pcr amplification of tem gene of esbl e.coli
TRANSCRIPT
What are we working on?
In-vitro Production Of Short Nucleotides and SELEX Process
Who are we?
Ramashree and Sajini
This is going to be a long presentation!
(We will try our best to not make it boring)
Forget the fancy title adorned by even fancier words
(Our project is for a noble cause)We are trying to find a cure for a microbe
that doesn’t respond to antibiotics
• Our Project deals with a super strong bacteria that can kill people in different stages if left untreated.
• Oh wait! Treatment? What treatment? There is no cure.
• Didn’t we tell you that our bacteria was Super Strong?
ESBL E.coli
It’s a mutant strain (hence, the mystery deepens!)
ESBL E.coli
• ESBL stands for Extended Spectrum Beta Lactamase
• It means that this particular strain of E.coli is resistant to a wide range of antibiotics ( 8 different classes of antibiotics)
• We call our bacteria the Octobiotic Bacteria.(That is something we came up with)
So, is it just a multidrug resistant microbe?
(pffft! What’s with all the hype?)
• As much as we wish it were, IT IS NOT.• This strain of E.coli changes from being the
healthy bacteria that helps digest our food in our intestines to the mutant strain which can potentially kill us.
WOW!Care to explain?
Legend speaks of a legendary warrior – ESBL E.coli
(Once upon a time…….and the story unfolds)
Chapter 1
Nosocomial Infections
• Nosocomial infections are infections acquired by a resident of the hospital or a visitor to the hospital.
• Because hospitals are teaming with diseases harbored by a multitude of patients with an even bigger number of people visiting them
• Not to mention the army of nurses and doctors working there.
Uhmmm, such as?
Be scared. Be very scared!
• Urinary Tract Infections• Blood poisoning• Bacteremia• Gastro-intestinal and skin infections
How does it get transmitted?
Who is responsible?
Is it you, Bacteria? Is it you, Fungus? Or is it you, Virus?
SURPRISE!• It’s them all.• BACTERIA• VIRUS• FUNGUS• Parasites as well
Meet the causative agents.
We are concerned only about the bacterial
agents.
And this is what E.coli unleashes
Urinary Tract Infection
• Cloudy Urine• Pain while urinating• Burning sensations while urinating• Need to urinate often• Bloody urine• Foul smelling urine• Back pain
And this is how they do it…
Chapter 2
ESBLWhat are you?
Extended Spectrum Beta Lactamase
• They are enzymes that hydrolyze extended spectrum cephalosporins with an oxymino side chain
• These cephalasporins include cefotaxime, ceftriaxone, ceftazidime
• They are plasmid encoded enzymes.
• The genes responsible are TEM-1, TEM-2 and SHV
• Mutations of these genes correspond to the altering of the amino acid configuration around the active site of these beta-lactamases.
TEM-1
Amino acid substitutions take place at positions 104, 164, 238 and 240
Chapter 3
How do we fight it?
WAR 1
• Collect ESBL E.coli isolates (from patients or from soil)
• Screen them• Confirm them
CHARGE!
Inoculation
• The sample was inoculated initially in 100ml of nutrient broth to which 10mg of ampicillin was added.
• In subsequent trials we changed the medium.• We inoculated the bacteria in Luria Bertani
broth.
Screening – MH plate
Sheesh!
Success!
Screening - DDSTAugmentin Disk (20µg of amoxilin + 10µg of clavulanic acid) in the centre surrounded by 3 cefotaxime tablets (30µg each)
One down!
WAR 2
• Isolate the DNA from the plasmid• Perform gel electrophoresis• Confirm by PCR amplification
Chapter 4Plasmid DNA isolation
Trial 1
• Bacteria was inoculated in Nutrient Broth• Two flasks containing 100 ml of broth were
taken• One contained ampicillin and the other did
not.• 1ml of culture was taken from each flask and
centrifuged at 10600rpm for 5 minutes
Solutions 1, 2 & 3
• Solution 1: 50mM Glucose, 25mM Tris pH 8.0, 10mM EDTA pH 8.0 – Re-suspension Solution
• Solution 2: 0.2N NaOH, 1% SDS – Lysis Solution
• Solution 3: 60 ml of 5M Potassium Acetate, 11.5 ml of Glacial Acetic Acid and 28.5 ml of distilled water – Neutralizing Solution
• PCI mixture: 12.5% Phenol, 12% Chloroform and 0.5% Iso amyl alcohol
• 200µl of ice-cold re-suspension buffer was added to the pellet and vortexed gently
• 10 mins later, 200µl of Lysis Buffer was added to the pellet and was incubated at RT
• 5 mins later, 200µl of Neutralizing solution was added ( a white precipitate was formed) and was incubated by keeping it in on ice.
