcription from cauliflower mosaic virus promoters by a cell-free extract from tobacco...

Plant Molecular Biology 14: 391-405, 1990. © 1990 Kluwer Academic Publishers. Printed in Belgium. 391

In vitro transcription from cauliflower mosaic virus promoters by a cell-free extract from tobacco cells

Richard Cooke and Paul Penon Laboratoire de Physiologie Vdg~tale (UA565 du CNRS), Universitd de Perpignan, Avenue de Villeneuve, 66025 Perpignan-Cedex, France

Received 11 July 1989; accepted in revised form 17 October 1989

Key words: RNA polymerase II, transcription initiation, Nicotiana tabacurn, promoter

Abstract

We have studied transcription from the cauliflower mosaic virus 19S and 35S promoters in a cell-free system derived from tobacco cells in suspension culture. While a whole-cell extract is incapable of detectable transcription from these promoters, successive purification by column chromatography allows the preparation of two fractions which contain all factors necessary for transcription from the 19S promoter. In contrast, transcription from the 35S promoter leads to the accumulation of short RNAs. This accumulation can only be partially alleviated by modifying the conditions of transcription.

Introduction

It has previously been demonstrated that while purified plant RNA polymerase II can selectively initiate transcription on a homologous template, it is incapable of initiating RNA synthesis at in vivo promoters [5, 6 and references therein]. Similar observations on animal cell polymerases have led to the development of in vitro transcription systems which faithfully reproduce in vivo gene expression [ 11, 20, 26]. More recently, cell- free extracts have also been prepared from Neurospora [25] and yeast cells [19]. Such cell- free extracts have allowed considerable progress in the understanding of the sequences and protein factors which are involved in the control of transcription [22, and references therein]. The lack of a similar system has so far prevented comparable studies on plant material. This is probably due to the low protein concentration in plant cells com- pared with animal cells and the presence of high

endogenous protease and nuclease levels. None- theless, the development of such a system would greatly facilitate the study of factors involved in the control of the transcriptional process and will be necessary to determine the precise role played by the increasing number of DNA-binding proteins which have been shown to interact with plant gene promoters. Flynn etal. [14] have shown by complementation of a Hela cell-free system that wheat germ extracts contain inhibitors of transcription which can be removed by further chromatography, allowing the replacement of Hela factors by wheat germ fractions in transcription from the adenovirus major late promoter. However, their system is inefficient and appears to be deficient in elongation.

We have applied the methods of Tyler and Giles [25], developed for Neurospora extracts, and Moncollin et al. [22], for the separation of specific transcription factors, to the preparation of a cell-free transcription system from tobacco

392

cells in suspension culture. These extracts have been used to study the transcription of templates containing the cauliflower mosaic virus (CaMV) 19S and 35S promoters. Transcription from both of these promoters has been studied in vivo [8] and they have been widely used in the construc- tion of vectors for the transformation of plant cells. In addition, they are efficiently used by a Hela cell-free transcription system [17, and our unpublished observations]. Although unfractio- nated extracts are transcriptionally inactive, a single chromatographic separation allows us to obtain selective transcription from the 19S promoter, which can be considerably improved by a second purification step. In contrast to the 19S promoter, transcription from the 35S promoter leads to the accumulation of short RNAs. This can be only partially alleviated by modifying the transcription conditions.

Materials and methods

Restriction endonucleases and other enzymes were obtained from Boehringer Mannheim (France). Radioactive products were from Amer- sham (France). Heparin-Sepharose and DEAE- Sepharose were obtained from Pharmacia. Pro- tein concentrations were determined as described [31.

Preparation of templates

Plasmids were prepared by the alkaline lysis method [2] and purified by caesium chloride gradient centrifugation. The 19S template was prepared by Eco RI digestion of the plasmid pCal9.2, which contains a 459 bp Eco RI fragment of CaMV DNA overlapping the 19S promoter (coordinates 5646-6105: all coordinates given are from the CaMV 1841 isolate [15]) cloned into pUC8. After digestion, EDTA was added to 10 mM, the solution heated to 65 °C for 10 min, cooled and loaded on 10-40~ sucrose gradients in 10mM Tris-HC1, pH 8; 1 mM EDTA; 0.1 M NaC1. After centrifugation at

39000 rpm in the Beckman SW41 rotor for 22 h, fractions were tested for the presence of the Eco RI insert. Fractions containing this DNA were pooled, precipitated with ethanol, washed in 70~o ethanol and redissolved in TE buffer at a concentration of 200#g/ml. The 35S template was recovered from plasmid pCa35.1, which contains a 719 bp Sau3A fragment overlapping the 35S promoter (coordinates 6932-7651 on the CaMV 1841 genome) cloned into the Bam HI site of pUC8. This plasmid was digested by Hind II and the 643 bp fragment extending from the Hind II site at 7013 bp on the CaMV genome to the Hind II site in the polylinker of the vector recovered as described.

The SP6 template was prepared by digesting pSC19.3, which contains a 202bp EcoRI- Hind III fragment of CaMV DNA (5646-5848 bp) cloned into pSP64, with Eco RV. After phenol-chloroform (1:1) extraction, the DNA was precipitated with ethanol, washed with 70~o ethanol and redissolved in TE buffer.

Preparation of tobacco cell extracts

Tobacco cell suspensions (Nicotiana tabacum cv. White Burley, cell line 195) were grown as previously described [18]. They were subcultured every week by 10 times dilution. Four-day-old cultures containing rapidly dividing cells were harvested by filtration, frozen in liquid nitrogen and stored at - 80 °C until extraction. All steps were carried out at 0-4 o C. To 500 g frozen cells were added 180ml of 0.35M Tris acetate, pH 7.9, 0.17 M potassium acetate, 36 mM MgSO4, 39 mM /~-mercaptoethanol, 18 mM dithiothreitol, 3.3 mM PMSF, 66 ~o (v/v) glycerol, 7/~M pepstatin A, and 1.4 #M leupeptin (buffer A) to give a final volume after homogenisation of about 600 ml. Cells were first homogenised in a Waring blendor until the temperature of the homogenate was about 0 °C (5 min), then by aliquots of 25 ml with a motor-driven Teflon-glass homogeniser. Ammonium sulphate (3.8 M) was added slowly to give a concentration of 0.38 M. The suspension was left for one hour with mag-

netic stirring at 4 °C and centrifuged at this temperature at 40 000 rpm for 2 h in a Beckman 70Ti or 42.1 rotor. The supernatant was adjusted to 75 % saturation with solid ammonium sulphate (0.44 g/ml) stirred for 1 h and centrifuged in a Beckman JS13.1 rotor at 12000 rpm for 20 min.

