relative quantification hla-dra1 dqa1 expression by real-time

8/2/2019 Relative Quantification HLA-DRA1 DQA1 Expression by Real-time

1/8

2003 Blackwell Publishing Ltd, European Journal of Immunogenetics30, 141148 141

BlackwellPublishingLtd.

Relative quantification of HLA-DRA1 and -DQA1 expression by real-time

reverse transcriptasepolymerase chain reaction (RTPCR)

S. Fernandez,* R. Wassmuth,* I. Knerr, C. Frank* and J. P. Haas*

Summary

Polymorphism in the upstream regulatory region (URR)of the MHC class II DQA1 gene defines 10 differentalleles named QAP (DQA1 promoter). In vitro studieshave suggested that allelic polymorphism in the HLA-DQApromoter region may result in differences in HLA-DQA1gene expression. In the present study, we used real-timereverse transcriptasepolymerase chain reaction (RTPCR)to quantify differences in HLA-DQA1 gene expression.After the isolation of total mRNA, reverse transcriptioninto cDNA was carried out using random hexamer primingand moloney murine leukaemia virus (MMLV) reversetranscriptase. Quantification of DQA1 mRNA speciesusing a set of six group-specific primer pairs for the detec-tion of HLA-DQA1*01, *02, *03, *04, *05 and *06 wascarried out on an ABI PRISM GeneAmp 7700 SequenceDetection System (Perkin Elmer, Foster City, CA) withreal-time detection and quantification taking advantage ofthe fluorescence TaqMan technology (Perkin Elmer, FosterCity, CA). Normalization of cDNA templates was achieved

by glyceraldehyde-3-phosphate dehydrogenase (GAPDH)quantification. In addition, the total amount of mRNAproduced by HLA-DQA1 and HLA-DRA1 expressionwas quantified for comparison. Subsequently, this approachwas validated using Raji and HUT-78 cell lines and testedwith peripheral mononuclear cells (PBMC) of 45 samplestaken from healthy volunteers. The sensitivity was deter-mined with 102 copies. Comparison of the allele-specificDQA1 expression with the total expression of DQA1 andDRA1 mRNA indicated that DQA1*04 expression wasincreased compared with the expression of other alleles of

the DQA1 gene. Thus, allele-specific quantification of DQA1gene products could be achieved by real-time RTPCRsuitable for the analysis of differential expression of DQA1mRNAs in homozygote and heterozygote combinations.

Introduction

MHC class II molecules play a major role in shapingthe antigen-specific immune response. Their expressionis regulated in a cell-specific manner and controlled viacis-acting elementsw in the upstream regulatory regions(URRs) located in the 5-flanking regions of HLA class IIgenes. These URRs consist of highly conserved sequenceshaving promoter, repressor or enhancer functions, e.g.TATA, CCAAT, and X1-, X2-, Y- and W-box. Trans-acting factors such as RF-X, c-fos, c-jun and hXBPbind to cis-acting elements and either activate or represstranscription (Edwards et al., 1986; Auffray et al., 1987;Reith et al., 1995). Despite the highly conserved seq-uences of the cis-acting elements, polymorphism hasbeen found in the URRs of HLA-D genes, namely in

DRB1 (Perfetto et al., 1993), DQA1 (Del Pozzo et al.,1992) and DQB1 (Andersen et al., 1991). In the URR ofDQA1, polymorphism is concentrated in the hypervaria-ble region between 240 and 200 bp upstream of exon 1,defining 10 different allelic variants referred to as QAP(DQA1 promoter) alleles: 1.1, 1.2, 1.3, 1.4, 1.5, 2.1, 3.1,3.2, 4.1 and 4.2 (Haas et al., 1994). These QAP alleleswere found to be in linkage disequilibrium with DQA1alleles defined by DQA1 exon 2 polymorphism (Haaset al., 1995). The URR of DQA1 differs from other MHCclass II URRs in the absence of a TATA as well as aCCAAT sequence. Moreover, the Y-box in the URR ofDQA1 (YC-box) differs from the consensus sequence (bp123 A instead of G) found in all other Y-boxes of classII URRs (Auffray et al., 1987). This may be relevant to thedecreased surface expression seen for HLA-DQ mole-cules, compared to HLA-DR and -DP (Edwards et al.,1986; Marley et al., 1987; Kimura & Sasazuki, 1992). Inaddition, the promoter variants QAP 4.1 (DQA1*0401and *0601) and 4.2 (DQA1*0501) carry a second substi-tution in their Y-box (YM-box: bp 119 A to G basechange). In vitro studies analysing cell lines have sug-gested a functional relevance of the allelic polymorphismin the DQA1 URR for DQA1 gene expression (Kimura &Sasazuki, 1992; Morzycka-Wroblewska et al., 1997).

