Journal of Cell Science, Supplement 19, 67-72 (1995)Printed in Great Britain © The Company of Biologists Limited 1995

67

Stepwise assembly of initiation complexes at budding yeast replication

origins during the cell cycle

John F. X. Diffley, Julie H. Cocker, Simon J. Dowell*, Janet Harwood and Adele Rowley*Imperial Cancer Research Fund, Clare Hall Laboratories, South Mimms, Hertfordshire, EN6 3LD, UK

'Present address: Glaxo-Wellcome Medicines Research Centre, Gunnels Wood Road, Stevenage, Hertfordshire SG1 2NY, UK

SUMMARY

DNA replication is a pivotal event in the cell cycle and, as a consequence, is tightly controlled in eukaryotic cells. The initiation of DNA replication is dependent upon the comple­tion of mitosis and upon the commitment to complete the cell cycle made during Gi. Characterisation of the protein factors required for initiating DNA replication is essential to understand how the cell cycle is regulated. Recent results indicate that initiation complexes assemble in multiple stages during the cell cycle. First, origins are bound by the multi­subunit origin recognition complex (ORC) which is essential for DNA replication in vivo. ORC, present at little more than one complete complex per replication origin, binds to origins immediately after initiation in the previous cell cycle. ORC binding occurs by the recognition of a bipartite sequence that includes the essential ARS consensus sequence (ACS) and the functionally important B1 element adjacent to the

ACS. A novel pre-replicative complex (pre-RC) assembles at origins at the end of mitosis in actively cycling cells and remains at origins until DNA replication initiates. Finally, Dbf4, which is periodically synthesised at the end of Gi, interacts with replication origins. Dbf4-origin interaction requires an intact ACS strongly suggesting that interaction occurs through ORC. Dbf4 interacts with and is required for the activation of the Cdc7 protein kinase and together, Dbf4 and Cdc7 are required for the Gi-S transition. Separate regions of Dbf4 are required for Cdc7- and origin-interac- tion suggesting that Dbf4 may act to recruit Cdc7 to repli­cation origins where phosphorylation of some key component may cause origin firing.

Key words: initiation complex, assembly, Saccharomyces cerevisiae, replication origin, cell cycle

INTRODUCTION

Eukaryotic genomes are often much larger than their prokary­otic counterparts. Moreover, genomic DNA is usually divided among multiple chromosomes. To deal with this, DNA repli­cation in eukaryotic cells initiates from large numbers of repli­cation origins during each S phase. Replication from these origins does not initiate synchronously at the beginning of S phase, but, instead, can initiate throughout S phase. Conse­quently, the co-ordination of replication origin function in eukaryotes poses a considerable problem; replication origins must be used efficiently in each S phase to ensure rapid and complete DNA replication, yet origins must never be reused in any S phase since this would lead to unbalanced DNA synthesis, abnormal DNA structures and alterations in gene dosage. Understanding this ‘once and only once’ mechanism for initiation on a molecular level represents an important goal in cell cycle study (reviewed by Rowley et al., 1994).

In Saccharomyces cerevisiae, specific, short DNA sequences known as autonomously replicating sequences (ARSs) serve as replication origins both genetically and bio­chemically. That is, ARSs are required for the initiation of DNA synthesis in vivo and DNA synthesis begins within these sequences. Analysis of the sequences required for origin function has revealed a common architecture to all budding

yeast origins. First, all ARSs contain an 11 bp A+T rich sequence, the ARS consensus sequence (ACS), that is essential for origin function. Second, this ACS is not sufficient for origin function; in all cases tested a flanking sequence 3' to the T-rich strand of the ACS is essential for origin function. Analysis of several origins has provided strong evidence that these flanking sequences are composed of multiple subdomains which are each important, but not essential, for origin function. The arrangement of sequence elements within one of the best studied yeast replication origins, ARS1, is shown in Fig. 1 (Marahrens and Stillman, 1992).

RESULTS

We have taken several approaches to characterise protein complexes at budding yeast replication origins in vivo.

