new england home's connecticut

142

Upload: network-communications-inc

Post on 12-Feb-2016

234 views

Category:

Documents


0 download

DESCRIPTION

Fall 2010 Celebrating Fine Design and Architecture

TRANSCRIPT

Page 2: New England Home's Connecticut
Page 3: New England Home's Connecticut
Page 4: New England Home's Connecticut
Page 5: New England Home's Connecticut

OPENING FALL ����: NEW YORK, NY & LOS ANGELES, CA • � STORES IN FAIRFIELD COUNTY, CT

FOR STORE LOCATIONS & UPDATES ON OUR NEW STORES VISIT LILLIANAUGUST.COM

������������ ���������

LOVE HOW YOU LIVEWELCOME TO LILLIAN AUGUST WHERE OUR MISSION

IS SIMPLE: To provide you with the best products andthe best services available in Home Furnishings today.For over 20 years we have been creating a one-stopresource with extraordinary merchandise, enduring quality,thoughtful service and value for all your home furnishingsand interior design needs. We are a one-of-a-kindcombination of furniture showroom, gift store, antiqueemporium and full-service design studio - we are passionateabout what we do and the relationships that we form.We love to inspire, we love to create, we love to help.Experience Lillian August and Love How You Live.

Page 6: New England Home's Connecticut

Residential Design & Build Firm New Construction & Renovations

203.972.1409 GardinerLarson.com

Page 7: New England Home's Connecticut

&&Gardiner Comfort + Beauty + Quality

H O M E SL a r s o n • CONNECTICUT • WESTCHESTER •

• THE HAMPTONS • VERMONT •

Page 8: New England Home's Connecticut
Page 9: New England Home's Connecticut

westport, ct | 203.341.0413 | [email protected] | www.marsilverdesign.com

“everyone should have a home that relaxes them, renews their spirit, and feeds their soul.”-mar

Page 10: New England Home's Connecticut

HEMINGWAY

CUSTOM CABINETRYANDARCHITECTURAL MILLWORK

Page 11: New England Home's Connecticut

The finest truly custom designed kitchen cabinetry and built-in furniture

for your entire home. Handcrafted in our own facility in Fairfield County.

3400 Fairfield Avenue | Black Rock | CT 06605

203.382.0300 | WWW.HEMINGWAYCUSTOM.COM

Page 12: New England Home's Connecticut

DesignBoutique&Café

Take time for tea at The Drawing Room!

Voted Fairfield County's favorite spot for lunch

and afternoon tea!

THE DRAWING ROOMThe destination for tea enthusiasts,

inspiration seekers and design fanatics

f ive suburban avenue cos cob ct 06807203.661.3737

www.thedrawingroom.cc

visi t us online for fabulous shopping,

Page 13: New England Home's Connecticut

Kenleigh and Mike ex plore the big blue marblegathering ingredients for authentic design,

unique home goods and enticing cuisine.

Falling in love again a t The Drawing Room

exit 5

exit 4

private sales and special events you won’t want to miss!

Design from that place

where your heartfound its flutter.

Page 14: New England Home's Connecticut

www.escapesinc.com

203-966-2843

Imagine... an endless vacation at home

Page 15: New England Home's Connecticut
Page 16: New England Home's Connecticut

12 New England Home’s Connecticut Fall 2010

I was last in school. Yet even after so long, something aboutthe onset of autumn still gives me the pleasantly expectantfeeling that it’s time to buckle down, be done with summerfoolishness and get back to work. Odd, really, since typicallyI’ve been working very hard all along. But there we are.

The effect is undoubtedly enhanced by living in Boston,whose streets and stores, restaurants and subways, becomevery visibly more packed as September draws nigh. Here thecrisper days of early fall invariably resound with the chatterof eager students pouring into town from far and wide.

I try telling myself it’s not only the school year that’s gear-ing up. The truly weighty events of the social and cultural calendars also resume, leaving as mere memories the whiteclothes and outdoor frivolities of the warmer months. So it’snose-to-the-grindstone time in many different ways. But real-ly, somewhere deep down in my heart, I’m just headed backto class, ready to plunge again into a joyous sea of learning.

What exactly does any of this have to do with architecture

and interiors? Maybe it’s that I’m somehow a born academic(that might certainly explain a slight tendency to lecture—have you noticed?), but the suppressed excitement of my annual back-to-school anticipation correlates directly withhow I, and this magazine, approach design.

It’s easy to assume that the fluffiest subjects are our jour-nalistic meat and drink: this season’s colors, say, or how muchlonger the vogue for animal prints will last. But underlyingthese (literally) surface concerns is always a more serious sub-text. How can this particular space be made more efficient forthis particular family’s needs? How seamlessly does this furni-ture plan adapt to an intimate gathering or a cocktail partyfor dozens? Does this kitchen layout make sense?

The depth of attention paid to issues such as usability,scale and integration is one of the surest ways to distinguishthe design amateur from the design professional. Do you seethe rhyme a chairback’s particular curve makes with the ten-drils of the oriental rug below? And the play of curtain andupholstery hues that don’t quite match but make a harmo-nious fellowship? And how the thickness of a chandelier’sarms relates to the chunkiness of the fireplace mantel? If thesigns are there but don’t smack you between the eyes, a true,and truly educated, talent has been at work.

I don’t mean to say that style, pattern and finish aren’t im-portant and fun; like summer’s relaxing pursuits they play acrucial role in a well-balanced life. But there should alwaysbe that back-to-school seriousness beneath. However flightya designer’s manner, if she or he is worth the hire it masks atough kernel of expertise and hard work—and the constantdrive to keep informed, keep exploring, keep learning.

The success of our first issue last spring makes me thinkyou share our delight in discovery. In fact, your reception hasbeen so welcoming that we’ll be publishing quarterly in 2011.So look for us again in January as we start our next term.

From the Editor

Always theSerious Student

MIC

HA

EL

FE

IN

Kyle Hoepner, [email protected]

IT HAS BEEN MORE YEARS THAN I CARE TO THINK SINCE

Page 18: New England Home's Connecticut

exclusively at Parc Monceau...

Offering ourParc Monceauclientelea creativecollaborationof styleand vision.

TARA SHAW

Page 20: New England Home's Connecticut

16 New England Home’s Connecticut Fall 2010

On the cover: A quiet palette and uncluttered design bring serenity to a Haddam home. Photographby Laura Moss. To see more, turn to page 74.

Featured Homes50 Details, Details Careful attention to the fine points turns a waterfront home from simple

to simply stunning. ARCHITECTURE: MCKEE PATTERSON, AUSTIN PATTERSON DISSTON ARCHITECTS •

INTERIOR DESIGN: NANCÉ J. VINGNEAU, VIGNEAU & ASSOCIATES INTERIORS • PHOTOGRAPHY: LAURA

MOSS • TEXT: ERIN MARVIN • PRODUCED BY STACY KUNSTEL

62 European Union In a perfect marriage of architecture and interior design, a Greenwichhouse rooted in Continental tradition enfolds its owners in a magical blend of comfort and luxury. ARCHITECTURE: ALEX KAALI-NAGY • INTERIOR DESIGN: KAREN KAALI-NAGY • LANDSCAPE

ARCHITECT: WESLEY STOUT ASSOCIATES • PHOTOGRAPHY: MICHAEL PARTENIO • TEXT: MEGAN

FULWEILER • PRODUCED BY STACY KUNSTEL

74 A Backdrop for Living A simple palette serves as a serene setting for a creative womanwhose life—both personally and professionally—centers on her Haddam home. PHOTOGRAPHY:

LAURA MOSS • WRITTEN AND PRODUCED BY STACY KUNSTEL

86 Heart of the Matter A desire for a bigger, better kitchen inspired a New Canaan family tobuild a whole new house where the kitchen of their dreams takes center stage. ARCHITECTURE:

MICHAEL SMITH • INTERIOR DESIGN: HEATHER MCWILLIAM-AUTORE • LANDSCAPE ARCHITECTURE: JOHN

C. DE FEO, MODEL PROPERTIES • PHOTOGRAPHY: LAURA MOSS • TEXT: PAULA M. BODAH • PRODUCED

BY STACY KUNSTEL

Departments12 From the Editor

28 Interview: Christy MacLear The outgoing head of New Canaan’s Glass House looks to itsfuture even as she prepares to move on. BY KYLE HOEPNER • PORTRAIT BY JULIE BIDWELL

40 Made Here: Dream Weavers In an environmentally friendly South Norwalk workspace,Elizabeth Eakins rugs are hand-woven with a nod to the past and an eye to the future. BY

NENA DONOVAN LEVINE • PHOTOGRAPHY BY BRUCE G. ANDO

• • •100 Design Life Our candid camera snaps recent gatherings that celebrate architecture and design.

108 Perspectives Three area designers imagine a handsome and cozy library.Wish List: Mar Silver shares her favorite home design products 116

120 New in Showrooms Unique, beautiful and now appearing at Connecticut shops and show-rooms. BY ERIN MARVIN

127 Resources A guide to the professionals and products in this issue’s featured homes.

134 Advertiser Index

136 Sketch Pad Architect and furniture designer David Harlan shows the design evolution of acustom dining table.

2862

116

50

FALL 2010VOLUME 1, NUMBER 2

Page 21: New England Home's Connecticut

47 Pine Street • New Canaan, CT 203.972.7722 • [email protected]

New Construction • Additions • Renovations • Restorations • Tear Downs • Green BuildingLicensed in: Connecticut and Westchester County

www.OlsonDevelopmentLLC.com

Page 22: New England Home's Connecticut
Page 23: New England Home's Connecticut

www.putnamkitchens.com

Dreams to Reality...

Page 24: New England Home's Connecticut

20 New England Home’s Connecticut Fall 2010

EDITOR-IN-CHIEF

Kyle [email protected]

HOMES EDITOR

Stacy [email protected]

SENIOR EDITOR

Paula M. [email protected]

MANAGING EDITOR

Erin [email protected]

ASSISTANT ART DIRECTOR

Jared [email protected]

CONTRIBUTING EDITORS

Cheryl and Jeffrey [email protected] [email protected]

CONTRIBUTING WRITERS

Regina Cole, Caroline Cunningham,Megan Fulweiler, Robert Kiener, KaraLashley, Christine Temin

CONTRIBUTING PHOTOGRAPHERS

Robert Benson, Tria Giovan, SamGray, John Gruen, Warren Jagger,Richard Mandelkorn, Laura Moss,Michael Partenio, Greg Premru, NatRea, Eric Roth, James R. Salomon,Brian Vanden Brink

EDITORIAL INTERN

Carling Sturino

• • •Editorial and Advertising Office530 Harrison Ave., Suite 302Boston, MA 02118(617) 938-3991(800) 609-5154

Editorial SubmissionsDesigners, architects, builders and home -owners are invited to submit projects foreditorial consideration. For informa tionabout submitting projects, e-mail emarvin@nehome mag.com.

Letters to the EditorWe’d love to hear from you! Write to us atthe above address, fax us at (617) 663-6377or e-mail us at letters @nehome mag .com.

SubscriptionsTo subscribe to New England Home ($19.95for one year) or for customer service, call(800) 765-1225 or visit our Web site, www.nehomemag .com.

Upcoming EventsAre you planning an event that we canfeature in our Calendar of Events? E-mail information to calendar @nehomemag .com, or mail to Calendar Editor, NewEngland Home, 530 Harrison Ave., Suite302, Boston, MA 02118.

PartiesWe welcome photographs from design- or architecture-related parties. Send high-resolution photos with information aboutthe party and the people pictured topbodah @nehome mag .com.

D a v i d D. H a r l a nA r c h i t e c t s , l l c

new haven, connecticut www.ddharch.com

A. Defne Veral

I N T E R I O R S L L C ,

Page 26: New England Home's Connecticut

22 New England Home’s Connecticut Fall 2010

PUBLISHER

Betsy Abeles [email protected]

SENIOR ACCOUNT EXECUTIVES

Roberta Thomas [email protected] [email protected] [email protected] [email protected] [email protected]

PRODUCTION MANAGER

Glenn [email protected]

SALES COORDINATOR

Janelle [email protected]

CIRCULATION MANAGER

Kurt Coey

NEWSSTAND MANAGER

Bob Moenster

• • •

Editorial and Advertising Office530 Harrison Ave., Suite 302Boston, MA 02118(617) 938-3991(800) 609-5154

Advertising InformationTo receive information about advertising in New England Home, please contact us at(800) 609-5154, ext. 713 or info @nehomemag .com.

• • •

NCI Corporate Offices2305 Newpoint ParkwayLawrenceville, GA 30043(800) 972-0189

Home Design DivisionPRESIDENT

Adam Japko

SENIOR VICE PRESIDENT, OPERATIONS

Stuart Christian

DIRECTOR OF PUBLISHING OPERATIONS

Rick Higgins

CHAIRMAN/CEO

Daniel R. McCarthy

CHIEF FINANCIAL OFFICER

Gerry Parker

GENERAL COUNSEL

Susan Deese

A MID CENTURY MODERN GALLERY

OF FURNITURE , LIGHTING, ART

AND DECORATIVE OBJECTS

In the heart of Stamford’s Arts and Antiques District

583 PACIFIC ST, STAMFORD, CT

www.irwinfelddesign.com | 203 588 0567

Showroom & Gallery Hours: Mon. - Fri. 10:30 - 5:30pm Sat. 11:00 – 5:00pm

MID CENTURY ANTIQUES

Page 28: New England Home's Connecticut

1. Vintage & Antique Architectural

Elements & Furniture

2. Giant Cup Coral

3. Reproduction Jacquemart Hound

4. Garden Urns

5. Antique Chinese Lion/Foo Dogs

6. Open Brain Coral on

Antique Barn Siding

7. Old Stone Architectural Elements

12 3

4

5

6

7

Page 29: New England Home's Connecticut

1. Succulents & Sedum

2. Old Clamshell & Desert Rose

3. Artist's Original Orb

4. Cast Iron Figures

5. Cast Iron Urns, Echeveria

6. Mini Pigs made from

Recycled Plastic

MARVIN

GARDENS

Gracious Living

OPEN TO THE TRADE | 713 Danbury Rd | Wilton, CT 203.544.2020 | www.MarvinGardensUSA.com

1

2

3

5

6

4

Page 30: New England Home's Connecticut
Page 31: New England Home's Connecticut

Linda ruderman interiors inc.

greenwich

19 East Elm StreetGreenwich, CT 06830

[email protected]