The main steps of the chromatographic separation are shown in Fig. 1. The pellet from ammonium sulphate precipitation was resuspended at a concentration of approximately 30 mg protein/ml in 20mM HEPES-KOH, pH7.9; 10mM MgSO4, 10mM EGTA; 20~ glycerol; 5 m M dithiothreitol and 0 .5mM PMSF (buffer B) containing 0.1 M KCI, 2 # M pepstatin and 0.5 #M leupeptin and dialysed overnight against the same buffer. The dialysate was loaded onto a Heparin-Sepharose CL6B column (25 ml, 1.7 cm x 10 cm) equilibrated in buffer B containing 0.1 M KCI. The column was washed with two column volumes of the same buffer, 6 ml fractions being collected, one column volume of buffer B containing 0.24 M KC1 (6 ml fractions) and finally 1.5 column volumes of the same buffer containing 0.6 M KC1 (1.6 ml fractions). The fractions of the flow-through peak, which contains about 90~ of the proteins, were pooled and loaded onto a DEAE-Sepharose CL6B column (50 ml, 2 cm x 16 cm) equilibrated with buffer B containing 0.1 M KC1. The column was washed with two volumes of the same buffer and eluted with buffer B containing 0.35 M KC1 (FT0.35 fraction). Peak protein fractions (2.7 ml, 2-3 fractions per extract) containing 15-17 mg/ml were pooled and dialysed against buffer B containing 0.1 M KC1.

The 0.6 M Heparin-Sepharose fractions contain the RNA polymerase activity. Specific transcription of the CaMV template only occurs with the leading edge fractions of the non-specific RNA polymerase peak (see Results). These fractions from two preparations were pooled and precipitated by addition of solid ammonium sulphate (0.47 g/ml). The precipitated material was collected by centrifugation, resuspended in buffer B (5 ml) containing 0.05 M KC1 and dialysed for 8 h against the same buffer. The dialysate was applied to a DEAE-Sepharose CL6B column (15 ml, 1.7 cm × 6 m). After washing with two

393

column volumes of dialysis buffer the proteins were eluted stepwise with 1.5 column volumes of buffer B containing successively 0.15 M (DE0.15), 0.20M (DE0.20), 0.25 M (DE0.25) and 1 M (DE1.0) KC1. For in vitro transcription, fractions were pooled as indicated in the legend to Fig. 4, precipitated by addition of ammonium sulphate (0.28 g/ml, then one volume of saturated ammonium sulphate) and dialysed against buffer B containing 0.1 M KC1. Dialysis at all steps results in the precipitation of a certain amount of protein. In most cases, dialysis at KCI concentrations below 0.1 M leads to the loss of a considerable amount of transcriptional activity.

In vitro transcription

Assay for non-specific transcription Assays were performed in 50 #1 of 11.2 mM HEPES-KOH, pH 7.9; 5 .6mM MgSO4; 1.1 mM MnCI2 ; 5.6 mM EGTA: 5.6 mM fl-mercaptoethanol; 2 .8mM dithiothreitol; 50mM KC1; 25u/test RNAsin (Amersham); 11.2~o (v/v) glycerol; 250#g/ml calf thymus DNA; 0.4 mM each ATP, CTP and GTP; 10 #M UTP and 1.5 #Ci 3H-UTP (40-60 Ci/mmol) test. After incubation at 30 °C for 30 min the solution was collected on Whatman GFC filters and washed 8 times with 10 ~ TCA and twice with 95 ~ ethanol before scintillation counting. One unit of enzyme is defined as the amount of RNA polymerase catalysing the incorporation of 1 pmol of 3H-UTP into TCA-insoluble material (6200 dpm in the test conditions).

Assay for transcription on CaMV templates Standard in vitro transcription consisted of a 10 min preincubation at 30 °C in 16 or 26 #1 of 10 mM HEPES-KOH, pH 7.9; 10 mM MgC12; 50 mM KCI; 5 mM DTT; 10~o glycerol; 125 ng poly(l) : poly(C); 400 ng template and extract fractions as indicated in individual legends. Transcription was initiated by adding 4 #1 NTP mix to give t'mal concentrations of 330 #M ATP, GTP and CTP, and 16 #M UTP containing 5 #Ci [ct-32p]-UTP (400 Ci/mmol) per reaction. Var-

394

iations to this procedure are detailed in figure legends. After 50 min at 30 °C, reactions were stopped by adding 270 #1 0.3 M ammonium acetate, 0.2~o SDS, 25 #g/ml tRNA, followed by phenol-chloroform (1 : 1) extraction and ethanol precipitation. In vitro transcription with a Hela cell extract (BRL) was carried out as described by the suppliers and RNA extracted as described above. For SP6 mapping transcription reactions contained 330 #M UTP with no radioactive tra- cer and RNA was extracted as described [21] using 60 units RNase-free DNase. Samples to be analysed on sequencing gels were redissolved in 6 #I sequencing gel loading buffer and electro- phoresed on 0.5 mm thick polyacrylamide-urea gels (32 cm x 18 cm). Gels were fixed, dried and exposed to Kodak X-Omat S films using Dupont Cronex Quanta III intensifying screens.