Genomic footprinting: the origin recognition complex binds replication origins in vivoTo begin to understand DNA-protein interactions at replication origins, we have used the technique of genomic footprinting to achieve a nucleotide level resolution map of the regions of replication origins bound by proteins in chromatin. In this technique, cells are permeabilised and immediately treated

68 J. F. X. Diffley and others

TRP1 GAL3ACS

B3 — B2 B l A ChromosomeIV

A R S I

Fig. 1. Schematic view of ARS1. ARS 1 is found on chromosome IV between the TRP1 and GAL3 genes. Celniker et al. showed it to be composed of three domains designated A, B and C. Analysis from Marahrens and Stillman (1992) showed domain B to be composed of three subdomains designated B l, B2 and B3. The essential ARS consensus sequence lies within domain A. The other elements are non-essential but make significant contribution to origin function both on plasmids and in their normal chromosomal location (Marahrens and Stillman, 1994).

with nuclease. DNA is purified and the positions of cleavage sites is determined by prim er extension into the region of interest with an end-labelled oligonucleotide. The pattern of cleavage sites in chromatin can then be com pared to the pattern of nuclease cleavage sites in purified DNA. Initial experiments on unsynchronised cells revealed a num ber of interesting features (Diffley and Cocker, 1992). M ost importantly, it showed that the essential ACS was protected from nuclease cleavage in chromatin and that sequences adjacent to the ACS, especially within the B l element, were hypersensitive to cleavage by nuclease, indicating that it was bound by a novel cellular factor. Concomitantly, Bell and Stillman (1992) iden­tified a m ulti-subunit protein factor that interacted specifically with the ACS in vitro. Across the ACS (in domain A) and the B 1 element, our in vivo cleavage patterns were remarkably

sim ilar to their in vitro patterns suggesting that this origin recognition com plex (ORC) binds to replication origins in vivo (Fig. 2A). Together, our data argued that a factor critical for initiation o f replication had been identified.

Since our genomic footprints were perform ed on unsyn­chronised cells, the saturated footprint at the ACS suggested that ORC binding was not transient during the cell cycle. This is discussed in further detail below. Our experiments also provided evidence that the above-m entioned ABF1 protein was bound at the B3 element o f ARS1 in vivo. Furtherm ore, ARS1 is bounded by a tightly positioned nucleosom e on the domain B-distal side o f domain A. These experiments gave a view of initiation com plexes at a eukaryotic replication origin at nucleotide resolution (summarised in Fig. 2B).

Identification and characterisation of the RRR1/ORC2 gene: genetic evidence that ORC plays a role in DNA replication and transcriptional silencing in vivoAlthough the dem onstration that ORC required the essential ACS for ARS binding in vitro (Bell and Stillman, 1992) and appeared to be bound at replication origins in vivo (Diffley and Cocker, 1992) strongly suggested a role for ORC in replica­tion, genetic evidence was lacking. ORC is com posed of subunits o f 120, 72, 62, 56, 53 and 50 kDa. In collaboration with Gos M icklem and Kim Nasmyth, we isolated the gene, designated RRR1, which encodes the 72 kD a subunit o f ORC (ORC2) (M icklem et al., 1993). RRR1 is essential for prolifer­ation and rrr l mutants are unable to maintain an endogenous plasmid, the 2 micron circle and have aberrant cell cycle kinetics (M icklem et al., 1993). The same gene, designated

B3 B2

ABF1 illi4 i : i ;n W W

AATTTCGTCAAAAATGCTAAGAAATAGGTTATTACTGAGTAGTATTTATTTAAGTATTGTTTGTGCACTTGCCTGCAGGC TTAAAGCAGTTTTTACGATTCTTTATCCAATAATGACTCATCATAAATAAATTCATAACAAACACGTGAACGGACGTCCG

.. ™ tt tt ft t tABF1

USD

tt tt

t

ORC

Genomic

Genomic

ORC

B1

■U'eaj • ____________________________ ________CTTTTGAAAAGCAAGCATAAAAGATCTAAACATAAAATCTGTAAAATAACAAGATGTAAAGATAATGCTAAATCATTTGGGAAAACTTTTCGTTCGTATTTTCTAGATTTGTATTTTAGACATTTTATTGTTCTACATTTCTATTACGATTTAGTAAACC

t̂ E

ORC

Genomic

910Genomic

B

Fig. 2. Summary of in vitro and in vivo footprinting results.(A) Regions of protection from DNase 1 at ARS 1 are shown as boxes while hypersensitive sites are shown as arrows. Data from genomic footprints is taken from Diffley and Cocker (1992) (grey rectangles), data for in vitro ORC footprints is