• 15 minutes later, the samples were centrifuged at 13000 rpm for 20 minutes at -4˚C
• Equal volume of PCI was added to the supernatant collected and vortexed
• It was centrifuged at 13000rpm for 5 minutes at RT and the supernatant was transferred to a fresh eppendorf tube.
• 500µl of ice-cold ethanol (70%) was added and centrifuged at 10000 rpm for 10 minutes at -4˚C
• The alcohol was discarded and the pellet was air dried for 10 minutes
• The pellet was dissolved in 20µl of TE buffer(1X)
1 2 3 4
Lane 1 - 100bp ladderLane 2 - Sample 1 (amp)Lane 3 - Sample 2 (w/o amp)Lane 4 - 1kb ladder
Sigh!
Trial 2
• We inoculated the bacteria in LB broth containing ampicillin.
• The same protocol was followed.
1 2 3 4
Lane 1 - 100bp ladderLane 2 - Sample 1 (amp)Lane 3 - Sample 2 (amp)Lane 4 - 100bp ladder
Oh no!
Trial 3
• We used two samples taken from a culture grown overnight and a culture that was 2 days old.
• We added RNase to the TE buffer• The same protocol was followed.
Lane 1 - 1kp ladderLane 2 - Sample 1 (fresh)Lane 3 - Sample 2 (fresh)Lane 4 - Sample 3 (old)Lanes 5,6,7,8 - empty
1 2 3 4 5 6 7 8
No. Not again!
Trial 3
• We increased the cell mass by using 5ml of fresh culture (amp + LB broth)
• We increased the volume of the solutions added.
• From 200µl to 300µl of Lysis Buffer.• From 200µl to 250µl of Neutralizing solution
1 2 3 4
Lane 1 - 1kp ladderLane 2 - Sample 1 (fresh)Lane 3 - Sample 2 (fresh)Lane 4 - Sample 3 (old)
Some hope.
Trial 4
• We increased the incubation periods for each of the steps when the solutions are added.
• From 10 minutes to 30 minutes
1 2 3 4
Lane 1 - 1k ladderLane 2 - Sample 1 (fresh)Lane 3 - Sample 2 (fresh)Lane 4 - 100bp ladder
Nooooooo!
Trial 5
• We realized that the increased exposure of the lysis solution to our bacterial cells degraded the DNA.
• We decreased the incubation from 30 minutes to 5 minutes and these were the observations
Upon adding Lysis Buffer
Upon adding neutralizing solution
Centrifugation
Cell Debris
Centrifugation after adding PC
Phase Separation
Supernatant
Upon adding isopropanol
Centrifugation
Pellet
Supernatant discarded
Pellet
Centrifugation after adding ethanol
Final Pellet – Plasmid DNA
Pellet
1 2 3 4 5
Lane 1 - 1kp ladderLane 2 - Sample 1 (fresh)Lane 3 - Sample 2 (fresh)Lane 4 - Sample 3 (old)Lane 5 - Sample 4 (old)
Finally!
PCR• Milli Q water• Agarose• TBE buffer• Ethidium bromide• Primers (10p/ml)• Primer sequence (5’-3’)• TEM• TEM F CTTCCTGTTTTTGCTCAACCCA (717 bp)• TEM R TACGATACGGGAGGGCTTAC• PCR machine (eppendorf thermocyclometer)• Electrophoresis Unit
Master mix :
• Distilled water -70µl• PCR Reaction buffer -10µl• dNTPs -2µl• Forward Primer -2µl• Reverse Primer -2µl• Taq Polymerase -2µlTotal volume was made to 22µl
• Tube containing mastermix was spun and then 22µl of the mix was aliquoted into each of the PCR tubes.
• 3µl of the sample DNA was then added to those PCR tubes and finally the volume was made to 25µl.
• These tubes were then placed in a thermocycler and the program was set as follows.
PCR Program
• Initial denaturation: 1min at 94°C• Annealing: 1min at 58°C• Extension: 1min at 72°C• Denaturation: 15sec at 95°C• Go to step 3 for 30 cycles• Final Extension: 7min at 72°C• 4°C forever• End
1 2 3 4 5 6 7 8
Lane 1 - 100bp ladderLane 2 - Sample 1 (fresh)Lane 3 - Sample 2 (fresh)Lane 4 - emptyLane 5 - Sample 3 (old)Lane 6 - Sample 4 (old)Lane 7 - Sample 5 (dh5α)Lane 8 – 1kb ladder
White Flag!
Chapter 5Same battle. New squad.
Plasmid DNA isolation
• We decided to use a new bacterial culture hoping that the new bacteria would have a higher copy number which is essential for our plasmid DNA isolation. (copy number is directly proportional to the presence of plasmid in the bacterium)
• We repeated the isolation and performed PCR.
Any questions?