pseudophosphorylation and glycation of tau protein enhance but do
TRANSCRIPT
1
Pseudophosphorylation and glycation of tau
protein enhance but do not trigger fibrillization
in vitro
Mihaela Necula‡ and Jeff Kuret§
From the ‡Biophysics Program; and §Department of Molecular and Cellular Biochemistry, The Ohio State University College of Medicine and Public Health, Columbus, Ohio 43210
§To whom correspondence should be addressed:
Jeff Kuret, Ph.D. OSU Center for Biotechnology 1060 Carmack Rd Columbus, OH 43210 TEL: (614) 688-5899 FAX: (614) 292-5379 Email: [email protected] Running Title: Posttranslational Modification and tau Assembly Key Words: Alzheimer’s disease, tau, phosphorylation, glycation
JBC Papers in Press. Published on September 10, 2004 as Manuscript M405527200
Copyright 2004 by The American Society for Biochemistry and Molecular Biology, Inc.
by guest on March 24, 2018
http://ww
w.jbc.org/
Dow
nloaded from
2
Abstract Alzheimer’s disease is defined in part by the intraneuronal aggregation of tau protein into
filamentous lesions. The pathway is accompanied by posttranslational modifications including
phosphorylation and glycation, each of which has been shown to promote tau fibrillization in
vitro when present at high stoichiometry. To clarify the site-specific impact of posttranslational
modification on tau fibrillization, the ability of recombinant full-length four repeat tau protein
(htau40) and eleven pseudophosphorylation mutants to fibrillize in the presence of anionic
inducer was assayed in vitro using transmission electron microscopy and laser light scattering
assays. Tau glycated with D-glucose was examined as well. Both glycated tau and
pseudophosphorylation mutants S199E, T212E, S214E, double mutant T212E/S214E, and triple
mutant S199E/S202E/T205E yielded increased filament mass at equilibrium relative to wild-type
tau. Increases in filament mass correlated strongly with decreases in critical concentration,
indicating that both pseudophosphorylation and glycation promoted fibrillization by shifting
equilibrium toward the fibrillized state. Analysis of reaction time courses further revealed that
increases in filament mass were not associated with reduced lag times, indicating that these
posttranslational modifications did not promote filament nucleation. The results suggest that
site-specific posttranslational modifications can stabilize filaments once they nucleate, and
thereby support their accumulation at low intracellular tau concentrations.
by guest on March 24, 2018
http://ww
w.jbc.org/
Dow
nloaded from
3
Introduction Neurofibrillary lesions are a hallmark pathology of tauopathic neurodegenerative diseases
such as AD1, cortico-basal degeneration, Down’s syndrome, Pick`s disease and progressive
supranuclear palsy (1,2). The lesions are composed primarily of tau, a microtubule-associated
protein that normally functions to promote tubulin assembly, microtubule stability, and
cytoskeletal integrity (3). The tau that accumulates in disease lesions differs from microtubule-
associated protein in its state of aggregation and posttranslational modification, including levels
of phosphorylation (4), glycation (5), proteolytic truncation (6), and racemization (7).
Especially dramatic among these is phosphorylation, which achieves significantly greater
stoichiometries in filamentous tau (averaging 7 – 8 mol/mol) relative to normal tau (averaging 2
- 3 mol/mol) (8,9). The phosphate is distributed into ~30 sites, most of which are clustered into
two regions flanking the microtubule-binding domain (10,11). Because few of these sites are
unique to filamentous tau, hyperphosphorylation mostly reflects increased occupancy of
phosphorylation sites found in normal tau (12,13). At least 15 of these sites fill in hierarchical
fashion as neurofibrillary lesions mature, suggesting a sequential correlation between site
occupancy and neuritic lesion development (14,15). In addition to serving as a marker for
diseased neurons, hyperphosphorylation neutralizes the microtubule-binding activity of tau,
yielding a cytosolic population available for aggregation (16-19). Phosphorylation may also
directly promote fibrillization, but in vitro this reaction requires stoichiometries of
phosphorylation well above average levels observed in filamentous tau (20,21). Part of the
experimental challenge stems from the diversity of tau phosphorylation sites, each of which may
enhance or depress fibrillization (22), and the difficulty of recapitulating the precise pattern
found in disease. To overcome these limitations, and to investigate the contribution of individual
by guest on March 24, 2018
http://ww
w.jbc.org/
Dow
nloaded from
4
sites, phosphorylation has been mimicked by mutation of hydroxyamino acids into negatively
charged Asp or Glu residues. The resultant “pseudophosphorylation” mutants imitate
phosphorylation-induced changes in the structure and microtubule-binding function of tau (23-
26), react with many phosphoepitope-selective antibodies (27), and reportedly can promote or
inhibit tau fibrillization depending on the sequence context investigated (24,25,27,28).
Nonetheless, the mechanisms through which phosphorylation or phosphorylation mimicry
modulates fibrillization have not been explored.
In addition to being phosphorylated, AD-derived tau protein is glycated (5,29-31). As with
phosphorylation, glycation has been implicated in events that may contribute to tau fibrillization
and neuronal death (32,33). In vitro glycation of tau can modify at least 13 sites (34), decrease
its affinity for tubulin (35-37), and promote fibrillization (5,30,31). Again the mechanisms
underlying the effect on tau aggregation have not been investigated.
Fibrillization of purified recombinant tau preparations is slow and essentially undetectable
when assayed over a period of days (38,39), but can be greatly accelerated by the addition of
anionic inducers. Among these, anionic surfactants (including fatty acids) have emerged as
especially useful agents because of their efficacy with full-length tau protein under near-
physiological conditions of temperature, pH, ionic strength, reducing environment, and tau
concentration (38,40). Anionic surfactants act in micellar form to stabilize assembly competent
intermediates on their surfaces, which then accumulate to sufficient concentrations so that the
barrier to filament nucleation is overcome (41). Using this approach, differences in fibrillization
efficiency among individual tau isoforms can be quantified in as short as 5 h (39).
Here we extend the approach by investigating the fibrillization properties of glycated tau and
pseudophosphorylation tau mutants that mimic occupancy of sites known to be filled in disease
(14) using quantitative transmission EM and static light scattering assays. The results show that
by guest on March 24, 2018
http://ww
w.jbc.org/
Dow
nloaded from
5
glycation and phosphorylation mimicry influence tau aggregation through mechanisms that
include filament stabilization.
by guest on March 24, 2018
http://ww
w.jbc.org/
Dow
nloaded from
6
Materials and Methods
Materials. Stocks of alkyl sulfate detergent C18H37SO4Na (Research Plus, Bayonne, NJ) were
prepared in 1:1 H2O/isopropanol. AA (Cayman Chemicals, Ann Arbor, MI) was dissolved in
ethanol (333 mM) and stored at -80°C until used. Dithiothreitol was from Sigma (St. Louis,
MO), D-glucose was from Fisher Chemicals (Fair Lawn, NJ), and uranyl acetate, glutaraldehyde
and 300 mesh copper formvar/carbon-coated grids were from EM Sciences (Fort Washington,
PA).
Oligonucleotide-directed Mutagenesis. Vector pT7C-htau40 served as a template for synthesis
of all mutants using the Quick Change site-directed mutagenesis kit (Stratagene, La Jolla, CA)
(42): S199E, 5’-ggctacagcgaacccggctccccaggcactc; S199E/S202E/T205E, 5’-
gcagcggctacagcgagcccggcgagccaggcgagcccggcagcc; T212E, 5’-
ctcccgcgaaccgtcccttccaaccccaccc; S214E, 5’-cgcaccccggaacttccaaccccacccacccg; T212E/S214E,
5’-ggcagccgctcccgcgaaccggaacttccaaccccaccc; T231E, 5’-ggtccgtgaaccacccaagtcgccgtcttccgc;
S235E, 5’-ccacccaaggagccgtcttccgccaagag; S262E, 5’-
gtcaagtccaagatcggcgaaactgagaacctgaagcacc; S409E, 5’-ggcatctcgaaaatgtctcctccaccggcagcatcg;
and S422E, 5’-gcagcatcgacatggtagacgagccccagc (mutated codons are underlined). Double
mutants C291A/C322A, S396E/S404E, and I277P/I308P were each prepared in an htau40
background as described previously (28,43,44). All mutations were confirmed by DNA
sequencing.