“Timeless, Elegant Interiors for Modern Day Living”

new york

www.lindaruderman.com

palm beach

Page 32: New England Home's Connecticut

28 New England Home’s Connecticut Fall 2010

hristy MacLear, for the past five years executive direc-tor of the Philip Johnson Glass House in New Canaan,will be leaving at the end of November to become the

first executive director of the Robert Rauschenberg Foundation.Yet her departure coincides with the fruition of Modern Views,a major project she helped initiate to raise funds and aware-ness for two seminal sites of modern architecture in the UnitedStates: the Glass House itself and Mies van der Rohe’s Farns -worth House in Illinois. New England Home’s Kyle Hoepner

met with her briefly to talk about this undoubtedly somewhatpoignant conjunction.Kyle Hoepner: How do you feel about the state of the GlassHouse, Christy, as you prepare now to move on to the nextphase of your professional life?CM: Having come to the Glass House as its first director,built the strategy and staff and prepared the site for open-ing—now, after five years, we are in great shape. I’m delight-ed about my new post. It has so many similar elements, chal-

Interview

C

The outgoing head of New Canaan’s Glass House looks to its future even as she prepares to move on.PORTRAIT BY JULIE BIDWELL

ChristyMacLear

Page 34: New England Home's Connecticut

30 New England Home’s Connecticut Fall 2010

lenges and opportunities. I love the early,conceptual aspects of cultural assets andlegacies.KH: Does the Modern Views project feellike a suitable valedictory with which toclose out your tenure in New Canaan?CM: The vision to be a leader in thebroader field of modern preservation—and how that connects art, architectureand design—has been captured perfectlyin Modern Views. Being able to see thisprogram come to life will be the culmina-tion of building off a wonderful legacy andhanding it over to a new director for itsnext phase of growth.KH: Can you give our readers a quickoverview of what the Modern Viewsproject is and how it’s going to work?CM: We’ve invited 100 architects, artistsand designers to contribute work and state-ments about what inspires them about orbetween the Glass House and the Farns -worth House. We’ve captured this creativityand this dialogue in a book, which will bepublished by Assouline, and through exhi-bitions and auctions to be held both inChicago, near where the Farnsworth Houseis, and in New York, in proximity to theGlass House. So, Modern Views is really aconversation about these two sites andwhat makes them relevant in our historiccontinuum.KH: I was interested to note that a lot ofthe art is not just paintings and works onpaper by the figures one might typicallyexpect. One of the people involved, forexample, is Gary Hildebrand, who’s actu-ally a landscape architect based nearBoston. What kinds of things are peoplelike Gary doing for this project?CM: We wanted to pay homage to the im-portant role that landscape plays at bothsites. The Glass House in many ways isabout the surrounding landscape, andwhen you go to the Farnsworth House yourealize the importance of its rural sur-roundings and its placement relative to theriver. So it was important to invite land-scape architects to be a part of this inter-pretation of these two sites.

There are some classic choices, peoplewho have historically been involved withthe Glass House or the Farnsworth, likeStanley Tigerman, Dirk Lohan, MichaelGraves, Cesar Pelli . . . the list goes on andon in that network of people. Then thereare the young, very vibrant architects likeJohnston Marklee out of Los Angles. Youhave young designers like Maarten Baas,

Interview

Hartford 167 Brainard Rd (I-91• Exit 27) 860-493-2532 Open 7 Days & 2 Nights

Shop Online at www.myRLG.com

Every Light Has A Story And

EVERY STORY IS UNIQUE

For all your lighting, fan and home accent needs visit The Lighting District

Every Light Has A Story And

EVERY STORY IS UNIQUE

dyyyyyyyyyyyyyyyyy dddddddddddddddddddddddddddddddddddddddas A Story Andas A Story And

We specialize in restoring, repairing and customizing

lamps and lighting fixtures

We WeWeWe We WeWeWe We WWeWeWWeWe spespespespespespepespespespspepespespespsp ciaciaciaciaciaciaciaciai lizlizlizlizlizlizlizlizlizlilizlizizizzze ie ie ie ie ie ie iee ie iiie ie ie ie in rn rn rn rn rn rn rn rnn rrn restestestestestesestesstestoriorioriorioriorioririoriorio iioring,ng,ng,ngngng,ng,nnngngng,g, re rere re rereererepaipaipaipaipaipaipaipaia rinrinrinrinririnrinririnrinriri g ag ag ag ag ag aaaag aand nd nd ndnd ndndndnndndnn cuscuscuscuscuscussuscuuuusucusuuusucuc stomtomtomtomtommtomtomomtommmiziiziiziiziiziiziiziiziizz ngngngngngngngnggng

lamlamlamlamlamlamlamlamlamlaml mmmps pspspspspspspspspspsps ps pps ps ps s psp anandandandandandandandaandandandandddan li lili lili lilililililightghtghtghtghthghtghttghtghttghthtghghgh ingingingingingingingingiingiinginginging fix fix fixfixfix fixfixfixfixfifixfifix fix fixfi turturturturturturturturturtureseseseseses

Our skilled craftsmen have over 60 years of

combined experience restoring vintage lighting

alalall

OurOurOurOuruOurOurururOurOuuO skskskskskkskskskkkksssss illillillillillillilllillililllli ed ed ed ed ed ed edd ed ed cracracracracracracracracracracraccracrac acrr ftsftsftsftsftsftsftsftsftftstsftstsfftft menmenmenmenmenmenmenmenmenenmenmenmeneeeeemeeem ha ha ha hahahahahahahahah haaaah ve ve ve veveveveveeeve veve ee oveoveoveoveoveoveoveoveoveoveovovoveveovveovoveeeeer 6r 6r 66r 6r 6r 6r 6r 6r 6r 6r 6r 6r 66666660 y0 y0 y0 y0 y0 y0 y0 y0 y0 y0 y00 y0 y00 yearearearearearearearareaareareararars os os os os os os os os oos os os ooss f f f fff f f

ririririririencencencencencencencencncencen e re re re re re re re re re re re reeeeee re estestestestestesttesteststttestestsestte oriorioriioriorioriorioriorioririoriioriiriorioo ing ng ng ng gng ngngng ng ng ngngnggngngggng ng vinvinvininvinvinvinvinvinininvinvinniv ntagtattagtagtagtagtagtagtagtagtagtagtagaagtagttagattagt ge le le le le e le le le le llle lle le le le le lee ighigighighighighighighighghighighighighigighightintintintintintinntinintintintitinggg

A world class collection of exclusive and

vintage lighting is yours for the asking at

Restoration Lighting Gallery. Each of our one-of-a-kind chandeliers and lamps are impeccably presented and priced far below what you’d expect to pay in the Big City.

• Reproduction and Vintage Lighting • Feature Chandeliers • Lamps and Shades • Full Restoration and/or Repair Services• Unique Home Accents

CIRCA 1950 –European Chandelier

A rich blue glazed porcelain bowl, molded with fine details and highlighted with hand painted French gold accents. There are six candlestick lights, each supported by curled brass and decorated with fleur-de-lis in a classical motif.

Page 35: New England Home's Connecticut

Comfort. From your perspective.

A beautiful custom home designed precisely for the way you live. Most people can only dream about it. With Country Club Homes, it’s yours. We pride ourselves on the quality of our designs. Every detail – from bathrooms and kitchens

to garages and gardens – is planned by a hand-picked team of specialists who understand perspective, proportion, grace, and functionality. And as designer-builders, we know how budgets translate into the final product, so we stick to them rigorously.

Talk to us about possibilities. There’s comfort in knowing you can have the home you’ve always wanted.

Page 36: New England Home's Connecticut

32 New England Home’s Connecticut Fall 2010

who was named “Designer of the Year,” byDesignMiami—you know, global figures.You have artists who have had a legacy atthis site, like Frank Stella, and you haveyounger designers such as Demian Re-pucci, who riffed off a Warhol poster to illustrate the combative relationship be-tween Philip Johnson and Mies van der

Rohe and their interpretation of the inter-national style. So you really get the veter-ans and the emerging talent in this proj-ect. Also the photographer Lynn Davis,Ed Ruscha, Claes Oldenburg—wonderful,wonderful artists who have interpretedthese two sites.KH: You mentioned that there will be ex-hibitions in both Chicago and New York,culminating in auctions in both places.CM: There will be a number of works thatwill be shown at the Arts Club in Chicagoand auctioned onSeptember 16;the same atSotheby’s in NewYork on October6. We have also commissioned Sarah Mor-ris, who is a wonderful internationallyknown artist, to create a film . . .KH: I was going to ask about that!CM: Her films are a visual interpretation ofthe social history of places, so she’s the per-fect artist to interpret this project. The film,

Interview

Julianne Stirling, ASID | 766 Old Post Road, Fairfield, CT (203) 255-5422 | www.stirlingdesignassociates.com

Modern Views pieces bylandscape architect GaryHilderbrand (top) andindustrial designer Con-stantin Boym (bottom)

Page 37: New England Home's Connecticut

Atlanta Boston Chicago Cleavland Dallas Dania Denver Fairfield Houston Las Vegas Los Angeles Minneapolis New JerseyNew York Philadelphia Salt Lake City San Francisco Santa Fe Scottsdale Seattle South Carolina Tennessee Toronto Washington DC

studio steel, inc. new preston, ct www.studiosteel.com 860.868.7305

Exceptional Handwrought Lighting

Page 38: New England Home's Connecticut

34 New England Home’s Connecticut Fall 2010

Points on a Line, will be premiered at theevent in Chicago and then in New York.KH: And the book from Assoulinecomes out at roughly the same time, Ibelieve?CM: We are actually getting the Chicagocopies air-shipped, so they will be therebefore anybody else has had a chance tosee them; and then they’ll be in New York.You’ll be able to buy books signed by theparticipants, which is very exciting. Thecover is by Al Taylor, who was a dearfriend of Philip Johnson’s longtime lifepartner Dave Whitney. Taylor’s estate ishaving a show at the David ZwirnerGallery in the fall, so after all the eventswe’ll have the book launch at the galleryto celebrate that.KH: You’ll also be having an online auc-tion. Is that at the same time as the liveauctions or is it a separate thing?CM: We are calling it an online exhibitionbecause people will be able to register abid through Sotheby’s, but they won’t beable to bid live like they do on eBay orLive Auctioneers, for example. It will golive on September 7, I think. People will beable to see all the work. We hope that theywill all be very interested, since the moneygoes to support our preservation, and theyabsolutely should buy something!KH: I’m curious about what kind ofwork the proceeds from Modern Viewswill make possible here at the GlassHouse compound. What are you plan-ning to use the money for?CM: The proceeds from Modern Viewswill be dedicated to the preservation of theBrick House. It’s actually the “other half ”of the Glass House. It sits at the bottom ofa slope, so it has been filling with water formany years, which has created a moldproblem. We need to go in and restore theinterior, including the Fortuny fabrics, thebooks, the Pesce chairs—but also the in-frastructure, to ensure that the building ispreserved in perpetuity. So, our part of theModern Views funds will be dedicated onehundred percent to that capital project.KH: Well, Christy, this sounds like quitea positive note on which to take yourleave. New Canaan’s loss is the Rauschen-berg Foundation’s gain; I’m sure yourfriends and supporters wish you well inyour next endeavor. •

Editor’s Note For more information aboutModern Views, call (203) 594-9884 or visit www .philip johnson glass house .org /programs/modern views.

Interview

Photos by David Sloane

DAVENPORTContracting, Inc. 203-324-6308 • www.dvnport.com

Page 39: New England Home's Connecticut

R O B E R T A . C A R D E L L O

A R C H I T E C T S L L C

9 7 W A S H I N G T O N S T R E E T S O U T H N O R W A L K , C T 0 6 8 5 4 W W W . C A R D E L L O A R C H I T E C T S . C O M2 0 3 . 8 5 3 . 2 5 2 4 F A X : 2 0 3 . 8 5 3 . 0 2 3 4

Page 40: New England Home's Connecticut

iH design studio

Interior Designwww.ihdesignstudio.com

203•968•7227

Page 41: New England Home's Connecticut

Admired for more than just their beauty

Your one-stop source for the finest modern and antique area rugs available in the world today.

Apadana Fine Rugs 539 East Putnam Ave, Cos Cob, CT 06807

(203) 422- 0700 www.apadanafinerugs.com

EFFERVESCENCE BLANC DE CHINE | BARBARA BARRY RADIANCE VEN GRAVEL | VICENTE WOLF

BROCADE CAMELOT | MODERN TWO MOD TEMPTATION | MARK POLLACK

Admired for more than just their beauty

Your one-stop source for the finest modern and antique area rugs available in the world today.

Apadana Fine Rugs 539 East Putnam Ave, Cos Cob, CT 06807

(203) 422- 0700 www.apadanafinerugs.com

Page 42: New England Home's Connecticut

P H O N E203 454 1825

A D D R E S S11 Riverfield Drive, Weston, CT 06883

W E B S I T Ewww.RobinMcGarry.com

F A X203 454 9999

RobinMcGarry Interior Design

ASID

Page 43: New England Home's Connecticut

A L E G A C Y I NExtraordinary Craftsmanship

S I N C E 1 9 8 0

Experience the Woodmeister Difference...800.221.0075www.woodmeister.comBoston . New York Nantucket . Newport

Fine Residential Construction

Custom Cabinetry & Interiors

Lifestyle Management Services

Page 44: New England Home's Connecticut

40 New England Home’s Connecticut Fall 2010

Made HereConnecticut companies creating beautiful products for the home BY NENA DONOVAN LEVINE • PHOTOGRAPHY BY BRUCE G. ANDO

en and hasn’t stopped. Today she heads up a business with internationalclients and several million dollars in annual sales.

Open any quality shelter magazine and chances are you’ll see her work:woven wonders that emerge from the 22,000-square-foot South Norwalkspace her eponymous company has occupied since 2000.

Eakins’s reputation for thoughtfully designed hand-woven and hand-hooked rugs stretches back to 1978 when, after art school in Berkeley,California, she opened her doors in New York City’s SoHo district. “Tomake things by hand, locally, using all natural fibers” was the missionstatement in her Thompson Street gallery. Three decades later thatmantra hasn’t changed.

Just about everything else has. The first rugs were woven by Eakins andher business partner, Scott Lethbridge, a Princeton graduate with an archi-tecture degree. Today the rugs are still hand-woven (although EakinsCloth, used for a rugged floor-covering as well as upholstery fabric, is produced on a mechanized loom), but by weavers locally and around the

DreamWeaversIn an environmentally friendly South Norwalk workspace,Elizabeth Eakins rugs are hand-woven with a nod to thepast and an eye to the future.

ELIZABETH EAKINS STARTED WEAVING WHEN SHE WAS ELEV-

Page 46: New England Home's Connecticut

world. Lethbridge manages the company’s Madison Avenue showroom,where he defines and designs rugs for each client’s project. All rugs werewool at the beginning; now fiber choices also include cotton, linen andsilk. (The pair debuted a line of companion fabrics in 2004.)

