involvement of pkc-dependent c-src and ikk activation in tnf-a

c-Src-dependent Tyrosine Phosphorylation of IKKβ Is Involved in

TNF-α-induced Intercellular Adhesion Molecule-1 Expression

Wei-Chien Huang, Jun-Jie Chen, and Ching-Chow Chen

Department of Pharmacology, College of Medicine, National Taiwan University,

Taipei, 10018, Taiwan

Correspondence: Dr. Ching-Chow Chen

Department of Pharmacology

College of Medicine

National Taiwan University

No.1, Jen-Ai Road, 1st Section

Taipei 10018, Taiwan

Tel: +886-2-23123456 ext. 8321

Fax: +886-2-23947833

E-mail: [email protected]

The abbreviations used are: ICAM-1, intercellular adhesion molecule-1; IKK, IκB

kinase; NF-κB, nuclear factor κB; TNF, tumor necrosis factor; NIK, nuclear

factor-κB-inducing kinase; EMSA, electrophoretic mobility shift assay; GST,

glutathione S-transferase

1

by guest on February 19, 2018http://w

ww

.jbc.org/D

ownloaded from

mailto:[email protected]

http://www.jbc.org/

Abstract

The signaling pathway involved in tumor necrosis factor-α (TNF-α)-induced

intercellular adhesion molecule-1 (ICAM-1) expression was further studied in human

A549 epithelial cells. TNF-α- or TPA-induced ICAM-1 promoter activity was

inhibited by a protein kinase C (PKC) inhibitor (staurosporine), tyrosine kinase

inhibitors (genistein and herbimycin A), or a Src-specific tyrosine kinase inhibitor

(PP2). TNF-α− or TPA-induced IKK activation was also blocked by these inhibitors,

which slightly reversed TNF-α-induced, but completely reversed TPA-induced, IκBα

degradation. c-Src and Lyn, two members of the Src kinase family, were abundantly

expressed in A549 cells, and their activation by TNF-α or TPA was inhibited by the

same inhibitors. Furthermore, the dominant-negative c-Src (KM) mutant inhibited

induction of ICAM-1 promoter activity by TNF-α or TPA. Overexpression of the

constitutively active PKCα or wild-type c-Src plasmids induced ICAM-1 promoter

activity, this effect being inhibited by the dominant-negative c-Src (KM) or IKKβ

(KM) mutant, but not by the nuclear factor-κB-inducing kinase (NIK) (KM) mutant.

The c-Src (KM) mutant failed to block induction of ICAM-1 promoter activity caused

by overexpression of wild-type NIK. In co-immunoprecipitation and immunoblot

experiments, IKKβ was found to be associated with c-Src and to be phosphorylated

on tyrosine residues after TNF-α or TPA treatment. Two tyrosine residues, Tyr188

and Tyr199, near the activation loop of IKKβ were identified to be important for

NF-κB activation. Substitution of these residues with phenylalanines abolished

ICAM-1 promoter activity and c-Src-dependent phosphorylation of IKKβ

induced by TNF-α or TPA. These data suggest that, in addition to activating NIK,

TNF-α also activates PKC-dependent c-Src. These two pathways converge at IKKβ

and go on to activate NF-κB, via serine phosphorylation and degradation of IκB-α,

and, finally, to initiate ICAM-1 expression.

Running title: PKC-dependent c-Src activation in IKKβ activation

2


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Extravasation of leukocytes from the microvasculature at sites of inflammation

or injury is a critical event in inflammation-mediated diseases, such as rheumatoid

arthritis, psoriasis, bronchial asthma, atopic dermatitis, and allograft rejection (1–3).

The process of leukocyte migration includes several steps (4,5). The first of these is

adhesion of the leukocyte to the endothelial cell. The initial interaction between the

leukocyte and the endothelium is transient, resulting in the leukocyte rolling along the

vessel wall. The rolling leukocyte then become activated by local factors generated by

the endothelium, resulting in its arrest and firm adhesion to the vessel wall. Finally,

the leukocyte squeezes between the endothelial cells and migrates to the inflammation

site. These complex processes are regulated, in part, by specific adhesion molecules

and their counter ligands on both circulating leukocytes and vascular endothelial cells;

these include E-selectin (endothelial-leukocyte adhesion molecule-1, CD62E) and

immunoglobulin superfamily members, such as intercellular adhesion molecule-1

(ICAM-1, CD54) and vascular cell adhesion molecular-1 (VCAM) (6,7). As the

counter-receptor for leukocyte β2 integrin, LFA-1 and MAC-1, which promote the

adhesion and transendothelial migration of leukocytes, ICAM-1 plays a central role in

a number of inflammatory and immune responses (7-9). Similar processes govern the

adhesion of leukocytes to lung airway epithelial cells and contribute to the damage to

these cells seen in asthma (10).

Basal levels of ICAM-1 are low, but high expression can be induced in a number

of cell types by a wide range of ligands, including bacterial lipopolysaccharide (LPS),

phorbol esters, or inflammatory cytokines, such as tumor necrosis factor (TNF)-α,

interleukin (IL)-1β, and interferon (IFN)-γ (11-13). Induction of ICAM-1 expression

requires de novo mRNA and protein synthesis (8,14), indicating regulation at the

transcriptional level. The promoter region of the human ICAM-1 gene has been

cloned and sequenced, and shown to contain putative recognition sequences for a

variety of transcriptional factors, including nuclear factor-κB (NF-κB), activator

protein-1 (AP-1), AP-2, and the interferon-stimulated response element (ISRE) (15).

Of these, NF-κB family proteins are essential for the enhanced ICAM-1 gene

3


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

expression seen in human alveolar epithelial cells on exposure to cytokines (16, 17).

The intracellular signaling pathways by which TNF-α and IL-1β cause ICAM-1

expression in A549 human alveolar epithelial cells have been explored and found to

involve the sequential activation of protein kinase Cα (PKCα), protein tyrosine kinase

(PTK), nuclear factor-κB-inducing kinase (NIK), and IκB kinaseβ (IKKβ) (16, 17).

The role of PTK has been further investigated in the present study. Using an

immunocomplex kinase assay and site-directed mutagenesis, we have demonstrated

that c-Src is involved in TNF-α-inducing NF-κB transcriptional activation and that, in

addition to serine phosphorylation of IKKβ by NIK, Tyr188 and Tyr199

phosphorylations by PKC-dependent c-Src activation also contribute to

TNF-α-induced ICAM-1 expression in human alveolar epithelial cells.

Experimental Procedures

Materials—Rabbit polyclonal antibodies specific for IκBα, IKKβ, c-Src, Lyn, Lck,

Fyn were purchased from Santa Cruz Biotechnology (Santa Cruz, CA) and rabbit

polyclonal anti-phosphotyrosine antibody was purchased from Upstate Biotechnology

(Lake Placid, NY). Human recombinant TNF-α was purchased from R&D Systems

(Minneapolis, MN). TPA was purchased from L.C. Service Corp (Worburn, MA).

Dulbecco’s modified Eagle medium (DMEM), fetal calf serum (FCS), penicillin, and

streptomycin were obtained from Life Technologies (Gaithersburg, MD).

Staurosporine, GST-agarose beads, and protein A-Sepharose were obtained from

Sigma (St. Louis, MO). Herbimycin A and PP2 were obtained from Calbiochem (San

Diego, CA). HRP-labeled donkey anti-rabbit second antibody and the enhanced

chemiluminescence (ECL) detecting reagent were obtained from Pharmacia Biotech

(Uppsala, Sweden). [γ-32P]ATP (3000 Ci/mmol) was obtained from DuPont-New

England Nuclear (Boston, MA). Tfx-50 and the luciferase assay kit were obtained

from Promega (Madison, MA). Plasmid purification and DNA recovery kits were

4


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

obtained from Qiagen (Chatsworth, CA). The QuickchangeTM mutagenesis kit was

obtained from Strategene (La Jolla, CA). EcoRI, XboI, and SalI restriction enzymes

and T4 DNA ligase were obtained from NEB (Beverly, MA).