Tau Purification. Recombinant wild-type tau protein (htau40) and all tau mutants were purified
as described previously (42). The quality of all preparations was assessed by SDS-PAGE, and
final protein concentrations were calibrated on the basis of optical density (42).
Tau Glycation. Aliquots of recombinant C291A/C322A and assembly incompetent I277P/I308P
by guest on March 24, 2018
http://ww
w.jbc.org/
Dow
nloaded from
7
double mutants (20 µM) were incubated in the presence and absence of 10 mM D-glucose in
assembly buffer (10 mM HEPES, 100 mM NaCl, pH 7.4) for 7 days, at 37°C, in the presence of
protease inhibitors (aprotinin and leupeptin; 0.02 mg/ml each) and 0.02% NaN3 (31). To
determine aggregation behavior, aliquots of glycation reactions were diluted to 4 µM tau and
subjected to the tau aggregation assays described below. Where indicated, glycation products
were separated from unincorporated glucose by desalting chromatography (Bio-Rad Econo-Pac
10DG) prior to dilution and assay.
To estimate glycation stoichiometry, tau was glycated as described above except that
radiolabeled D-[14C(U)]-glucose (10 Ci/mol) served as carbohydrate donor. Aliquots of the
glycation reaction were removed as a function of time and precipitated with trichloroacetic acid
(15% final concentration, 15 min on ice; Ref. (45). Trichloroacetic acid pellets were harvested
by centrifugation (15,800g for 10 min at 4°C), washed five times with 1 ml of 10 mM D-
glucose/15% trichloroacetic acid, then resuspended in 1 M NaOH and subjected to scintillation
spectroscopy. Protein was estimated in parallel using the Coomassie blue binding method with
recombinant htau40 as standard (19).
Tau Aggregation Assays. All tau preparations (4 µM) were incubated (25°C) in assembly buffer
containing dithiothreitol (5 mM) and either AA (75 µM) or C18H37SO4Na (50 µM) inducer.
Reaction products were analyzed by two methods. For analysis by transmission EM (46),
aliquots (30 µl) were removed, fixed with glutaraldehyde (2 %) and adsorbed (1 min) onto 300
mesh formvar/carbon-coated copper grids. The grids were washed with water, stained (1 min)
with 2% uranyl acetate, washed again with water, blotted dry, and visualized using a Phillips CM
12 microscope operated at 65 kV. Two to ten random images from each experimental condition
were captured on film at 22,000-fold magnification, digitized, calibrated, and imported into
by guest on March 24, 2018
http://ww
w.jbc.org/
Dow
nloaded from
8
Optimas 6.5.1 for quantitation of filament length and number as described previously (46).
Interfacial filament concentration (Γf) is defined as the summed lengths of all filaments >50 nm
in length per unit area of grid surface, and is reported in units of length/field ± S.D or as a
percentage of wild-type htau40 control values ± S.D.
Right angle laser light scattering (LLS) assays were performed as described previously (47),
except that the contribution of micellization to scattering intensity was controlled in parallel
reactions containing htau40I277P/I308P, an assembly incompetent mutant of htau40 (48). When
employed as light scattering control, htau40I277P/I308P was preincubated in exact parallel with
experimental conditions (including glycation and desalting procedures described above). We
refer to this assay as the corrected LLS assay (43). Aggregation reactions (200 µl) were
transferred to quartz cuvettes (3 x 3 mm internal diameter) and illuminated with light from an
argon laser (λ = 488 nm; Edmund Scientific). The scattered light was captured at an angle of 90°
to the incident light using an EDC1000HR digital camera operated at an aperture of f8 and
exposure times ranging from 50 – 400 ms (47). Captured images were imported into Adobe
Photoshop 5.0 and the intensity of scattered light was estimated as described previously (47).
The scattering intensity captured at zero exposure time (dark current) was subtracted from all
measurements, which were then normalized for exposure time so that the arbitrary units of light
scattering intensity reported always corresponded to a 200 ms exposure at aperture f8. Scattering
intensities from parallel reactions containing htau40I277P/I308P were then subtracted from all values
to yield In(90°), the net right angle light scattering intensity. In(90°) values are directly
proportional to Γf values determined by the transmission EM assay (43).
Assembly Critical Concentration Determination. Tau samples (2 – 4.5 µM, final
concentrations) were added from serially diluted stocks to assembly buffer at room temperature
by guest on March 24, 2018
http://ww
w.jbc.org/
Dow
nloaded from
9
and incubated for 26 h in the presence of 50 µM anionic surfactant C18H37SO4Na and in the
absence of agitation. Samples were analyzed by laser light scattering as described above. The
net intensity of scattered light corresponding to fibrillization was plotted against tau
concentration. Critical concentration for assembly was estimated from abscissa intercept after
least squares linear regression and expressed as ± S.E. of the estimate.
Analytical Methods. Sigmoidal reaction progress curves were fit to the Gompertz function (49):
( )
eaey bitt
−=
−−
(eq 1)
where y is total filament length (50 nm cutoff) or light scattering intensity measured at time t, ti is
the inflection point corresponding to the time of maximum growth rate, a is the maximum total
filament length or light scattering at equilibrium, and b = 1/kapp , where kapp is the first order rate
constant describing growth of the filament population in units of time-1 (49). Lag times, defined
as the time when the tangent to the point of maximum polymerization rate intersects the abscissa
of the sigmoidal curve (50), were calculated as ti – b (49).
Filament length distributions calculated as described previously (41,51) were fit to the
exponential function:
y = aebx (eq 2)
where y is the percentage of all filaments filling a bin of length interval x, and b is a constant
(slope parameter) with units of length-1.
All parameters estimated by linear or non-linear regression are reported ± S.E.
by guest on March 24, 2018
http://ww
w.jbc.org/
Dow
nloaded from
10
Results
Impact of Phosphorylation Mimicry on tau Fibrillization. The distribution of phosphorylation
sites on authentic AD-derived tau protein reported from mass spectroscopic methods (10,11) is
summarized in Fig. 1. Because of the large number of individual sites, and the even larger
number of potential combinations, only a subset of these were modeled in a full-length, htau40
isoform background by pseudophosphorylation mutagenesis and kinetic analysis (Table I).
These 12 sites, which spanned the proline-rich, microtubule-binding, and C-terminal tau domains
where phosphorylation sites cluster (Fig. 1), were selected because alone or in combination they
compose phosphoepitopes that have been studied extensively by immunohistochemistry and
shown to be occupied in nearly all tauopathies investigated to date (1). Moreover, the temporal
correlation between their occupancy and neuritic pathogenesis has been quantified (14,15).
Therefore 11 mutant proteins containing selected single, double, and triple
pseudophosphorylation mutations in 12 positions were prepared along with wild-type htau40 and
characterized for fibrillization activity.
To determine whether low-stoichiometry site-specific pseudophosphorylation could replicate
the effects of non-specific high-stoichiometry phosphorylation, the ability of each of the mutant
constructs to fibrillize under standard, near-physiological conditions of pH, ionic strength, and
bulk tau concentration (4 µM) was determined relative to wild-type recombinant htau40 in the
presence of AA inducer. All preparations fibrillized with untwisted morphology as described
previously (41), with no morphological differences apparent among samples except mutant 235,
which formed a mixture of typical untwisted filaments and small (< 50 nm in length) amorphous
aggregates (data not shown). Despite similarities in morphology, significant differences in
extents of fibrillization were apparent when reaction products were assayed by quantitative EM.
by guest on March 24, 2018
http://ww
w.jbc.org/
Dow
nloaded from
11
Greatest differences were observed with mutants 212, 214, 212/214, and 199/202/205, which
accumulated 2 – 3-fold as much filamentous tau as did wild-type htau40 and mutants 231, 262,
396/404, 409, and 422 (Fig. 2A).