These are custom rugs, ready in about twelve weeks. “Anything is avail-able in any color,” promises Eakins. They are venerable rugs, too. Not onlydo they incorporate ancient spinning and weaving traditions, but the com-pany never closes out a weave or pattern. Should you want an exact replicaof your 1985 purchase, it’s yours.

Rug “family” names read like history lessons, because that’s where theyoriginated. There’s Drugget (a seventeenth-century Scottish weave), Crum-ble (a texture that mimics a fireplace built of river rocks) and Union Cloth(as in union suits, the undergarment staple of the Old West). Each family in-cludes lots of “children,” who get place names like Kansas and Abilene. Natu-ral dyes including marigold, madder, black walnut and woad (a blue dyeused as body paint by Druids) create the color palette. Eakins then matchesthose hues using manufactured dyes, which are both more stable and morecolorfast. New Zealand fleece is used exclusively, because Eakins maintainsit’s the best in the world.

Both principals are especially proud of the Teff collection, named for thegrassy forage that sheep eat. Teff combines a linen warp yarn with a woolweft, creating an attractively priced, flat-woven rug. Color and weave pattern

choices are limitless, says Eakins. Teff rugs wear like ironand work well as stair runners or area rugs. Plus, they’rereversible, yielding a different color mix when flippedover. Eakins happily replaces the edge binding when itwears, as she recently did on an eighteen-year-old rug. Shewants you to keep Eakinsrugs forever, and couldn’t bemore serious when shepromises that the sale of arug doesn’t end the company-customer relationship.

Lethbridge loves the hooked rugs for their “blankcanvas” potential. These rugs are custom-designed fortheir surroundings, so the company has worked in stylesfrom Arts & Crafts to country to contemporary. Thefinal design, hand-painted on mesh backing, is hookedusing the customer’s chosen color palette. Certain rugs,such as the Audubon, created for a house near a saltmarsh, have more than seventy-five colors.

Prices for hand-woven cotton rugs start at $24 persquare foot; wool at $110 per square foot; and Teff is

priced in the middle. Hooked rugs start at $80 per square foot and in-crease in price with the number of colors and complexity of design.

In Eakins’s SoNo facility, an old packing-crate factory that architectDeborah Berke and Associates recycled into an environmentally mindfulbuilding, a twenty-foot-high ceiling pulls a visitor’s eye up and around theinterior; tall partitions divide the cathedral-height volume into task areaswithout isolating any space. One is always aware of where the materialhas come from and where it is headed. A salvaged bowling alley is repur-posed into an expansive raised floor. Several of the twenty-five employeeskneel or sit cross-legged to assemble, seam and iron rugs.

As benign as it sounds, traditional spinning, dyeing and weaving ofnatural materials doesn’t by itself guarantee a healthy workplace. Berkeand her team joined with Eakins and Lethbridge to plan an environmentof excellent air quality, upgraded insulation and sustainable features.

Lynn Morgan, owner of Lynn Morgan Design in Rowayton, uses Eakinsrugs whenever she can. Eakins rugs, she says, “add that magic that makes theroom sing. Rug shopping used to be boring. Now it is so much fun.” •

42 New England Home’s Connecticut Fall 2010

Elizabeth Eakins(203) 831-9347 www.elizabetheakins.com

Made Here

Page 47: New England Home's Connecticut

DOTSIE DORAN

AMY ANDREWS

NANCY ELSBERRY

NICOLE LIMBOCKER

3 3 E A S T E L M S T R E E T, G R E E N W I C H ( 2 0 3 ) 6 6 1 - 4 8 4 4 ( 2 1 2 ) 3 7 1 - 3 3 5 0

Page 48: New England Home's Connecticut

More than Just Good Looking Radiators…Green and Energy Efficient too!

For over 50 years, Runtal Radiators have been the favorite among architects anddesigners for their superior style and comfortable radiant warmth and today the otheraspects of Runtal are appreciated as well — durability, energy efficiency and cleanliness:

Formore information or a dealer near you call 1 -800-526-2621 or online at:www.runtalnorthamerica.com

Factory and showroom located in Haverhill, MA

• Constructed of cold rolled steel — Runtal Radiators are built to last.• The flat tube construction provides a quiet blanket of radiant warmth without the usual drafts, cold spots, or dry air.• Runtal panels are easily cleaned and are the choice of many hospitals and medical facilities for their superior hygiene.• Runtal’s unique design provides much greater heat transfer.• Efficient even at system water temperatures as low as 120° F — or less!• The Towel Radiators are also offered in self-contained electric versions as well as hydronics.

Page 50: New England Home's Connecticut

( 8 0 2 ) 7 6 7 - 4 4 2 1 v t v e r d e . c o m

V E R M O N T

A N T I Q U EW O R L D ’ S F I N E S T S E R P E N T I N E

Beautiful

Available

Nature made it

We made it

Page 51: New England Home's Connecticut

CreativeINTERIOR DESIGN

Violet Nastri, ASID | [email protected] | www.crinteriordesign.com

Page 52: New England Home's Connecticut

Boston | Washington DC | zenassociates.com | 800.834.6654

At ZEN Associates there’s a reason behind every stone, every texture, every color, every angle and

every thing we do. From our award-winning Landscape Design to our Construction, Interior Design

and Maintenance services, no one puts more thought into it, so you get the most out of it.

B e h i n d e v e r y d e s i g n , t h e r e ’ s a s t o r y .To hear this one, call 800.834.6654.

Z E N A s s o c i a t e s , I n c .The balance of art, science and nature.

Page 53: New England Home's Connecticut

www.colonyrug.com800.458.4445

Exceptional QualityArea Rugs & Carpeting

Photo by James K. Lindleywww.jamesklindley.com

Interior Design by Bramhall & DunnPrivate Residence: Chilmark, MA

Exceptional QualityArea Rugs & Carpeting

Page 54: New England Home's Connecticut

50 New England Home’s Connecticut Fall 2010

Det

ails

,Det

ails

Careful attention to the fine points turns awaterfront home from simple to simply stunning.TEXT BY ERIN MARVIN • PHOTOGRAPHY BY LAURA MOSS • ARCHITECTURE: MCKEE

PATTERSON, AUSTIN PATTERSON DISSTON ARCHITECTS • INTERIOR DESIGN: NANCÉ J.

VIGNEAU, VIGNEAU & ASSOCIATES INTERIORS • PRODUCED BY STACY KUNSTEL

Page 55: New England Home's Connecticut

The large dining table, which offersplenty of seating for family and friends,came with the owners from their previ-ous house. Facing page: Round andoval ornamental windows add interestto the house’s front facade.

Page 56: New England Home's Connecticut

Interior designer Nancé Vigneau styled the intimate living room with a monochro-matic beige-and-tan color scheme. Facingpage top: The paneled wall underneath the staircase landing encloses a small pow-der room. Facing page bottom: Some ofthe bookcases architect McKee Patterson designed wear a cover of ornamental wire.

Page 57: New England Home's Connecticut

Fall 2010 New England Home’s Connecticut 53

rom a distance, it’s a simple stoneand shingle house with a bevy oflarge, unadorned windows and anample porch overlooking NorotonHarbor. Though it has an expansivegreen lawn, the house itself seemscontent nestled back within the pro-tecting shadows of wizened trees.

The finer points begin to revealthemselves on closer inspection: round and oval orna-mental windows beautify the home’s front facade. Alongthe edge of the property, a low-set stone wall is occasion-ally interrupted by a series of small wrought-iron gates. A breezeway that connects the garage to the main houseoffers both shelter from inclement weather and privacyfrom those arriving by car, who are not yet privy to viewsof the splendid stone terrace or adjacent blue pool thatshimmers in the backyard sunlight.

Step inside, and the careful attention to detail changesthis house from simple to something special. The designof the staircase newel post is fashioned after the binnacleof a sailboat, in homage to the harbor outside. Hiddenbehind a curved paneled wall underneath the landing isa small powder room complete with a hammered brasssink. (This same brass is echoed in the inserts in a pairof cherry tables in the living room and lamps in themaster bedroom.)Looking through an in-terior window, the twinstar light fixtures abovethe dining table are seenrepeated as smaller ver-sions in the familyroom. Coffered ceilingsin the living room boasta delicate roping detail,another nod to being onthe water.

“The idea was tomake the house feel generous but not overly grand,” saysarchitect McKee Patterson, a principal at the Southport-based firm Austin Patterson Disston.

When the clients approached Patterson with the com-mission for a new house, their requests were relativelystraightforward: a fairly classical aesthetic, a large porchoverlooking the water and a big family room. A formaldining room would be perfect for entertaining guests, butit shouldn’t be too formal—they wanted the house to feelrelaxed, not stuffy.

The property itself forms a large L, and while thatmight normally present a siting challenge, it was actuallythe perfect shape to fit both the main house and the out-buildings—a detached garage, guest house and cabana—

F

“They wanted it to feel fairly timeless, so once itweathered in itwouldn’t feel likeit had landedfrom the moon.”

Page 58: New England Home's Connecticut

54 New England Home’s Connecticut Fall 2010

Page 59: New England Home's Connecticut

Fall 2010 New England Home’s Connecticut 55

that the clients also wanted. “We worked on keeping themajor trees and shoehorned the house in,” says Patterson.“They wanted it to feel fairly timeless, so once it weath-ered in it wouldn’t feel like it had landed from the moon.”

One last request came from the husband who, much tohis wife’s chagrin, wanted a built-in bar in the family room.“It presented a design challenge,” says Patterson. “I’ve neverhad to put a full-on bar in the middle of a room.”

The wife was insistent that the bar not dominate theroom. Though Patterson did recess it in an alcove, some-what in shadow, the end result—a beautiful cherry-wood bar with working taps, seating for friends andglass-enclosed shelves—is just as much of a conversationstarter as any of his carefully designed bookcases, bench-es, mantels and other interior architectural elementsfound throughout the house.

Patterson also designed the white wood cabinetry forthe kitchen. This room feels slightly more rustic than therest of the house, with its walls of colored clay plaster andtongue-and-groove planks and a natural rough-sawn oaktimbered ceiling. The kitchen sink sits in a bay windowwith a water view; the backsplash and counters are a warmgray and creamy white grigio stone. An island and a bararea allow both plenty of prep space and room to pull up astool and chat with the cook. “If they have friends comingover they want people to feel like they can hang out in thekitchen and be a part of it,” explains Patterson.

Patterson took care of the hardscaping as well, creatingan outdoor terrace complete with an extensive barbequearea for the husband that boasts a smoker, gas grill andwood-burning barbeque grill. The large stone fireplace,perfect for keeping the outdoor space warm on chilly

The back porch sprawls across the living room,family room and kitchen with their spectacularviews of the harbor beyond (facing page bottom). Second-floor dormers give the mas-ter suite and guestroom similar vistas. Facingpage top: The terrace, with its large barbequearea, outdoor dining space and stone fire-place, connects the main house and cabana.

Page 60: New England Home's Connecticut
Page 61: New England Home's Connecticut

A rough-sawn oak timbered ceilinglends the kitchen and adjacent sittingarea a rustic look. Vigneau mixed styles,using an antique trunk as a coffee tableand contemporary chrome-and-leatherstools. To the right of the kitchen a smalloffice sits behind paned-glass walls.

Page 62: New England Home's Connecticut

The master bedroom boasts a variety of softcolors and sumptuous textures, from the tuft-ed blue-velvet headboard to the quilted creambedding and luxurious faux-fur throw. Facingpage top: The bowed ceiling and beaded pan-eling of the cabana’s bedroom was inspired by boat interiors. Facing page bottom: The tubin the master bathroom offers harbor views.

Page 63: New England Home's Connecticut

Fall 2010 New England Home’s Connecticut 59

nights, pulls double duty in the cabana building that it backs up to. The owners enjoy dining outdoors, andthere’s plenty of seating for family and friends at bothoutside tables and in a screened-in eating porch adjacentto the barbeque area.

When the time came to look for interior paint colorsand furnishings, Patterson suggested the owners meetwith Westport-based interior designer Nancé Vigneau,with whom he’s collaborated in the past. “Mac is greatwith the details,” says Vigneau. “He’s my favorite architectto work with.”

Because the house is on the water, the clients wanted a sea-inspired palette of aqua, sea glass green and sand,which Vigneau incorporated into the paint colors, fabricsand furnishings. Paintings throughout the house, chosenby the owners, are all serene beach and water scenes thatecho these same hues.“It’s very beautiful but very subtle,”says Vigneau. “It doesn’t scream at you.”

As a young couple, the homeowners had no need ofstiff formal rooms, preferring that the interiors reflecttheir casual lifestyle. To help accomplish that, Vigneaumixed styles, incorporating items that fit the wife’s pre-ferred aesthetic of contemporary/transitional designwith the husband’s penchant for the traditional. Fab-rics—even chenille, mohair and velvet—were chosen forcomfort rather than luxury. New furniture mingles withpieces the clients al-ready owned, and thewife was very involvedin choosing many of theaccessories. “I want thehome to be a reflectionof them, not me,” saysVigneau.

Again, close attentionto detail keeps this casu-al house from beingcommonplace. Interiorwalls are paneled andinset with a delicate grasscloth in one room, and painteda faux strié in another. Custom Elizabeth Eakins rugs linequarter-sawn white oak floors throughout the house. Inthe family room, a welcoming sofa, along with two big,comfy chairs and a matching child-sized version for theowners’ young daughter, gather around a large stone fire-place like old friends. No heavy draperies block the viewfrom any room; rather, window treatments are kept sim-ple, from wooden matchstick blinds to light-as-air sheersthat waft in the breeze. “They wanted a casual house that’sfilled with light,” says Vigneau. “And it is.”

If, as the saying goes, God is in the details, this couplehas built themselves a little piece of heaven. •Resources For more information about this home, see page 127.

Because thehouse is on the water, theclients wanted a sea-inspiredpalette of aqua,sea glass greenand sand.

Page 64: New England Home's Connecticut

ELIZABETH EAKINS

THE MOST SOOTHING WELCOME HOME.

R U G S A N D F A B R I C S I N N A T U R A L F I B E R SOur studio is now open to the public by appointment with a splendid collection of pillows, fabrics and rugs.

©

Page 65: New England Home's Connecticut

BACK BAY SHUTTER CO. INC.totally passionate about shutters®

(and shades too!)

78i.22i.0i00 www.backbayshutter.comGeographically flexible.

You’re Picky, Meticulous,and Will Do Absolutely

ANYTHINGfor Your Clients.

�Are We Related?