SP6 mapping

SP6 mapping was carried out essentially as described [21]. Probes were synthesised in 10 y1 using 200 ng Eco RV-linearised pSC19.3, 10 yM UTP and 10#Ci [~-32]-UTP (400Ci/mmol). Lower concentrations of unlabelled UTP lead to unacceptable levels of premature termination. 105 or 2 x l0 s cpm of probe were hybridised with in vitro synthesised RNA in 50~o formamide; 0.4M NaC1; 40mM PIPES, pH6.7; 1 mM EDTA at 37 °C. These conditions take into

account the extremely low T m of the expected hybrids. After hybridisation, reactions were digested with RNase A and RNase T~ at 30 °C for 90 min, with proteinase K at 30 ° C for 10 min and purified as described [21 ]. RNase-resistant molecules were analysed by electrophoresis on 5 mm thick 8 ~ polyacrylamide-urea gels (32 cm x 18 cm) at 650 V for 3 h.

Results

Figure 1 shows the principal steps used in the purification of the tobacco system. We chose to study transcription from the CaMV 19S promoter in this extract. It has previously been suggested that this promoter is considerably weaker than the more widely used 35 S promoter in a Hela cell-free extract [17]. However, our preliminary experiments indicated that it is very efficiently used in such a system, giving a signal which is 5-10 times weaker than that observed with the adenovirus major late promoter (which is considered to be the strongest promoter in the Hela system) and of comparable intensity to that observed for the 35S promoter. We subcloned a 459bp fragment containing about 100 bp upstream from the 19S initiation site and 350 bp downstream into pUC8, allowing the preparation of large quantities of insert for use as a transcription template. Figure 2 shows the main features of the CaMV DNA fragments used for in vitro transcription (Fig. 2a)

TOBACCO WHOLE CELL EXTRACT

I I HEPARIN SEPHAROSE I

I o. I M KCII" 0.24M' KCl 0.6M KCI

(n,v IDEAE CL6BI tkreqk)

I OEAE.CL6BI O.OS 0.20M M ],.OM

Fig. 1. Purification procedure for preparation of the tobacco extract. The figure shows the principal steps in the preparation of the active fractions described in the text. Fractions used in in vitro transcription experiments are boxed.

a

(5646) (6105) Eco RI 5762 Eco RI

I ' I GENE V GENE VI

341/345nt

395

AGATA~TT ~T-TGT-GGI~TG/tT ATC.E*-EE*.~G C T ~ T ~ A TCTATTCT~t~ GGGTGTGTE~ ~_Ad~:EC~TA TAGTTTTTCC G~TGrTGt~T ATAI~I'TGTGT

+1 TCTCTC, GAGA CTGAGAAAAT CAGACCTCCA AGCATGGAGA ACATAC.~A. *. ACTCCTCATG AGAGACCTCT GACTCTTTTA GTCTGGAGGT TCGTACCTCT TGTATCTTTT TGAGGAGTAC

b Eco RI Eco RV

AT T A ~ T ~ T T M T T C C T M T T ~ T C ~ T M ~ T T ~ C T T G T ~ ~ ~ TMT~T T ~ TAT TC~T TM~TTMCTTTA~CTTCTATTCTM~TGTGT~C~TATA~TT T TCC

+20 19S initiation I

CTACTA~OACAT GT OT GGAGACT GAGAAAATCAGACOTOCAAGCAT GGAGAAOATAGANV~ACTCCTCAT G GATGATG~TATAl~TGTGTAGAGA~cTcTGA~T~TTTTAGTcTGGAGGTT~TACCTcTTGTAT~TTTTTGAGGAGTA~ i i i i i I i I i i i I i i i i i i i i I I I I I I I I I I I I I I I I I I I I

+40 +60 ÷ 6 0 Hind III i i ! _ _ _ _ / CAAGAGAAAATACTAAT GCTAGAGCTCGATCTAGTMGAG~AAAAI~-~T1]GTAT T CTATAGTGTCACCTAAATCGTA GTTCTCTTTTAT~T TAC~TCT~TA~T~TTCT~TTTTT~ I ~ T M ~ T A T ~ G T ~ T T T A ~ ; ' , T

l l l l l l l l l l ~ SP6 initiation

Fig. 2. The 19S promoter templates, a. The template used for run-offtranscription. The upper part of the figure shows the region of the CaMV genome contained on the 459 bp Eco RI fragment of pCal9.1. Protein coding regions are indicated in black and the putative initiation site at 5762 bp [15] is localised. Coordinates are those of the CaMV CM1841 isolate. The arrow shows the run-off RNA expected if transcription is initiated correctly. Its length is 341-345 depending on the termination site on the staggered Eco RI end [16, and see text]. Below is shown the sequence around the transcription initiation site. The TATA box is boxed and the potential CAAT region overlined with a dotted line. The presumed transcription initiation site is shown ( + 1) and the transcribed region indicated by heavy overlining, b. The template used for SP6 mapping. The figure shows the limits of the 202 bp Eco RI-Hind III fragment which was subcloned into pSP64. The initiation sites for RNA polymerase II (19S) and SP6 RNA polymerase are shown with the transcribed regions of each strand (solid and dotted lines respectively). The Eco RV

site used for SP6 run-off transcription is indicated. Numbers correspond to distances from the 19S initiation site.

and SP6 mapping (Fig. 2b). Correct initiation on the transcription template should lead to the synthesis of a 345 nt RNA if transcription proceeds to the end of the transcribed strand (Fig. 2a).

Transcription after Heparin-Sepharose fractionation

Our method of preparation of the tobacco in vitro transcription system is based on those described

by Tyler and Giles for Neurospora [25] and Mon- collin et aL [22] for Hela cells. In contrast to these two cell types, we have never observed transcription using a whole-cell extract before fractionation. This may be due to the presence of enzymatic activities (proteases, DNases, RNases) and/or inhibitors of transcription, as described by Flynn et al. [ 14] for a wheat germ system. We fractionated the whole-cell extract on a Heparin-Sepharose CL6B column [22]. This step separates the Hela extract into two fractions:

396

the flow-through, containing an essential factor which can be further purified on a DEAE-Sepha- rose column, and the other essential factors, which elute with about one third of the RNA polymerase II activity in the leading edge of the 0.6 M KC1 step [ 10]. We thus tested the capacity

of the fractions eluted at 0.6 M KC1 to transcribe the 19S template in the presence of the FT0.35 fraction.