To confirm these findings, the amount of filamentous pseudophosphorylated tau at
equilibrium relative to wild-type htau40 was estimated using a second inducer (C18H37SO4Na).
Results showed that pseudophosphorylation mutants differentially fibrillized in response to
C18H37SO4Na inducer as well. Indeed, when the equilibrium levels of fibrillization attained with
AA and C18H37SO4Na inducers were compared, a linear relationship was found with nearly
identical rank orders of mutant fibrillization levels (Fig. 2B). When equilibrium levels of
fibrillization attained with C18H37SO4Na were compared by EM and corrected LLS (a solution-
based assay method), again a consistent rank order of fibrillization levels was observed (Fig.
2C). The only exception was mutant 235, which formed both filamentous and nonfilamentous
aggregates. Because the EM assay only measures filaments, whereas LLS detects all aggregates
in solution, the LLS assay overestimated filament mass for this mutant. Together these results
suggested that low-stoichiometry pseudophosphorylation could recapitulate the effects of non-
specific phosphorylation on tau fibrillization levels at equilibrium, and that they were additive
with the action of anionic inducers.
The equilibrium phase of tau fibrillization is attained when the rate of protein addition to
filament ends equals the rate of protomer dissociation. It is characterized by a “critical”
concentration corresponding to the maximal solubility of protein above which all additional
assembly-competent protein enters the polymeric phase (52). It is the highest concentration of
protein that does not support fibrillization, and therefore can be estimated from the dependence
of fibrillization on bulk protein concentration (53). To determine whether
pseudophosphorylation modulated this equilibrium, the critical concentration of all mutations
by guest on March 24, 2018
http://ww
w.jbc.org/
Dow
nloaded from
12
were estimated using corrected LLS and compared to values for wild-type htau40. The value for
wild-type htau40 in the presence of C18H37SO4Na inducer was 2.00 ± 0.07 µM (shown in Fig. 3
and summarized in Table II). Critical concentrations for pseudophosphorylation mutants ranged
from this value to as low as 680 ± 130 nM for mutant 212 (Fig. 3; Table II). The relationship
between critical concentration and equilibrium levels of fibrillization (both assayed with
C18H37SO4Na inducer) was linear, with lowest critical concentrations yielding the greatest
amounts of fibrillization at equilibrium (Fig. 4). These data suggest that the increased
fibrillization at equilibrium produced by pseudophosphorylation resulted from increased affinity
of filament ends for assembly competent tau.
Anionic surfactants trigger protein fibrillization in micellar form by shifting prenuclear
equilibria from assembly-incompetent to assembly-competent conformations (43), which then
serve as substrates for nucleation reactions on the micelle surface (41,51). The enhanced
nucleation rate shifts sigmoidal reaction progress curves toward shorter lag times with increasing
inducer concentrations (43,54). Because the increase in filament mass induced by high-
stoichiometry phosphorylation has been attributed to creation of “nucleation centers” (55), a
similar shift in reaction progress curves should accompany increased fibrillization. To test this
hypothesis using pseudophosphorylation mutants, the total length of tau filaments formed from
each mutant as a function of time in response to anionic surfactant inducer C18H37SO4Na was
quantified using the EM assay. All resultant reaction progress curves were sigmoidal with clear
lag, exponential growth, and equilibrium phases (Fig. 5). Kinetic parameters of lag time (a
measure of nucleation rate; Ref. (50) and kapp (the first order rate of approach to equilibrium)
were derived from fitting these data to a 3-parameter Gompertz growth function as described in
Experimental Procedures. The Gompertz function was used because it better fit time course data
than the 3- or 4-parameter logistic functions we have used in the past (51,54). Under these
by guest on March 24, 2018
http://ww
w.jbc.org/
Dow
nloaded from
13
conditions, wild-type htau40 fibrillized with a lag time of 42.8 ± 0.8 min and a kapp of 1.33 ± 0.07
h-1, whereas pseudophosphorylation mutants fibrillized with lag times ranging from 38.9 – 61.6
min and kapp values ranging from 1.00 – 1.40 h-1 (Table II). The nucleation rate as reflected by
lag time was directly proportional to fibrillization at equilibrium, with longest lag times
correlating with greatest fibrillization at equilibrium (Fig. 6A). In contrast, no correlation
between kapp (which incorporates nucleation, elongation, and equilibrium terms) with
fibrillization at equilibrium was apparent (Fig. 6B). These data suggest that
pseudophosphorylation had statistically significant effects on tau fibrillization kinetics, but did
not increase filament nucleation rates.
Despite having a critical concentration (~2 µM) low enough to support fibrillization under
assay conditions (4 µM), the wild-type htau40 preparation used here does not assemble
spontaneously (i.e., in the absence of exogenous inducer) over time courses as long as 7 days at
37°C in the absence of nucleation inducers (38,39). To determine whether assembly-enhancing
effect of pseudophosphorylation could promote spontaneous fibrillization, mutant 212 also was
incubated (4 µM) for 7 days at 37°C under assembly conditions. As with wild-type htau40, no
spontaneous fibrillization was apparent over this period (data not shown). These data suggest
that simply having a lower critical concentration for assembly-competent conformations is
insufficient to promote spontaneous fibrillization at physiological tau concentrations, and that
low stoichiometry pseudophosphorylation alone cannot overcome the energy barrier for
nucleation over the time periods studied.
The nucleation and elongation phases of protein aggregation reactions compete for assembly
competent species, resulting in their time-dependent depletion until the critical concentration is
reached (56). In the case of tau aggregation, the exponential distribution of tau filament lengths
observed at all time points indicates that the rate of elongation exceeds that of nucleation, with
by guest on March 24, 2018
http://ww
w.jbc.org/
Dow
nloaded from
14
both occurring throughout the reaction time course (41,57). Under these conditions, lower
critical concentrations could lead to decreased nucleation rates at the latter stages of the time
course by consuming assembly competent tau. The resultant increase in filament elongation
relative to nucleation should be detectable as shifts in filament length distributions toward longer
lengths. For mutants with low critical concentrations, such as 212, the change in distribution was
apparent on visual inspection of electron micrographs (Fig. 7). To test the prediction,
equilibrium length distributions were estimated after fibrillization of all tau constructs in the
presence of AA, with the polydispersity of each population quantified by the slope parameter (b).
Results (Fig. 8) confirmed that the increases in filament mass at equilibrium induced by
pseudophosphorylation correlated with decreases in the slope parameter (i.e., shifts to longer
length distributions). Together these data suggest that the principal effect of
pseudophosphorylation on tau fibrillization is to reduce critical concentration, which leads to a
shift in the length distribution to longer lengths, and a more stable filament population at low
bulk tau concentrations.
Tau Glycation Promotes tau Filament Formation. The effects of glycation on tau assembly
were examined by incubating tau with D-glucose for up to 7 days (31), after which time samples
were analyzed by EM- or LLS-based assays. Double mutant C291A/C322A was used for these
experiments because it lacked Cys residues that could potentially react under glycating
conditions and complicate tau aggregation kinetics (58). On the basis of EM assays using 75 µM
AA as inducer, the presence of up to 2 mM glucose in the assay had no significant effect on
fibrillization levels at equilibrium (Fig. 9). After 7 days incubation at 37°C with 10 mM glucose,
however, statistically significant increases in fibrillization at equilibrium appeared (Fig. 9). On
the basis of parallel reactions containing 14C-labeled glucose, these conditions led to the
incorporation of ~1 mol/mol radiolabel. Desalting of the preparation prior to assay did not
by guest on March 24, 2018
http://ww
w.jbc.org/
Dow
nloaded from
15
significantly diminish the stimulatory effect, confirming that the modification was stable and that
carryover of unincorporated glucose was not a contributory factor (Fig. 9).