Page 66: New England Home's Connecticut

62 New England Home’s Connecticut Fall 2010

EuropeanUnionIn a perfect marriage of architecture and interior design, a Greenwich house rooted in Continentaltradition enfolds itsowners in a magicalblend of comfort andluxury. Text by Megan

Fulweiler • Photography by

Michael Partenio • Architect:

Alex Kaali-Nagy • Interior

design: Karen Kaali-Nagy •

Builder: Alex Kaali-Nagy

Development Corporation •

Landscape architect: Wesley

Stout Associates • Produced

by Stacy Kunstel

n a brilliant afternoon, the sun knifes through tall trees across emerald-green lawnsspilling in all directions. Should a gleaming horse-drawn carriage or a sleek Ferrari pull up, neither would seem misplaced. As welcoming as it is gracious, this Greenwichhouse blurs the distinction between past and present. Not readily apparent is the five-car garage below, the state-of-the-art elevator or the manner in which the generousground floor walks out in back to the landscape and an enviable pool. • The newly con-

structed home’s overall demeanor dovetails with history. The architectural style—Georgian colonial—hasroots, after all, stretching back to the ancient Greeks and Romans. Half a dozen shades of granite give theexterior a definite I’ve-been-in-New England-for-ages look. Inside, classic details intermingle with upscaleamenities. This seamless union of old and new in every little detail springs from a highly personal vision.

O

Page 67: New England Home's Connecticut

The home’s exterior and its surroundingsblend references to the stately houses of Europe and New England’s iconicstone walls. Facing page: The foyer’scurved wall lent itself to the “Scenes of North America” wallpaper by Zuber, a paper also found in the White House.

Page 68: New England Home's Connecticut

64 New England Home’s Connecticut Fall 2010

Fortunately, it’s one shared by the owners: architectAlex Kaali-Nagy and interior designer Karen Kaali-Nagy. Over the years, the couple’s combined talentshave allowed them to shepherd their dreams fromdrawing board to fruition several times. Their most re-cent endeavor, however, may be the pièce de résistance.

Born and schooled in Europe, Alex derives a gooddeal of inspiration from across the sea. The streets ofLondon, Budapest, Prague and Paris have all had aninfluence. Castles, grand manors and opera houses—each plays its part in a reservoir grown rich with travel.

Not for him, though, are ostentatious rooms that,like heavy coats, overwhelm their inhabitants. “Everyspace must be created equal. No room should intimi-date,” Alex says. “They must all have the same comfortlevel, the same magic and, if they don’t, you’ve failed.”It’s a sage comment that neatly explains the home’s in-credible charm.

From the elegant core—the circular entry hall wherethe staircase begins its spiral upwards and a hand-paint-ed Zuber wallpaper depicting, among other things, theHudson River and Niagara Falls, conjures an outdoorstate of mind—to the luminous kitchen, the level of de-tail never falters. Meticulous custom moldings, panelingand pilasters reign throughout. The millwork is thetelling thread that gives the house character and conti-nuity. Some spaces grow more formal than others, but

Page 69: New England Home's Connecticut

A nineteenth-century Hungarian oil paintinghangs above a living room loveseat. Facingpage top: The dining room includes an antique mahogany sideboard. Facing pagebottom: A sisal carpet interjects a casualnote in the perfectly composed living room.

Page 70: New England Home's Connecticut
Page 71: New England Home's Connecticut

Rich architectural detailing sets off theintimate library. The Lee Jofa windowfabric was Karen Kaali-Nagy’s startingpoint for the room’s palette. Burgundy-colored grasscloth covers the walls and provides a striking backdrop forthe couple’s outstanding art collection.

Page 72: New England Home's Connecticut

68 New England Home’s Connecticut Fall 2010

the overall tone remains harmonious, even serene.“It’s true,” says Karen, “This house is peaceful. You

feel relaxed in all these rooms. It’s because everythingis symmetrical and symmetry is soothing.”

To one side of the entry, the enticing living roomawaits company. Directly opposite, the library fostersmore introspective hours and intimate conversation.While the former flaunts pale walls, the latter sportsmahogany woodwork and cherry-colored grasscloth.“The grasscloth lightens it up a bit,” Karen notes.

A leather ottoman anchored between two down-filled sofas serves as the library’s coffee table. The dec-orative rug is by locally based Mark carpets. The an-tique brass fireplace accessories are English treasures.

Karen took her cue for the living room’s decorfrom the summer garden-like Lee Jofa curtain fabric.“I always work backward,” she laughs, “fabrics first,then wall color, furnishings and carpet.” The result ofher unique approach is a pleasing pastiche includingcustom pieces (the ruddy corduroy velvet loveseatand matching striped armchairs, for example) andantiques big and small (the grandfather clock andbrass candlesticks).

The living room may not be the most frequentedspot, Alex admits, but it does see daily activity as this iswhere he dutifully practices his piano. According to theseason, there might be a fire blazing on the hearth as

Page 73: New England Home's Connecticut

Antique light fixtures illuminate the kitchenisland. Facing page top: The butler’s pantryis wallpapered in “Tile Tales,” a documen-tary print by Brunschwig et Fils. Facingpage bottom: Antique prints enliven a son’sroom. The pine chest holds keepsakes.

Page 74: New England Home's Connecticut

70 New England Home’s Connecticut Fall 2010

his music fills the house. The icing on the cake in thisroom is the art. The owners have been collecting nine-teenth-century European paintings for three decades.

The dining room sits adjacent to the living room,highlighted by an antique mahogany Georgian table.Ribbon-back dining chairs wearing scalloped slip-covered seats gather around the table like girls in partydresses. Dainty Staffordshire plates frame the antiquesideboard, which is perfectly set off by the window andits silk balloon shade above. Add some light from thecustom chandelier, a bit of glimmer from the sconcesand an Aubusson carpet to assure footsteps fall aslightly as snow and the dining room becomes one of those memorable settings guests recall for friends.

Cooking duties fall to Karen, but so well-choreo-graphed is the kitchen even everyday chores are has-sle-free. The beautifully integrated appliances (twodishwashers, two fridges) are top-notch, but concealedto maintain a low profile. “We used Calacatta marblefor the countertops, but topped the island with butter-nut. It’s a good balance,” Karen explains. A highly efficient butler’s pantry swathed in a whimsical Brun-schwig et Fils paper links kitchen and dining room forease of entertaining.

If tastes evolve over time, the master suite must be a culmination of desires, lessons learned and savvy.

Unlike the more mascu-line bedrooms visitedthese days by their grownsons, the couple’s ownsleeping quarters areultra feminine. “Envelop-ing,” is how Karen de-scribes their space.

A hand-painted LouisXVI bed from Julia Graycozied up with Matouklinens sets the luxurioustone. Armchairs (one a custom version of its

nineteenth-century twin) covered in dreamy blueScalamandré velvet keep the lush rhythm going asdoes the French-patterned carpet. There’s a standingantique mirror, too, a silver tray table and rose-colored lamps to elevate the lady-like vibe.

The sitting area with fireplace in the posh masterbath is a sheer stroke of genius. “We actually meethere quite a bit,” Alex says. “We have a cup of coffeeand discuss our schedules.” Karen cleverly covered thehearthside chairs in terrycloth to erase any worry overwet towels or hair drippy from the shower.

Particularly striking, once more, is Alex’s focus ondetails. Marble floor, handpainted commodes andsoaking tub aside, the eye is drawn again to the lovelyarchitecture. No lowly role for this grooming room.Like the rest of the house, it’s a dazzling oasis any tra-ditionalist—or modernist—couldn’t help but adore. •Resources For more information about this home, see page 127.

If tastes evolveover time, themaster suitemust be aculmination of desires,lessons learnedand savvy.

Page 75: New England Home's Connecticut

An antique tea table resides between themaster bedroom’s velvet-covered chairs.Facing page top: The couple’s handpaintedLouis XVI bed is from Julia Gray, New York.Facing page bottom: A heated marblefloor ups the master bath’s comfort level.

Page 76: New England Home's Connecticut

B E I N F I E L D A R C H I T E C T U R E P CT 203 838 5789 / South Norwalk / CT / www.BEINFIELDARCHITECTURE.com

Page 78: New England Home's Connecticut
Page 79: New England Home's Connecticut

ABackdropforLivingA simple palette serves as a serene setting for a creative

woman whose life—both personally and professionally—centers on her Haddam home. WRITTEN AND PRODUCED BY STACY KUNSTEL •

PHOTOGRAPHY BY LAURA MOSS • WOODWORKING BY TIGER CARLSON

Over the years, the 1840s Federal-stylehouse had been given a mansard roofand Victorian flourishes. In renovating,Robin Grassi followed her instinctsrather than adhere to a particular style.

Page 80: New England Home's Connecticut

76 New England Home’s Connecticut Fall 2010

obin Grassi lives with no art on her walls and few accessories to speakof. Only one wall of her Haddam home sports a color other than white,and you’ll only find wallpaper if you visit the small downstairs powderroom hung in leopard print. Throw pillows are as scarce as songbirds inwinter, as are knickknacks, souvenirs and collectibles. • For Grassi, homeis a backdrop for life, a canvas that she has meticulously planned and de-

signed to fit her busy, creative existence. Consider it the antidote to the high-definition,iPad, BlackBerry, 3-D, laptop, Wii world we live in—what a relief to revel in simplicity. •It was 1990 when she stumbled on the 1840s Federal-style house that along the way hadbeen given a mansard roof and a few Victorian flourishes. Recently divorced and the sin-gle mom of a four-month-old, she was looking for somewhere to raise her son, not a par-ticular style or location. The house may look large now, thanks to Grassi’s renovations,but at the time it was just the right scale for her needs. “The third floor was all attic then,so three bedrooms didn’t seem so big,” says Grassi, a petite blond with bangs that brushthe tops of her eyelashes. “It looks grand now because of the columns and the big backporch, but it wasn’t when I bought it.” • The house needed little work and she kept thefurnishings simple. It was here that she raised her son and ran her business working withforeign manufacturers to create rugs and textiles for the American market. • “They sendme a basic product they can make and I give them recommendations on color and de-sign packaging,” she says. Hundreds of samples a month arrive at her home, so organiza-tion is key. • In 2002 she married Chris Grassi. The house was due for some updates andChris encouraged her to make the house just as she wanted. • The couple embarked on a

R

“Architecture is just so satisfying to me. The moldings, thestructure, are my art.”

Page 81: New England Home's Connecticut

The living room plays out a simple, neutralpalette with a black-accented vibe. Previouspage clockwise from top left: An outdoor diningarea off the kitchen is a popular warm-weatherhangout. Grassi designed the house’s curveddoorway. The exterior brackets on the tower addition match those flanking the back door.

Page 82: New England Home's Connecticut

“I didn’t renovate the house with a purist heart. I think the end result came

A deep Jacobean brown stains allthe floors. The marbleized globeceiling fixture was brought in fromthe front porch ceiling.

Page 83: New England Home's Connecticut

out kind of cool, though.”

Page 84: New England Home's Connecticut

The pale palette is broken only by an accentwall in green, a custom color chosen to reflecta bit of the outdoors. Facing page clockwisefrom top left: An antique mirror reflects thedining room tablescape. The thick turned legsof the dining table reflect some of the home’sheavier architecture details. The third-floorstaircase leads to the new master suite.

Page 85: New England Home's Connecticut

Fall 2010 New England Home’s Connecticut 81

major renovation, adding a pool and patio, bumping out the kitchen a few feet, finishingthe attic into a master suite, and completing a tower on the second and third floors togive themselves a walk-in closet and extra office space. They added columns to the frontporch, giving the facade a more stately feel, and ripped off the back porch, replacing itwith a raised stone patio large enough for an outdoor dining area and stone fireplace.

“Chris really pushed me,” says Grassi. “He worked in New York during the week and Iworked on the house.”

She conceived and oversaw the bulk of the work, often designing as she went along.The ideas for the large architectural brackets flanking the back door came from a build-ing in New York, while the master bath vanity is a variation on one she saw in a maga-zine. As she thought ideas through and looked to magazines for inspiration, her partnerin crime was local woodworker Tiger Carlson.

“Tiger’s a local craftsman who has no idea how talented he is,” says Grassi. “He dideverything—windows, doors, moldings, staircases, brackets, kitchen cabinets, man-tels . . . on and on. He’s a peach of a guy.”

Grassi gravitated toward items with patina and simple lines, like the Rocky Mountainhardware she used throughout the house and the concrete counters in the kitchen. Wood-work was also important. She designed it to look like furniture, incorporating feet, cabinetsand drawers. In the kitchen, a row of thin, stacked, built-in drawers add to the graphic na-ture of the space and provide storage for placemats and silverware. If a certain corner waslacking character, beaded board was added to the ceiling or the interior architecture wasbeefed up until it met with her approval. “I didn’t renovate the house with a purist heart,”she says. “I think the end result came out kind of cool, though. I brought it up to date.”

“I like a type ofdecoration that staysthe same. It’s a goodbackdrop to my life.”

Page 86: New England Home's Connecticut

Nestled in a sea of white walls and leafygreen plants, the master suite feels like atree house. Facing page clockwise from topleft: A small dining area off the kitchen fea-tures a round table that Grassi cut down tofit the space. A page from a magazine influ-enced the vanity design in the master bath.Narrow built-in drawers add a graphic note.

Page 87: New England Home's Connecticut

Fall 2010 New England Home’s Connecticut 83

Friend Liz Bazazi, a space planner near Hartford, gave Grassi ideas for using herrooms to their maximum potential. She spied an area on the roof of the third floor sheenvisioned as a secluded deck and helped Grassi lay out the plan for the third-floor mas-ter suite that opens onto it.

Once again the house is Grassi’s. She and Chris split in 2009 and her son is now in col-lege. Meticulously kept, simply decorated, quiet and serene, it is home to a woman with-out regret. She’s still a minimalist, exercising a palette of white, dark chocolate and touch-es of green. Most of her furniture is slipcovered in white, including all of the sofas in theliving and family rooms and the dining room chairs. Simple shapes, stained tables andvintage-looking lighting are all part of the look. A few books lie scattered on the windowsill of the third-floor bedroom, giving the only hint of disorder. “I like a type of decora-tion that stays the same,” says Grassi. “It’s a good backdrop to my life. I have never foundany artwork that I love enough to live with every day. I’m drawn more to architecture.Architecture is just so satisfying to me. The moldings, the structure, are my art.”

The single green-painted wall in a sitting room off the living room was long contem-plated before Grassi committed to it. She says it’s the color of the greens outside, her at-tempt to keep everything as natural as possible. The custom Pratt & Lambert shade per-fectly shows off an arched-back sofa covered in linen that was her grandmother’s.