Cell culture—A549, a human alveolar epithelial cell carcinoma, were obtained from

the American Type Culture Collection (Manassas, VA) and cultured in DMEM

supplemented with 10% FCS, 100 U/ml of penicillin, and 100 µg/ml of streptomycin

in six-well plates for transfection experiments, in 6 cm dishes for IKK, c-Src, or Lyn

kinase activity measurements and Western blot analysis, or in 10 cm dishes for EMSA

and co-immunoprecipitation tests.

Plasmids—The ICAM-1 promoter construct (pIC339) was a gift from Dr. van der

Saag (Hubrecht Laboratory, Utrecht, Netherlands). The κB-luc plasmid was from

Stratagene. The PKC-α constitutively active (PKC-α/AE) or dominant negative

mutant (PKCα/KR) were provided by Dr. A. Altman (La Jolla Institute for Allergy

and Immunology, San Diego, CA). The wild-type (wt) and dominant-negative

mutants of NIK and IKKβ (NIK wt and mutant KA; IKKβ wt and mutant KM) were

gifts from Signal Pharmaceuticals (San Diego, CA). The dominant negative mutant of

IKKβ (AA) was from Dr. Karin (UCSD, CA). pGEX-IκBα (1-100) was a gift from Dr.

Nakano (University of Juntendo, Tokyo). pGEX-IKKβ (132-206) was a gift from Dr.

Nakanishi (University of Nagoya, Nagoya).

Immunoprecipitation and kinase activity assay—Following treatment with TNF-α or

TPA, with or without 30 min pretreatment with PKC, tyrosine kinase, or Src kinase

inhibitors, the cells were rapidly washed with PBS and lysed with ice-cold lysis buffer

(50 mM Tris-HCl, pH 7.4, 1 mM EGTA, 150 mM NaCl, 1% Triton X-100, 1 mM

PMSF, 5 µg/ml of leupeptin, 20 µg/ml of aprotinin, 1 mM NaF, and 1 mM Na3VO4),

then IKK, c-Src, or Lyn was immunoprecipitated. For the in vitro kinase assay, 100

µg of total cell extract was incubated for 1 h at 4°C with 0.5 µg of rabbit anti-IKKβ,

5


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

anti-c-Src, or anti-Lyn Ab, then protein A-Sepharose CL-4B beads (Sigma) were

added to the mixture and incubation continued for 4 h at 4°C. The immunoprecipitates

were collected by centrifugation, washed three times with lysis buffer without Triton

X-100, then incubated for 30 m 30°C in 20 µl of kinase reaction mixture (20 mM

HEPES, pH 7.4, 5 mM MgCl2, 5 mM MnCl2, 0.1 mM Na3VO4, 1 mM DTT)

containing 10 µM [γ-32P]ATP and either 1 µg of bacterially expressed GST-IκBα

(1-100) as IKK substrate, 1 µg of acidic denatured enolase as c-Src or Lyn substrate

or 6 ug of bacterially expressed GST-IKKβ(132-206), GST-IKKβ(132-206) (Y188F),

GST-IKKβ(132-206) (Y199F) or GST-IKKβ(132-206) (Y188F; Y199F) as c-Src

substrate. The reaction was stopped by addition of an equal volume of Laemmli buffer,

the proteins separated by electrophoresis on 10% SDS polyacrylamide gels, and

phosphorylated-GST-IκBα (1-100), phosphorylated-GST-IΚΚβ (132-206) or

phosphorylated-enolase visualized by autoradiography. Quantitative data were

obtained using a computing densitometer and ImageQuant software (Molecular

Dynamics, Sunnyvale, CA).

Western blot analysis—Following treatment with TNF-α or TPA, total or

immunoprecipitated cell lysates were prepared and subjected to SDS-PAGE using

7.5% running gels, as described previously (17). The proteins were transferred to a

nitrocellulose membrane, which was then incubated successively at room temperature

for 1 h with 0.1% milk in TTBS (50 mM Tris-HCl, pH 7.5, 0.15 M NaCl, and 0.05%

Tween-20), for 1 h with rabbit antibody specific for IKKβ, IκBα, c-Src, Lyn, Lck, or

Fyn, and for 30 min with HRP-labeled anti-rabbit antibody. After each incubation, the

membrane was washed extensively with TTBS. The immunoreactive bands were

detected using ECL detection reagent and Hyperfilm-ECL (Amersham International).

Preparation of nuclear extracts and the electrophoretic mobility shift assay

(EMSA)—Control cells or cells pretreated with various inhibitors for 30 min were

treated with TNF-α for 10 min or with TPA for 30 min, then nuclear extracts were

6


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

isolated as described previously (17). Briefly, cells were washed with ice-cold PBS

and pelleted, then the cell pellet was resuspended in a hypotonic buffer (10 mM

HEPES, pH 7.9, 10 mM KCl, 0.1 mM EDTA, 0.1 mM EGTA, 1 mM DTT, 0.5 mM

PMSF, 1 mM NaF, and 1 mM Na3VO4) and incubated for 15 min on ice, then lysed by

the addition of 0.5% NP-40 followed by vigorous vortexing for 10 s. The nuclei were

pelleted and resuspended in extraction buffer (20 mM HEPES, pH 7.9, 400 mM NaCl,

1 mM EDTA, 1 mM EGTA, 1 mM DTT, 1 mM PMSF, 1 mM NaF, and 1 mM

Na3VO4), and the tube vigorously shaken at 4°C for 15 min on a shaking platform.

The nuclear extracts were then centrifuged and the supernatants aliquotted and stored

at -80°C.

Oligonucleotides corresponding to the downstream NF-κB consensus sequence

(5'-AGCTTGGAAATTCCGGA-3') in the human ICAM-1 promoter were

synthesized, annealed, and end-labeled with [γ-32P]ATP using T4 polynucleotide

kinase. The nuclear extract (6-10 µg) was incubated at 30°C for 20 min with 1 ng of 32P-labeled NF-κB probe (40,000-60,000 cpm) in 10 µl of binding buffer containing

1 µg of poly(dI-dc), 15 mM HEPES, pH 7.6, 80 mM NaCl, 1 mM EGTA, 1 mM DTT,

and 10% glycerol as described previously (17). DNA/nuclear protein complexes were

separated from the DNA probe by electrophoresis on a native 6% polyacrylamide gel,

then the gel was vacuum-dried and subjected to autoradiography using an intensifying

screen at -80°C.

Site-directed mutagenesis—Using a QuickchageTM site-directed mutagenesis kit

according to the manufacturer's manual, lysine (K) 295 in the mouse c-Src cloned in

the pBluescript vector was substituted with methionine (M) by changing the triplets

from AAG to ATG. Tyrosine (Y)199, tyrosine 188 or both sites in the human IKKβ

cloned in the pcDNA3.1 vector, or in the human GST-IKKβ(132-206) cloned in the

pGEX vector was substituted with phenylalanine (F) by change the triplet from TAC

to TTC. The mutated primers used were primer 1

(5'-CGAGGGTTGCCATCATGACTCTGAAGCCAGGCA-3') and primer 2

7


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

(3'-GCTCCCAACGGTAGTACTGAGACTTCGGTCCGT-5') for c-Src (K295M)

mutation, primer 3 (5’−GGGGACCCTGCAGTTCCTGGCCCCAGAGC−3’) and

primer 4 (3’−CCCCTGGGACGTCAAGGACCGGGGTCTCG−5’) for IKKβ

(Y188F) mutation, and primer 5 (5’−GGAGCAGCAGAAGTTCACAGTGAC

-CGTCG−3’) and primer 6 (3’−CCTCGTCGTCTTCAAGTGTCACTGGCAGC−5’)

for IKKβ (Y199F) mutation. DNA prepared from overnight cultures of picked

colonies using Miniprep (Qiagen) was subjected to restriction digest analysis and the

nucleotide changes confirmed by DNA sequencing. The mutated c-Src plasmid

containing the point mutation was digested with EcoRI and XhoI and inserted into the

pcDNA3(+) vector.