To determine the mechanism underlying these effects, the full reaction progress curves for
both glycated- and non-glycated C291A/C322A were estimated using the corrected LLS assay
and C18H37SO4Na as a second fibrillization inducer. All glycated samples were desalted prior to
assay in these studies. C291A/C322A incubated at 37°C for 7 days in the absence of glucose
assembled with lag time of 27.4 ± 4.3 min and kapp of 2.15 ± 0.17 h-1 (Fig. 9A). Although
C291A/C322A incubated 7 days in the presence of glucose assembled with similar kinetics as
the non-glycated sample (lag time = 30.9 ± 2.6 min; kapp = 1.86 ± 0.09 h-1), the amount of
fibrillar tau at equilibrium was 1.8 ± 0.1-fold greater (Fig. 9A). Filament accumulation was
accompanied by a shift in length distribution to longer lengths as indicated by a decrease in the
slope parameter to 76 ± 14% of control values (data not shown). To clarify the source of
increased filament mass at equilibrium, critical concentrations of both glycated and non-glycated
samples were determined by LLS and found to be 1.16 ± 0.09 and 1.86 ± 0.14 µM, respectively
(Fig. 9B). These characteristics resemble the effects of pseudophosphorylation on tau assembly,
and indicate that low-stoichiometry glycation enhances fibrillization by lowering critical
concentration and stabilizing filaments.
by guest on March 24, 2018
http://ww
w.jbc.org/
Dow
nloaded from
16
Discussion
Phosphorylation and the tau Aggregation Pathway. Site-specific phosphorylation is an early
and ongoing event in neurofibrillary lesion formation, suggesting a potential role in the process
(14,15,59). Although phosphorylation could potentially modulate multiple aspects of tau biology
(e.g., turnover, localization, etc.), it has been hypothesized that at least one major function in
disease is to directly promote the fibrillization reaction (1). One established mechanism through
which it may do so is the neutralization of tau’s microtubule-binding activity, thereby fostering
an accumulation of freely soluble tau in the cytoplasm (16,19). This reaction, which may
represent the first step in the fibrillization pathway, has been replicated both in situ and in vitro
using various phosphotransferases and also with pseudophosphorylation mutations (16-19,23-
26). But whether it represents a commitment toward fibrillization is not clear. In vivo
phosphorylation of fetal tau at similar sites (12,13) and nearly the same stoichiometry (60) as
PHF-tau does not trigger fibrillization. In situ, tau hyperphosphorylation leads to formation of
thioflavin S-reactive tau species with primarily reticular macroscopic morphology (61),
consistent with the formation of thioflavin S-reactive intermediates but only modest amounts of
filaments (51).
In contrast to these findings, experimentation in vitro suggests that non-specific, high
stoichiometry phosphorylation can directly promote tau aggregation, leading to increased
amounts of amorphous and fibrillar aggregates at equilibrium (20,21,55). This phenomenon has
been proposed to stem from incorporation of negative charge, which may neutralize the net
positive charge of native tau protein and lower the energy barrier for self association (62,63).
Thus the incorporation of negative charge accompanying phosphorylation has been proposed to
create “nucleation centers” that directly trigger tau fibrillization (55).
by guest on March 24, 2018
http://ww
w.jbc.org/
Dow
nloaded from
17
Although the pseudophosphorylation mutants studied here recapitulated the effects of
hyperphosphorylation with respect to increased filament mass at equilibrium, neither
spontaneous nucleation nor increased nucleation rate in the presence of anionic inducers was
observed. Rather, the mechanism involved a shift in assembly equilibrium toward the
filamentous state as indicated by site-dependent decreases in critical concentration. Lower
critical concentrations reflect decreases in the free energy of the filamentous state, and therefore
increases in the driving force for filament nucleation and subsequent elongation (64). But as
shown here and previously by others (27,38,39,65,66), simply raising tau high above its critical
concentration of assembly (i.e., creating a supersaturated solution) is insufficient to trigger
fibrillization over incubation periods spanning one week. Moreover, supersaturated solutions of
soluble recombinant tau protein do not efficiently polymerize onto exogenous filamentous seeds
in the absence of anionic inducers (38,62), and only small amounts of filaments form in situ even
when tau is expressed at supraphysiological levels (67). These data suggest that while
recombinant tau is natively unfolded (68), the equilibrium conformation is not necessarily
assembly competent. Thus, despite being energetically favorable, filament nucleation proceeds
slowly if at all until assembly competent conformations are attained. Under these conditions,
protein turnover rates may well exceed tau nucleation rates, and the increased cytosolic levels of
supersaturated tau protein engendered by phosphorylation may not lead to fibrillization.
These considerations suggest that assembly competent conformations must be populated
before fibrillization can proceed efficiently. In vitro, the barriers to conformational change and
nucleation can be overcome by anionic condensation agents such as anionic surfactants or
polymers (40,41,51,69,70). Increasing concentrations of anionic inducers lead to decreasing lag
times (i.e., increasing nucleation rates) and increasing quantities of filamentous tau at
equilibrium without changes in critical concentration (43). Similar data has been obtained with
by guest on March 24, 2018
http://ww
w.jbc.org/
Dow
nloaded from
18
micelle-mediated fibrillization of α-synuclein (54). The ability of micellar inducers to increase
levels of filamentous tau at equilibrium appears to derive in part from changes in pre-nuclear
equilibria, including the conversion of assembly-incompetent to assembly-competent
conformations (43).
On the basis of these considerations, we propose two general classes of tau assembly
modulators. Those agents or posttranslational modifications that modulate pre-nuclear equilibria
by stabilizing assembly competent conformations can act to trigger fibrillization. Examples
include anionic membranes (41), which because of their association of tau filaments in biopsy
specimens of AD tissue (71), may be pathophysiologically relevant sources of nucleating
activity. The second category includes modifications that affect post-nuclear equilibria such as
critical concentration. These enhance fibrillization by stabilizing filaments and increasing the
driving force for nucleation without necessarily triggering it or increasing its rate. The negative
charges introduced by pseudophosphorylation exemplify this second category. Because of their
different underlying mechanisms, anionic inducers and pseudophosphorylation act
synergistically in vitro. Similarly, multiple fibrillization triggers and enhancers may combine to
promote tau fibrillization in disease.
Molecular Mechanism. The extent of fibrillization of tau and pseudophosphorylation mutants at
equilibrium was found linearly related to the critical concentration, which is defined as (53):
+
−=kkacrit (eq 3)
where acrit is the critical concentration, and k- and k+ are the rate constants for protein monomer
dissociation from and association with filament ends, respectively. Lowering of critical
concentration implies a decrease in k-, an increase in k+, or a combination of both. Although
pseudophosphorylation clearly modulates filament elongation relative to nucleation rate, we
by guest on March 24, 2018
http://ww
w.jbc.org/
Dow
nloaded from
19
could not directly test whether elongation rates (i.e., k+) change in response to
pseudophosphorylaton owing to the inability to seed fibrillization reactions in the absence of
condensing agents (38,62).
The relationship between critical concentration and filament nucleation in nucleation-
elongation reactions has been derived as (72):
( )ncrit
init
aC
kk
=−
(eq 4)
where kinit represents the operational nucleation rate from n monomers (i.e., n = nucleus size)
and C is a constant. Thus, decreases in critical concentration can associate with decreases in k-,
increases in kinit, or decreases in nucleation molecularity (n). It has been shown in other systems
that these parameters can change in combination in response to decreases in critical
concentration (73). In the case of tau pseudophosphorylation, however, the absence of increased
nucleation rates suggests that increases in kinit can be ruled out.
The relationship between critical concentration and length distribution has been derived as
(72):
j
critj a
aCx
= (eq 5)
where a is the concentration of free monomer and xj is the concentration of polymers composed
of j protomers. Thus, decreases in critical concentration are associated with lengthening of
filament length distributions at equilibrium. This effect was observed for all
pseudophosphorylation mutants that decreased critical concentration.