As we are constantly stung with stimuli, Grassi knows just what she needs to maintainher creativity and the calm her home achieves. “It’s so serene to have a blank canvas,” shesays. “Your home should be a place of serenity. Nothing to get in the way, no obstacles.” •Resources For more information about this home, see page 127.

“Your home should be a place of serenity.Nothing to get in theway, no obstacles.”

Page 88: New England Home's Connecticut

740 Boston Post Road • Sudbury, Massachusetts 01776Phone 978-443-3638(MA) • 401-789-5889(RI)

www.sudburydesign.comblog.sudburydesign.com

Page 89: New England Home's Connecticut

20 CHURCH STREETGREENWICH, CT

203.625.0491WWW.RIDARCH.COM

RIDBERG+AssociatesArchitects

Page 90: New England Home's Connecticut

86 New England Home’s Connecticut Fall 2010

Heart of the MatterA desire for a bigger, betterkitchen inspired a New Canaan family to build a whole new house where thekitchen of their dreams takes center stage. TEXT BY PAULA M.

BODAH • PHOTOGRAPHY BY LAURA

MOSS • ARCHITECTURE: MICHAEL

SMITH • INTERIOR DESIGN: HEATHER

MCWILLIAM-AUTORE • BUILDER: WALTER

CROMWELL, COUNTRY CLUB HOMES •

LANDSCAPE ARCHITECTURE: JOHN C.

DE FEO, MODEL PROPERTIES •

PRODUCED BY STACY KUNSTEL

Page 91: New England Home's Connecticut

Fall 2010 New England Home’s Connecticut 87

A half-wall and columns separate the large living room into two more intimate seatingareas. Facing page clockwise from top left:The living room includes a well-equipped bar.Arches like this one in the foyer add a touch offormality throughout the interior. The kitchenwas the starting point for the home’s design.

Page 92: New England Home's Connecticut

e all know how even the simplest homeproject seems to take on a life of its own. A fresh coat of paint, and suddenly thesofa looks dingy. New upholstery rendersthe window treatments hopelessly wrongfor the room. Before we know it, we’ve

spent twice as much time (and goodness knows how much moremoney) redoing a room we thought just needed repainting. • Thatprocess—on a much larger scale—is how this appealing Shingle-stylehouse in New Canaan came to be. • The homeowners’ original aimwas a larger, upgraded kitchen for the house they’d been living in forfourteen years. “Next thing we knew,” recalls the husband, “we were off down a different path.” • They looked around at other houses withan eye toward buying something with a kitchen that better suited their needs. They talked to the original builder of their house, WalterCromwell of Country Club Homes, about remodeling. Ultimately, the idea of getting exactly what they wanted proved too alluring. “Weended up deciding to build a new house,” the homeowner says. • Therewas no question that the construction would be trusted to Cromwell,who, with his sister Carolyn Wheeler, runs the company their familystarted in the 1950s. The couple also knew they wanted designerHeather McWilliam-Autore to work the same magic on their interiorsthat she’d performed in the house they were leaving. On Cromwell’srecommendation they added Wilton architect Michael Smith to theteam. • The owners, who have three teenagers, didn’t necessarily gointo the process with the image of a Shingle-style house in mind. “I

88 New England Home’s Connecticut Fall 2010

W

Page 93: New England Home's Connecticut

Fall 2010 New England Home’s Connecticut 89

Porches, like this favorite spot for morningcoffee, are deeper than the standard. Facingpage top: Symmetry defines the front of theShingle-style house. Facing page bottom: In back, symmetry gives way to interestingroof lines, a turret, porches and a fieldstonechimney that serves four fireplaces.

Page 94: New England Home's Connecticut

90 New England Home’s Connecticut Fall 2010

Deep blue walls and a barrel-vaultedceiling with shimmering silver paintbring drama to the dining room. Fac-ing page top: Casual comfort reigns in the more rustic family room. Facingpage bottom: A nook in the mastersuite provides a cozy spot for relaxing.

Page 95: New England Home's Connecticut

Fall 2010 New England Home’s Connecticut 91

don’t know that we had a clear view ofprecisely what we wanted,” the husbandsays. “We’re not really formal people, sowe wanted to be sure to create a houseto be lived in, not a museum to bewalked around in. If there was a themewe started with, that would be it.”

Smith took all the factors into con-sideration—the wedge-shaped lot on a hill overlooking a pond, setback re-quirements that guided the building’ssiting and the family’s wish for a com-fortable, casual home whose heartwould be a stylish and functionalkitchen—and suggested the coastalNew England–inspired result.

From the driveway the house pres-ents a modest face that belies its 10,000square feet. “We designed the house tobe fairly narrow from the front, butquite long behind that, partly due tothe shape of the site and partly becausewe didn’t want it to look like a gigantichouse,” Smith says. Perfect symmetrydefines the front, where steeply pitchedtwin peak roofs flank a bell-shapeddormer on the attic floor and two sec-ond-story bay windows project prettilyabove the overhanging roof that topsthe gracious columned porch. Whitecedar shingles and siding and whitetrim with the occasional flourish com-plete the classic coastal feel.

At the sides and back of the house,symmetry gives way to a series of inter-esting roof lines, dormers, porches, aturret and a massive fieldstone chimney that serves basement, out-door, first- and second-floor fireplaces.

Inside, Smith’s work began with the all-important kitchen, situatingthe eighteen-by-thirty-foot room on the spot that offered the bestviews of the pond. “It truly is the heart of the house,” he says. “Every-thing flows from there.”

Here, the wife can indulge her love of and talent for cooking, mak-ing use of a wealth of granite-topped counters, a freestanding walnut-topped center island with a second sink and plenty of drawer andcounter space. Appliances are disguised by white paneling, and littlecabinets with retractable doors hide small appliances between uses.

Designer McWilliam-Autore brought elegance and modernity to theroom with her introduction of satin nickel hardware, a contemporarylight fixture above the island and a backsplash of nickel mesh over alight linen fabric. A casual dining area anchors one end of the room,though in warm months the family is more likely to take meals on theporch that sweeps across the kitchen and family room. Smith designedthe porches to be deeper than the standard six to eight feet, the betterto fit chairs and tables comfortably. “My wife loves the patio outsidethe kitchen,” the husband says. “Looking on to the pond when you’rehaving your coffee on a nice summer morning—it’s very peaceful.”

In both architecture and decor, the interior maintains a blend ofthe formal and the casual. Beginning in the foyer, with its Venetian-

In both architecture and decor, the interiormaintains a blend of the formal and the casual.

Page 96: New England Home's Connecticut

92 New England Home’s Connecticut Fall 2010

Copper-toned chair cushions accent theneutral color scheme in the casual diningarea. Facing page top: Granite-toppedcounters and a walnut-topped island pro-vide plenty of working space in the kitchen.Facing page bottom: The master bath tubsits in a nook with views of a pond.

Page 97: New England Home's Connecticut

Fall 2010 New England Home’s Connecticut 93

plastered walls in a shade of summer-fresh green, a series of archestrimmed in white millwork help guide the transition from one roomto the next. The palette adheres, for the most part, to soft neutrals—beige, taupe and mocha—with touches of pale blues and greens ac-cented with hints of copper. The chairs at the kitchen island, breakfasttable and living room bar as well as the mudroom’s wallpaper and thewalls of the butler’s pantry all sport coppery hues.

Half-walls, columns and coffered ceilings bring the large living roomdown to more intimate proportions and offer a number of seating op-tions. To one side of the columns, a white sofa and chairs are matchedwith raw silk curtains the color of cafe au lait and an Elizabeth Eakinswool rug in shades of beige, taupe and light blues and greens. On theother side, a sitting area with a bold mocha-toned wallpaper holds afully outfitted bar and comfortable banquette seating. As traditionallyelegant as the room is, McWilliam-Autore also incorporated moderntouches in the geometric pattern of the rug, a hammered nickel tablelamp and a mirrored chandelier that, despite being an antique, has asimple shape that McWilliam-Autore calls “clean and European.”

Things take a dramatic turn in the formal dining room, where thewalls above the white wainscoting wear a coat of deep blue and a silk-shaded chandelier diffuses light upward to a barrel-vaulted ceilingthat shimmers with silvery paint. “I’m always interested in how totreat ceilings to make them a little more special,” Smith says.

In so many projects, that first small step leads to big changes. For thisfamily, the dream of a better kitchen led to the house of their dreams. •Resources For more information about this home, see page 127.

Page 98: New England Home's Connecticut

“Creating extraordinary designs, in extraordinary locations for people living extraordinary lives...”

Featured as one of Connecticut’s Outstanding DesignersTown & Country August 2010

Award winning Interior Design & Decoration by...

C2 Limited Design Associates1226 Post Road, Fairfield, Connecticut, 06824

T: 203 259 2555 www.c2limited.com

A.S.I.D.

Page 99: New England Home's Connecticut

Call 800 • 842• 5275 for an appointment in our working kitchen showrooms 64 South Main Street, South Norwalk CT • 393 Fortune Boulevard, Milford, MA

Come visit our new website at www.clarkecorp.com

With a high return on investment, Sub-Zero and Wolf appliances are a wise choice in any economy.Go ahead, play. Clarke’s showrooms feature the largest interactive display of Sub-Zero and Wolfappliances in all of New England. Each kitchen vignette features real, working appliances, so you canhop from one to the other to find the one you love. Bake cookies in a Wolf dual convection oven. Testout a Wolf electric cooktop or gas griddle. Or taste fresh, crisp veggies from a Sub-Zero Pro48. It’sour way of demonstrating the amazing superiority of Sub-Zero and Wolf appliances. So, drop on byor make an appointment with one of our expert kitchen consultants. They’ll make investing in thekitchen of your dreams, well, child’s play.

No safer environment for your money. Clarke. The Premier Sub-Zero and Wolf showrooms in New England.

Invest in the right playground.INSTANTREBATES up to $2,500 on

Sub-Zero & Wolf through Dec. 31st, 2010

Visitwww.clarkecorp.com/rebate.

Page 100: New England Home's Connecticut

WWW.RAMCONSTRUCTIONLLC.COM | T. 203.325.0503 | F. 203.325.0570

Design-Build

Millwork

Property Management

Custom Homes

Renovations

Fine Cabinetry

Page 101: New England Home's Connecticut

13 South Ave • New Canaan, CT 06840 (203) 972-7878

www.CobbleCourtInteriors.com

Cobble Court Interiors

Page 102: New England Home's Connecticut

The Return ofWainscotingby jennifer brabson

Where to use it? EntriesUse panel wainscoting in rooms and entryways where you canstand back and appreciate it. “Pencil Panel” (see left) worksbetter in close quarters- hallways, mudrooms and utility areas.

Stairs and HallwaysAdding the wainscot panels to the wall leading to the livingroom and up the main stairwell visually enlarges the diningroom andprovides a continuous look.

Eating AreasCleverly adding tall wainscoting panels in a dining room tocreate a dramatic backdrop. Paneling can also double as theback and sides of a window seat in a breakfast nook.

Kids RoomsBecause wainscoting was created for rooms that receive a lot ofwear and tear what better place to add this architectural detailthan to a room where finger paints and crayon are the norm.

CeilingsCeilings take up the same real estate as the floor, few peopleconsider spending even a fraction of their decorating budgeton the ceiling design to make it stand out and up above therest. Adding paneling to a ceiling will create an aesthetic di-mension you never knew existed.

203.730.9700 | www.wainscotsolutions.com

Pro Advice

Michael YedowitzWainscot Solutions

“Adding architectural detail likewainscoting doesn’t have to be expensive or time-consuming.Using a company like WainscotSolutions is definitely a way to add high-value details.”

For more advice from Michael,call 203.730.9700

ADVERTISEMENT

Page 103: New England Home's Connecticut

PETER CADOUX ARCHITECTS P.C.35 POST ROAD WEST, WESTPORT, CONNECTICUT • 203-227-4304

WWW.CADOUXAIA.COM

Page 104: New England Home's Connecticut

100 New England Home’s Connecticut Fall 2010

Design LifeOut and about in celebration of design and architecture in Connecticut

made the perfect setting for our party to celebrate the launchof NEW ENGLAND HOME’S CONNECTICUT, the newestmember of the New England Home family. The fine earlysummer evening combined with Tami and Dan’s graciousnessas hosts made for an event to remember as some 200 peoplegathered to enjoy hors d’oeuvres by Food Design. We’re still

debating whether the tiny waffle cones filledwith smoked salmon or the bite-size

cheeseburgers were our favorites.You have to love Twitter and Face-

book for the way they help us keepus in touch with friends and clients,but there’s nothing quite like qualitytime together. IRWIN FELD DE-

SIGN threw the first of what it hopeswill be many “Tweet-Up” celebrations

in its Stamford gallery. The gallery’sfriends and clients mixed and mingled and

cemented bonds formed over months of online conversation.Besides their networking savvy, the partygoers discoveredthey have congeniality and a love of good design in common.

Smart business people know how important networking—in person and online—is. It may be even more important forthose who own their companies; sometimes the only personwho can understand your challenges is another person at thehelm of his or her own ship. That’s the thinking behind thefledgling DESIGN GUILD, a group of people who run design-related businesses in Fairfield County. Designer Linda Rud-erman got the group together at her Greenwich home for anevening of wine, dinner and lively conversation.

New Canaan’s Le Beau Chateau, a gracious 1937 mansionstyled after a French manor house, was the setting forSPRING AWAKENING, a display of table-top vignettes creat-ed by designers and inspired by Broadway musicals. Theopening party doubled as a fundraiser for the Summer The-ater of New Canaan.

Shouldyour party be

here? Send photographsor high-resolution images,with information about theevent and the people in the

photos, to New England Home,530 Harrison Ave., Suite 302,Boston, MA 02118, or e-mailimages and information to

pbodah@ ne home mag .com.

THE LOVELY GREENWICH HOME OF TAMI AND DAN MCCARTHY

IRWIN FELD DESIGN Clockwise from top: Mona Klein Klapper and Marcy Feld • Liz Orgera andRoberta Mancuso of New England Home • Maybelline Te, Tracy Hiner and

Liz Orgera • Susan Blumenfeld, Ruth Warner and Mona Klein Klapper •Beth Dempsey and Liz Orgera • Bob and Catherine Avery, Richard Allan

Marti Jr. and Laini B. Curcio-Marti • Irwin Feld and Tracy Hiner

Page 106: New England Home's Connecticut

Design Life

SPRING AWAKENING From left to right: Carol Seldin, Mar Jennings, Charles Pavarini III and MelodyLibonati • Mary Harrison, Brian StokesMitchell and Priscilla Potenza • DanielleAnn Millican and Priscilla Potenza

DESIGN GUILD From top, left to right: Michael Yedowitz, Joyce Clear and Jeff Scott

• Carol Kurth, Roberta Mancuso of New England Home and LindaRuderman • Paula Bodah of New England Home, Rich

Rosano, Jordy Scott and Carol Kurth • Rich Rosano and Jordy Scott

102 New England Home’s Connecticut Fall 2010

NE

IL L

AN

DIN

O, J

R.