* Institute for Clinical Immunology, Department of Medicine III, Friedrich

Alexander University, Erlangen-Nuremberg, Germany, Institute forTransplantation Diagnostics and Cell Therapeutics, University of

Dusseldorf Medical Center, Germany, Childrens Hospital, Friedrich

Alexander University, Erlangen, Germany, and Department of

Pediatrics, Division of Neonatology and Critical Care Medicine,

University of Greifswald, Germany.

Received 22 February 2002; revised 15 October 2002;

accepted 6 December 2002

Correspondence: Johannes-Peter Haas, Department of Paediatrics,

Division of Neonatology and Critical Care Medicine, University of

Greifswald, Soldtmannstr. 15, D17487 Greifswald, Germany. Tel:

49 3834 866409; Fax: 49 3834 867377;

E-mail: [email protected]


2/8

142 S. Fernandez et al.

2003 Blackwell Publishing Ltd, European Journal of Immunogenetics30, 141148

Association of HLA markers is a hallmark of someautoimmune diseases. Particularly, HLA-DQ moleculesmay play a significant role in susceptibility to, for exam-ple, diabetes mellitus type 1, juvenile idiopathic arthritis(JIA) and coeliac disease. Moreover, a positive association ofthose DQA1 URR alleles carrying the mutated YM-boxwith the oligoarticular subtype of JIA has been described,

suggesting the relevance of regulatory effects on diseasesusceptibility in autoimmune disease (Haas et al., 1995).

Thus, the aim of this study was to establish a polymer-ase chain reaction (PCR)-dependent assay to quantifyHLA-DQA1 expression in an allele-specific manner inorder to investigate the role of allele-specific expression inautoimmunity.

Materials and methods

Cell isolation and cell lines

Cell lines [Raji (ATCC CCL86) and HUT-78 (ATCCTIB161)] were cultured in R10, i.e. RPMI 1640 supple-mented with 10% heat-inactivated foetal calf serum,2 mm l-glutamine, 100 g ml1 penicillin and 100 g ml1

streptomycin (Invitrogen, Darmstadt, Germany). Periph-eral blood mononuclear cells (PBMC) were isolated withHistoprep (BAG GmbH, Lich, Germany) from peripheralblood samples using standard methods.

DQA1 genotyping

MHC class II polymorphism was investigated in 40healthy unrelated volunteers, all of Caucasian origin. ForDNA isolation, cell nuclei were prepared and DNAseparated with guanidine isothiocyanate, followed by

precipitation with isopropanol (Ciulla et al., 1988). PCRamplification of DQA1 alleles was carried out using exon-specific primers described elsewhere (Haas et al., 1994).DIG-11-ddUTP (digoxigenin-11-2-3-didesoxy-uridine-triphosphate) oligonucleotide labelling and detection wereperformed as described by Nevinny-Stickel & Albert (1993).

RNA extraction and cDNA synthesis

Total RNA was extracted from PBMC using TRIzolreagent (Invitrogen, Darmstadt, Germany). Total RNAwas reverse transcribed using random hexamer primingand MMLV reverse transcriptase (RT) (ProSTAR First-Strand RTPCR Kit, Stratagene, La Jolla, CA). One RNAsample of each preparation was processed withoutMMLV RT (RT reaction) to provide a negative control insubsequent PCR reactions.

Primers and probes

PCR primers and fluorogenic probes were designed for alltarget genes according to the published sequences (Olerupet al., 1993; Marsh & Bodmer, 1995) using PrimerExpress software (Applied Biosystems, Foster City, CA)They were obtained from Eurogentec (Seraing, Belgium)

purified with high-performance liquid chromatography(HPLC). The fluorogenic probes contained a reporterdye (FAM, 6-carboxy-fluorescein) covalently linked atthe 5 end and a quencher dye (TAMRA, 6-carboxy-tetramethyl-rhodamine) covalently attached at the 3 end.Extension from the 3 end was blocked by attachmentof a 3-phosphate group.

cDNA standards

As external controls for each target gene, plasmidrecombinants containing the specific target sequence weregenerated for DQA1 alleles, as well as GAPDH andDRA1*01. For this purpose, total RNA from individualspositive for the allele of interest was extracted and reversetranscribed as described above. Following reversetranscription and allele-specific PCR, amplicons werecloned into pCR2.1 TOPO (Invitrogen Co., Carlsbad,CA). Recombinant plasmids were expressed in compe-tent Escherichia coli (TOP 10F, Invitrogen). PlasmidDNA was isolated using silicea cartridges (QIAprepSpin Miniprep Kit Qiagen, Hilden, Germany). Sequencesof the cloned amplicons were verified using an automatedcapillary sequencer (ABI PRISM 310, Perkin Elmer,Foster City, CA) with universal M13 primers. Concentra-tions of the recombinant plasmids were determinedby optical density spectrometry (Eppendorf, Hamburg,Germany). Serial dilutions from the resulting cloneswere used for standardization, as described in detail inthe manufacturers bulletin (Applied Biosystems, 1997).