Transient transfection and luciferase assay—A549 cells, grown to 50% confluent in

six-well plates, were transfected with the human ICAM-1(pIC-339/0)/firely luciferase

(Luc) or κB-luc plasmid using Tfx-50 (Promega) according to the manufacturer's

recommendations. Briefly, reporter DNA (0.4 µg) and β-galactosidase DNA (0.2 µg;

plasmid pRK containing the β-galactosidase gene driven by the constitutively active

SV40 promoter, used to normalize the transfection efficiency were mixed with 0.6 µl

of Tfx-50 in 1 ml of serum-free DMEM. After 10-15 min incubation at room

temperature, the mixture was applied to the cells, then, 1 h later, 1 ml of complete

growth medium was added. On the following day, the medium was replaced with

fresh medium. Forty-eight hours after transfection, the cells were treated with

inhibitors (as indicated) for 30 min, then TNF-α or TPA was added for 6 h. Cell

extracts were then prepared and luciferase and β-galactosidase activities measured,

the luciferase activity being normalized to the β-galactosidase activity. In experiments

using dominant-negative mutants, cells were co-transfected with reporter (0.2 µg) and

β-galactosidase (0.1 µg) and either the dominant-negative NIK, IKKβ, or c-Src

mutant or the respective empty vector (0.4 µg).

In experiments using wt plasmids, cells were co-transfected with 0.2 µg of

reporter plasmid, 0.1 µg of β-galactosidase plasmid, 0.4 µg of the constitutively active

8


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

PKCα (A/E) plasmid, wt c-Src or NIK plasmid, or the respective empty vector, and

0.4 µg of the dominant-negative NIK, IKKβ, or c-Src mutant or the respective empty

vector.

Co-immunoprecipitation assay—Cell lysates containing 1 mg of protein were

incubated for 1 h at 4°C with 2 µg of anti-IKKβ or anti-c-Src Ab or with 4 µg of

anti-phosphotyrosine Ab, then 50 µl of 50% protein A-agarose beads were added and

mixed for 16 h at 4°C. The immunoprecipitates were collected and washed three times

with lysis buffer without Triton X-100, then Laemmli buffer was added and the

samples subjected to electrophoresis on 10% SDS polyacrylamide gels. Western blot

analysis was performed as described above using antibodies against phosphotyrosine,

IKKβ, or c-Src.

RESULTS

Effect of inhibitors of PKC, tyrosine kinase, or Src kinase on the induction of ICAM-1

promoter activity by TNF-α or TPA in A549 Cells—In our previous study (17), we

found that PKC and tyrosine kinase were involved in TNF-α–induced ICAM-1

expression. Transient transfection using the ICAM-1 promoter-luciferase construct,

pIC-339 (-339/0) was performed to elucidate the signaling pathway mediated by these

kinases. The pIC-339 construct contains the downstream NF-κB site (-189/-174)

responsible for mediating the induction of ICAM-1 promoter activity by TNF-α or

TPA (17). As shown in Figure 1, TNF-α led to a 2.9-fold increase in ICAM-1

promoter activity. When cells were pretreated with inhibitors of PKC (staurosporine),

tyrosine kinases (genistein or herbimycin A), or Src kinases (PP2), the

TNF-α-induced increase was inhibited by 69%, 84%, 65%, or 66%, respectively. TPA,

a direct PKC activator, resulted in a 3.5-fold increase in ICAM-1 promoter activity,

and this effect was inhibited by genistein, herbimycin A, or PP2 by 74%, 60% or 87%,

respectively. None of these inhibitors alone affected the basal luciferase activity (data

9


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

not shown).

Induction of IKK activation, IκBα degradation, and NF-κB-specific DNA-protein

complex formation by TNF-α and TPA, and the inhibitory effect of inhibitors of PKC,

tyrosine kinase, or Src kinase—Since TNF-α- and TPA-induced ICAM-1 promoter

activity in A549 cells is inhibited by the dominant-negative IKKβ mutant (17),

endogenous IKK activity was measured by immunoprecipitation with anti-IKKβ

antibody. When cells were treated with 10 ng/ml of TNF-α for 5, 10, 30, or 60 min,

maximal IKK activity was seen after 5 min (Fig. 2A), while maximal degradation of

IκB-α was seen after 10 min, IκB-α levels being restored to the resting level after 1 h

of treatment (Fig. 2B). In TPA-treated cells, maximal IKK activity was seen after 30

min of treatment (Fig 2A), whereas maximal IκB-α degradation was seen after 60

min (Fig 2B). The TNF-α-induced IKK activation was inhibited by a PKC, tyrosine

kinase, or Src kinase inhibitor by 56%, 49%, or 50%, respectively, while these same

inhibitors suppressed TPA-induced IKK activation by 71%, 91%, or 90%,

respectively (Fig. 3A). The IκBα degradation induced by TPA was reversed by PKC,

tyrosine kinase, and Src kinase inhibitors, but that induced by TNF-α was only

slightly affected by these inhibitors (Fig 3B). The effect of these inhibitors on TNF-α-

or TPA-induced NF-κB specific DNA-protein binding was examined. As shown in

Fig 3C, when cells were treated with TNF-α for 10 min, increased NF-κB-specific

DNA-protein binding was seen, and this effect was inhibited by PKC, tyrosine kinase,

and Src kinase inhibitors by 20%, 51%, and 48%, respectively. TPA treatment for 30

min also increased NF-κB specific DNA-protein binding and this was more

effectively suppressed by these inhibitors (75%, 74%, and 87%, respectively; Fig.

3C).

Induction of c-Src and Lyn activation by TNF-α and TPA, and the inhibitory effect of

inhibitors of PKC, tyrosine kinase, or Src kinase—TNF-α- or TPA-induced IKK

activation was inhibited by PKC, tyrosine kinase, and Src kinase inhibitors, indicating

10


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

the involvement of tyrosine kinase, or at least the Src family, downstream of PKC in

the induction of IKK activation. To further characterize the tyrosine kinase involved,

Western blot analysis using antibodies against the Src family members, c-Src, Lck,

Lyn, and Fyn, was performed. Since c-Src is reported to be expressed in platelets and

neuronal tissues, Lck in T lymphocytes, Lyn at high levels in platelets, and Fyn in the

brain and T lymphocytes, we used the Jurkat T cell line, the HL-60 promyelocytic cell

line, and brain as positive controls. As shown in Fig. 4A, c-Src was abundantly

expressed in brain, in Jurkat and HL-60 cells, and in the human alveolar epithelial cell

lines, NCI-H292 and A549. Lck was abundantly expressed in brain and Jurkat cells,

but only weakly expressed in NCI-H292 and A549 cells. Lyn was abundantly

expressed in brain and in Jurkat, HL-60, NCI-H292, and A549 cells, while Fyn was

only expressed in brain and in Jurkat and HL-60 cells. c-Src and Lyn in A549 cells

were therefore isolated by immunoprecipitation using anti-c-Src or anti-Lyn antibody

and their in vitro kinase activity measured using enolase as substrate. As shown in Fig.