Figure 3a shows the profile of the 0.6 M elution from the Heparin-Sepharose column. The non- specific RNA polymerase activity elutes slightly

Fig. 3. Analysis of run-off transcription by fractions from the Heparin Sepharose column, a. Chromatography on a Heparin- Sepharose column (16 ml, 1.7 cm x 7 cm) of a tobacco whole-cell extract (24 ml, 14.8 mg/ml). After washing with buffer B containing 0.1 M KC1 (30 ml) and 0.24 M KCI (16 ml), elution was carried out with 0.6 M KC1. Protein content and non-specific RNA polymerase activity are indicated for fractions corresponding to the 0.6 M eluate, b. Transcription of the 19S template. Fractions corresponding to the RNA polymerase peak were analysed for transcription of the 19S template. Transcription assays (20 #1) contained 5 #1 of 0.6 M Heparin-Sepharose fractions 8 (6.5 #g protein, 0.2 units RNA polymerase), 9 (6 #g, 0.4 units), 10 (5.5 #g, 2.8 units), 11 (7.5 #g, 13.3 units), 12 (9 #g, 19.3 units), 13 (11.5 #g, 9.0 units) and 14 (9.5 #g, 6.3 units) with 2 #1 (35 #g) of the FT0.35 fraction. RNAs were analysed on a 4~ polyacrylamide-urea gel. Figures indicate the sizes in nt of molecular weight marker fragments (pCa29 [7] digested by Hpa II and labelled by filling in the protruding 5' extremities). The arrow indicates

the expected 345 nt band.

before the bulk of eluted proteins. It can be seen from Fig. 3b that the first polymerase-containing fractions eluted from the column are capable of synthesising 5-6 major RNA species of various lengths, one of which corresponds to the expected run-off product of 345 nt (arrowed). The smaller bands could correspond to different initiation sites, premature termination products or could arise from nuclease degradation. The presence of an RNase inhibitor reduces their level without affecting the 345 nt product. A chase with an excess of cold UTP (the labelled nucleotide) has no effect (unpublished observations), indicating that, if these RNAs are premature termination products, they are released from the template and cannot be chased into larger molecules. In the absence of the FT0.35 fraction, the transcription products are much shorter (not shown). It can be seen that the fractions corresponding to the majority of the RNA polymerase activity synthesise very little RNA (fractions 12-14). This may indicate that these fractions contain inhibitory activities which have been described in other systems [14]. As in the Hela system [10], the active fractions contain about one third of the total non-specific RNA polymerase activity. It should be noted that fraction 10, which shows the highest level of transcription on the CaMV template, contains only 5 ~ of the polymerase activity measured on calf thymus DNA.

Transcription with the DEAE CL6B fractions

In order to attempt to obtain a higher level of specific transcription, we increased the amount of starting material and fractionated the pooled active fractions from two Heparin-Sepharose columns on a DEAE-Sepharose CL6B column. Figure 4 shows typical elution profiles from these columns, indicating the fractions which were pooled and used for subsequent chromatographic steps. Five fractions were recovered from the DEAE CL6B column and tested for their transcriptional activity in association with the FT0.35 fraction. Analysis of RNA polymerase activity on calf thymus DNA shows that RNA polymerase I

397

is mostly present in the 0.20 M eluate, while the majority of the RNA polymerase II activity elutes at 1 M KC1. This activity is, however, highly unstable and is frequently lost during dialysis. The DE0.25 fraction contains about 40~o of the total polymerase II loaded on the DEAE CL6B column (i.e. less than 20~o of the initial level of polymerase II in the Heparin-Sepharose fractions).

Figure 5 shows that, in contrast to the Hela system where the 0.15 M and 0.25 M fractions contain essential factors, the tobacco 0.25 M fraction alone is capable of synthesising the 345 nt RNA in the presence of FT0.35 (lanes 1 and 2). This difference may be due to a real difference in chromatographic behaviour, as has been observed for one transcription factor from yeast [4], or to the fact that this chromatographic step is carried out on the Hela cell extract on an HPLC column which has a higher resolution. As in other in vitro systems [23 ], it is probable that our DEAE CL6B fractions show a certain degree of cross- contamination. It can be seen that the 345 nt RNA is now one of the major transcription products, the majority of the smaller RNAs being no longer observed, while the other major band corresponds to end-to-end transcription of the template. Addition of the 0.15 M fraction slightly in- creases the level of the 345 nt RNA (lanes 3 and 4) and decreases the level of end-to-end transcription, but this is associated with the appear- ance of several other species which migrate above the specific band and an increase in the intensity of the smaller bands.

Dependence of transcription on RNA polymerase H

In order to exclude the possibility that the transcription we observe could be due to another RNA polymerase, we carried out transcription in the presence of ~-amanitin, which specifically inhibits RNA polymeraselI at low concentrations. Figure 6 shows that a concentration of 1 #g/ml is sufficient to block almost all the observed transcription (lane 3), indicating that the RNAs we observe are RNA polymerase II products. The

398

8 20

E

E ~ 10 r-

n

b 1400

1200

• ~ 1000 .

e- 6 0 0 -

~ 4 0 0 - O.