PCR amplification and cDNA quantification

PCR reactions contained at a final concentration: 300 nm

forward and reverse primers, 200 nm TaqMan probe(Table 1), 200 m dATP, dCTP and dGTP, 400 m dUTP,0.025 U l1 AmpliTaq Gold, 0.01 U l1 uracil-N-glycosylase and 2.5 l cDNA in a total volume of 25 l.Each PCR amplification was performed in triplicate wellsusing the following temperature and cycling profile: 50 Cfor 2 min and 95 C for 10 min, followed by 40 cycles of95 C for 15 s and 60 C for 1 min (DQA1*04 primers:66 C for 1 min, DQA1*05 primers: 62 C for 1 min).Reagents were obtained from Applied Biosystems(Weiterstadt, Germany). For quantification, an ABIPRISM 7700 Sequence Detection System (Perkin Elmer)was used (Gibson et al., 1996; Heid et al., 1996; AppliedBiosystems, 1997; Knerr et al., 1999).

Detection of genomic DNA contamination

Exclusion from the PCR amplification of contaminatinggenomic DNA was accomplished by coamplification witha pair of primers located in the first DQA1 intron(Table 1). The copy number of this intron PCR productcorresponds to the number of genomic DNA moleculesand it was thus used to estimate the genomic DNAcontent of the samples and compared with the copynumber of the allele-specific products.


3/8

Quantification of HLA-DRA1 and -DQA1 expression by real-time RTPCR 143


Relative expression of different DQA1 alleles

The relative expression of DQA1 alleles was determinedwith reference to the total amount of HLA-DQA1 mRNAafter normalization against GAPDH as implementedin the ABI PRISM 7700 Sequence Detection Systemsoftware (Applied Biosystems, 1997).

Results were considered only if the analysis for allele 1(e.g. DRA1) showed all reactions to have the same amountof amplification as allele 2 (e.g. GAPDH). This procedureallowed comparison of group-specific HLA-DQA1 expres-sion as well as the total expression levels of HLA-DQA1and -DRA1.

Results

Design of primers and probes

For the allele-specific quantification of DQA1 gene prod-ucts, a real-time RTPCR set of primer pairs (n = 6) andprobes (n = 6) was designed and optimized (Table 1).HLA-DQA1 specific primers and probes were designed toencompass allele group-specific detection of HLA-DQA1

gene expression. Primers were designed based on theDQA1 genotyping system described by Olerup et al.(1993). The primers for DQA1*01, *02, *03, *05 and *06were located in the hypervariable region within exon 2(see Fig. 1). For DQA1*04, exon-spanning primer pairswere employed. For normalization, GAPDH and HLA-DRA1 gene expression were used as endogenous refer-ence. Primers for DRA1 were also located within the secondexon, while for GAPDH exon-spanning primer pairs wereemployed. Melting temperatures (Tm) were chosen torange from 56 to 60 C (see Table 1). Probes were con-structed to have an annealing temperature at least 10 Chigher than the primer Tm, thus approximately 6870 C.The amplicon lengths were kept between 71 and 173 bp.

The reproducibility of the assay was determined byquantification of different cDNA target samples carryingthe same allele. Quantifications were obtained byperforming individual experiments with repeated runs ofthe same preparation. As shown in Table 2, the standarderror of the mean (SEM) was within 310%.

The specificity of DQA1 allele-specific amplification indifferent homozygous and heterozygous combinationswas confirmed by the analysis of a panel of 51 individuals.