4B, when A549 cells were treated with 10 ng/ml of TNF-α for 10, 30, or 60 min,

maximal c-Src and Lyn activity (enolase phosphorylation) was seen after 10 min and

was maintained to 60 min. In addition, marked autophosphorylation of c-Src and Lyn

was seen over the same time period. TPA (1 µM) also induced c-Src and Lyn

activation after 30 min treatment of A549 cells (Fig. 5). The TNF-α- and

TPA-induced activation of c-Src and Lyn was inhibited by staurosporine, herbimycin

A, and PP2 (Fig. 5).

Induction of ICAM-1 promoter activity by overexpression of PKCα or c-Src and the

inhibitory effect of dominant-negative mutants of c-Src or IKKβ —Since the TNF-α-

or TPA-induced activation of c-Src and Lyn was inhibited by PKC, tyrosine kinase, or

Src kinase inhibitors, this indicated that PKC-dependent c-Src and Lyn activation was

required to induce IKK and NF-κB activation in A549 cells. To further examine the

involvement of c-Src, a dominant-negative mutant was generated by site-directed

mutagenesis of mouse c-Src lysine (K) 295 to methionine (M). Overexpression of

11


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

c-Src (KM) attenuated the TNF-α- or TPA-induced ICAM-1 promoter activity (Fig.

6). The TNF-α-induced ICAM-1 promoter activity was also inhibited by the

dominant-negative NIK (KA) and IKKβ (KM) mutants, as previously reported (17).

In order to characterize the relationship between PKC, c-Src, NIK, and IKKβ,

overexpression of the constitutively active form of PKCα (A/E) or of wt c-Src, NIK,

or IKKβ was performed. Overexpression of PKCα (A/E) or wt c-Src, NIK, or IKKβ

significantly increased ICAM-1 promoter activity by 2-, 2.7-, 3.4-, or 2.5-fold,

respectively (Fig. 7A). The ICAM-1 promoter activity induced by overexpression of

PKCα (A/E) or c-Src wt was inhibited by the dominant-negative c-Src (KM) or IKKβ

(KM) mutant, but not by the NIK (KA) mutant. In contrast, the dominant-negative

IKKβ (KM) mutant, but not the c-Src (KM) mutant attenuated the promoter activity

induced by overexpression of NIK wt (Fig. 7B). These results indicate the

involvement of both the PKC/c-Src/IKKβ and NIK/IKKβ pathways in

TNF-α-induced ICAM-1 expression in A549 cells.

Induction by TNF-α or TPA of tyrosine phosphorylation of IKKβ and of the c-Src and

IKKβ association, and the inhibitory effect of PP2—Since c-Src-dependent IKK

activation was shown to be involved, co-immunoprecipitation of c-Src and IKKβ was

performed to examine whether c-Src directly regulates IKK activity through

phosphorylation of tyrosine residues. When cells were treated with TNF-α for 5, 10,

or 15 min, IKKβ was tyrosine-phosphorylated in a time-dependent manner, the

maximal effect being seen at 10 min; a similar effect was seen after 30 min treatment

with TPA (Fig. 8A). Both effects were inhibited by PP2 (Fig 8A). To demonstrate that

c-Src associated with IKKβ and phosphorylated its tyrosine residues, cell lysates

were immunoprecipitated with anti-IKKβ antibodies, then the immunoprecipitates

were separated by SDS-PAGE, transferred to membranes, and blotted with

anti-phosphotyrosine antibodies. As shown in Fig. 8B, tyrosine phosphorylation of

IKKβ was seen after TNF-α or TPA treatment, the effect being maximal at 10 or 30

min, respectively, and inhibited by PP2. When cell lysates were immunoprecipitated

12


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

with anti-phosphotyrosine antibody and immunoblotted with anti-IKKβ or

anti-c-Src antibody, both IKKβ and c-Src were shown to be tyrosine-phosphorylated

after TNF-α or TPA treatment, and these effects were again inhibited by PP2 (Fig.

8C). These results indicate that c-Src can associate with IKKβ and phosphorylate its

tyrosine residues after TNF-α or TPA stimulation. The association between c-Src and

IKK was further examined. Anti-IKKβ antibody was used to precipitate IKK from

A549 cells, then the immunoprecipitated proteins were subjected to Western blotting

using anti-c-Src antibody. As shown in Fig. 9A, an increased amount of c-Src

co-precipitated with IKKβ after TNF-α or TPA stimulation. In the converse

experiment in which c-Src was precipitated using anti-c-Src antibody, IKKβ was

shown to be associated with c-Src in a time-dependent manner after TNF-α or TPA

treatment (Fig. 9B). These results show an association between c-Src and IKKβ and

that IKKβ tyrosine residues were phosphorylated.

Inhibitory effect of the dominant-negative mutants, IKKβ (Y188F), IKKβ (Y199F) or

IKKβ (FF), on TNF-α- and TPA-induced ICAM-1 promoter activity and on the

PKCα- and c-Src-induced, but not the NIK-induced, increase in NF-κB activity—The

above experiments demonstrated that c-Src could directly interact with IKKβ and

phosphorylate its tyrosine residues after TNF-α or TPA stimulation. When the amino

sequences of subdomain VII and VIII in the kinase domain of PKCδ, AKT1 and

IKKα/β were aligned, the tyrosine residues were found to be conserved (Fig. 9C).

Hypothesizing that Tyr188 and/or Tyr199 of IKKβ were the targets for c-Src

phosphorylation after TNF-α or TPA stimulation, we used site-directed mutagenesis

to generate the dominant-negative tyrosine mutants, IKKβ (Y188F), IKKβ (Y199F)

and IKKβ (Y188F, Y199F). Overexpression of these mutants attenuated the TNF-α-

or TPA-induced ICAM-1 promoter activity, the double mutant having a greater

inhibitory effect than either of the single mutants (Fig. 10A). The dominant-negative

IKKβ (KM) mutant, with Lys44 mutated to methionine, had a similar inhibitory effects

to IKKβ (Y188F) or IKKβ (Y199F) on TNF-α- and TPA-induced ICAM-1 promoter

13


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

activity, while IKKβ (AA), with Ser177 and Ser181 mutated to alanine, was as effective

as IKKβ (Y188F) or IKKβ (Y199F) in inhibiting TNF-α-induced ICMA-1 promoter

activity, but had no effect on TPA-induced ICAM-1 promoter activity (Fig. 10A).

To further confirm the involvement of tyrosine phosphorylation in

PKCα/c-Src/IKKβ pathway and serine phosphorylation in NIK/IKKβ pathway, the

dominant-negative IKKβ mutants with either a tyrosine or serine mutation were

co-transfected with PKCα (A/E), wt c-Src or wt NIK to examine their inhibitory

effects on the constitutively active or wt plasmid-induced NF-κB activity. As shown

in Fig. 10B, PKCα (A/E)- or wt c-Src-induced NF-κB activity was inhibited by all

three tyrosine mutants, but not by the double serine mutant, whereas the converse was

true for NIK-induced NF-κB activity.

Since Tyr188 and Tyr199 in IKKβ were found to be critical for the

PKCα/c-Src/IKKβ pathway to elicit NF-κB activation, leading to induction of TNF-α-

or TPA-stimulated ICAM-1 promoter activity (Fig. 10), endogenous c-Src

phosphorylation of Tyr188 and Tyr199 in IKKβ was further examined. c-Src was

immunoprecipitated using anti-c-Src antibody and its ability to phosphorylate IKKβ

measured using GST-IKKβ (132-206) as an in vitro substrate. When cells were

treated with TNF-α or TPA, IKKβ was phosphorylated by c-Src in a time-dependent

manner. The maximal effect was seen at 10 min treatment with TNF-α or 30 min

treatment with TPA (Fig. 11A), and both effects were inhibited by PP2 (Fig. 11B).