NEW ENGLAND HOME’S CONNECTICUT From top, left to right: Adam Japko of Network Communications, Mary KayDaughters, Jeff Brown and New England Home’s Kyle Hoepner • Skye Kirby,

Sean Clarke and Katie DeFlorio • Amy Carbone, Oksana Quirk, Dan McCarthyof Network Communications, Tami McCarthy and Tuly O’neil • Kenleigh

Larock, New England Home’s Betsy Abeles Kravitz and Mike Larock • ThierryRosier, Linda Ruderman and Kyle Hoepner • Catherine Avery, New England

Home’s Kim Sansoucy and Roberta Mancuso and Victoria Lyon

Page 107: New England Home's Connecticut

Glen Gate is a team of artists and artisans who assume responsibility for your pool and property every step of the way - as architects of the landscape, builders of the vision, and caretakers of the land. We work, think, plan, advise and act in harmony, so everything

we do is true to the style and character of your home. For you, it means a seamless process and a higher level of service.

To learn about our comprehensive capabilities, call Sheila at 203.762.2000, or visit www.glengatecompany.com.

Visionary LandscapesDesigned, created and cared for by Glen Gate

DESIGNING AND CARING FOR THE FINEST PROPERTIES, GARDENS AND POOLS - SINCE 1972

Page 108: New England Home's Connecticut

Cindy Rinfret is the founder of Rinfret, Ltd., which is one of the leading design firms

on the East Coast. Her work has appeared in numerous publications including her book, CLASSIC GREENWICH STYLE (Rizzoli). The garden photos featured here were taken at Rinfret’s Greenwich home,

Laurel Hill, which was on the cover of the Holiday issue of TRADITIONAL HOME.

354 GREENWICH AVENUE GREENWICH, CONNECTICUT

www.rinfretltd.comSHOP 203.622.0204

DESIGN 203.622.0000

Interior Design & Decoration

Page 110: New England Home's Connecticut

Suzanne Novik, ASID

4 North Avenue • Weston, Connecticut 06883 • Tel 203.454.5557 • Fax 203.454.5537

E-mail [email protected] • www.suzannenovikinteriors.com

In collaboration with Woodmeister Master Builders

Ph

otog

rap

hy

by G

ary

Sloa

n

Page 111: New England Home's Connecticut

Hyannis Port

79 ISLAND AVENUE $8,900,000

Squaw Island beachfront on Nantucket Sound! One of the most

exclusive summer spots on the East coast. The magnificent

1.13 acre property offers a private island setting; sandy beach;

exquisite views; gunite pool; serene, seaside backyard.

Osterville Office 508.420.1130

Barnstable

112 SCUDDERS LANE $3,895,000

Landmark Barnstable estate. This remarkable property is a

recreation of an older gracious manor with all the trimmings

one expects in today’s homes. Enjoy some of the most beautiful

views of Barnstable harbor, Sandy Neck and Cape Cod Bay.

Barnstable Office 508.362.2120

Yarmouth Port

112 NOTTINGHAM DRIVE $1,650,000

Incredible views and highest quality craftmanship in this custom

built home looking west over the great salt marsh and Cape Cod

Bay for amazing sunsets. Extensive custom features, including

heated salt water pool, make this 5700+ sq ft property amazing.

Yarmouth Port Office 508.362.3000

Yarmouth Port

88 MILL ROAD $8,900,000

First time opportunity to own Cape Cod’s finest estate. The

current owner’s vision and inspiration created a magnificent 7500

square foot modern home with 300’ pier/ dock, commanding

views of both the countryside, Cape Cod Bay and Sandy Neck.

Barnstable Office 508.362.2120

kinlingrover.comCape Cod’s best address

Serving the most buyers and sellers on Cape Cod, MassachusettsBARNSTABLE BOURNE BREWSTER CHATHAM FALMOUTH HARWICH ORLEANS OSTERVILLE PROVINCETOWN SANDWICH WELLFLEET YARMOUTH

Page 112: New England Home's Connecticut

108 New England Home’s Connecticut Fall 2010

PerspectivesFresh outlooks on design and resources

• Three area designersimagine a handsomeand cozy library

• Wish List: Mar Silvershares her favoritehome design products

IRWIN FELDLeather and Wood Desk by EdwardWormley for Dunbar “I love this deskfor its rarity and its scale. You don’t seemany of these desks, an early 1940sDunbar. It’s an easy desk for simple letter writing or to use with a laptop.”

CAREY KARLANBolero Chair by Hickory Chair “Thispiece offers what we all want in a leatherlibrary chair: comfort, presence andquality. It would translate well in an un-expected shade such as a soft metallicleather, soft taupe or even a contempo-rary bright leather such as chartreuse!”

The Library:Leather Furniture

LINDA RUDERMANFan-Back Wing Chair “A leatherwing chair, like this transitional piecefrom Edward Ferrell, would lookwonderful as a pair, flanking a library’s fireplace to create a sense of sumptuous warmth and richness.”

Page 113: New England Home's Connecticut

BUILDERS OF HOMES… BUILDERS OF DREAMS…

Builders for Life

Certified Green Professional

325 Post Road West, Westport, CT 06880Phone: 203 227 8215 Fax: 203 227 0408Website: www.wrightbuild.com Email: [email protected]

CT Contractor’s #519933 Westchester Lic. # 06178-H94

Member: BBB, Accredited Business; Home Builders & Remodelers Association of

Fairfield County; Home Builders Association of Connecticut; National Association

of Home Builders; and U.S. Green Building Council (USGBC).

USGBC is a trademark owned by the U.S. Green Building Council and is used by permission.

Page 114: New England Home's Connecticut

Perspectives

110 New England Home’s Connecticut Fall 2010

IRWIN FELDStroheim and RomannThrow “This black eyelashthrow, made from Jabfabric, is completely deca-dent and sumptuous.”

Throw

LINDA RUDERMANHolland & Sherry CashmereThrow “There’s nothing betterthan wrapping yourself in luxuriouscashmere as you sit by the fire-place absorbed in a favorite book.”

CAREY KARLANLeron’s Leida Throw “Beautifuldrape, subtle sophisticated colorsand a luscious hand—these throws,a blend of lamb’s wool, silk andcashmere, are the height of luxury.I like a throw that is an elegant ac-cessory, not one whose bulk andsize threaten to take over the sofa.”

Irwin Feld’s passion for allthings modern is reflected inhis 5,000-square-foot loft-stylegallery filled with fine art, furni-ture and lighting with a mid-century feel. His selections can

be found at Irwin Feld Design. STAMFORD,(203) 588-0567, WWW.IRWINFELDDESIGN.COM

Page 115: New England Home's Connecticut

4 6 2 D a n b u r y R o a d

W i l t o n , C T 0 6 8 9 7

p. 2 0 3 . 5 6 3 . 0 5 5 3

f . 2 0 3 . 5 6 3 . 0 5 9 3W W W . M I C H A E L S M I T H A R C H I T E C T S . C O M

WILTON, CONNECTICUT P. 203 .563.0553

Page 116: New England Home's Connecticut

112 New England Home’s Connecticut Fall 2010

Perspectives

IRWIN FELDVintage Fireplace Surround “Classic meetsmodern in this 1940s fireplace surround ofwood and felted fabric. Whether used infront of a regular firebox opening or as afaux mantel, this piece has the warmth anddimension that can make it a focal point.”

Fireplace

CAREY KARLANRegency Bullseye in ClassicoLimestone “A lighter fireplacecan be very dramatic againsta dark painted or paneledwall. Just as important as themantel is the surround and ac-cessories and I absolutely lovethis Georgian steel register.”

LINDA RUDERMANNineteenth-century Pine and GessoMantel “A fireplace is a quintessen-tial piece for the library and plays anintegral part in creating a warm envi-ronment. This carved pine mantelfrom Chesney’s ignites that warmthand mixes harmoniously with anytransitional or traditional library.”

Carey Karlan, owner of Last Detail, afull-service interior design firm, insistson quality workmanship and materialswhen she’s creating interiors that reflecteach client’s aesthetic and lifestyle. Herselections are available through Last

Detail. DARIEN, (203) 921-5151, WWW.CAREYKARLAN.COM

Page 117: New England Home's Connecticut

S I N K L E G S

RESIDENTIAL HOSPITALITY

CUSTOM SIZES, CONFIGURATIONS, FINISHES

AVAILABLE MODELS: DECORATIVE COLLAR, TAPERED FOOT,

BUN FOOT, FLUSH, SQUARE

C U S T O M M E TA L WA S H S TA N D S

email inquiries to [email protected] 800-398-9676

www.SinkLegs.com

Tapered Foot model washstand

Southport, Connecticut • (203) 255-4031Quogue, New York • (631) 653-1481

New Milford, Connecticut • (860) 210-7852apdarchitects.com

A R C H I T E C T S

AUSTINPATTERSONDISSTON

Page 118: New England Home's Connecticut

114 New England Home’s Connecticut Fall 2010

Perspectives

LINDA RUDERMANVaughan Designs FloorLamp “This mahogany lampwith its burgundy linen shadeestablishes substantial visualweight by introducing ahandsome, organic material.”

Reading Lamp

CAREY KARLANEvry Tripod Lamp “This piece fromVaughan is a charming little lamp witha lot of confidence and personality.It’s perfect as a partner for a smallerchair. Who can resist the soft gilt fin-ish and pheasant feather shade?”

Linda Ruderman believes that the jour-ney a homeowner embarks on with adesigner should be both enjoyable andeducational. She works very closelywith her clients, designing their interiorspaces to articulate their own histories,

passions, needs and desires. Her choices can be purchased through Linda Ruderman Interiors. GREEN-WICH, (203) 552-9700, WWW.LINDARUDERMAN.COM

IRWIN FELDWood and Brass FloorLamp “This piece is specialbecause it was convertedfrom a torchiere to a regularfloor lamp. The base andneck have touches of bright-ly polished metal that shineagainst the rich chocolatewood. It is practical and canbe used almost anywhere.”

Page 119: New England Home's Connecticut

Marble | Grani t e | Limes tone

Til e s | Tables | Counter Tops

Vani ty Tops | Fireplaces

34 Riverside Avenue, Norwalk, CT 06850tel (203) 847-6880, fax (203) 847-3902

www.casatellimarbleandtile.com

Custom fabrication of marble and granite since 1988IMAGES BY LAURA MOSS PHOTOGRAPHY

Helen RichardsonInteriors

Creating Beautiful &Distinctive Spaces

www.HelenRichardsonInteriors.com(203) 910-0649

Page 120: New England Home's Connecticut

116 New England Home’s Connecticut Fall 2010

Perspectives • Wish ListWhat are some things you’d love to use in a project?

LA

RA

TO

ML

IN

An early love of antiquing was thetrigger that led to Mar Silver’s careerin interior design. With her charac-teristic passion for beautiful things,Silver began traveling the world insearch of wonderful pieces that shedisplays in her Westport antiquesshop and uses in her interior designbusiness. “I love to use exclusivepieces that aren’t widely available in Fairfield County or anywhere, be-cause I want my clients’ homes tobe as personal and unique as theyare,” she says.

Silver has become known for hersophisticated, serene interiors—spaces that go beyond beauty tonurture the soul. “My approach todesign is very organic,” she says. “Mysignature look combines a neutralpalette and sensual textures with amix of custom-fabricated pieces thatI design or find in my travels,” shesays. “I also use one-of-a-kind artand vintage lighting, bringing every-thing together to create modern, so-phisticated rooms.” The items on herWish List are all available throughMar Silver Design. WESTPORT, (203)341-0413, WWW.MARSILVERDESIGN.COM

1 Bouvier Chandelier“No room is complete in my book without vintage Italian lighting. I love toadd interesting ones in the kitchen or a bathroom. They add a touch of un-expected drama and are extremely pleasing to look at.”

2 Mandala by James Wilkins“I enjoy collecting art, both personally and for clients. For me, art thatevokes mood or emotion works extremely well with my design approach.This piece by photographer James Wilkins is a good example.”

3 Matteograssi Dining Chairs“White open-back Italian leather chairs are a great wish-list item whenI’m designing a dining room. I love the lines on these chairs, and they’recomfortable.”

4 Nana Wall System“A folding glass door system like the Nana Wall is great for bringing theoutside into a room, even when temps drop. They function well, and youcan always experience the wonder of nature around you.”

5 Gianda Blasco Tipi“I love incorporating unexpected details or elements like these pool tepees.They’re decorative, functional and something you don’t see every day.”

6 Custom Vanity“This stone and wood bathroom vanity is an example of a piece that I cus-tom designed. I love to play with textures to create furniture that is bothbeautiful and functional.”

6

5

1

3

2

4

Mar Silver, Westport

Page 121: New England Home's Connecticut

108 River Road, Cos Cob, CT • (230) 661-1107

WWW.COASTALPT.COMCT license #’s NHC 0010367 & HIC 0607818

Page 122: New England Home's Connecticut

Models on Display

Fine POST & BEAM Carriage Houses, Garden Sheds & Country Barns, Shipped Nationwide

326 Gilead St. Hebron, CT 06248 www.countrycarpenters.com 860.228.2276

781-235-5650 www.divinekitchens.com

EXQUISITE DESIGNS TURN-KEY KITCHEN & BATHROOM RENOVATION UNPARALLELED SERVICE

Long a favorite in Atlanta, Chicago, Los Angles...Leicht, Germany’s

top cabinet manufacturer, is now exclusively available in New

England through Divine Kitchens. Divine introduces architectural

concepts to create a fluid transition between the kitchen and the

rest of the living space.

Colors and options limited only by your imagination. Impressive

pricing when comparing the modern landscape.

Architects, designers and homeowners are invited to make an

appointment to explore a whole new way to think about the home.

Page 123: New England Home's Connecticut

www.edsgaragedoors.com Telephone: 203 8471284

Located:

136 Water Street

South Norwalk,CT

06854

Sales,

Installation

& Service

since1972

For over 35 years, we have offered the finest custom

and semi-custom architectural styles in Fairfield

and Westchester County:

• Elegant design and superior craftsmanship

• State-of-the-art manufacturing technologies

• Highest-quality materials

• Beauty, security, and durability.

The largest GarageDoor showroom

inNew England. See OVER 30 full-size

doorsondisplay!

