Upload File

standard 4 exon gene -where is the polya tail in the gene above? -draw a 4 exon gene where exon 4 is...

  • Home
  • Documents
  • Standard 4 exon gene -Where is the polyA tail in the gene above? -Draw a 4 exon gene where exon 4 is all 3’UTR
10
Standard 4 exon gene -Where is the polyA tail in the gene above? -Draw a 4 exon gene where exon 4 is all 3’UTR

Post on 21-Dec-2015

217 views

Category:

Documents


1 download

Report

Tags:

TRANSCRIPT

Page 1: Standard 4 exon gene -Where is the polyA tail in the gene above? -Draw a 4 exon gene where exon 4 is all 3’UTR

Standard 4 exon gene

-Where is the polyA tail in the gene above?-Draw a 4 exon gene where exon 4 is all 3’UTR

Page 2: Standard 4 exon gene -Where is the polyA tail in the gene above? -Draw a 4 exon gene where exon 4 is all 3’UTR

Chapter 9 and some of 8DNA and the Molecular Structure

of Chromosomes

Page 3: Standard 4 exon gene -Where is the polyA tail in the gene above? -Draw a 4 exon gene where exon 4 is all 3’UTR

The Structures ofDNA and RNA

DNA is usually double-stranded, with

adenine paired with thymine

and guanine paired with

cytosine. RNA is usually single-

stranded and contains uracil in

place of thymine.

Page 4: Standard 4 exon gene -Where is the polyA tail in the gene above? -Draw a 4 exon gene where exon 4 is all 3’UTR

WhenDo weFind RNAMixed with The DNA?

nucleoside = sugar +base

nucleotide = sugar + base + phosphate

Page 5: Standard 4 exon gene -Where is the polyA tail in the gene above? -Draw a 4 exon gene where exon 4 is all 3’UTR

Ribonucleotide Reductase

Page 6: Standard 4 exon gene -Where is the polyA tail in the gene above? -Draw a 4 exon gene where exon 4 is all 3’UTR

Pyrimidines have the longer name and smaller basePurines have the shorter name and bigger base

Page 7: Standard 4 exon gene -Where is the polyA tail in the gene above? -Draw a 4 exon gene where exon 4 is all 3’UTR

QuickTime™ and a decompressor

are needed to see this picture.

Page 8: Standard 4 exon gene -Where is the polyA tail in the gene above? -Draw a 4 exon gene where exon 4 is all 3’UTR

Structure of aPolynucleotide

Chain

Why do weAlways talk aboutDNA going in the 5’ to 3’ direction?

Page 9: Standard 4 exon gene -Where is the polyA tail in the gene above? -Draw a 4 exon gene where exon 4 is all 3’UTR
Page 10: Standard 4 exon gene -Where is the polyA tail in the gene above? -Draw a 4 exon gene where exon 4 is all 3’UTR

Deoxyribonucleotides

What is dideoxyadenosine triphosphate (ddATP)?

Why are dideoxynucleotides useful in Mol.Bio.?


4: Genome evolution. Exon Shuffling 3 types of exon shuffling exon duplication = the duplication of one or more exons within a gene (internal duplication)

4: Genome evolution. Types of Genomic Duplications Part of an exon or the entire exon is duplicated Complete gene duplication Partial chromosome duplication

GENE Exon 1IntronExon 3IntronExon 4Exon 2Intron Promoter Enhancer mRNA transcript Exon 1IntronExon 3IntronExon 4Exon 2Intron 5’-untranslated region 5’3’

Genomica applicata - units.it...Genome sequencing showed that gene and exon density in the euchromatic regions can vary enormously. Some chromosomes are gene-rich, such as chromosomes

Disease-Specific Induced Pluripotent Stem Cells · Name Disease Molecular Defect Donor Cell Age Sex ADA ADA-SCID GGG >AGG, exon 7 and Del(GAAGA) exon 10, ADA gene Fibroblast 3 M

Dominant neurodegenerative disease Polyglutamine repeat expansions (CAG, codon, Q) in exon 1 of huntingtin gene (htt). Usually >35 CAG repeats

Genetic and Molecular อ.สู้3.1 x 109 bp In Mitochondria 16,569 bp Gene Coding Sequences (Exon) Non coding Sequences (Intron) Non-gene (Extragenetic) Repetitive DNA Tandem repeats

Exon Table

the Human Protein C Gene Associated With Venous Thrombosis ... fileSplice Site Mutation in the Human Protein C Gene Associated With Venous Thrombosis: Demonstration of Exon Skipping

Genetic Diseases3.1 x 109 bp In Mitochondria 16,569 bp Gene Coding Sequences (Exon) Non coding Sequences (Intron) Non-gene (Extragenetic) Repetitive DNA Tandem repeats (satellite,