These data suggest that the kinetic and equilibrium effects of pseudophosphorylation can be
rationalized from changes in critical concentration, and that in addition to destabilizing tau-
tubulin interactions, a second effect of pseudophosphorylation and potentially phosphorylation is
by guest on March 24, 2018
http://ww
w.jbc.org/
Dow
nloaded from
20
to stabilize filaments once nucleated. This mechanism could be significant at early stages of
disease by supporting filament accumulation at submicromolar intracellular concentrations.
Comparison with Previous Work. The effects of pseudophosphorylation on tau fibrillization has
been contentious with many conflicting studies. Much of this stems from differences in the
methodology used to assay fibrillization. Previously we showed a strong increase in
fibrillization tendency with pseudophosphorylation mutant 396/404 (28). However, these results
were based on an LLS assay that was not corrected for inducer micellization, which makes a
major contribution to scattering intensity (43). Eliminating the micelle background as described
here brings the corrected LLS assay into harmony with the EM assay, and reveals that the
increases in fibrillization at equilibrium accompanying pseudophosphorylation at 396/404 are
statistically significant but modest. Others have assayed pseudophosphorylation mutants using
fluorescent reporter probes such as thioflavin S (27). But this reagent fluoresces in the presence
of tau intermediates as well as filaments, and therefore is not specific for fibrillization when
employed under the conditions used here (41). Similarly, centrifugation-based assays pellet both
fibrillar and non-fibrillar tau aggregates, potentially masking fibrillization-specific effects. This
limitation is exemplified by mutant 235, which formed both filamentous and amorphous
aggregates, and therefore yielded higher signals in LLS assays compared to EM assays. Finally,
results are highly dependent on tau concentration. The effects described here, which are readily
apparent at near physiological levels of tau protein, would be difficult to detect at the higher tau
concentrations (40 to 100 µM) used in other assembly paradigms (22,27).
An example of these considerations in the context of the surfactant-induced tau aggregation
system employed here is illustrated in Fig. 4. The relationship between critical concentration
and total fibrillization at equilibrium was found to be linear with an extrapolated ordinate
intercept of 2.8 ± 0.1 µM htau40. These data indicate that tau preparations with critical
by guest on March 24, 2018
http://ww
w.jbc.org/
Dow
nloaded from
21
concentrations above this level cannot fibrillize under our standard bulk tau concentrations (4
µM), and may explain why certain tau isoforms fail to assemble in the presence of AA (39) but
readily do so at high concentration (40 – 100 µM) in response to heparin (66). Similarly, the
abscissa intercept of this plot shows that the maximum increase in fibrillization theoretically
detectable at “zero” critical concentration and 4 µM bulk htau40 concentration is ~3.6-fold.
Relative increases will appear smaller at higher bulk tau concentrations, illustrating the
importance of working at physiological tau concentration for these studies.
Non-specific, high stoichiometry phosphorylation of recombinant tau in the presence of
crude extracts has been found to enhance aggregate formation with both amorphous and
filamentous morphologies (20,55). The requirement for high stoichiometry (i.e., ≥10 mol/mol,
or ~1.5 standard deviations above the mean stoichiometry observed in autopsy-derived
filamentous tau) may result from non-specific incorporation of anionic charge into multiple sites,
each of which may differ in the ability to enhance fibrillization (as found here). Although these
data have been interpreted as evidence for the phosphorylation-dependent creation of “nucleation
centers”, nonphosphorylated recombinant full-length htau40 also aggregated spontaneously in
these studies (20). As discussed above, the latter result is highly unusual, and suggests the
presence of exogenous aggregation inducers that are absent from most in vitro fibrillization
experiments. Quantitative experiments with purified components will be required to establish
whether high-stoichiometry phosphorylation can also directly accelerate nucleation rate and
promote spontaneous assembly.
Sites of Pseudophosphorylation. On the basis of immunohistochemical studies, tau
phosphorylation sites fill hierarchically during the course of AD (14,15). Early modifications
predominating in the pre-tangle stage include sites 231, 235, 262, and 409.
Pseudophosphorylation mutants corresponding to single residue changes at these positions did
by guest on March 24, 2018
http://ww
w.jbc.org/
Dow
nloaded from
22
not differ significantly from wild-type htau40 with respect to assembly kinetics or final
equilibrium position. Sites more fully occupied in classic intracellular NFTs, such as those
detected by monoclonal antibodies AT100 (212/214) and AT8 (199/202/205), however, were
associated with the largest changes in fibrillization behavior. Although both 212 and 214 single
mutants greatly modified fibrillization characteristics, the effects of these closely spaced
mutations were not additive in the 212/214 double mutant. Mutants corresponding to sites
enriched in late-stage disease, including those identified by PHF1 (396/404) and site 422, were
not substantially different from wild type. Correlations with lesion stage must be interpreted
with caution, however, because staging data depends on the differential reactivity of monoclonal
antibodies and is potentially biased toward sites that are stable to the proteolysis (74) and
changes in tau conformation (75) that accompany lesion maturation. Rather than maturation
stage, the rank order of pseudophosphorylation efficacy may more closely reflect their location
in the polypeptide chain, with activating mutations clustering in residues 199 – 214 of the
proline-rich domain. This region flanks the microtubule-binding domain and is required for tau
induced tubulin nucleation in vitro (76). It also promotes interaction of tau with the microtubules
(77). The ability of tau to induce microtubule nucleation is lost upon phosphorylation of this
region (78). Together, these observations support the hypothesis that phosphorylation within the
proline-rich domain critically affects the physiological function and pathological aggregation of
tau.
Role of Glycation. As shown previously (5,30,31), and confirmed here, in vitro glycation can
increase the equilibrium levels of tau fibrillization at constant bulk tau concentration. The
reaction must proceed for several days to yield these differences, however. Like
pseudophosphorylation mutants, glycation depressed critical concentration, indicating that
filament stabilization is one mechanism underlying the phenomenon. Despite its ability to
by guest on March 24, 2018
http://ww
w.jbc.org/
Dow
nloaded from
23
enhance tau fibrillization, glycated tau did not fibrillize spontaneously or increase nucleation rate
again suggesting that the glycation conditions used here did not promote the accumulation of
assembly competent conformations.
Together these data are consistent with at least two key roles for tau modifications in
promoting tau fibrillization in early stage disease. The first is to modulate tau/microtubule
equilibrium to regulate intracellular concentrations of free tau. The second is to lower the critical
concentration for assembly thereby stabilizing filaments and increasing the driving force for
nucleation. The approach outlined here will be useful in characterizing the ability of diverse tau
modifications to modulate tau aggregation kinetics.
Acknowledgments
We thank Drs. and Aida Abraha (Chicago State University) and Lester I. Binder (Northwestern
University Medical School) for providing pseudophosphorylation mutant 396/404.
by guest on March 24, 2018
http://ww
w.jbc.org/
Dow
nloaded from
24
References
1. Buee, L., Bussiere, T., Buee-Scherrer, V., Delacourte, A., and Hof, P. R. (2000) Brain
Res. Brain Res. Rev. 33, 95-130
2. Goedert, M., Spillantini, M. G., and Davies, S. W. (1998) Curr. Opin. Neurobiol. 8, 619-
632
3. Shahani, N., and Brandt, R. (2002) Cell. Mol. Life Sci. 59, 1668-1680
4. Goedert, M. (1996) Ann. N.Y. Acad. Sci. 777, 121-131
5. Ledesma, M. D., Bonay, P., and Avila, J. (1995) J. Neurochem. 65, 1658-1664
6. Mena, R., Edwards, P. C., Harrington, C. R., Mukaetova-Ladinska, E. B., and Wischik,
C. M. (1996) Acta Neuropathol. (Berl) 91, 633-641
7. Watanabe, A., Takio, K., and Ihara, Y. (1999) J. Biol. Chem. 274, 7368-7378
8. Ksiezak-Reding, H., Liu, W. K., and Yen, S. H. (1992) Brain Res. 597, 209-219
9. Kopke, E., Tung, Y. C., Shaikh, S., Alonso, A. C., Iqbal, K., and Grundke-Iqbal, I. (1993)
J. Biol. Chem. 268, 24374-24384
10. Hanger, D. P., Betts, J. C., Loviny, T. L., Blackstock, W. P., and Anderton, B. H. (1998)
J. Neurochem. 71, 2465-2476
11. Morishima-Kawashima, M., Hasegawa, M., Takio, K., Suzuki, M., Yoshida, H., Titani,
K., and Ihara, Y. (1995) J. Biol. Chem. 270, 823-829
12. Matsuo, E. S., Shin, R. W., Billingsley, M. L., Van deVoorde, A., O'Connor, M.,
Trojanowski, J. Q., and Lee, V. M. (1994) Neuron 13, 989-1002
13. Seubert, P., Mawal-Dewan, M., Barbour, R., Jakes, R., Goedert, M., Johnson, G. V.,
Litersky, J. M., Schenk, D., Lieberburg, I., Trojanowski, J. Q., and et al. (1995) J. Biol.