The c-Src-dependent IKKβ phosphorylation was specific for Tyr188/Tyr199, as it was

not seen when either or both tyrosine residues were substituted with phenylalanines

(Fig 11C).

DISCUSSION

The PKC-dependent tyrosine kinase activation pathway is involved in

TNF-α-induced NF-κB activation and ICAM-1 expression in A549 alveolar epithelial

cells and in causing monocytes to adhere to these cells (17). The role and molecular

identity of the tyrosine kinase involved have been further characterized in the present

14


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

study. TNF-α- and TPA-induced ICAM-1 promoter activity were both inhibited by

PKC, tyrosine kinase, and Src kinase inhibitors, indicating the possible involvement

of the Src tyrosine kinase family downstream of PKC activation in the induction of

ICAM-1 expression. IKKβ, but not IKKα, is involved in the TNF-α- and TPA-induced

ICAM-1 promoter activity (17), and TNF-α- or TPA-induced stimulation of IKK

activity and parallel degradation of IκB-α was seen in the present study. The TNF-α-

and TPA-induced IKK activity and NF-κB specific DNA-protein binding were

attenuated by PKC, tyrosine kinase, and Src kinase inhibitors, indicating that the Src

tyrosine kinase family is involved downstream of PKC in the induction of IKKβ

activation leading to NF-κB activation and ICAM-1 expression in A549 cells.

Western blot analysis showed that c-Src and Lyn were abundantly expressed in A549

cells and that TNF-α and TPA induced activation of these two Src tyrosine kinases.

The c-Src and Lyn activation induced by either stimulus was also inhibited by PKC,

tyrosine kinase, and Src kinase inhibitors. Taken together, these results demonstrate

that the tyrosine kinase involved downstream of PKC is c-Src or Lyn. The

involvement of PKC/c-Src/IKKβ activation in TNF-α-induced ICAM-1 expression

was confirmed by the finding that the dominant-negative c-Src (KM) mutant

attenuated the TNF-α- and TPA-induced ICAM-1 promoter activity.

In nonstimulated cells, NF-κB dimers are present as cytoplasmic latent

complexes due to the binding of specific inhibitors, the IκBs, which mask their

nuclear localization signal. Following stimulation by proinflammatory cytokines, the

IκBs are rapidly phosphorylated at two conserved NH2-terminal serine residues and

this posttranslational modification is rapidly followed by their polyubiquitination and

proteasomal degradation (18, 19). This results in the unmasking of the nuclear

localization signal in NF-κB dimers, followed by their translocation to the nucleus,

binding to specific DNA sites (κB sites), and targeting of gene activation. The protein

kinase that phosphorylates IκBs in response to proinflammatory stimuli has been

15


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

identified biochemically and molecularly (20-24). Named IKK, it exists as a complex,

termed the IKK signalsome, which is composed of at least three subunits, IKKα

(IKK1), IKKβ (IKK2), and IKKγ (25). IKKα and IKKβ are very similar protein

kinases that act as the catalytic subunits of the complex (20-24). In mammalian cells,

IKKα and IKKβ form a stable heterodimer that is tightly associated with IKKγ, a

regulatory subunit (26). The IKKs bind NIK (22, 23), a member of the MAPK kinase

kinase family, that interacts with the TRAF6-associated IL-1 receptor complex or

TRAF2-associated TNF receptor complex, thereby linking IκB degradation and

NF-κB activation to IL-1β or TNF-α stimulation (27). The activities of both IKKα

and IKKβ are reported to be regulated by NIK (28). Our results showed that the

TNF-α-induced increase in ICAM-1 promoter activity was inhibited by the

dominant-negative NIK (KA) and IKKβ (KM), but not IKKα (KM) mutants (Fig. 6;

17). The dominant-negative IKKβ (KM) mutant attenuated wt NIK-induced ICAM-1

promoter activity, indicating the involvement of NIK/IKKβ pathway in

TNF-α-induced ICAM-1 expression.

To elucidate the relationship between the PKC/c-Src/IKKβ and NIK/IKKβ

pathways in TNF-α-induced ICAM-1 expression, overexpression of a constitutively

active PKCα plasmid and the wt c-Src, NIK, and IKKβ plasmids was used. These

plasmids all induced increase in ICAM-1 promoter activity, and their effects were

blocked by the dominant-negative IKKβ (KM) mutant. The effect of the constitutively

active PKCα (A/E) was blocked by the dominant-negative c-Src (KM) mutant, but

not by the NIK (KA) mutant. The effect of the wt c-Src plasmid on ICAM-1 promoter

activity was not affected by the dominant-negative NIK (KA) mutant, neither that of

the wt NIK plasmid was affected by the dominant-negative c-Src (KM) mutant (Fig.

7B). These results show that the PKC/c-Src/IKKβ and NIK/IKKβ pathways function

in parallel in the TNF-α-mediated induction of ICAM-1 expression in A549 cells. The

16


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

existence of these two pathways explains why inhibitors of PKC, tyrosine kinases, or

Src kinase could reverse TPA-, but not TNF-α-, induced IκB-α degradation, since

TNF-α could still act via the NIK/IKKβ pathway in the presence of these inhibitors.

c-Src is involved in NF-κB activation in bone marrow macrophages, U937 cells,

and B cells (29-31). In bone marrow macrophages, TNF-α induces activation of c-Src,

which associates with IκB-α and phosphorylates Tyr42 of IκB-α, leading to NF-κB

activation and IL-6 release (29). In contrast to the rapid degradation of

serine-phosphorylated IκB-α (32), tyrosine-phosphorylated IκB-α is not subject to

rapid proteolysis (29, 33). In the present study of TNF-α-induced ICAM-1 expression,

the downstream target of c-Src was IKKβ and rapid degradation of IκB-α was seen

(Fig. 2B). Involvement of a tyrosine kinase upstream of IKK activation has also been

reported in CD23 signaling in U937 cells (30) and in B cell antigen receptor

stimulation (31). A similar PKC-dependent c-Src activation pathway has been found

in human osteoblasts, in which FGF-2 increases N-cadherin expression, in A7r5

vascular smooth muscle cells, in which TPA induces Rho-dependent actin

reorganization, and in SH-SY5Y neuroblastoma cells, in which TPA induces Cas-Crk

complex formation (34-36). Furthermore, the PKC/c-Src/IKK pathway, here shown to

be involved in induction of ICAM-1 expression, might be a common signaling

pathway for inducible gene expression, as TNF-α-, IL-1β-, or IFN-γ-induced COX-2

or ICAM-1 expression in human alveolar epithelial cells also involves

PKC-dependent activation of c-Src or Lyn (16, 37, 38 and our unpublished data).