Table 1. Primers and probes

Name Sequence (5 3) Length (mer) Tm (C)

Amplicon

length (bp)

DQA1*01 DQA01F GAAGGAGACTGCCTGGCG 18 58 105

DQA01R ATGATGTTCAAGTTGTGTTTTGC* 23 56

DQA01FATA CAAATTTGGAGGTTTTGACCCGCAGG 26 69

DQA1*02 DQA02F ACGGTCCCTCTGGCCAGTT* 19 60 122DQA02R TTGCGGGTCAAATCTAAGTCTGT 23 59

DQA0203FATA ATGAATTTGATGGAGACGAGGAGTTCTATGTGG 33 69

DQA1*03 DQA03F GGTCCCTCTGGGCAGTACAG 20 58 127

DQA03R CAAATTGCGGGTCAAATCTTCT* 22 59

DQA0203FATA ATGAATTTGATGGAGACGAGGAGTTCTATGTGG 33 69

DQA1*04 DQA04F GAGCAGTTCTACGTGGACCTGG 22 60 170

DQA04R GGAACCTCATTGGTAGCAGCA* 21 59

DQA0405FATA ACTGTCTGGTGTTTGCCTGTTCTCAGACAA 30 68

DQA1*05 DQA05F AGATGAGCAGTTCTACGTGGACC 23 58 153

DQA05R AGAGTTGGAGCGTTTAATCAGAC* 23 56

DQA0405FATA ACTGTCTGGTGTTTGCCTGTTCTCAGACAA 30 68

DQA1*06 DQA06F ACGGTCCCTCTGGCCAGTT* 19 60 119

DQA06R CGGGTCAAATCTAAATTGTCTGAGA* 25 60

DQA06FATA AATTTGATGGAGACGAGCAGTTCTACGTGGA 31 70

DQA1 (total DQAF CACAGCTCAGAGCAGCAACTG 21 59 127

DQA1 primer) DQAR AGCCACAATGTCTTCACCTCCA 22 60

DQAFATA CCTTGGGAAGAGGATGATCCTAAACAAA 33 70

DQA1 DQAintrF GTTGCCCGTTTCTTTCTCTCA 21 58 80

(intron primer) DQAintrR TGGACTCCTTTACCCACTCCC 21 59

DQAintrFATA ATTTCCACATGGGAACTGGCACAGGT 26 68

DRA1 DRAF GGACAAAGCCAACCTGGAAA 20 59 120

DRAR AGGACGTTGGGCTCTCTCAG 20 58

DRAFATA TACTCCGATCACCAATGTACCTCCAGAG 34 69

GAPDH GAPDH3 GCCATCAATGACCCCTTCATT 21 60 89

GAPDH5 TTGACGGTGCCATGGAATTT 20 60

GAPDHFATA CCTCAACTACATGGTTTACATGTTCCAATATGATTCCAC 39 70

*Primers modified according to the sequences published by Olerup et al. (1993). Forward (F) and reverse (R) primers for DQA1*01, *02, *03, *05

and *06 and DRA1*01 are located in a single exon; primers for DQA1*04 and GAPDH are located in two exons, thus spanning one intron. Fluorogenic

probes (FATA) are FAM-labelled at the 5-end and TAMRA-labelled at the 3-end.


4/8



Criteria for inclusion in the analysis were: (i) HLA-DQA1genotyping, (ii) positive result for GAPDH and DRA, and(iii) positive result for DQA1 expression for at least oneDQA1 allele. Six individuals did not fulfill these criteriaand were thus excluded. The other 45 individuals covereda broad range of DQA1 alleles and allelic combinations(see Table 3). There were five individuals each homozygousfor DQA1*01 and DQA1*05. In the remaining 35individuals and both cell lines, gene expression of twodifferent DQA1 alleles was seen. There were no discrep-ancies between expression data and the DQA1 genotype.The rare allele DQA1*0601 was not represented in ournon-selected study population.

Quantification

Standard curves for the direct quantification of the cDNAlevels of HLA-DQA1 and -DRA1 were established usingserial dilutions of the corresponding recombinant plasmidclones. For each standard curve, a linear range of con-centrations covering 6 log units (102108) was employed(Fig. 2). The precision and reproducibility of amplifica-tion were confirmed for input amount of copies rangingfrom 108 down to 50 copies. Standard errors of the mean(SEM) for assay variation (Table 2) were calculated withmaximums of 8.4% (interassay) and 11.7% (intra-assay).At 102 copies, the minimum input amount of cDNA was

Figure 1. Sequences of HLA-DQA1 alleles, showing the sequence alignment of published (Marsh & Bodmer, 1995) nucleotide sequences containing

the first 100 amino acids (exons 13) of HLA-DQA1 alleles *0101 to *0601. Numbers above the sequences refer to the amino acid position. Nucleotide

sequences were aligned to the DQA1*0101 allele. Dashes indicate identity of nucleotides. The reverse 3-primer DQA04R extends into part of the

third exon. Primers are shaded dark grey, and allele-specific probes light grey.