200

e

-a- protein

1oo

Vo lume e lu ted (ml )

8000

- 60O0

,4000

-2000

0)

z r r

protein / 2000

~ -e- RNApolymerase

i 0.15M I ~ 0 . 2 M 0.25M • 1.0M I ~ KCI I ~.K cl KCl / I KCl l I ~ --~

f 000 ''° '° r~

i i i 0

20 40 60 80 Volume

e luted (ml )

Fig. 4. Fractionation of the tobacco whole cell extract, a. Chromatography of a tobacco whole cell extract on Heparin-Sepharose CL6B. A crude, dialysed tobacco whole cell extract (30 ml, 31 mg/ml) was prepared from 500 g fresh weight of tobacco cells and applied to a Heparin-Sepharose CL6B column (25 ml, 1.7 cm x 11 cm) equilibrated in buffer B containing 0.1 M KC1. The column was washed with two column volumes of this buffer, followed by one column volume of buffer B containing 0.24 M KC1 and finally 1.5 column volumes of the same buffer containing 0.6 M KC1. The fractions of the 0.1 M flow through (indicated by a bar on the figure) were pooled and loaded onto a DEAE Sepharose CL6B column (50 ml, 2 cm x 16 cm). After washing with buffer B containing 0.1 M KC1, elution was carried out with the same buffer containing 0.35 M KC1 and protein peak fractions pooled and diaiysed (FT0.35 fraction). The transcriptionally active fractions from the 0.6 M eluate (indicated by a bar on the figure) were pooled, dialysed against buffer B containing 0.1 M KC1, precipitated with solid ammonium sulphate (0.45 g/ml) dissolved in buffer B containing 0.05 M KC1 and dialysed against the same buffer, b. Chromatography of Heparin-Sepharose 0.6 M fractions on DEAE-Sepharose CL6B. Pooled, ammonium sulphate precipitated, dialysed fractions from two Heparin- Sepharose columns (4.5 ml, 14 mg/ml) were loaded onto a DEAE CL6B column (14 ml, 1.7 cm x 6 cm) equilibrated with buffer B containing 0.05 M KCI. After washing with 28 ml of the same buffer, the column was eluted stepwise with 1.5 column volumes each of buffer B containing successively 0.15 M, 0.20 M, 0.25 M, and 1 M KC1. Fractions of 1.6 ml were collected and tested for non-specific RNA polymerase activity. 0.15 M and 0.25 M fractions, indicated by bars, were pooled, precipitated with ammonium sulphate (0.45 g/ml), dialysed against buffer B containing 0.05 M KC1 and used in specific transcription reactions

as indicated in figure legends.

399

Fig. 5. Analysis ofrun-offtranscription by fractions from the DEAE-Sepharose column. Transcription reactions (30 #1) contained 5 #1 (85 #g) of the FT0.35 fraction. Individual reactions contained 2 #1 (3.2 #g, 3 units ofRNA polymerase, lanes 1 and 3) or 4/~1 (6.4 #g, 6 units of RNA polymerase, lanes 2 and 4) of the DE0.25 fraction and 2 #1 (5/~g, lanes 3 and 4) of the DE0.15 fraction. RNAs were analysed on a 5% polyacrylamide gel. Sizes (in nt) of molecular weight markers are shown. The expected 345 nt product is indicated by an

arrow.

~-amanitin lanes (3 and 4) have been overexposed in comparison with lanes 1 and 2.

Optimisation of the transcription reaction

We have not exhaustively tested the effect of varying all the parameters on the transcription reaction. Lower D N A concentrations give lower signals, while an increase in template concentration leads to a slightly higher background (compare lanes 1 and 2 of Fig. 6). Reducing the reaction temperature to 25 o C slightly reduces the level of transcription but has no qualitative effect. The most striking effect is that of salt concentration. Figure 7 shows that an increase in KCI concentration In'st leads to a general increase in the level of the transcription products, while at the highest salt concentration tested (lane 3) end-to- end transcription is greatly reduced and the 345 nt

Fig. 6. Inhibition of transcription by ~-amanitin. Trans- cription reactions contained 2 #1 of DE0.15, 4 #1 of DE0.25 and 5 #1 of FT0.35. Reactions contained 400 ng (lanes 1, 3 and 4) or 800 ng (lane 2) of DNA and 1 #g/ml (lane 3) or 5 #g/ml (lane 4) of ~-amanitin. The 345 nt product is shown

by an arrow.

band constitutes more than half of the total transcription. However, at this concentration, the overall level of transcription is reduced.

Comparison with RNAs synthesised in a Hela cell extract

As indicated above, the 19S promoter is efficiently used by a Hela cell in vitro transcription system. Figure 8 shows the results of a comigration of products synthesised in the Hela cell system and by the DE0.25 fraction of our tobacco extract supplemented by the FT0.35 fraction. The R N A corresponding to specific transcription synthesised in the latter system is slightly longer than that observed in the Hela extract. We estimate the difference in length of the transcription products to be four nucleotides. This could be due to slight differences in the initiation site or to a difference in the termination site at the staggered ends of the template. Similar variations in termination sites

400

have already been observed in in vitro transcription of fl-globin templates in a Hela extract [16].

SP6 mapping of the initiation site

We obtained confirmation of the transcription initiation sites at the 19S promoter by using the S P6 mapping technique [ 21 ]. This is the simplest and most sensitive method for localising such sites. The template used for synthesis of the RNA probe consists of a 202 bp Hind III-Eco RI fragment overlapping the 19S initiation site cloned into the vector pSP64 (Fig. 2b). Truncation of this template at the unique Eco RV site allows the

Fig. 7. Effect of ionic strength on transcription. Reactions were carried out under standard conditions using 4/zl of DE0.25 and 5/A of FT0.35, except that the KC1 concentration was 25 mM (lane 1), 50mM (lane 2) or 100 mM

(lane 3). The 345 nt band is arrowed.

Fig. 8. Comigration of RNAs synthesised in tobacco and Hela cell extracts. Reactions were carried out as described and RNAs analysed on a 5% polyacrylamide-urea gel. Lane 1: RNA synthesised in the tobacco extract. Lane 3: RNA synthesised in the Hela cell extract. Lane 2: Mixture of RNAs analysed in lanes 1 and 3. Sizes of molecular weight

markers are shown.