Exon-intron structure and sequence variation of the ......RESEARCH Open Access Exon-intron structure and sequence variation of the calreticulin gene among Rhipicephalus sanguineus

Antisense Oligonucleotide-mediated Exon Skipping as a ... · tein.13 COL7A1 is a good candidate gene for AON-mediated exon skipping, as most RDEB-gen sev patients have small exonic

Modulating the exon 7 skipping or inclusion of SMN gene by pH

Expression a Maize Ubiquitin Gene Promoter-bar Chimeric ...first exon, and first intron of a maize ubiquitin gene (Ubi-1) and the coding sequence of the bar gene from Streptomyces

RFLP in exon 26 changes amino 3611 to Gin · ApoB gene Mspl RFLP in exon 26 changes amino acid 3611 from Arg to Gin Li-Shin Huang, Jacqueline de Graaf, and Jan L. Breslow Rockefeller

Exon sequencing of the gene encoding UCMA/GRP in healthy and clinical subjectsliu.diva-portal.org/smash/get/diva2:439228/FULLTEXT01.pdf · 2011-09-06 · Exon sequencing of the gene

Mouse Abcg2 Conditional Knockout Project (CRISPR/Cas9) · 2020. 12. 2. · Gene ID: 26357, updated on 24-Oct-2019 Gene summary Genomic context Exon count: 22 Annotation release Status

Exon Duplication and 5’ mutations in the DMD gene Nicolas Wein, PhD Flanigan Lab Center for Gene Therapy Nationwide Children’s Hospital Columbus, OH, USA

Bases genéticas y moleculares del síndrome de … · Bases genéticas y moleculares del síndrome de Brugada 297 Exon 28 Exon 9 ¿Mutación? Exon 28 Exon 28 Exon 9 V2 V2 Figura

Analysis of Affy 1.0 ST Gene Array Data in R To analyze Affymetrix 1.0 ST data (exon or gene) you need: Expression data in.CEL format A CDF (chip definition

2000 by Cell Press Piccolo, a Presynaptic Zinc Finger Protein ...Piccolo, a Presynaptic Zinc Finger Protein 205 Table 1. Exon–Intron Boundaries of Human PCLO Gene Exon Encoded Exon

University of Groningen Exon skipping therapy for dystrophic … · 2018. 4. 6. · Functional consequences of targeted exon deletion in the COL7A1 gene 51 3 Analysis of the functional

CircularRNAs from transcripts rat cytochrome P4502C24 gene ... · exon 1 FIG. 2. (a) Agarose gel electro-phoresis ofPCRamplification products using an exon 1 sense and an exon 9 exon5

Prevalence of Mutation in BRCA1 gene, exons-2, 3, 5, 11 ... · exon 20 . were 94% homologous with USA; (Gene Bank . exon 20 from ACCESSION Number DQ478408.1) (Table 2). D. ISCUSSION

Frequent Association of p53 Gene ... - Cancer Research · p53 gene mutations were investigated in exon regions 4 to 11. Twenty- four were transitional cell carcinomas, and the remaining

Gene and exon signatures as radiation biomarkers · • Samples from the same donor must be in the same partition ... Gene and exon signatures as classifiers Equal performance of

Tumor-speci c exon creation of the …ousar.lib.okayama-u.ac.jp/files/public/3/33002/...Tumor-speci c exon creation of the HELLS/SMARCA6 gene in non-small cell lung cancer Masaaki

GTCAGATGAGCAAAGTAGACACTCCAGTAACGCGGTGAGTACATTAA exon intron intergene Find Gene Structures in DNA Intergene State First Exon State Intron State

In-silico and In-vitro Analysis of Exon 18 of ASPM Gene and Its Importance in Determining Mammalian Brain Size

Mouse Cd44 Knockout Project (CRISPR/Cas9) · 2020. 12. 2. · Gene ID: 12505, updated on 10-Oct-2019 Gene summary Genomic context Exon count: 20 Annotation release Status Assembly

Analysis of the functional consequences of targeted exon ... · COL7A1 gene, no general conclusion of the aptitude of exon skipping for DEB can be drawn, since regulation of collagen

Detection of Three Novel Mutations in Exon 7 of FGFR3 Gene

Gene Level Expression Profiling Using Affymetrix Exon Arrays Alan Williams, Ph.D. Director Chip Design Affymetrix, Inc

channel gene cacophony disrupts locomotion in Drosophila larvae · RESEARCH ARTICLE Deletion of a specific exon in the voltage-gated calcium channel gene cacophony disrupts locomotion

Detection of Mutations in Exon 10 and 13 of ATP7B Gene … · 2017. 7. 30. · Supervisors Certification I, certify that this thesis entitled "Detection of Mutations in Exon 10 and