0RC taken from Bell and Stillman(1992) (black rectangles) and data for in vitro ABF1 footprints is taken from Diffley

and Stillman (1988) (white rectangles). D N asel cleavage sites within the positioned nucleosome adjacent to domain A are indicated as black filled circles. The positions o f the individual ARS 1 sequence elements are indicated above the sequence. (B) Results of footprinting analysis suggest that ORC binds across the A and B 1 elements with the DNA in the B 1 element lying on the ORC protein surface while ABF1 binds to the B3 element. Weak protection at B2 suggests that it may also be bound by a protein in vivo. This figure is derived from Fig. 4 (Diffley and Cocker, 1992).

Stepwise assembly of initiation complexes 69

ORC2, was isolated in Jasper Rine’s laboratory (Bell et al., 1993; Foss et al., 1993). Together with Bruce Stillman and col­leagues, they showed that orc2 mutants were defective in maintaining plasmids and were unable to enter and complete S phase at the non-permissive temperature (Bell et al., 1993; Foss et al., 1993). Together our results indicated a crucial role for ORC2 in initiating DNA synthesis.

In addition to being defective in DNA replication, rrrl/orc2 mutants are also defective in transcriptional silencing of the HMR mating type locus (Foss et al., 1993; Micklem et al., 1993). In budding yeast two mating type loci, HML and HMR, are main­tained in a transcriptionally silent state by flanking sequences known as ‘silencers’. These silencers each contain an ACS and can act as replication origins on plasmids. Thus, the finding that rrrl/orc2 mutants are defective in silencing further supports an interesting link between origin function and silencing.

Biochemical characterisation of ORC: a protein present at low levels in vivo with complex sequence requirements for origin binding both in vitro and in vivoThe inability to detect ORC DNA binding activity in crude yeast extracts (Bell and Stillman, 1992, and data not shown) together with the generally low yields from ORC protein purifi­cations led us to examine the amount of ORC per cell. The availability of the cloned RRR1/ORC2 gene allowed us to express the ORC2 subunit in Escherichia coli and generate polyclonal antisera to the purified subunit. From quantitative immunoblots on whole cell extracts we estimate that logarith­mically growing haploid yeast cells contain only approxi­mately 600 molecules of the ORC2 subunit (Rowley et al., 1995), which appears to be directly involved in origin recog­nition (Bell and Stillman, 1992) and ORC integrity (Bell et al.,1993). Previously it has been estimated that there are approx­imately 350-470 origins per haploid genome. Assuming haploid cells spend approximately half their time with a 2C DNA content (i.e. G2 and M phases), the average number of origins per cell in an asynchronous population is approxi­mately 525-705. Thus, ORC is present at levels of approxi­mately one complex per replication origin.

The low abundance of ORC in vivo together with the fact that ORC binds origins almost immediately after initiation and remains bound throughout the cell cycle (see below) suggested that the mechanism by which ORC locates and binds to repli­cation origins would be interesting. We have purified ORC to apparent homogeneity and begun to characterise its require­ments for DNA binding. It had previously been shown that ORC requires ATP and an intact ACS for efficient ORC binding (Bell and Stillman, 1992) and our results were consis­tent with this. Importantly, we also found that mutations in the B l element of ARS1 reduced ORC binding efficiency 5- to 10- fold in vitro. This B 1 effect was dependent upon the presence of a non-specific competitor DNA in the binding reaction. Fur­thermore, genomic footprinting experiments demonstrated that ORC requires both the ACS and the B 1 element for efficient binding in vivo indicating that the B l element appears to act in vivo to increase the affinity of ORC for replication origins.

Cell cycle regulation of protein-origin complexes: identification of a novel G1 origin binding factorAs described above, the fact that the ORC footprint was

detectable at replication origins from asynchronous popula­tions of cells suggested that its binding was not transient during the cell cycle. Therefore, interactions of other proteins with origins might play important roles in the cell cycle regulation of replication. To address this, we undertook an extensive analysis of complexes at replication origins through the cell cycle by genomic footprinting.