Fig. 9. SP6 mapping of transcription initiation sites for Hela and tobacco extracts on the 19S promoter. Hybridisation reactions contained 105cpm (lane4) or 2 x 105cpm (lanes 1,2, 3 and 5) labelled probe and RNAs synthesised in the Hela extract (lanes 1 and 3: lane 1 is a shorter exposure of lane 3) or the tobacco extract (lanes 4 and 5). In the latter case, five transcription reactions, using the DE0.25 and FT0.35 fractions and carried out as described in the legend to Fig. 5, were pooled for each hybridisation reaction. RNase-resistant fragments were analysed on an 8 % polyacrylamide-urea gel. Lane 6 contains 104 cpm probe which was treated under hybridisation conditions but did not undergo RNase treatment. The lengths of molecular weight

markers are shown.

synthesis of a 149 nt RNA, 143 nt of which are identical to the transcribed strand of the CaMV insert. Correctly initiated RNA should protect a 92 nt fragment. Figure 9 shows the result of paral- lel mapping experiments carried out with unlabelled RNA synthesised by the tobacco and Hela cell extracts. One of the two major fragments observed for the Hela system corresponds to the expected 92 nt fragment (lane 1). The same fragments are observed when RNA synthesised in the tobacco extract is used in the hybridisation (lanes 4 and 5), whereas when hybridisation is carried out with the same quantity of yeast tRNA, the probe is completely degraded (lane 2).

The longest protected fragment corresponds to end-to-end transcription of the template (143nt protected fragment). The additional bands apparently do not correspond to the other transcription products which can be seen in run- off experiments (Fig. 4), as all of these latter products are long enough to protect the totality of the SP6 probe, which probably leads to the high level of the 143 nt fragment. The majority of these supplementary bands are also present after hybridisation with RNA synthesised by the Hela

401

system (lane 3). They could correspond to variations in the transcription pattern under the slightly modified conditions used for preparation of RNA for SP6 mapping or possibly to slight degradation of the in vitro synthesised RNA during the additional steps used in extraction.

Transcription from the 35S promoter

We have tested our in vitro transcription system on the CaMV 35S promoter. Figure 10 presents the main features of the template used for run-off transcription. Figure 11, lane 2 shows that the Hela cell system is capable of efficient transcription initiation at this promoter, the major band (arrow) corresponding to three contiguous initiation sites. In contrast, in the tobacco extract, and under identical conditions to those used for the 19S promoter, no bands comigrating with the major bands of the Hela system are observed (lane 1). However, we note the accumulation of a number of low molecular weight products (bracketed, lane 1) as well as several larger RNAs including end-to-end transcription products. We

(7013) (pUCS) Htndll EIII~I~ER 7435 Hlndll

I . . . . . . ' I 6ENE VI

2 2 4 nt

T CCACT GACGTA~GGGATGACGCACAATCCO~CTAT CCT T C;GCAAGACGC:T T GC:TCrf'~'~GGAAGTT AGGTGACT GC, AT11CCCTACT GGGT(~TT~GGflT GATAGGAAGCGTTCTGGGAAGGAGt~,TATAIIT CCT T CAA

*1 CAT T TCAT TTGGAGAGGACAC:GCTGAAATCACCAGTCTCTCTCTACAAATCTAT CTCT CTCTAT TTTCTC GTAAAGTAAACCT CTC:CT GT GCGACTT TAGT GGTCAGAGAGAGATGTTTAGATAGAGA~T~G

CATAATAAT(3TGTGAGTAGTTCCCAGATAA6OGAATTAGGGTTCT TATAGGGT TTCGCT CACGTGTTGAG 6TAT TAT TACACACT CAT CAAGGGT CTATTCCCTTAATCCCAAOAATATCCCAAAOCGAGTGCACAACTC

* 7 8

Fig. 10. The 35S promoter template. The upper part of the figure shows the region of the CaMV genome contained on the 643 bp Hind II fragment of pCa35.1. The protein coding region is indicated in black and the putative initiation site at 7435 bp [17] is localised. Coordinates are those of the CaMV CM 1841 isolate. The arrow shows the run-off RNA expected if transcription is initiated correctly. The transcription enhancer region is overlined. Below is shown the sequence around the transcription initiation site. The TATA and CAAT regions are boxed. The presumed transcription initiation site is shown (+ 1) and the transcribed

region indicated by heavy overlining. The potential cruciform structure centered at + 78 (see text) is indicated.

402

using these modified conditions, the level of low molecular weight products is reduced, practically all the shorter products having been chased into longer molecules at 200/~M UTP in the chase reaction (lane 5). Two bands comigrating with two of the Hela system products are observed, although the level of these products is considerably lower than that of the 19S run-offRNAs. We have detected similar small RNAs in a Hela cell system at sub-optimal UTP concentrations (re- suits not shown). In this extract, as with the chase at the highest UTP concentration in the tobacco extract, most, but not all, of these products disap- pear after a longer incubation.

Conclusion

Fig. 11. Run-offtranscription fromthe 35S promoter. Trans- cription reactions were carried out by the standard method for lanes 1 (tobacco extract) and 2 (Hela extract). For the reactions analysed in lanes 3-5, after the preincubation of DNA and extract fractions (see Materials and methods), ATP and GTP were added to 330 #M and CTP to 5 #M with 5 #Ci [ct-32p]-UTP and no unlabeUed UTP. After a further 10 min, CTP was added to 330#M and UTP to 50 #M (lane 3), 100 pM (lane 4) or 200 #M (lane 5), followed by a further 50 min incubation. Reaction products were analysed on a 5% polyacrylamide-urea gel. The lengths of the

molecular weight markers are shown.

noticed that these small RNAs could correspond to correctly initiated products whose synthesis terminates at an inverted repeated sequence whose centre is 78 bp downstream from the initiation site and suspected that they may arise from premature termination in this region under our transcription conditions in which the UTP concentration is limiting.

In order to test this hypothesis, we modified our incubation conditions to form transcription complexes containing short, highly radioactive RNA chains, followed by a chase at higher UTP concentrations. Figure 11, lanes 3 to 5, shows that,

Our results strongly suggest that our tobacco extract is capable of specific transcription initiation at the CaMV 19S promoter. Although our method differs only very slightly from published procedures for other organisms [ 18, 19, 24] we have incorporated several modifications which probably account for our success. The choice of material appears to be important, as we have attempted to prepare extracts from wheat germ by the same method but have never obtained levels of transcription comparable with those observed in the tobacco system, despite the fact that these preparations contain very high levels of RNA polymerase II activity. These observations are in agreement with those of Flynn et al. [ 14], whose wheat germ system appears to be deficient in certain factors and, at least in the early stages of purification, contains transcription inhibitors.