Table 2. Reproducibility of the assay, showing quantification of DQA1*05 expression by real-time PCR in three different cDNA target samples

Assay

Sample 1 Sample 2 Sample 3

Ct Copy number Ct Copy number Ct Copy number

1A 24.98 72250 25.98 34019 27.05 15241

1B 25.03 69516 26.06 32091 27.15 14208

1C 25.12 64963 26.04 32604 27.13 14332

1D 24.88 77398 26.03 32692 27.12 14429

Mean SEM 71032 2600 32852 411 14552 234

2A 22.65 74863 23.71 37799 25.07 15668

2B 22.81 67323 23.83 35032 24.43 23684

2C 22.76 69647 23.75 36689 24.64 20707

Mean SEM 70611 2229 36507 803 20020 2339

Mean SEM (total) 70851 1628 34418 828 16896 1420

All quantifications were obtained by performing individual experiments with quadruplicate (1A1D) and triplicate (2A2C) runs of the same preparation.


5/8



determined to be above 102 copies with a markedlyincreased intra-assay variation (data not shown).

Genomic DNA contamination

Comparison of copy numbers of amplified DQA1 intronsequence with DQA1 exon 2 allele-specific amplificationsindicated contamination of the cDNA with genomicDNA. The contamination rate was found to range from0.01 to 4.2% (mean 0.8%, SEM 0.7).

Relative expression of different DQA1 alleles

HLA-DQA1 was found to have 4.15-fold lower averageexpression than HLA-DRA1 (Fig. 3). The analysis ofthe expression levels of individual HLA-DQA1 allelesshowed that DQA1*04 expression was significantlyincreased (ratio 0.37) compared to the expression ofGAPDH. All other HLA-DQA1 alleles, namely DQA1*01,*02, *03 and *05, showed very similar ratios, from 0.09to 0.14 relative to GAPDH expression. Thus, the relativeexpression of HLA-DQA1*04 was observed to be 2.6 4-fold higher than that of any other HLA-DQA1 allele. Rel-ative to HLA-DRA1, the expression of HLA-DQA1*04was observed to be 2.2-fold higher.

In homozygous individuals (DQA1*01/*01 and *05/05), expressions levels for individual alleles were nothigher than their corresponding levels in heterozygousindividuals (DQA1*01/*05). In order to examine relative

rates of expression of particular DQA1 alleles in differentheterozygous combinations, DQA1 interallelic ratioswere determined in heterozygous individuals. The resultsare summarized in Table 3. Taking DQA1*01 as an

example, the relative expression ranged from 0.12 withDQA1*03 expressed on the second haplotype up to 0.2with DQA1*02 on the second haplotype. Anotherexample is the combination of HLA-DQA1*01 and*04, with eight individuals found to be positive. WhileDQA1*04 showed a relative expression of 0.37 (SEM 0.13), DQA1*01 showed a relative expression of 0.13(SEM 0.02) compared with GAPDH.

Discussion

Recent in vitro studies have suggested that variability ofcis-acting elements may contribute to the differentialregulation of HLA-DQA1 expression (Kimura &Sasazuki, 1992; Morzycka-Wroblewska et al., 1997).Nevertheless, the relevance of DQA1 promoter polymor-phism for allele-specific differences in DQA1 expressionin vivo remains to be determined (Cesari et al., 1999). Forthis purpose, we have developed a real-time RTPCR-based system to allow quantification of HLA-DQA1 geneexpression in an allele group-specific manner in hetero-zygous combinations without any in vitro manipulation.

Studies on DQA1 gene expression in homozygouscells have shown differences in DQA1 expression tocorrelate with nucleotide substitutions in conserved

Figure 2. Efficiency of PCR amplification in Raji

and plasmids. Five-fold serial dilutions of target

(cDNA prepared from Raji cell lines) and control

cDNA (cloned DQA1 cDNA prepared from

plasmids) were carried out. Triplet amplification

was performed with HLA-DQA1 specific

primers using the ABI Prism 7700 Detection

System. Obtained Ct values are plotted against

the relative amount of input copies.

Figure 3. Ratio of expression of different

DQA1 and DRA1 alleles. Ratios (given in

numbers above the bars) of expression were

calculated from the concentrations of the

different DQA1 alleles, and the total amounts of

DQA1 (t-DQA1), DRA1 (t-DRA1) and GAPDH

mRNA. The numbers of samples tested are

given in parenthesis.