Our Showroom

Page 124: New England Home's Connecticut

120 New England Home’s Connecticut Fall 2010

1 Bloom Design introduces Leah, a uniqueoccasional furniture line that’s “bold in itsuse of sculptural shapes and finish mate-rials—a minimalist fusion of art and func-tion.” This round coffee table, part of thenew collection, has a removable suspend-ed fossil insert, making it the perfect con-versation piece. NEW HAVEN, (203) 773-9992, WWW.BLOOM-DESIGN.NET

2 Potter John Macomber of Greenleaf Pottery has been handcrafting stone -ware pottery for nearly thirty-five years,producing richly colored pieces that, ac-cording to Macomber, are both delicatelydesigned and extremely durable. We’reespecially fond of his new line of hand-built slab dinnerware, shown here. SOUTHWINDSOR, (860) 528-6090, WWW .GREENLEAF POTTERY .NET

3 The Flower Loop vase from Mix DesignStore is stylish in its simplicity, madefrom a delicate yet sturdy free-flowingsteel wire. Even better, it comes com-plete with a high-quality artificial calla lilyfor those times you’ve run out of freshflowers. Three or four would make alovely table centerpiece. GUILFORD, (203)453-0202, WWW .MIX DESIGN STORE.COM

4 Oh so seasonal, this 1950s Fall StripeSofa at Irwin Feld—“one of our currentfavorites,” says Feld—is covered in alter-nating orange and brown stripes on abeige background and is framed in darkwood with an elegant curved back andtapered legs. STAMFORD, (203) 588-0567,WWW.IRWINFELDDESIGN.COM

5 Safavieh Home Furnishings recentlylaunched a new Country French collectionthat includes tables, chairs, settees andbenches. The aptly named ProvenceFrench Arm Chair, with its chippy whitepaint finish (called Flax) and beige linenupholstery, would look beautiful at thehead of formal dining table. STAMFORD,(203) 327-4800, WWW .SAFAVIE HHOME .COM

6 Atlas Homewares designer AdrienneMorea founded the company fifteenyears ago with a guiding principle of creating “jewelry for the home.” Theseembellished beauties—a new line of crys-tal knobs and crystal pave knobs andpulls—are created of brushed anodizedaluminum along with the crystals. Findthem at Klaff’s. SOUTH NORWALK, (800)552-3371, WWW.KLAFFS.COM

New in the ShowroomsUnique, beautiful and now appearing in Connecticut shops and showroomsBY ERIN MARVIN

4

2

1

6

3

5

Page 126: New England Home's Connecticut

7 Spark Modern Fires heats things upwith the Linear Burner system, whichdesigners can customize to fit theirclients' needs. All Spark models featurestate-of-the-art burners and controlsand offer environmental and design ad-vantages over typical wood-burningfireplaces. BETHEL, (866) 938-3846, WWW.SPARK FIRES .COM

8 Olley Court has some great surprises instore for fall and winter, including a newVerellen couch, the Madeira buffet fromShawna Stoney, a ClubCu coffee tableand these gorgeous Metallic Earth linenpillows from Ankasa that are available ina variety of colors and sizes. RIDGEFIELD,(203) 438-1270, WWW .OLLEY COURT .COM

9 Just in at Hanes & Ruskin Antiques isThe Isaac Webb by Lucius Briggs, whichdepicts the packet ship leaving New YorkHarbor's Castle Island. Signed in thelower left corner, the painting has beenrestored to its original condition and ismounted in a period gold frame. OLDLYME, (860) 434-1800, WWW .HANES ANDRUSKIN .COM

10The Muu line of modern, sustainable andcustomizable baby furniture debuts inConnecticut at O Lulla. Shown here is acrib from Muu’s Sam Collection, aimed at“new parents who want to furnish theirhome with products that are modern andelegant, high quality and durable, andmade of sustainable, non-toxic materials.”SOUTHPORT, (203) 292-8880

11 We can’t wait to stretch out on theDeana Chaise, one of the newest designsfrom Jessica Charles Furniture that’s nowavailable at The House in the Country.With its clean, elegant lines, the chaise,available in a variety of fabrics, would bea comfortable fit in any transitional-styleliving room or bedroom. WOODBURY,(203) 263-6660

12 The polished nickel on this eye-catchingCascade Chandelier from Studio Steel isa new finish that’s now available at Fair-field Lighting. Studio Steel is renownedfor one-of-a-kind custom wrought-ironfixtures; this is the first time polishednickel has been added to their twenty-five-plus selections of available finishes.FAIRFIELD, (203) 384-2209, WWW .FAIRFIELDLIGHTING .COM

New in the Showrooms

122 New England Home’s Connecticut Fall 2010

11

7

8

10

12

9

Page 127: New England Home's Connecticut

B O X W O O Dhome & interiors

44 East Avenue New Canaan CT 06840(203) 972-1010 Fax (203) 972-3030 www.BoxwoodInteriors.com

44 East Avenue New Canaan CT 06840(203) 972-1010 Fax (203) 972-3030 www.BoxwoodInteriors.com

Finished in Fabrice u r o p e a n e l e g a nc e

Finished in Fabric is a family-operated, European-trainedworkroom that specializes in antique upholstery done in OldWorld style with hand-sewn edging and horse hair.The all-inclusive workroom can fulfill all of your home’s uphol-stery and drapery needs, from decorative pillows, headboards andbedding to fabric walls and complete drapery installation.

Photographer - Philip Ennis

(860)346-4843 | [email protected]

Page 128: New England Home's Connecticut

������������ ������������������������

��������������������������������������������������������������� ���������������������������������������������������������������

�������������� � ���� ��� � ���������� �������� � �������������� � ��!!����"

Tel.: 1 866 851-5113 (toll free)www.belislewindows.com

In a Class by itselfIn a Class by itself

R.B

.Q. :

82

31

-10

69

-27

Page 129: New England Home's Connecticut

MARBLE AND GRANITE, INC.

“It’s like a museum of stone*.”Dream. Design. Discover

Prutting & Company70 Pine Street New Canaan, CT 06840Tel: 203.972.1028

West Coast Office:Prutting & Company2353 S.E. 58th AvenuePortland, Oregon 97215 Tel: 503.233.1253

173 PARK STREET NEW CANAAN

www.prutting.com

Photo by Michael Biondo

Visit our blog at www.pruttingandcompany.wordpress.com

Page 130: New England Home's Connecticut

Come out to honor and celebrate with this year’s interior design, architecture and landscape architecture inductees at The Fourth Annual

New England Design Hall of Fame Awards and Gala

November 11, 2010The State Room, Boston

Tickets on Sale Now! For further information, visit www.nedesignhalloffame.com or call 800.609.5154

A portion of ticket proceeds will go to the New England Design Hall of Fame Scholarship Fund

Event Partner Flower Sponsor Host VenueHospitality Sponsor

Silver Sponsors

Hosted By

New England’s Design Event of the Year…...A Night Not to be Missed

PHO

TOS

BY T

ARA

CA

RVA

LHO

Gold Sponsors

Cocktail sponsor

Page 131: New England Home's Connecticut

Fall 2010 New England Home’s Connecticut 127

DETAILS, DETAILSPAGES 50–59Architect: McKee Patterson, Austin PattersonDisston Architects, Southport, Conn., (203)255-4031, www.apdarchitects.comInterior designer: Nancé J. Vigneau, Vigneau &Associates Interiors, Westport, Conn., (203)226-0581, www.vigneauandassociates.comPage 51: Dining chair fabric from Cowtan &Tout, New York City, (212) 753-4488,www.cowtan.com, upholstered by Triple S,Norwalk, Conn., (203) 847-8000, www .triplesclean .com; decorative painting on inset panelsand ceiling by Heidi Holzer Design and Decora-tive Work, Redding, Conn., (203) 544-9471,www.heidiholzer.com; pair of tole and mirrorwall lights over fireplace mantel from VaughanDesigns, New York City, (212) 319-7070, www.vaughan designs .com; pair of brass starlanterns from Vaughan Designs; fireplace fromChesney’s USA, New York City, (646) 8400609, www.chesneys.co.uk.Page 52: TRS sofa through Darien Design Cen-ter, Darien, Conn., (203) 655-8739, www .dariendesign center .com, with fabric from Cowtan &Tout; Jessica Charles club chairs throughDarien Design Center with fabric from Cowtan& Tout; caned library chairs from Edward Fer-rell, New York City, (212) 758-5000, www.ef-lm.com; custom end tables from Nininger &Co., Waterbury, Conn., (203) 574-1925, www.nininger andco .com; coral table lamps fromTrovare Home, Cos Cob, Conn., (203) 869-5512,www.trovareathome.com; wool carpet fromElizabeth Eakins, South Norwalk, Conn., (203)831-9347, www.elizabetheakins.com; wovenwood blinds through A&M Drapery, Norwalk,Conn., (203) 847-8000; glass globe lanternceiling fixture from Vaughan Designs; PowellBuff wall trim color from Benjamin Moore,www.benjaminmoore.com; grasscloth insetpanels from Phillip Jeffries Ltd., Fairfield, N.J.,(800) 576-5455, www.phillipjeffries.com.Page 53: Stair carpet from Elizabeth Eakins;bench cushion fabric from Hinson & Co., NewYork City, (212) 688-5538, www.hinsonco.com,upholstered by Triple S; glass globe lantern ceil-ing fixture from Vaughan Designs; Ivory Tuskfoyer wall trim color from Benjamin Moore;grasscloth from Phillip Jefferies; Clandon Stormwall light next to fireplace from Vaughan De-signs; fireplace from Chesney’s USA.Page 55: Wicker furniture from JANUS et Cie,New York City, (212) 752-1117, www .janus et cie.com, with fabric from Perennials, Dallas, Tex.,(214) 638-4162, www.perennialsfabrics.com.Pages 56–57: Mis B bar stools through Sig-norello of Westport, Westport, Conn., (203)221-3200, www.signorellowestport.com; chairsfrom Mitchell Gold + Bob Williams, Greenwich,Conn., (203) 661-4480, www.mgbwhome.com,with fabric from Cowtan & Tout; chair pillowfabric from Lee Jofa, Stamford, Conn., (203)504-2640, www.leejofa.com, with trim fromSamuel & Sons, New York City, (212) 704-8000,www.samuelandsons.com, upholstered byTriple S; TRS loveseat through Darien DesignCenter with fabric from Hinson & Co.; wovenwood blinds through A&M Drapery; antiquetrunk from Leonards Antiques, Westport,Conn., (203) 222-7031, www .leonards direct.com; cotton area carpet from Elizabeth Eakins;Greenhouse hanging lantern over kitchen islandfrom Charles Edwards, London, +44 (0) 207736 8490, www .charles edwards .com; New-port White granite countertops from FordhamMarble, Stamford, Conn., (203) 348-5088,www.fordhammarble.com; kitchen hardware

ResourcesA guide to the products and professionals in this issue’s featured homes

111 Cherry Street, New Canaan, CT 06840 (203) 966-8333

R o b e r t B r u c e D e a n , A I A

w w w . r o b e r t d e a n a r c h i t e c t s . c o m

r o b e r t d e a n a r c h i t e c t s

Page 132: New England Home's Connecticut

Barbara McEntee | 203.354.0278 | 9:30-4:30 Mon.-Fri., Sat. by appointmentVisit our showroom; A Design Destination | 21 Lois Street Norwalk, CT

interiors

Page 133: New England Home's Connecticut

Resources

Fall 2010 New England Home’s Connecticut 129

from Whitechapel, Jackson, Wyo., (307) 739-9478, www.whitechapel-ltd.com.Page 58: Custom bed designed by Vigneau &Associates Interiors, in fabric from J. RobertScott, Los Angeles, Calif., (310) 680-4300,www.jrobertscott.com, fabricated by Triple S;grasscloth wallcovering from Phillip Jefferies;Malabar Grove coverlet through Lynnens,Greenwich, Conn., (203) 629-3659, www.lynnens .com; bedside arm library light fromBesselink & Jones, London, +44 (0) 20 73514669, www.besselink.com.Page 59: Roman shade in master bath throughA&M Drapery, in fabric from Lee Jofa; silhou-ette shades through A&M Drapery; bath fix-tures from Harrington Brass Works, Allendale,N.J., (201) 818-1300, www .harrington brass works.com; Ivory Tusk wall and trim paint from Ben-jamin Moore; oriental carpet from Stark Carpet,Norwalk, Conn., (203) 899-1771, www .starkcarpet .com.

EUROPEAN UNIONPAGES 62–71Architect: Alex Kaali-Nagy, The Kaali-NagyCompany, New Canaan, Conn., (203) 966-8254, www.kaali-nagy.comInterior designer: Karen Kaali-Nagy, The Kaali-Nagy CompanyBuilder: Alex Kaali-Nagy Development Corpo-ration, New Canaan, Conn., (203) 966-8254,www.kaali-nagy.comLandscape architect: Wesley Stout Associates,New Canaan, Conn., (203) 966-3100, www.wesley stout .comPlant installation: Young’s Nurseries, Wilton,Conn., (203) 762-5511, www.youngsnursery.comPage 62: Scenes of North America wallpaperby Zuber, New York City, (212) 486-9226,www.zuber.fr; table skirt by Brunschwig et Fils, North Plains, N.Y, (914) 684-5800, www.brunschwig .com; skirt fringe by MJ Decor fromRunk Douglas Hayes & Wheeler Antiques,Southport, Conn., (203) 254-7315.Pages 64–65: Window treatment fabric fromLee Jofa, Bethpage, N.Y., (800) 453-3563,www.leejofa.com; curtain rods from Houlés,D&D Building, New York City, (212) 838-7878,www.houles.com; antique English mahoganytray table from Runk Douglas Hayes & WheelerAntiques; antique tray table from Nicholas An-tiques, New York City, (212) 688-3312, www.nicholas antiques .com; hand-painted oval cof-fee table and Sheraton cane chair from JuliaGray, D&D Building, New York City, (212) 223-4454, www.juliagray.com; sisal carpet by StarkCarpet, New York City, (212) 752-9000, www.stark carpet .com; red velvet corduroy sofa fab-ric from Lee Jofa; all dining room fabrics fromChristopher Norman, D&D Building, New YorkCity, (212) 838-7878, www .christopher normancollection .com; chandelier from Rue FaubourgSt. Honoré, Greenwich, Conn., (203) 869-7139.Pages 66–67: Window treatment fabric by LeeJofa; carpet from Mark, Inc., Greenwich, Conn.,(203) 861-0110, www.markinccarpets.com;sconces and antique andirons from RueFaubourg St. Honoré, leather ottoman fabric byEdelman, D&D Building, New York City, (212)751-3339, www.edelmanleather.com; box onmantel from Sallea Antiques, New Canaan,Conn., (203) 972-1050, www .sallea antiques.com; sofa fabric by Lee Jofa; sofa pillows fromNicholas Antiques.Page 68: Custom butternut cabinet hardwareby Top Knobs from Canaan Distributors, Stam-ford, Conn., (203) 356-1000; Tile Tales docu-mentary print wallpaper by Brunschwig et Fils;faucet by Perrin and Rowe from Best Plumb-ing, Stamford, Conn., (203) 975-9448, www.bestplg .com; Lagos Azul limestone countertop