We have also attempted to limit the volumes of extraction buffers in order to work at the highest possible protein concentrations. Thus, in the initial homogenisation, the buffer is constituted by adding the smallest possible volume of a concentrated solution to the frozen tobacco cells. This is particularly important, simply for practical reasons, as the initial homogenate undergoes an ultracentrifugation after the first ammonium sulphate treatment. However, we have also noticed that the yield at all steps of the chromatographic

separation is considerably increased when work- ing with concentrated extracts of large quantities of material.

The choice of template also appears to be important as we obtain only very low levels of correct initiation from the 35S promoter even under modified transcription conditions. Similar observations have been made in other RNA polymerase II cell-free transcription systems [14]. Our results with the 35S promoter may be due to the absence in our extracts of factors necessary for the elongation of RNA chains under certain conditions, as has been observed for the adenovirus major late promoter in a wheat germ extract [1]. However, it has been shown that the major late promoter is not always correctly used by purified fractions from Hela cells [22], a specific factor being required to transcribe the gene when elongation occurs on the true viral gene rather than on sequences derived from another region of the viral genome. Thus, we cannot absolutely exclude the possibility that our observations on the 35S promoter reflect the lack of an additional factor which is not essential for transcription from the 19S promoter. The DNA sequence downstream from the 35S initiation site contains a number of particular structural features which may be involved in the control of transcription from this promoter [8].

We cannot formally exclude the possibility that the transcription product we observe could correspond to a processed RNA rather than a product initiated at the 19S promoter. However, several observations suggest that this site is effectively a transcription initiation site. Studies on in vivo transcription from the 19S promoter [9, 12, 17] or in vitro in a Hela cell extract [ 17] have localised initiation in the region from 5760-5770 bp on the viral genome. Although these authors do not agree on the precise initiation site, Covey et al. [9] have localised one major site by primer extension to 5763 bp, while Guilley et al. [ 17] map this site to 5762 bp (CaMV CM1841 isolate coordinates). It thus appears probable that we observe initiation of transcription at this same site.

Our SP6 mapping results suggest the existence of several initiation sites. While only one band is

403

seen in the run-off experiments, this may simply reflect the lower resolution of the RNAs in the high molecular weight region of the sequencing gels in these experimental conditions. In this context it should be noted that on the 35S template, which has blunt ends, the Hela system synthesises three major products which are not separated on the gel (Fig. 11, lane 2), two of these RNAs corresponding to the bands observed in the tobacco extract (lanes 3-5), indicating that initiation occurs at several sites. These observations may be explained by the particular nature of the CaMV initiation sites, which are purine-rich on the transcribed strand, whereas the consensus site consists of a purine residue surrounded by pyrimidines, the former being the unique initiation site. Lue and Kornberg [ 19], using SP6 mapping of RNAs in a cell-free transcription system from yeast cells, have also observed slight discre- pancies between in vivo and in vitro initiation sites.

As indicated in the results section, the 19S promoter is 5-10 times less efficient than the adenovirus major late promoter in a Hela cell extract. This observation is confirmed by the SP6 mapping results, which indicate that the CaMV promoter is used with an efficiency of approximately 2 × 10-4 mol of RNA synthesised per mole of DNA template, while Manley et al. [20] indicate an efficiency of about 4 × 10- 3 mol per mole of template on the major late promoter. Scintillation counting of the bands corresponding to specific transcription cut out of the sequencing gel indicates that the tobacco system is about ten times less efficient than the Hela extract on the 19S promoter.

It is difficult to compare our results with those published by Flynn et al. [14] on a wheat germ system, as their purification scheme is different from the one which we have used. In addition, elution characteristics can depend not only on the type of active group used on the different columns, but also on the supporting matrix of these columns and the order in which the chromatographic steps are carried out. Our observations correlate fairly well with published results on Hela extracts purified by similar techniques.

Using affinity chromatography on Heparin-

404

Ultrogel as the initial step of fractionation, Mon- collin e t aL [22] obtained specific transcription from the adenovirus major late promoter in a system containing four components: the flow- through fractions of the Heparin column, two fractions, DE0.15 and DE0.25, prepared by chromatography of the 0.6 M effluent of this column on a D E A E exchanger, and exogenous R N A polymerase II. Dynan and Tjian [ 13] fractionated the Heparin-agarose eluate, containing R N A polymerase and factors, into two fractions, the 0.1 M flow-through and 0.225 M eluate, on DEAE-Sepharose CL6B. In this case the 0.225 M fraction contains endogenous R N A polymerase which, when supplemented with the 0.1 M fraction and the heparin flow-through, is able to perform specific transcription. This system is very similar to ours, except that our DE0.25 fraction apparently contains factors which are less firmly bound on D E A E ion exchangers in the Hela cell system, where they are eluted from 0.1 M to 0.15 M KCI [13, 22].

Ackerman e t al. [1] suggest that the wheat transcription machinery may be purified as a preformed complex involving protein-protein in- teractions, certain factors being eluted in the same fractions as the R N A polymerase because they are bound to this enzyme. As the two Hela factors which Moncollin e t al. [22] find to elute from the D E A E column at 0.15 M KCI have been shown to bind to R N A polymerase II [24,27], this observation could explain why we find that the DE0.25 fraction contains the factors necessary for specific transcription. The observation by Flynn e t al. [ 14] that their fraction X is sufficient for the formation of specific transcription complexes which are, however, deficient in elongation [ 1 ] is in agreement with our results, as the FT0.35 fraction appears to contain an activity which allows the synthesis of longer RNAs in association with the Heparin-Sepharose or the DE0.25 fractions.

Our current efforts are dedicated to the development of a more efficient system and of conditions allowing high levels of transcription from all promoters. This should permit precise studies on the factors involved in transcription of plant genes

and the characterisation of the sequences which are involved in the control of the transcriptional process. Such a system will be essential in order to study the role of DNA-binding proteins which have been shown to interact with specific sequences in a number of plant promoters.