6/8



regulatory boxes of the DQA1 promoter region(Morzycka-Wroblewska et al., 1997). Since polymorphicsites within the W-, X- andY-boxes of the DQA1 promoterhave been shown to be in strong linkage disequilibriumwith DQA1 allele groups including DQA1*01, DQA1*02,DQA1*03, DQA1*04, DQA1*05 and DQA1*06, thelevel of qualitative resolution for quantification waschosen accordingly (Haas et al., 1994) Thus, a set of sixprimers and probes was constructed allowing thequantification of DQA1*01 (including *0101, *0106),DQA1*02 (including *0201), DQA1*03 (including*0301, *0302), DQA1*04 (including *0401), DQA1*05(including *0501) and DQA1*06 (including *0601) inhomozygous and heterozygous combinations. Becauseexon-specific primers were used, genomic DNA contami-nation was monitored by amplification of DQA1 intron

sequences in parallel. To allow reproducible standardiza-tion and quantification, a panel of recombinant plasmidclones containing the DQA1 exon 2 target sequences wasestablished and used for the determination of sensitivityand specificity of amplification. When this panel wasapplied, we were able to show linearity of amplificationefficiency in a range above 6 log units. Moreover, thesensitivity and specificity were found to correspond tothose obtained using real-time RTPCR-based quanti-fication systems targeting other genes (Heid et al., 1996;Knerr et al., 1999).

Since HLA-DRA1 shows only limited polymorphism inexon 2 and in the promoter region and is constitutivelyexpressed in MHC class II positive cells (Abdulkadiret al., 1995), HLA-DRA1 expression was used as amarker for HLA class II expression. Comparison of thetotal amounts of HLA-DRA1 and -DQA1 expression inPBMC showed HLA-DRA1 expression to be on average4.15-fold higher in all individuals tested. This relationshipcorresponds to the relative proportion of cell surfaceexpression of HLA-DR and -DQ (Brooks & Moore,1988). The difference in the expression of HLA-DRand -DQ genes may result from structural differences in

cis-acting elements which in turn lead to differential bind-ing and gene activation via trans-acting elements, as has

recently been observed for the activation of HLA-DR vs.-DQ by class II transactivator (CIITA) in hematopoieticcells (Liu et al., 1999). Structurally, the lower expressionof the DQA1 gene has been linked to the difference in theY-box sequence (YC-box) unique to the HLA-DQA1 gene(Auffray et al., 1987; Kimura & Sasazuki, 1992; Morzycka-Wroblewska et al., 1997).

The interallelic comparison of HLA-DQA1 allelesindicated rather homogeneous levels of expression inPBMC from healthy donors. Surprisingly, expression inhomozygous individuals was not observed to be sig-nificantly increased as compared to heterozygous com-binations, thus excluding significant gene dosage effectsat the mRNA level. Although only a limited number ofheterozygous combinations could be analysed for thepurpose of establishing the real-time RTPCR detection

system, no DQA1 allele hierarchy for the expression ofparticular HLA-DQA1 allelic groups was seen whendifferent heterozygous combinations were compared.However, a consistency in expression patterns was seenfor the DQA1*04 and DQA1*01 alleles, as in allDQA1*04/*01 heterozygotes DQA1*04 was expressedat a higher level than DQA1*01. Interestingly, DQA1*04carries a promoter (QAP 4.1) which is very similar to thatfound with DQA1*05 and *06 (QAP 4.2). QAP 4.1 andQAP 4.2 carry the YM-box characterized by a secondnucleotide exchange compared to the HLA class II con-sensus sequence (Haas et al., 1994). However, QAP 4.2 ascompared with the sequence of QAP 4.1 carries someremarkable nucleotide substitutions apart from those inthe Y-box. One is a T to G mutation at position 134, andthe other is a G to T mutation at position 209. Bothregions have been determined to be located in the cis-acting sequence for a transcription factor regulated bytumour necrosis factor (TNF)- (Kimura & Sasazuki,1992). In vitro studies with cell lines carrying the QAP 4.1or the QAP 4.2 promoter showed decreased levels ofexpression in the presence of the mutated YM-box foundin both promoter alleles (Morzycka-Wroblewska et al.,1997; Indovina et al., 1998). This suggests other regionslocated within the DQA1 promoter region might be

Table 3. Relative expression of DQA1 alleles in 45 individuals. Mean values obtained from analyses of relative HLA-DQA1 gene expression

comparing different haplotypic combinations are shown. Gene expressions are given relative to GAPDH

DQA1 *01 SEM *02 SEM *03 SEM *04 SEM *05 SEM *06

*01 0.17 0.08 0.10 0.02 0.09 0.03 0.37 0.23 0.10 0.05

(n = 5) (n = 3) (n = 7) (n = 8) (n = 13)

*02 0.20 0.03 0.07 0.02

(n = 3) (n = 2)*03 0.12 0.03 0.05 0.02

(n = 7) (n = 2)

*04 0.13 0.02

(n = 8)

*05 0.13 0.07 0.06 0.01 0.07 0.02 0.09 0.08

(n = 13) (n = 2) (n = 2) (n = 5)

*06

SEM = standard error of the mean.


