pap biology warm up discuss at your table what protein synthesis is.using the terms: transcription,...
DESCRIPTION
Question #2 Sequence of three nucleotides that codes for one amino acid.TRANSCRIPT
PAP Biology Warm up Discuss at your table what protein synthesis is.using the terms: transcription, translation, mRNA, rRNA, tRNA, codon, anticodon and ribosome. Question #1 The process by which mRNA is decoded and a protein is produced. Question #2 Sequence of three nucleotides that codes for one amino acid. Question #3 Form of RNA that carries genetic information from the nucleus to the cytoplasm, where it serves as a template for protein synthesis. Question #4 Identify the 4 amino acids that will be made from the following strand of mRNA GGG AUC CCA UUG Question #5 Cell differentiation is determined by what biomolecule? Question #6 A set of three nucleotides in a tRNA molecule that binds to a complementary mRNA codon during translation. Question #7 Form of RNA that brings amino acids to ribosomes during protein synthesis. Question #8 Process of copying a nucleiotide sequence of DNA to form a complementary strand of mRNA. Question #9 Expression of genes can be prevented by different things that are in the ______________________. Question #10 Identify the two mutations that cause a frameshift. Question #11 Point mutations are also known as ________________ mutations. Question #12 Where does transcription take place? Question #13 What components of the DNA/RNA determine the genetic code? Question #14 The ribosome is responsible for the production of proteins. What does it put together to make these proteins? Question #15 What type of mutation is this: Normal = TACCCGTTACAGGCA Mutated =TACCCGTTACAGCAGCAGGCA Question #16 What type of mutations is this: Normal = ACTCCTGAGGAG Mutated =ACTCCTGTGGAG Question #17 Identify three difference between DNA and RNA. Question #18 Identify the 4 nitrogen bases in RNA. Question #19 Identify the following mutation: Normal = ATATTAGAACGCCTAGCA Mutated =ATAACGATCCGCAAGAATT Question #20 What type of mutation has the most significant results? Question #21 Write the DNA strand for the following strand of amino acids: Methionine Tryptophan Cysteine Phenylalanine Question #22 Transcribe the following DNA strand into RNA..and then translate it into a protein. TAC CCG GGT AAC ACT Question #23 Name the three types of RNA. Question #24 A change in the DNA sequence. Question #25 What are the base pairing rules? Final Wager The genetic disorder cystic fibrosis occurs when the codon GUC is replaced with AUC. What type of mutations is this and what amino acid is being made now instead of valine? Answers 1. Translation 2. Codon 3. Messenger RNA 4. Gly-Iso-Pro-Leu 5. Nucleic acid 6. Anticodon 7. Transfer RNA 8. Transcription 9. Environment 10. Deletion and Insersion 11. Silent 12. Nucleus 13. Nitrogen bases 14. Amino acids Answers 15. Insersion 16. Substitution 17. Sugar (R & D), uracil/thymine, structure (one strand/double helix) 18. A U C G 19. Inversion 20. Frameshift 21. AUGUGGUGU(UGC) UUU(UUC) 22. AUG-GGG-CCA-UUG-UGA Meth- Gly-Pro-Leu-Stop 23. mRNA, tRNA, and rRNA 24. Mutation 25. DNA= A pairs w/ T and G pairs w/C RNA= A w/ U, T w/ A and G pairs w/ C Wager Substitution Isoleucine