Chem. 270, 18917-18922
by guest on March 24, 2018
http://ww
w.jbc.org/
Dow
nloaded from
25
14. Augustinack, J. C., Schneider, A., Mandelkow, E. M., and Hyman, B. T. (2002) Acta
Neuropathol. (Berl) 103, 26-35
15. Kimura, T., Ono, T., Takamatsu, J., Yamamoto, H., Ikegami, K., Kondo, A., Hasegawa,
M., Ihara, Y., Miyamoto, E., and Miyakawa, T. (1996) Dementia 7, 177-181
16. Bramblett, G. T., Goedert, M., Jakes, R., Merrick, S. E., Trojanowski, J. Q., and Lee, V.
M. (1993) Neuron 10, 1089-1099
17. Biernat, J., Gustke, N., Drewes, G., Mandelkow, E. M., and Mandelkow, E. (1993)
Neuron 11, 153-163
18. Patrick, G. N., Zukerberg, L., Nikolic, M., de la Monte, S., Dikkes, P., and Tsai, L. H.
(1999) Nature 402, 615-622
19. Li, G., Yin, H., and Kuret, J. (2004) J. Biol. Chem. 279, 15938-15945
20. Alonso, A., Zaidi, T., Novak, M., Grundke-Iqbal, I., and Iqbal, K. (2001) Proc. Natl.
Acad. Sci. U.S.A. 98, 6923-6928
21. Alonso, A. D., Grundke-Iqbal, I., Barra, H. S., and Iqbal, K. (1997) Proc. Natl. Acad. Sci.
U.S.A. 94, 298-303
22. Schneider, A., Biernat, J., von Bergen, M., Mandelkow, E., and Mandelkow, E. M.
(1999) Biochemistry 38, 3549-3558
23. Leger, J., Kempf, M., Lee, G., and Brandt, R. (1997) J. Biol. Chem. 272, 8441-8446
24. Eidenmuller, J., Fath, T., Hellwig, A., Reed, J., Sontag, E., and Brandt, R. (2000)
Biochemistry 39, 13166-13175
25. Eidenmuller, J., Fath, T., Maas, T., Pool, M., Sontag, E., and Brandt, R. (2001) Biochem.
J. 357, 759-767
26. Fath, T., Eidenmuller, J., and Brandt, R. (2002) J. Neurosci. 22, 9733-9741
27. Haase, C., Stieler, J. T., Arendt, T., and Holzer, M. (2004) J. Neurochem. 88, 1509-1520
by guest on March 24, 2018
http://ww
w.jbc.org/
Dow
nloaded from
26
28. Abraha, A., Ghoshal, N., Gamblin, T. C., Cryns, V., Berry, R. W., Kuret, J., and Binder,
L. I. (2000) J. Cell Sci. 113, 3737-3745
29. Yan, S. D., Chen, X., Schmidt, A. M., Brett, J., Godman, G., Zou, Y. S., Scott, C. W.,
Caputo, C., Frappier, T., Smith, M. A., and et al. (1994) Proc. Natl. Acad. Sci. U.S.A. 91,
7787-7791
30. Ledesma, M. D., Bonay, P., Colaco, C., and Avila, J. (1994) J. Biol. Chem. 269, 21614-
21619
31. Ledesma, M. D., Medina, M., and Avila, J. (1996) Mol. Chem. Neuropathol. 27, 249-258
32. Smith, M. A., Tabaton, M., and Perry, G. (1996) Neurosci Lett. 217, 210-211
33. Smith, M. A., Taneda, S., Richey, P. L., Miyata, S., Yan, S. D., Stern, D., Sayre, L. M.,
Monnier, V. M., and Perry, G. (1994) Proc. Natl. Acad. Sci. U.S.A. 91, 5710-5714
34. Nacharaju, P., Ko, L., and Yen, S. H. (1997) J. Neurochem. 69, 1709-1719
35. Vitek, M. P., Bhattacharya, K., Glendening, J. M., Stopa, E., Vlassara, H., Bucala, R.,
Manogue, K., and Cerami, A. (1994) Proc Natl Acad Sci U S A 91, 4766-4770
36. Ledesma, M. D., Bonay, P., Colaco, C., and Avila, J. (1994) J Biol Chem 269, 21614-
21619
37. Ledesma, M. D., Bonay, P., and Avila, J. (1995) J Neurochem 65, 1658-1664
38. King, M. E., Ahuja, V., Binder, L. I., and Kuret, J. (1999) Biochemistry 38, 14851-14859
39. King, M. E., Gamblin, T. C., Kuret, J., and Binder, L. I. (2000) J. Neurochem. 74, 1749-
1757
40. Wilson, D. M., and Binder, L. I. (1997) Am. J. Pathol. 150, 2181-2195
41. Chirita, C. N., Necula, M., and Kuret, J. (2003) J. Biol. Chem. 278, 25644-25650
42. Carmel, G., Mager, E. M., Binder, L. I., and Kuret, J. (1996) J. Biol. Chem. 271, 32789-
32795
by guest on March 24, 2018
http://ww
w.jbc.org/
Dow
nloaded from
27
43. Necula, M., and Kuret, J. (2004a) Anal. Biochem., in press
44. Gamblin, T. C., King, M. E., Kuret, J., Berry, R. W., and Binder, L. I. (2000)
Biochemistry 39, 14203-14210
45. Illenberger, S., Zheng-Fischhofer, Q., Preuss, U., Stamer, K., Baumann, K., Trinczek, B.,
Biernat, J., Godemann, R., Mandelkow, E. M., and Mandelkow, E. (1998) Mol. Biol.
Cell. 9, 1495-1512
46. Necula, M., and Kuret, J. (2004b) Anal. Biochem. 329, 238-246
47. Gamblin, T. C., King, M. E., Dawson, H., Vitek, M. P., Kuret, J., Berry, R. W., and
Binder, L. I. (2000) Biochemistry 39, 6136-6144
48. von Bergen, M., Friedhoff, P., Biernat, J., Heberle, J., Mandelkow, E. M., and
Mandelkow, E. (2000) Proc. Natl. Acad. Sci. U.S.A. 97, 5129-5134
49. Winsor, C. P. (1932) Proc. Natl. Acad. Sci. U.S.A. 18, 1-8
50. Evans, K. C., Berger, E. P., Cho, C. G., Weisgraber, K. H., and Lansbury, P. T., Jr.
(1995) Proc. Natl. Acad. Sci. U.S.A. 92, 763-767
51. Chirita, C. N., and Kuret, J. (2004) Biochemistry 43, 1704-1714
52. Harper, J. D., and Lansbury, P. T., Jr. (1997) Annu. Rev. Biochem. 66, 385-407
53. Timasheff, S. N. (1981) in Protein-Protein Interactions (Frieden, C., and Nichol, L. W.,
eds), pp. 315-336, John Wiley and Sons, New York
54. Necula, M., Chirita, C. N., and Kuret, J. (2003) J. Biol. Chem. 278, 46674-46680
55. Alonso, A. C., Grundke-Iqbal, I., and Iqbal, K. (1996) Nat. Med. 2, 783-787
56. Fesce, R., Benfenati, F., Greengard, P., and Valtorta, F. (1992) J. Biol. Chem. 267,
11289-11299
57. Wilson, D. M., and Binder, L. I. (1995) J. Biol. Chem. 270, 24306-24314
58. Thorpe, S. R., and Baynes, J. W. (2003) Amino Acids 25, 275-281
by guest on March 24, 2018
http://ww
w.jbc.org/
Dow
nloaded from
28
59. Bancher, C., Brunner, C., Lassmann, H., Budka, H., Jellinger, K., Wiche, G.,
Seitelberger, F., Grundke-Iqbal, I., Iqbal, K., and Wisniewski, H. M. (1989) Brain Res.