7/8



relevant to the observed differences in gene expression.Indovina et al. (1998) recently reported expression datafrom a heterozygous lymphoblastoid cell line positive forHLA-DQA1*04 and 02. In view of the strong linkagedisequilibrium between DQA1 alleles within the promoterand the second exon, this cell line is likely to be positivefor QAP 4.1 and QAP 2.1. The authors demonstrated

decreased expression of DQA1*04 in this homozygouslymphoblastoid cell line using competitive RTPCR andnorthern blotting (Indovina et al., 1998). The expressionof DQA1 alleles was previously analysed by transfectionassays or semiquantitative RTPCR in mostly lymphoblas-toid cell lines. In this study, we have used bulk PBMCs toexplore the differential expression patterns seen in heter-ozygous individuals. With respect to previous reports,differences may relate to the fact that, in transformed celllines, HLA class II genes may be regulated differently,and that PBMCs constitute a heterogeneous group of celltypes. Cell type-specific differences may therefore existand the overall expression may consequently be alteredcompared with that found for isolated cell types. This,however, remains to be determined.

Regulation of HLA-DQ gene transcription is a complexphenomenon. Allelic polymorphism is present in theDQA1 (encoding the -chain) as well as in the DQB1(encoding the -chain) genes. Moreover, both geneshave been found to have allelic polymorphism within theirURRs. Strong linkage disequilibria have been observedbetween QAP and DQA1 alleles (Haas et al., 1994) aswell as between QBP and DQB1 alleles (Reichstetteret al., 1996). As both genes may be subject to allelic reg-ulation, complex patterns of interaction at the level ofgene expression, pairing and surface expression may bepresent, influencing the level of allelic mRNA expression.

HLA-DQ molecules are associated with susceptibilityto autoimmune diseases such as diabetes mellitus type 1,

JIA and coeliac disease. Moreover, particular haplotypiccombinations have been shown to be of central impor-tance in disease susceptibility and protection. Because ofthe very close proximity of the HLA-DR and -DQ genesthere is still a debate over whether HLA-DR or HLA-DQis the more relevant association in JIA (Smerdel et al.,2002). A hierarchy of MHC class II associations has beenobserved in JIA, where DQA1 alleles (*0401, *0501 and*0601) are responsible for disease association whileDQB1 alleles (susceptibility: *0301 and *0402; protection:*0201) are crucial for the gene effect. Under the hypoth-esis that quantitative differences in allelic expression maylead to alterations in the composition of the functionallyactive heterodimer, which in turn may give rise to qualita-tive differences in the ability of the - heterodimer tobind and present peptides, the study of allelic expressionof DQA1 alleles may contribute to our understanding ofthe role of HLA-DQ in autoimmunity.

Acknowledgements

This work was supported by the Deutsche Forschungsge-meinschaft (grant nos DFG-HA 2306 and SFB263/C8)

and by the BMFT-funded Center for InterdisciplinaryClinical Research at the Friedrich Alexander UniversityErlangen-Nrnberg [IZKF Erlangen (01 KS 9601)/projectB17, B31 and C8]. We would like to thank the healthyvolunteers who participated in the study. The generousprovision of cell samples with rare DQA1 alleles by A.McNickolas and E. D. Albert, Immunogenetic Laboratory,

Ludwig Maximillians University, Munich is gratefullyacknowledged.

References

Abdulkadir, S.A., Krishna, S., Thanos, D., Maniatis, T., Strominger, J.L.

& Ono, S.J. (1995) Functional roles of the transcription factor

Oct-2A and the high mobility group protein I/Y in HLA-DRA

gene expression.Journal of Experimental Medicine, 182, 487.

Applied Biosystems (1997) User Bulletin #2: ABI PRISM 7700

Sequence Detection System. Applied Biosystems, Weiterstadt,

Germany.

Andersen, L.C., Beaty, J.S., et al. (1991) Allelic polymorphism in

transcriptional regulatory regions of HLA-DQB genes.Journal of

Experimental Medicine, 173, 181.