Acknowledgements

We thank Mich61e Laudi6, Georges Villelongue and Alain Got for technical assistance, Yves Meyer for unstinting provision of tobacco cells and Jean-Marc Egly for helpful discussions.

References

1. Ackerman S, Flynn PA, Davis EA: Partial purification of plant transcription factors: Initiation. Plant Mol Biol 9:147-158 (1987).

2. Birnboim HC, Doly J: A rapid alkaline extraction procedure for screening recombinant plasmid DNA. Nucl Acids Res 7:1513-1523 (1979).

3. Bradford MM: A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72: 248-254 (1976).

4. Cavallini B, Huet J, Plassat J-L, Sentenac A, Egly JM, Chambon P: A yeast activity can substitute for the Hela cell TATA box factor. Nature 334:77-80 (1988).

5. Cooke RM, Penon P: Selective dinucleotide-primed in vitro transcription of a cloned fragment of cauliflower mosaic virus DNA is dependent on a limited region of the viral genome. Eur J Biochem 157:83-89 (1986).

6. Cooke RM, Penon P: Detection of a potential transcription control sequence on the cauliflower mosaic virus genome by dinucleotide primed in vitro transcription. Biochem Biophys Res Comm 138:17-23 (1986).

7. Cooke R, Penon P, Got C, Miassod R: Selective transcription of a cloned cauliflower mosaic virus DNA fragment in vitro by soybean RNA polymerase II in the presence of dinucleotide primers. Eur J Biochem 137: 365-371 (1983).

8. Covey SN: Organisation and expression of the cauliflower mosaic virus genome. In Davies JW (ed) Molecular Plant Virology, vol II, pp. 121-159. CRC Press, Boca Raton, FL (1985).

9. Covey SN, LomonossoffGP, Hull R: Characterisation of cauliflower mosaic virus DNA sequences which encode major polyadenylated transcripts. Nucl Acids Res 9: 6735-6747 (1981).

I0. Davison BL, Egly JM, Mulvihill ER, Chambon P: For- mation of stable preinitiation complexes between eukaryotic class B transcription factors and promoter sequences. Nature 301:680-686 (1983).

11. Dignam JD, Lebovitz RM, Roeder RG: Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucl Acids Res 11:1475-1489 (1983).

12. Dudley RK, Odell JT, Howell SH: Structure and 5' termini of the large and 19S RNA transcripts encoded by the cauliflower mosaic virus genome. Virology 117: 19-28 (1982).

13. Dynan WS, Tjian R: Isolation of transcription factors that discriminate between different promoters recognis- ed by RNA polymerase II. Cell 32:669-680 (1983).

14. Flynn PA, Davis EA, Ackerman S: Partial purification of plant transcription factors. II. An in vitro transcription system is inefficient. Plant Mol Biol 9:159-169 (1987).

15. Gardner RC, Howarth AJ, Hahn P, Brown-Leudi M, Shepherd RJ, Messing J: The complete nucleotide sequence of an infectious clone of cauliflower mosaic virus by M13mp7 shot gun sequencing. Nucl Acids Res 9: 2871-2887 (1981).

16. Grosveld GC, Shewmaker CK, Jat P, Flavell RA: Local- ization of DNA sequences necessary for transcription of the rabbit fl-globin gene in vitro. Cell 25:215-226 (1981).

17. Guilley H, Dudley RK, Jonard J, Balazs E, Richards KE: Transcription of cauliflower mosaic virus DNA: detection of promoter sequences and characterisation of transcripts. Cell 30:763-773 (1982).

18. Jouanneau JP, Tandeau de Marsac N: Stepwise effects of cytokinin activity and DNA synthesis upon mitotic cycle events in partially synchronised tobacco cells. Exp Cell Res 77:167-174 (1973).

19. Lue NF, Kornberg RD: Accurate initiation at RNA polymerase II promoters in extracts from Saccharomyces

405

cerevisiae. Proc Natl Acad Sci USA 84:8839-8843 (1987).

20. Manley J, Fire A, Cano A, Sharp PA, Getter M: DNA- dependent transcription of adenovirus genes in a soluble whole cell extract. Proc Natl Acad Sci USA 77: 3855-3859 (1980).

21. Melton DA, Krieg PA, Rebagliati MR, Maniatis T, Zinn K, Green MR: Efficient in vitro synthesis of biologically active RNA and RNA hybridisation probes from plasmids containing a bacteriophage SP6 promoter. Nucl Acids Res 12:7035-7056 (1984).

22. Moncollin V, Miyamoto NG, Zheng XM, Egly JM: Purification of a factor specific for the upstream element of the adenovirus-2 major late promoter. EMBO J 5: 2577-2584 (1986).

23. Reinberg D, Horikoshi M, Roeder RG: Factors involved in specific transcription by mammalian RNA polymerase. II. Functional analysis of initiation factors IIA and l iD and identification of a new factor operating at sequences downstream of the initiation site. J Biol Chem 262:3322-3330 (1987).

24. Reinberg D, Roeder RG: Factors involved in specific transcription by mammalian RNA polymerase. II. Purifi- cation and functional analysis of initiation factors IIA and IIB. J Biol Chem 262:3310-3321 (1987).

25. Tyler BM, Giles NH: Accurate transcription of cloned Neurospora RNA polymerase II-dependent genes in vitro by homologous soluble extracts. Proc Natl Acad Sci USA 82:5450-5454 (1985).

26. Weil PA, Luse DS, Segall J, Roeder RG: Selective and accurate initiation of transcription at the Ad2 major late promoter in a soluble system dependent on purified RNA polymerase II and DNA. Cell 18:469-484 (1979).

27. Zheng X-M, Moncollin V, Egly J-M, Chambon P: A general transcription factor forms a stable complex with RNA polymerase B (II). Cell 50:361-368 (1987).

in vitro transcription from cauliflower mosaic virus promoters by a cell-free extract from tobacco...

Documents