477, 90-99
60. Kenessey, A., and Yen, S. H. (1993) Brain Res. 629, 40-46
61. Sato, S., Tatebayashi, Y., Akagi, T., Chui, D. H., Murayama, M., Miyasaka, T., Planel,
E., Tanemura, K., Sun, X., Hashikawa, T., Yoshioka, K., Ishiguro, K., and Takashima, A.
(2002) J. Biol. Chem. 277, 42060-42065
62. Friedhoff, P., von Bergen, M., Mandelkow, E. M., Davies, P., and Mandelkow, E. (1998)
Proc. Natl. Acad. Sci. U.S.A. 95, 15712-15717
63. Alonso, A., Mederlyova, A., Novak, M., Grundke-Iqbal, I., and Iqbal, K. (2004) J. Biol.
Chem. 279, 34873-34881
64. Kashchiev, D. (2000) Nucleation: basic theory with applications, Butterworth
Heinemann, Oxford
65. Crowther, R. A., Olesen, O. F., Smith, M. J., Jakes, R., and Goedert, M. (1994) FEBS
Lett. 337, 135-138
66. Friedhoff, P., Schneider, A., Mandelkow, E. M., and Mandelkow, E. (1998) Biochemistry
37, 10223-10230
67. Ko, L. W., DeTure, M., Sahara, N., Chihab, R., and Yen, S. H. (2002) J. Mol. Neurosci.
19, 311-316
68. Schweers, O., Schonbrunn-Hanebeck, E., Marx, A., and Mandelkow, E. (1994) J. Biol.
Chem. 269, 24290-24297
69. Perez, M., Valpuesta, J. M., Medina, M., Montejo de Garcini, E., and Avila, J. (1996) J.
Neurochem. 67, 1183-1190
by guest on March 24, 2018
http://ww
w.jbc.org/
Dow
nloaded from
29
70. Goedert, M., Jakes, R., Spillantini, M. G., Hasegawa, M., Smith, M. J., and Crowther, R.
A. (1996) Nature 383, 550-553
71. Gray, E. G., Paula-Barbosa, M., and Roher, A. (1987) Neuropathol. Appl. Neurobiol. 13,
91-110
72. Edelstein-Keshet, L., and Ermentrout, G. B. (1998) Bull. Mathematical Biol. 60, 449-475
73. Bubb, M. R., Spector, I., Beyer, B. B., and Fosen, K. M. (2000) J. Biol. Chem. 275, 5163-
5170
74. Braak, E., Braak, H., and Mandelkow, E. M. (1994) Acta Neuropathol. (Berl) 87, 554-
567
75. Garcia-Sierra, F., Ghoshal, N., Quinn, B., Berry, R. W., and Binder, L. I. (2003) J,
Alzheimers Dis, 5, 65-77
76. Brandt, R., and Lee, G. (1993) J. Biol. Chem. 268, 3414-3419
77. Gustke, N., Trinczek, B., Biernat, J., Mandelkow, E. M., and Mandelkow, E. (1994)
Biochemistry 33, 9511-9522
78. Brandt, R., Lee, G., Teplow, D. B., Shalloway, D., and Abdel-Ghany, M. (1994) J. Biol.
Chem. 269, 11776-11782
by guest on March 24, 2018
http://ww
w.jbc.org/
Dow
nloaded from
30
Footnotes
*This work was supported by National Institutes of Health grant AG14452 (to J.K.)
1The abbreviations used are: AA, arachidonic acid; AD, Alzheimer's disease; EM, electron
microscopy; In(90°), net light scattering intensity corrected for micellization; LLS, laser light
scattering
by guest on March 24, 2018
http://ww
w.jbc.org/
Dow
nloaded from
31
Figure Legends
Fig. 1. Distribution of pathophysiological phosphorylation sites on htau40. AD-derived tau
proteins contain covalently bound phosphate distributed across ~30 sites clustered primarily on
each side of tau microtubule binding region (white box) with two sites (Ser262 and Ser356) lying
within it. Sites modeled in this work by phosphorylation mimicry are shown graphically with
hollow symbols and summarized in detail in Table I.
Fig. 2. Site-specific modulation of tau fibrillization equilibria by pseudophosphorylation.
A, Wild-type and mutant htau40 preparations (4 µM) were incubated (4 h at room temperature)
in assembly buffer containing 75 µM AA and then examined by transmission EM. The total
lengths/field of all filaments ≥50 nm in length adsorbed onto grids (Γf ) were measured from the
resultant digitized images. All data are presented as percentages of normalized values ± SD (n =
3), with wild-type control htau40 defined as 100%. Significance at p < 0.05 (*) and p < 0.01
(**) was estimated by t-test. Significant differences in filament mass were detectable within 4 h
in the presence of AA inducer. B, Fibrillization assays were performed as described above
except that 50 µM C18H37SO4Na served as aggregation inducer and that reactions were stopped
after 5 h incubation. Each point represents the normalized fibrillization lengths/field achieved in
the presence of C18H37SO4Na (Γf C18H37SO4Na) relative to AA (Γf AA) inducer, whereas the
line represents linear regression analysis of the data points (symbol key is located in Panel C).
The data show that the effect of mutations on tau fibrillization could be detected in the presence
of both fatty acid and alkyl sulfate inducers. C, Fibrillization assays were performed using 50
µM C18H37SO4Na as aggregation inducer as described above except that fibrillization was
quantified after 26 h by the static light scattering assay. Each point represents the net intensity of
by guest on March 24, 2018
http://ww
w.jbc.org/
Dow
nloaded from
32
scattered laser light corresponding to fibrillization, In(90°), normalized to wild-type tau relative
to total filament lengths/field determined in Panel B, whereas the solid line represents linear
regression of the data points (excluding mutant 235, which produced amorphous aggregates as
well as filaments). These data show that the effects of pseudophosphorylation on fibrillization
equilibria were consistent by two distinct assay methods.
Fig. 3. Pseudophosphorylation modulates the critical concentration for assembly. The
fibrillization of wild-type htau40 and pseudophosphorylation mutants incubated (room
temperature for 26 h) with C18H37SO4Na inducer (50 µM) in assembly buffer was assayed as a
function of tau concentration (1 - 4.5 µM) by static LLS. Each data point represents the net
intensity of scattered light corresponding to fibrillization, In(90°), at a specific tau concentration,
whereas each solid line represents linear regression analysis of the data. The critical
concentration of assembly, which was estimated from the abscissa intercept of each regression
line (summarized in Table II), was modulated by site-specific pseudophosphorylation. Although
measured in quadruplicate, error bars on data points have been omitted for clarity.
Fig. 4. Filament mass at equilibrium correlates with critical concentration. The critical
concentrations of wild-type htau40 and pseudophosphorylation mutants (mean ± SD) were
plotted against total filament lengths at equilibrium estimated in Fig. 2C (% wild-type tau control
± SD) and analyzed by linear regression. Total filament lengths were directly proportional to
critical concentrations.