Auffray, C., Lillie, J.W., et al. (1987) Structure and expression of

HLA-DQ alpha and -DX alpha genes: interallelic alternate splicing

of the HLA-DQ alpha gene and functional splicing of the HLA-DQ

alpha gene using a retroviral vector. Immunogenetics, 26, 63.

Brooks, C.F. & Moore, M. (1988) Differential MHC class II

expression on human peripheral blood monocytes and dendritic

cells. Immunology, 63, 303.

Cesari, M., Caillens, H., et al. (1999) In vivo analysis of HLA-DQ

gene expression in heterozygous cell lines. Immunogenetics , 50,

309.

Ciulla, T.A., Sklar, R.M., et al. (1988) A simple method for DNA

purification from peripheral blood. Analytical Biochemistry, 174,

485.

Del Pozzo, G., Perfetto, C., et al. (1992) DNA polymorphisms in the

5-flanking region of the HLA-DQA1 gene. Immunogenetics, 35,

176.Edwards, J.A., Durant, B.M., et al. (1986) Differential expression of

HLA class II antigens in fetal human spleen: relationship of

HLA-DP, DQ, and DR to immunoglobulin expression.Journal of

Immunology, 137, 490.

Gibson, U.E., Heid, C.A., et al. (1996) A novel method for real time

quantitative RTPCR. Genome Research, 6, 995.

Haas, J.P., Kimura, A., et al. (1994) Polymorphism in the upstream

regulatory region of DQA1 genes and DRB1, QAP, DQA1, and

DQB1 haplotypes in the German population. Human

Immunology, 39, 31.

Haas, J.P., Kimura, A., et al. (1995) Early-onset pauciarticular

juvenile chronic arthritis is associated with a mutation in the

Y-box of the HLA-DQA1 promoter. Tissue Antigens, 45, 317.

Heid, C.A., Stevens, J., et al. (1996) Real time quantitative PCR.

Genome Research, 6, 986.

Indovina, P., Megiorni, F., et al. (1998) Different binding of NF-Ytranscriptional factor to DQA1 promoter variants. Human

Immunology, 59, 758.

Kimura, A. & Sasazuki, T. (1992) HLA-DQA gene is differently

regulated from other HLA class II genes. In: Molecular

Approaches to the Study and Treatment of Human Diseases

(ed. by T. O. Yoshida and J. M. Wilson), p. 97. Elsevier Science

Publishers, Cambridge.

Knerr, I., Repp, R., Dotsch, J., Gratzki, N., Hanze, J., Kapellen, T.

& Rascher, W. (1999) Quantitation of gene expression by

real-time PCR disproves a retroviral hypothesis for

childhood-onset diabetes mellitus. Pediatrics Research, 46,

57.


8/8



Liu, A., Takahashi, M., et al. (1999) Regulation of the expression of

MHC class I and II by class II transactivator (CIITA) in

hematopoietic cells. Hematological Oncology, 17, 149.

Marley, N.J., Macartney, J.C., et al. (1987) HLA-DR, DP and DQ

expression in the small intestine of patients with coeliac disease.

Clinical and Experimental Immunology, 70, 386.

Marsh, S.G. & Bodmer, J.G. (1995) HLA class II region nucleotide

sequences, 1995. Tissue Antigens, 46, 258.

Morzycka-Wroblewska, E., Munshi, A., et al. (1997) Differentialexpression of HLA-DQA1 alleles associated with promoter

polymorphism. Immunogenetics, 45, 163.

Nevinny-Stickel, C. & Albert, E.D. (1993) HLA class II typing in a

microtitre plate format using digoxigenin-labelled amplified DNA

and biotin-labelled oligonucleotide probes. European Journal of

Immunogenetics, 20, 419.

Olerup, O., Aldener, A., et al. (1993) HLA-DQB1 and -DQA1

typing by PCR amplification with sequence-specific primers

(PCR-SSP) in 2 hours. Tissue Antigens, 41, 119.

Perfetto, C., Zacheis, M., et al. (1993) Polymorphism in the

promoter region of HLA-DRB genes. Human Immunology, 36,

27.

Reichstetter, S., Brunnler, G., et al. (1996) DQB1 promoter sequence

variability and linkage in caucasoids. Human Immunology,

51, 73.Reith, W., Steimle, V., et al. (1995) Regulation of MHC class II gene

expression. Immunobiology, 193, 248.

Smerdel, A., Ploski, R., et al. (2002) Juvenile idiopathic arthritis

(JIA) is primarily associated with HLA-DR8 but not DQ4

on the DR8-DQ4 haplotype. Annals of Rheumatic Disease, 61,

354.

relative quantification hla-dra1 dqa1 expression by real-time

Documents