SUPERIOR GARAGE DOORSDISTINGUISHED WOOD GARAGE DOORS

| 860.633.2973 | www.superiordoorne.com

Page 134: New England Home's Connecticut

130 New England Home’s Connecticut Fall 2010

from Fordham Marble, Stamford, Conn., (203)348-4458.Page 69: White stoneware from Country DiningRoom Antiques, Great Barrington, Mass., (413)528-5050, www .country dining room antiq .com;calacatta countertop and tile above stove fromFordham Marble; lamps by David Fuller, Kittery,Maine, (207) 286-3810, www .david fuller lamps.com; Staffordshire blue and white transfer warefrom Country Dining Room Antiques; windowtreatment fabric by Zimmer and Rohde throughTravers, D&D Building, New York City, (212) 758-5357, www .zimmer-rohde .com; antique lightingfixtures from Rue Fauborg St. Honoré; butternutcountertop by One & Co., Norwich, Conn., (860)892-5180; braided area rug from Stark, D&DBuilding, New York City, (212) 752-9000, www.stark carpet .com.Pages 70–71: Sconces at fireplace, antiqueLimoge figurines and mirror above chest fromRue Faubourg St. Honoré; antique plates byCountry Dining Room Antiques; blue velvet onFrench chairs by Scalamandré, New York City,(212) 980-3888, www.scalamandre.com; antiquemahogany swivel floor mirror and antique silvertray from Runk Douglas Hayes & Wheeler An-tiques; andirons from Rue Faubourg St. Honoré;hand-painted Louis XVI bed, chest betweenwindows and rose-colored lamps from JuliaGray; bedding by Matouk, Fall River, Mass.,(508) 997-3444, www .matouk .com; curtain anddust ruffle fabric from Travers; curtain trim byClarence House, D&D Building, New York City,(212) 752-2890, www .clarence house .com; em-broidered pillow by Chelsea Textiles Ltd., NewYork City, (908) 233-5645, www .chelsea textiles.com; fabric on chair by bed by Old WorldWeavers from Stark, www .old-world-weavers.com; regency commode bedside table fromJulia Gray; carpet by Mark, Inc.; master bathlighting fixtures and hand-painted antiqueFrench commode with faux marble top fromRue de Faubourg St. Honoré; embroidered tow-els from Matouk; carpet by Stark; floral printsfrom J. Pocker & Son, Westport, Conn., (203)222-7800; glass bottles above fireplace fromCountry Dining Room Antiques.

A BACKDROP FOR LIVINGPAGES 74–83Woodworker: Tiger Carlson, Haddam, Conn.,(860) 345-3355Hardware throughout: Rocky Mountain Hard-ware, Hailey, Ida., (208) 788-2013, www .rockymountain hardware .comPage 76: Light fixture from Urban Archaeolo-gy, New York City, (212) 431-4646, www .urbanarchaeology .com.Page 78: Vases on mantel from Crate & Barrel,www.crateandbarrel.comPage 80: Custom wall color by Pratt & Lam-bert, www.prattandlambert.comPage 81: Chandelier from ABC Carpet & Home,New York City, (212) 473-3000, www .abc home.com; dining table and mirror from Old BankAntiques, Hampton, Conn., (860) 267-0790.Page 83: Bathroom sink from Ann Sacks,Greenwich, Conn., (203) 622-8884, www .annsacks .com, with Perrin & Rowe faucet throughRohl, Best Plumbing Tile & Stone, Stamford,Conn., (203) 975-9448, www .bestplg .com;Shaws Original kitchen sink through Rohl.

HEART OF THE MATTERPAGES 86–93Architect: Michael Smith, Michael Smith Archi-tects, Wilton, Conn., 203-563-0553, www.michael smith architects .comInterior designer: Heather McWilliam-Autore,McWilliam-Autore Interiors, Wilton, Conn.,(203) 834-0354, www.mcwilliaminteriors.com

Resources

nukitchens

������������ ������������� �������� ��� ��������������������������

����������� ����������� ��������������������������������

nukitchens

Page 135: New England Home's Connecticut

Fall 2010 New England Home’s Connecticut 131

Builder: Walter Cromwell, Country Club Homes,Wilton, Conn., (203) 763-0550, www .countryclub homes inc .comLandscape architect: John C. De Feo, ModelProperties, Ridgefield, Conn., (914) 589-0446,www.modelproperties.netPage 86: Bar chairs from Duralee Fine Furni-ture, D&D Building, New York City, (212) 752-4040, www.duralee.com; Marcel fabric in drift-wood from Romo, New York City, (212)319-7666, www.romo.com; hallway rug fromStark Carpet, Norwalk, Conn., (203) 899-1771,www.starkcarpet.com; hallway runner fromKaoud Rugs, West Hartford, Conn., (203) 762-0376, www.kaoud.com; pillow from Lillian August, Norwalk, Conn., (203) 847-3314, www.lillian august .com; Guilford Green wallcolor fromBenjamin Moore, www .benjamin moore .com,Venetian plaster by Lawrence Oliver, LawrenceOliver Painting, Norwalk, Conn., (203) 246-7636, www.oliverpainting.com; kitchen runnerfrom Elizabeth Eakins, South Norwalk, Conn.,(203) 831-9347, www .elizabeth eakins .com;counter surface honed Portofino granitethrough Casatelli Marble and Tile, Norwalk,Conn., (203) 847-6880, www .casatelli marbleand tile .com; backsplash tile from Ceramic Design, Westport, Conn., (203) 454-0032,www.ceramicdesignltd.com.Page 87: Chandelier by Currey & Co. throughKlaff’s, South Norwalk, Conn., (203) 866-1603,www.klaffs.com; Coronata Star wallpaper byOsborne & Little, Stamford, Conn., (203) 359-1500, www.osborneandlittle.com; custom rugby Elizabeth Eakins; Marcel in driftwood andEvellyn in stone pillow fabrics by Romo; tablelamp by Barbara Cosgrove through McWilliam-Autore Interiors; Spring in Aspen wallcolor byBenjamin Moore.Page 89: Outdoor chairs from Brown Jordan,New York City, (212) 593-1390, www .brownjordan .com.Page 90: Chandelier from Fine Art Lampsthrough Klaff’s; custom dining table from Ster-ling Custom Cabinetry, Bridgeport, Conn.,(203) 335-5151; chairs from Artistic Frame, NewYork City, (212) 289-2100, www .artistic frame.com with Komaka Sukoshi fabric from Os-borne & Little; rug from Patterson, Flynn andMartin, New York City, (212) 688-7700, www.patterson flynn martin .com; Stunning wallcolorby Benjamin Moore; ceiling treatment byLawrence Oliver.Page 91: Sofa through McWilliam-Autore Interi-ors with Motif Designs fabric; ottoman throughMcWilliam-Autore Interiors with fabric by Os-borne & Little; armchair fabrics from Anzea,Fort Worth, Tex., (817) 336-2310, www .anzea.com; hanging lamps from Hubbarton Forgethrough Klaff’s; Bleeker Beige wallcolor byBenjamin Moore; bedroom inglenook sconcesand chandelier by Currey & Co. through Klaff’s;fireplace tile from Casatelli Marble and Tile;Pismo Dunes wall and ceiling color from Ben-jamin Moore.Page 92: Cancun Texture in sunset chair fabricfrom Calvin Fabrics through Donghia, D&DBuilding, New York City, (212) 935-3713, www.donghia .com; rug from Merida Meridian,Boston, (800) 345-2200, www .merida meridian.com; chandelier from Boyd Lighting, San Fran-cisco, Calif., (415) 778-4300, www .boyd lighting.com; Sefina curtain fabric from Romo; BleekerBeige wallcolor by Benjamin Moore.Page 93: Faucet from Perrin & Rowe throughKlaff’s; curtain fabric by Victoria Hagan Home,New York City, (212) 888-3241, www .victoriahagan home .com; floor tile from SteppingStones Marble and Granite, Norwalk, Conn.,(203) 854-0552, and Westport, Conn., (203)293-4794, www .classic stones .com, PismoDunes wallcolor by Benjamin Moore. •

Page 136: New England Home's Connecticut

Outstanding Food, Extraordinary Service & Flawless PresentationExecutive Chef ~ Michael W. BattWeddings • Social Events • Corporate Events • Fund Raisers

Private Chef Service • Dinner Deliveries • Event & Wedding Planning

28 Old Field Point Road • Greenwich, CT 06830 • T/203.622.0725 • F/203.625.9314www.fooddesigncatering.com

The Possibilities are Endless...

Food Design...Events Cater ed Beyond Expectations!

Page 137: New England Home's Connecticut

HGTV was here to film an outdoor kitchen designed and built byPreferred Properties Lsc. SEE FOR YOURSELVES: on YouTube

http://www.youtube.com/user/Preferredworld#p/a/u/0/7GZpOCg7D6s

203.250.1030 • [email protected] • www.OutdoorlivingCt.com

Award Winning Outdoor Lighting and Living Specialists

Free night lighting demos to show you just how good your house looks at night

26 Arcadia Rd., Suite 6 | Old Greenwich, CT | (203) 540-5350 | www.VictoriaLyonInteriors.com

Phot

o by

Eri

c R

oth.

Pai

ntin

g by

Bar

t Gul

ley,

cou

rtes

y of

art

+int

erio

rs.

FROM TRADITIONAL TO MODERN

Page 138: New England Home's Connecticut

134 New England Home’s Connecticut Fall 2010

Ahearn–Schopfer and Associates 41

Amy Aidinis Hirsch 73

Apadana Fine Rugs 37

Aqua Pool & Patio 45

Austin Patterson Disston Architects 113

Back Bay Shutter Co. 61

BAM Interiors 128

Beinfield Architecture 72

Belisle Doors and Windows 124

Boxwood Interiors 123

Brooks and Falotico Associates 101

C2 Limited Design Associates 94

Casatelli Marble and Tile Imports 115

Clarke Distributors 95

Coastal Point Construction 117

Cobble Court Interiors 97

Colony Rug Company 49

Country Carpenters 118

Country Club Homes 31

Creative Interior Design 47

Davenport Contracting 34

David D. Harlan Architects 20

Divine Kitchens 118

The Drawing Room 8–9

Earthscapes 10–11

Ed’s Garage Doors 119

Elizabeth Eakins 60

Finished in Fabric 123

Food Design Catering 132

Gardiner & Larson Homes 2–3

Glen Gate Properties 103

Granoff Architects 29

Helen Richardson Interiors 115

Hemingway Custom Cabinetry 6–7

Hilton-VanderHorn Architects 105

HM Oliver Interiors 24–25

iH Design Studio 36

Irwin Feld Design 22

Karp Associates 135

Katherine Cowdin 43

Kinlin Grover Corporate 107

Kitchens by Deane 23

Klaff ’s 124

Lillian August Inside front cover, page 1

Linda Ruderman Interiors 26–27

Lynne Scalo Design 13

Mar Silver Design 4–5

Marble and Granite 125

Michael Smith Architects 111

Neil Hauck Architects 131

NuKitchens 130

Olson Development 17

Orrick & Company 117

Palmer Industries 113

Parc Monceau 14–15

Peacock & Beale Back cover

Peter Cadoux Architects P.C. 99

Preferred Properties 133

Prutting & Company 125

Advertiser IndexA helpful resource for finding the advertisersfeatured in this issue

Putnam Kitchens 18–19

Quidley & Company 21

Ram Construction 96

Restoration Lighting Gallery 30

Ridberg & Associates 85

Rinfret Design Limited 104

Robert Cardello Architects 35

Robert Dean Architects 127

Robin McGarry 38

Runtal North America 44

Stirling Design Associates 32

Studio Steel 33

Sudbury Design Group 84

Superior Garage Doors 129

Suzanne Novik Interiors 106

Vandamm Interiors 121

Vermont Verde Antique Marble Co. 46

Victoria Lyon Interiors 133

Wadia Associates Inside back cover

Wainscot Solutions 98

Woodmeister Master Builders 39

Wright Brothers Builders 109

Zen Associates 48

New England Home’s Connecticut, Fall 2010© 2010 by Network Communications, Inc. All rights reserved. Permission to reprint orquote excerpts granted by written requestonly. Editorial and advertising office: NewEngland Home, 530 Harrison Avenue, Suite302, Boston, MA 02118, (617) 938-3991, (800)609-5154. Corporate office: Network Commu-nications, Inc. 2305 Newpoint Parkway,Lawrenceville, GA 30043, (770) 962-7220.

Page 139: New England Home's Connecticut

K A R PA s s o c i a t e s

Renovation

Custom Homes

Construction Management

Consulting

Award winning builder since 1989

www.karpassociatesinc.com

80 Main Street, New Canaan, CT 06840Phone 203-972-3366

Page 140: New England Home's Connecticut

136 New England Home’s Connecticut Fall 2010

Sketch PadDesign ideas in the making

WE NAME EACH OF our new custom furniture pieces after our clients’ children, and in this case the commissionwas for a new dining table named “Lily.” The name quite literally (and yes, predictably) motivated my first ideas and sketches. The studies of overlaid petals in relief, from which an urn emerges, provided a unique sculptural

depth and radial clarity. The Lily table became the third in a series of four based on the forms of the classical urn.The complete design evolved into a large double-pedestal table with scalloped ends, supported by brackets inspiredby forms found in pergolas and other classic garden structures. The clients loved the personal reference and char -

acter of the petaled urns, but they thoughtfully, at the last moment, decided on a simpler pedestal design for the fin-ished table. Happily, they are now considering resurrecting the original petaled urn for a new dining table, “Lily 2.”

DAVID HARLAN, DAVID D. HARLAN ARCHITECTS, NEW HAVEN, (203) 495-8032, WWW.DDHARCH.COM

Page 141: New England Home's Connecticut

RE

SID

EN

TIA

L D

ES

IGN

~ I

NT

ER

IOR

DE

SIG

N A

ND

DE

CO

RA

TIO

N ~

CO

NS

TR

UC

TIO

N M

AN

AG

EM

EN

T(2

03)

966-0

048 ~

WA

DIA

AS

SO

CIA

TE

S.C

OM

RE

SID

EN

CE

IN

CA

SE

Y K

EY,

FLO

RID

A

Page 142: New England Home's Connecticut

p. 203 661 3540 • f. 203 661 7017 • [email protected]

Furniture • Gifts • Antiques • Accessories