Fig. 5. Effect of pseudophosphorylation on fibrillization kinetics. Fibrillization of wild-type
htau40 and tau phosphorylation mimicry mutants (4 µM) in the presence of 50 µM C18H37SO4Na
was assayed as a function of incubation time at room temperature. Each data point represents
average filament lengths/field calculated from EM images whereas each curve represents best fit
by guest on March 24, 2018
http://ww
w.jbc.org/
Dow
nloaded from
33
of the data points to a three parameter Gompertz growth function (eq. 1). Although
pseudophosphorylation had only minor effects on fibrillization kinetics as estimated by lag time
or first order growth rates (summarized in Table II), it greatly modulated total filament mass at
equilibrium relative to wild-type htau40.
Fig. 6. Filament mass at equilibrium correlates with fibrillization lag times. A, lag times
and B, kapp values for wild-type htau40 and pseudophosphorylation mutants estimated in Fig. 5
were plotted against total filament lengths at equilibrium estimated in Fig. 2C (% wild-type tau
control ± SD) and analyzed by linear regression. Horizontal error bars were omitted for clarity.
Total filament lengths at equilibrium were directly proportional to lag times but not kapp,
consistent with a decrease in critical concentration.
Fig. 7. Pseudophosphorylation at position 212 leads to longer filament lengths. A, Wild-
type htau40 and B, mutant htau40T212E preparations (4 µM) were incubated (5 h at room
temperature) under standard conditions (assembly buffer with 75 µM AA) and then visualized by
transmission EM. Although both tau preparations yielded filaments with straight morphology,
mutant htau40T212E yielded filaments with greater average length relative to wild-type htau40.
This profile was typical of all pseudophosphorylation mutants that enhanced tau fibrillization.
Bar = 100 nm.
Fig. 8. Pseudophosphorylation modulates equilibrium length distributions. Wild-type and
mutant htau40 preparations (4 µM) were incubated (4 h at room temperature) in assembly buffer
containing 75 µM AA and then examined by transmission EM. The total lengths/field of all
filaments ≥50 nm in length adsorbed onto grids (Γf ) were measured from the resultant digitized
images. Distributions of lengths that segregated into consecutive intervals (50-nm bins) were
also calculated and quantified by a slope parameter as described in Experimental Procedures.
by guest on March 24, 2018
http://ww
w.jbc.org/
Dow
nloaded from
34
All data points are presented as percentages of normalized values, with wild-type control htau40
defined as 100% on both axes. The solid line represents the best fit of the data points to an
exponential function. Increases in filament mass at equilibrium produced by
pseudophosphorylation were accompanied by decreases in slope.
Fig. 9. Glycation increases inducer-mediated tau fibrillization. The fibrillization of
htau40C291A/C322A (4 µM) under standard conditions (assembly buffer with 75 µM AA) was
quantified by transmission EM. Total lengths/field of all filaments ≥50 nm in length (Γf) were
calculated as percentages of normalized control values ± SE, with untreated htau40C291A/C322A
(glucose -) defined as 100%. The presence of free D-glucose (2 mM) in the assay (glucose +;
glycation time = 0 d) did not significantly change the extent of fibrillization relative to the no
glucose control, confirming that the presence of free glucose in the assay at low millimolar
concentrations did not modulate tau assembly under these conditions. In contrast, preincubation
of htau40C291A/C322A under glycating conditions (glycation time = 7 d at 37°C) resulted in a nearly
two-fold increase in the amount of filamentous material at equilibrium. The enhanced
aggregation activity was stable to desalting by gel filtration prior to dilution and assay
confirming that it resulted from a stable modification of tau protein and not from free glucose or
other small molecules carried over into the assay. Significance at p < 0.01 (**) was estimated by
t-test.
Fig. 10. Effect of glycation on tau fibrillization kinetics. Mutant htau40C291A/C322A
preparations (4 µM) treated 7 d (37°C) in the presence (○) or absence (●) of 10 mM D-glucose
were subjected to fibrillization conditions (assembly buffer with 50 µM C18H37SO4Na) after
desalting chromatography and examined as a function of A, incubation time or B, tau
concentration by the corrected LLS assay. A, Each data point represents net light scattering
by guest on March 24, 2018
http://ww
w.jbc.org/
Dow
nloaded from
35
intensity of glycated (●) and non-glycated (○) sample as a function of time, whereas each
sigmoid curve represents the best fit of the data points to a three parameter Gompertz function
(eq 1). Glycation resulted in increases in equilibrium levels of fibrillization with only minor
changes in lag time. B, varying concentrations (1.5 - 4.5 µM) of glycated (●) and non-glycated
(○) htau40C291A/C322A were fibrillized in the presence of 50 µM C18H37SO4Na for 26 h at 22°C
and then analyzed by corrected LLS. Each data point represents the net intensity of scattered
light at a given tau concentration (mean ± SD of triplicate determinations) whereas the solid lines
represent best fit of the data points to a linear regression. The critical concentration, estimated
from the abscissa intercept of linear regression lines, decreased with glycation.
by guest on March 24, 2018
http://ww
w.jbc.org/
Dow
nloaded from
36
Table I
Pseudophosphorylation mutants examined in this work
Sites Probea AD Stageb Tauopathya
Ser199, Ser202, Thr205 AT8 Late All
Thr212, Ser214 AT100 Late ---
Thr231, Ser235 AT180; TG3 Early ---
Ser262 12E8 Early Most
Ser396, Ser404 AD2; PHF1 Late All
Ser409 --- Early ---
Ser422 AP422 Mid All
aSite-selective immunological probes of phosphorylation occupancy (AT8, AT100, etc.) are
reviewed in (1).
bRefs. (14,15)
by guest on March 24, 2018
http://ww
w.jbc.org/
Dow
nloaded from
37
Table II
Kinetic and thermodynamic parameters of pseudophosphorylation mutants
Tau construct aLag time
(min)
akapp
(h-1)
bCritical concentration
(µM)
WT 42.4 ± 0.8 1.33 ± 0.07 2.00 ± 0.07
199 51.5 ± 0.9 1.08 ± 0.10 1.62 ± 0.02
199/202/205 57.9 ± 0.5 1.31 ± 0.07 1.05 ± 0.16
212 59.5 ± 0.4 1.13 ± 0.03 0.68 ± 0.13
214 61.6 ± 0.5 1.03 ± 0.03 0.81 ± 0.09
212/214 53.8 ± 0.3 1.40 ± 0.06 1.07 ± 0.07
231 41.7 ± 0.9 1.08 ± 0.10 2.03 ± 0.14
235 40.3 ± 0.5 1.25 ± 0.09 1.97 ± 0.17
262 38.9 ± 1.1 1.01 ± 0.10 1.95 ± 0.08
396/404 52.6 ± 1.2 1.28 ± 0.12 2.02 ± 0.13
409 41.3 ± 0.7 1.05 ± 0.07 1.92 ± 0.10
422 39.2 ± 1.2 1.00 ± 0.11 1.88 ± 0.11
aDetermined from 4 µM tau and 50 µM C18H37SO4Na by EM and fitted to a three-parameter
Gompertz growth function as described in Experimental Procedures (shown in Fig. 5).
Parameters are expressed ± SE.
bDetermined by static laser-light scattering in the presence of 2 - 4.5 µM tau and 50 µM
C18H37SO4Na (shown in Fig. 3) and expressed as mean ± SD.
by guest on March 24, 2018
http://ww
w.jbc.org/
Dow
nloaded from
Mihaela Necula and Jeff Kuretfibrillization in vitro
Pseudophosphorylation and glycation of tau protein enhance but do not trigger
published online September 10, 2004J. Biol. Chem.
10.1074/jbc.M405527200Access the most updated version of this article at doi:
Alerts:
When a correction for this article is posted•
When this article is cited•
to choose from all of JBC's e-mail alertsClick here
by guest on March 24, 2018
http://ww
w.jbc.org/
Dow
nloaded from