Since involvement of the PKC/c-Src/IKKβ pathway had been demonstrated,

tyrosine phosphorylation of IKKβ by c-Src was further examined. Several lines of

evidence show that this occurred. Firstly, in both crude cell lysates and

immunoprecipitates formed using anti-IKKβ antibody, IKKβ was found to be

tyrosine-phosphorylated after TNF-α or TPA stimulation. Secondly, in

immunoprecipitates formed using anti-phosphotyrosine antibody, both IKKβ and

17


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

c-Src were tyrosine-phosphorylated after treatment with TNF-α or TPA. Thirdly, all

these effects were inhibited by PP2. Fourthly, using either immunoprecipitation with

anti-IKKβ antibody followed by blotting with anti-c-Src antibody or

immunoprecipitation with anti-c-Src antibody followed by blotting with anti-IKKβ

antibody, an association between c-Src and IKKβ was demonstrated and shown to be

increased after TNF-α or TPA treatment. Fifthly, an in vitro kinase assay

demonstrated that c-Src directly phosphorylated IKKβ at Tyr188 and Tyr199. IKKβ is a

Thr/Ser kinase and phosphorylation of Ser177 and Ser181 in the kinase domain is

necessary for its activation, since substitution of these two residues with alanines

reduces IKKβ activity and leads to reduced Rel A nuclear translocation and

NF-κB-dependent gene expression (21, 39). MEKK1 and NIK are reported to

phosphorylate these two serine residues (40). The present experiments further

demonstrated Tyr188 and Tyr199 phosphorylation by c-Src via a PKC-dependent

activation pathway. This tyrosine phosphorylation of IKKβ was essential for

TNF-α-induced ICAM-1 expression in A549 cells, since the dominant-negative

mutants, IKKβ (Y188F), IKKβ (Y199F) or IKKβ (FF), abrogated the effects of both

TNF-α and TPA. Tyrosine phosphorylation of Thr/Ser kinases, such as PKCs and Akt,

has also been reported to be important for their activation (41, 42). Akt activation by

extracellular stimuli is a multistep process involving translocation and

phosphorylation. Two phosphorylation sites, Thr308 and Ser473, have been shown to be

critical for growth factor-induced activation of Akt (43-45). In addition to the

phosphorylation of these two sites, tyrosine phosphorylation plays an important role

in regulation of Akt activity. Both the EGF-induced tyrosine phosphorylation and

kinase activity of Akt are blocked by PP2, and Src phosphorylates Tyr315 and Tyr326 of

Akt both in vivo and in vitro (41). It is noteworthy that these tyrosine residues are

conserved in about 50% of Ser/Thr kinases and that phosphorylation of the

corresponding residues, Tyr512 and Tyr523, in PKCδ is also critical for PKCδ activation

in response to H2O2 (42). Phosphorylation of the two conserved tyrosine residues in

the kinase domains of Ser/Thr kinases may therefore be a general mechanism by

18


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

which Akt, PKCδ, and IKKβ are regulated (41, 42, and present study; Fig. 9C). The

Src tyrosine kinase family therefore directly regulates IKKβ activity via

phosphorylation at Tyr188 and Tyr199, rather than solely by NIK-mediated

phosphorylation at Ser177 and Ser181, as previously suggested (27). Three findings

further support the notion that PKC/c-Src/IKKβ pathway induces tyrosine

phosphorylation, while the NIK/IKKβ pathway induces serine phosphorylation.

Firstly, NF-κB activity induced by PKCα (A/E) or wt c-Src was inhibited by the

tyrosine mutants, IKKβ (Y188F), IKKβ (Y199F), or IKKβ (FF), but not by IKKβ

(AA), in which Ser177 and Ser181 are mutated. Secondly, wt NIK-induced NF-κB

activity was inhibited by IKKβ (AA), but not by IKKβ (Y188F), IKKβ (Y199F), or

IKKβ (FF) (Fig. 10B). Thirdly, TPA-induced ICAM-1 promoter activity was not

affected by IKKβ (AA) (Fig. 10A). Our data demonstrate, for the first time, that, in

addition to phosphorylation of Ser177 and Ser181, Tyr188 and Tyr199 phosphorylation of

IKKβ is required for its full activation and biological functions.

In summary, the signaling pathways involved in TNF-α-induced ICAM-1

expression in A549 cells have been further explored. In addition to activating the

NIK/IKKβ pathway, TNF-α activates the PKC-dependent c-Src pathway. These two

pathways converge at IKKβ, and are, respectively, responsible for phosphorylation of

Ser177/Ser181 and Tyr188/Tyr199 of IKKβ, then go on to activate NF-κB, via serine

phosphorylation and degradation of IκB-α, then, finally, initiate of ICAM-1

expression. A schematic diagram showing the involvement of these two pathways in

TNF-α –induced ICAM-1 expression in A549 epithelial cells is shown in Fig. 12.

Acknowledgement: This work was supported by a research grant from the National

Science Council of Taiwan.

REFERENCES

1. Springer, T.A. (1990) Nature 346, 425–434.

2. Wegner, C.D., Gundel, R.H., Reilly, P., Haynes, N., Letts, L.G., and Rothlein, R.

19


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

(1990) Science 247, 456–459.

3. Isobe, M., Yagita, H., Okmura, A.K., and Ihara, A. (1992) Science 255,

1125–1127.

4. Springer, T.A. (1994) Cell 76, 301–314.

5. Carlos, T., Kovach, N., Rosa, M., Newman, B., Wayner, E., Benjamin, C.,

Osborn, L., Lobb, R., and Harlan, J. (1991) Blood 77, 2266–2271.

6. Osborn, L., Hession, C., Tizard, R., et al. (1989) Cell 59, 1203-1211.

7. Dustin, M.L., and Springer, T.A. (1988) J. Cell Biol. 107, 321-331.

8. Smith, C.W., Marlin, S.D., Rothlein, R., Toman, C., and Anderson, D.C. (1989) J.

Clin. Invest. 83, 2008-2017.

9. Staunton, D.E., Marlin, S.D., Stratowa, C., Dustin, M.L., and Springer, T.A.

(1988) Cell 52, 925-933.

10. Bloemen, P.G., Van Den Tweel, M.C., Henricks, P.A. J., Engel, F., Wagenaar,

S.E., Rutten A.A.J.J.L., and Nijkamp, F.P. (1993) Am. J. Respir. Cell Mol. Biol.

9, 586–593

11. Tosi, M.F., Stark, J.M., Smith, C.W., Hamedani, A., Gruenert, D.C., and Infeid,

M.D. (1992) Am. J. Respir. Cell. Mol. Biol. 7, 214-221.

12. Pobers, J.S., Gimbrone, M.A., Lapierre, L.A., Mendrick, D.L., Fiers, W.,

Rothelein, R., and Springer, T.A. (1986) J. Immunol. 137, 1893-1896.

13. Lane, T.A., Lamkin, G.E., and Wancewicz, E. (1989) Biochem. Biophys. Res.

Commun. 161, 945-952.

14. Wertheimer, S.J., Myers, C.L., Wallace, R.W. and Park, T.P. (1992) J. Biol. Chem.

267, 12030-12035.

15. Voraberger, G., Shafer, R. and Stratowa, C. (1991) J. Immunol. 147, 2777-2786.

16. Chen, C.C., Chen, J.J., and Chou, C.Y. (2000) Mol. Pharmacol. 58, 1479-1489.

17. Chen, C.C., Chou, C.Y., Sun, YT and Huang, W.C. (2001) Cell. Signal. 13,

543-553.

18. Thanos, D., and Maniatis, T. (1995) Cell 80, 529-531.

19. Chen, Z.J., Parent, L., and Maniatis, T. (1996) Cell 84, 853-862.

20


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

20. DiDonato, J.A., Hayakawa, M., Rothwarf, D.M., Zandi, E., and Karin, M. (1997)

Nature 388, 548-554.

21. Mercurio, F., Zhu, H., Murry, B.W., Shevchenko, A., Bennett, B.L., Li, J.W.,

Young, D.M., Barbosa, M., Mann, M., Manning, A., and Rao, A. (1997) Science

278, 860-866.

22. Regnier, C.H., Song, H.Y., Gao, X., Goeddel, D.V., Cao, Z., and Rothe, M.,

(1997) Cell 90, 373-383.

23. Woronicz, J.D., Gao, X., Cao, Z., Rothe, M., and Goeddel, D.V. (1997) Science

278, 866-869.

24. Zandi, E., Rothwarf, D.M., Delhase, M., Hayakawa, M., and Karin, M. (1997)

Cell 91, 243-252.

25. Zandi, E., and Karin, M. (1999) Mol. Cell. Biol. 19, 4547-4551.

26. Rothwarf, D.M., Zandi, E., Natoli, G., and Karin, M. (1998) Nature 395,

297-300.

27. Malinin, N.L., Boldin, M.P., Rovalenko, A.V., and Wallach, D. (1997) Nature

385, 540-544.

28. Nakano, H., Shindo, M., Sakon, S., Nishinaka, S., Mihara, M., Yagita, H., and

Okumura, K. (1998) Proc. Natl. Acad. Sci. 95, 3537-3542.

29. Abu-Amer, Y., Ross, F.P., McHugh, K.P., Livolsi, A., Peyron, J.F., and

Teitelbaum, S.L. (1998) J. Biol. Chem. 273, 29417-29423.

30. Ten, R.M., McKinstry, M.J., Trushin, S.A., Asin, S., and Paya, C.V. (1999) J.

Immunol. 163, 3851-3857.

31. Petro, J.B., Rahman, S.M., Ballard, D.W., and Khan, W.N. (2000) J. Exp. Med.

191, 1745-1754.

32. Baldwin AS. (1996) Annun. Rev. Immunol. 14, 649-683.

33. Imbert, V., Rupec, R. A., Livolsi, A., Pahl, H. L., Traenckner, E. B.-M.,

Mueller-Dieckmann, C., Farahifar, D., Rossi, B., Auberger, P., Baeuerle, P. A.,

and Peyron, J.F. (1996) . Cell 86, 787-798.

34. Debiais, F., Lemonnier, J., Hay, E., Delannoy, P., Caverzasio, J., and Marie, P.J.

21


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

(2001) J. Cell. Biochem. 81, 68-81

35. Brandt, D., Gimona, M., Hillmann, M., Haller, H., and Mischak, H. (2002) J.

Biol. Chem. 277, 20903-20910.

36. Bruce-Staskal, P.J., and Bouton, A.H. (2001) Exp.Cell Res. 264, 296-306.

37. Chang, Y.C., Holtzman, M.J., and Chen, C.C. (2002) J. Biol. Chem. 277,

7118-7126

38. Chen, C.C., Sun, Y.T., Chen, J.J., and Chiu, K.T. (2001) J. Immunol. 165,

2719-2728.

39. Delhase, M., Hayakawa, M., Chen, Y., and Karin, M. (1999) Science 284,

309-313.

40. Nemoto, S., Didonato, J.A., and Lin, A. (1998) Mol. Cell. Biol. 18, 7336–7343.

41. Chen, R., Kim, O., Yang, J., Sato, K., Eisenmann, K.M., McCarthy, J., Chen, H.,

and Qiu, Y. (2001) J. Biol. Chem. 276, 31858-31862.

42. Konishi, H., Tanaka, M., Takemura, Y., Matsuzaki, H., Ono, Y., Kikkawa, U.,

and Nishizuka, Y. (1997) Proc. Natl. Acad. Sci. U.S.A. 94, 11233-11237.

43. Alessi, D. R., Andjelkovic, M., Caudwell, B., Cron, P., Morrice, N., Cohen, P.,

and Hemmings, B. A. (1996) EMBO J. 15, 6541-6551.

44. Stokoe, D., Stephens, L. R., Copeland, T., Gaffney, P. R., Reese, C. B., Painter,

G. F., Holmes, A. B., McCormick, F., and Hawkins, P. T. (1997) Science 277,

567-570.

45. Stephens, L., Anderson, K., Stokoe, D., Erdjument-Bromage, H., Painter, G. F.,

Holmes, A. B., Gaffney, P. R., Reese, C. B., McCormick, F., Tempst, P.,

Coadwell, J., and Hawkins, P. T. (1998) Science 279, 710-714.

22


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Figure legends:

Fig. 1. Effect of various inhibitors on TNF-α- or TPA-induced ICAM-1 promoter

activity in epithelial cells. A549 cells were transfected with the pIC339

luciferase expression vector as described under “Experimental Procedures”,

then pretreated for 30 min with vehicle, 300 nM staurosporine, 30 µM

genistein, 1 µM herbimycin A, or 10 µM PP2 before incubation for 6 h

with 10 ng/ml of TNF-α or 1 µM TPA. Luciferase activity was then

measured as described under “Experimental Procedures”, normalized to

the β-galactosidase activity and expressed as the mean±S.E.M. for three

independent experiments performed in triplicate. *: P < 0.05, compared

to TNF-α or TPA alone.

Fig. 2. Kinetics of TNF-α-induced IKK activation and IκB-α degradation. A549

cells were treated with 10 ng/ml of TNF-α or 1 µM TPA for 5, 10, 30, or

60 min, then cell lysates were prepared. In (A), cell lysates were

immunoprecipitated with anti-IKKβ antibody, then the kinase assay (KA)

and autoradiography for phosphorylated GST-IκBα (1-100) were

performed on the precipitates as described under “Experimental

Procedures”. Levels of immunoprecipitated IKKβ protein were estimated

by Western blotting (WB) using anti-IKKβ antibody. In (B), cytosolic

levels of IκB-α were measured using anti-IκB-α antibody as described

under “Experimental Procedures”.

23


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Fig. 3. Effect of various inhibitors on TNF-α- or TPA-induced IKK activity, IκBα

degradation, and NF-κB-specific DNA-protein complex formation in

epithelial cells. A549 cells were pretreated for 30 min with 300 nM

staurosporine, 1 µM herbimycin A, or 10 µM PP2 before incubation with

10 ng/ml of TNF-α for 10 min or 1 µM TPA for 30 min, then whole cell

lysates or nuclear extracts were prepared. In (A), whole cell lysates were

immunoprecipitated with anti-IKKβ antibody and the kinase assay (KA)

and autoradiography for phosphorylated GST-IκBα (1-100) performed on

the precipitates as described under “Experimental Procedures”. Levels of

immunoprecipitated IKKβ were estimated by Western blotting (WB) using

anti-IKKβ antibody. In (B), cytosolic levels of IκB-α were measured by

Western blotting using anti-IκB-α antibody as described under

“Experimental Procedures”. In (C), the NF-κB specific DNA-protein

activity in nuclear extracts was determined by EMSA as described under

“Experimental Procedures”.

Fig. 4. Src family expression and time-dependent activation of c-Src or Lyn by

TNF-α in A549 cells. In (A), Jurkat, HL-60, NCI-H292, or A549 cells and

brain lysates were prepared and subjected to Western blotting using

antibodies against c-Src, Lck, Lyn, or Fyn as described in the Methods. In

(B), A549 cells were treated with 10 ng/ml of TNF-α for 10, 30, or 60 min,

then whole cell lysates were prepared and immunoprecipitated with

anti-c-Src or anti-Lyn antibody. The kinase assay (KA) and

autoradiography for phosphorylated enolase were performed on the

precipitates as described under “Experimental Procedures”. Levels of

immunoprecipitated c-Src or Lyn were estimated by Western blotting (WB)

using anti-c-Src or anti-Lyn antibody, respectively.

24


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Fig. 5. Effect of various inhibitors on TNF-α- or TPA-induced c-Src or Lyn

activation in epithelial cells. A549 cells were pretreated with 300 nM

staurosporine, 1 µM herbimycin A, or 10 µM PP2 for 30 min before

incubation with 10 ng/ml of TNF-α for 10 min or 1 µM TPA for 30 min.

Whole cell lysates were prepared and immunoprecipitated with anti-c-Src

or anti-Lyn antibody and the kinase assay (KA) and autoradiography for

phosphorylated enolase were performed on the precipitate as described

under “Experimental Procedures”. Levels of immunoprecipitated c-Src or

Lyn were estimated by Western blotting (WB) using anti-c-Src or anti-Lyn

antibody, respectively.

Fig. 6. Effect of various dominant-negative mutants on TNF-α- or TPA-induced

ICAM-1 promoter activity in A549 cells. A549 cells were co-transfected

with pIC339 and the dominant-negative c-Src (K295M), NIK (KA), or

IKKβ (KM) mutant, or the respective empty vector, then treated for 6 h

with 10 ng/ml of TNF-α or 1 µM TPA. Luciferase activity was then

measured as described under “Experimental Procedures” and the results

normalized to the β-galactosidase activity and expressed as the

mean±S.E.M. for three independent experiments performed in triplicate.

*: P < 0.05, **: P<0.01 compared to TNF-α or TPA alone.

Fig. 7. Effect of various dominant-negative mutants on wild-type

plasmid-induced ICAM-1 promoter activity. In (A), A549 cells were

co-transfected with pIC339 and the constitutively active form of

PKCα (A/E), wild-type c-Src, IKKβ, or NIK, or the respective empty

vector. In (B), A549 cells were co-transfected for 24 h with PKCα (A/E),

wild-type c-Src, or NIK and c-Src (K295M), IKKβ (KM), or NIK (KA).

Luciferase activity was then assayed as described under “Experimental

Procedures”, and the results normalized to the β-galactosidase activity and

expressed as the mean±S.E.M. for three independent experiments

performed in triplicate. *:P < 0.05 **: P<0.01 compared to the control

vector. 25


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Fig. 8. Tyrosine phosphorylation of IKKβ induced by TNF-α or TPA and the

inhibitory effect of PP2. Control cells or cells pretreated for 30 min with

10 µM PP2 were stimulated with TNF-α for 5, 10, or 15 min or with TPA

for 10 or 30 min. In (A), crude lysates were prepared. In (B) and (C), equal

amounts (1 mg) of cell lysate were immunoprecipitated (IP) with

anti-IKKβ (A) or anti-phosphotyrosine (PY) (B) antibodies. Crude lysates

and immunoprecipitated proteins were separated by SDS-PAGE on a 10%

gel and immunoblotted (WB) with anti-phosphotyrosine (PY) (A, B),

anti-IKKβ (C), or anti-c-Src (C) antibodies or reprobed with anti-IKKβ (A,

B) antibody.

Fig. 9. c-Src co-immunoprecipitates with IKKβ after TNF-α or TPA treatment.

A549 cells were treated with TNF-α for 5, 10, or 15 min or with TPA for

10 or 30 min. Equal amounts (1 mg) of cell lysate were

immunoprecipitated (IP) with anti-IKKβ (A) or anti-c-Src (B) antibodies.

Immunoprecipitated proteins were separated by SDS-PAGE on a 10% gel

and immunoblotted (WB) with anti-IKKβ or anti-c-Src antibodies. In (C),

alignment of subdomains VII and VIII of the kinase domains of PKCδ,

Akt1, and IKKα/β.

26


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Fig. 10. Effect of the dominant-negative tyrosine mutants, IKKβ (Y188F), IKKβ

(Y199F), and IKKβ (FF), on TNF-α- or TPA-induced ICAM-1 promoter

activity and on wild-type plasmid-induced NF-κB activity. In (A), A549

cells were co-transfected with pIC339 plus one of the dominant-negative

tyrosine mutants [IKKβ (188F), IKKβ (Y199F), or IKKβ (FF)],

dominant-negative mutant [IKKβ (KM)], or dominant-negative serine

mutant [IKKβ (AA)], or the respective empty vector, then treated with 10

ng/ml of TNF-α or 1 µM TPA for 6 h. In (B), A549 cells were

co-transfected with κB-luc and the constitutively active form of PKCα

(A/E), wild type c-Src, or wild-type NIK, plus the dominant-negative

mutants, IKKβ (Y188F), IKKβ (Y199F), IKKβ (FF), or IKKβ (AA), or the

respective empty vector. Luciferase activity was then measured as

described under “Experimental Procedures” and the results normalized to

the β-galactosidase activity and expressed as the mean±S.E.M. for three

independent experiments performed in triplicate. *: P < 0.05, **: P<0.01

compared to TNF-α or TPA alone (A) or wild type alone (B).

27


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Fig. 11. c-Src-dependent phosphorylation of IKKβ at Y188 and Y199 is induced by

TNF-α or TPA and inhibited by PP2. A549 cells were treated with 10

ng/ml of TNF-α or 1µM TPA for 5, 10, 30, or 60 min (A) or pretreated

with 10 µM PP2 for 30 min before stimulation with TNF-α for 10 min or

TPA for 30 min (B). Whole cell lysates were prepared and

immunoprecipitated with anti-c-Src antibody, then a kinase assay (KA)

and autoradiography for phosphorylated GST-IKKβ (132-206) were

performed as described under “Experimental Procedure”. The amount of

immunoprecipitated c-Src was detected by Western blotting (WB) using

anti-c-Src antibody. In (C), cells were treated with 10 ng/ml of TNF-α for

10 min or 1uM TPA for 30 min, the whole cell lysates were

immunoprecipitated with anti-c-Src antibody followed by kinase assay

(KA) and autoradiography for phosphorylated wt GST-IKKβ(132-206),

GST-IKKβ(132-206) (Y188F), GST-IKKβ (132-206) (Y199F), or

GST-IKKβ(132-206) (Y188F; Y199F). The amount of

immunoprecipitated c-Src was detected by Western blotting (WB) using

anti-c-Src antibody. Amount of GST-IKKβ (132-206) were detected by

Coomassie Brilliant blue staining.

Fig. 12. Schematic representation of the signaling pathways involved in

TNF-α-induced ICAM-1 expression in A549 epithelial cells. TNF-α binds

to TNFR1 and activates PC-PLC to induce PKCα and c-Src activation,

leading to tyrosine phosphorylation of IKKβ at Tyr188 and Tyr199. TNF-α

also activates TRAF2 to induce NIK activation, leading to serine

phosphorylation of IKKβ at Ser177 and Ser181. These two pathways

converge at IKKβ, resulting in phosphorylation and degradation of IκB-α,

stimulation of NF-κB in the ICAM-1 promoter, and, finally, initiation of

ICAM-1 expression.

28


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Wei-Chien Huang, Jun-Jie Chen and Ching-Chow Chenintercellular adhesion molecule-1 expression

-inducedα is involved in TNF-βc-Src-dependent trosine phosphorylation of IKK

published online January 6, 2003J. Biol. Chem.

10.1074/jbc.M208521200Access the most updated version of this article at doi:

Alerts:

When a correction for this article is posted•

When this article is cited•

to choose from all of JBC's e-mail alertsClick here


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/lookup/doi/10.1074/jbc.M208521200

http://www.jbc.org/cgi/alerts?alertType=citedby&addAlert=cited_by&cited_by_criteria_resid=jbc;M208521200v1&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/early/2003/01/06/jbc.M208521200.citation

http://www.jbc.org/cgi/alerts?alertType=correction&addAlert=correction&correction_criteria_value=early/2003/01/06/jbc&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/early/2003/01/06/jbc.M208521200.citation

http://www.jbc.org/cgi/alerts/etoc

http://www.jbc.org/

involvement of pkc-dependent c-src and ikk activation in tnf-a

Documents