Consistent with our experiments on unsynchronised cells, we found that the ACS remains protected from nuclease digestion throughout the cell cycle, suggesting that ORC is bound during the entire cell cycle. Post-replicative origin complexes, which appear shortly after DNA replication initiates in S phase and are present through S, G2 and M phases, are nearly indistinguishable from complexes generated in vitro with purified ORC and ABF1. These results indicate that ORC and ABF1 rebind to replication origins very quickly after repli­cation initiates. Furthermore, these results argue strongly that the binding of ORC and ABF1 to origins is not sufficient to drive initiation.

In rapidly cycling cells, origin chromatin undergoes a change at the end of mitosis consistent with the binding of an additional factor. This ‘pre-replicative complex’ (pre-RC) remains at origins until DNA replication initiates, after which origins return to the post-replicative state described above. When cells enter stationary phase from Gi, they lose the pre- RC. Stationary phase origin complexes are indistinguishable from post-replicative origins at the level of genomic footprint­ing. Thus, ORC and ABF1 remain stably bound to origins during long periods of quiescence while the pre-RC is quickly lost.

The G1 -S transition: Dbf4, the regulatory subunit of the Cdc7 protein kinase, interacts with replication origins through ORCIn an attempt to identify other gene products that interact with yeast replication origins, we developed a ‘one hybrid’ genetic screen (Fig. 3). In this screen, an intact and functional replica­tion origin was placed upstream of the lacZ reporter gene. By itself, this sequence does not activate transcription in budding yeast (Buchman and Kornberg, 1990). We reasoned that proteins interacting with replication origins either directly, such as ORC and ABF1, or indirectly might activate tran­scription from this reporter gene when fused to the strong tran­scriptional activation domain from the GAL4 protein (GAD).

Using this approach to screen libraries of budding yeast cDNA-GAD fusions, we isolated five clones that induced sig­nificant levels of (3-galactosidase activity from reporters con­taining ARS1 upstream of the lacZ gene but little or no (3- galactosidase activity from reporters without a replication origin upstream of lacZ. All of the positive clones contained overlapping regions of the previously identified DBF4 gene (Dowell et al., 1994). DBF4, originally isolated in Lee Johnston’s lab, is specifically required at the end of Gi for the initiation of DNA synthesis. The product of another gene, CDC7, which encodes a protein kinase, is also required at this point. The Cdc7 protein is present throughout the cell cycle, but the Cdc7-associated kinase activity peaks at the Gi-S tran­sition. Dbf4 appears to play a critical role in the activation of the Cdc7 kinase: Cdc7 kinase activity is reduced in dbf4 mutants (Jackson et al., 1993), Cdc7 and Dbf4 physically interact in vivo (Dowell et al., 1994; Jackson et al., 1993;

70 J. F. X. Diffley and others

lacZ

~¥i— 1

CSt7C'' r*-W M --------------

Fig. 3. A one-hybrid approach to identify origin-interacting gene products. Gene products that interact either directly (shown in white) or indirectly (shown in grey) with either the A or B elements of ARS1 are expected to activate transcription from the adjacent lacZ gene when they are fused to the transcriptional activation domain of GAL4 (GAD). Colonies o f cells harbouring such fusions are expected to turn blue in qualitative (3-galactosidase assays using X- gal. Adapted from Fig. 1 of Dowell et al. (1994).

Kitada et al., 1992, and S. Dowell and J. Diffley, unpublished data); and DBF4 is specifically transcribed in late Gi at approx­imately the tim e that Cdc7 kinase becomes activated (Chapman and Johnston, 1989). The finding that Dbf4 interacts with DNA replication initiation com plexes suggested that Dbf4 might act to recruit the Cdc7 protein kinase to initiation complexes. Alternatively, Dbf4 might interact with initiation com plexes through Cdc7. To distinguish between these possibilities, we assayed a series o f Dbf4 deletions for their ability to interact with ARS1 in a one-hybrid assay and with Cdc7 in a two- hybrid assay (Fig. 4). This experim ent indicated that the origin- interaction dom ain of Dbf4 maps to the am ino term inus while the Cdc7-interaction domain mapped to the middle of the protein. That is, the origin- and Cdc7-interaction domains are separable and, therefore, Dbf4 does not interact with initiation com plexes through Cdc7.

DISCUSSION

The results summ arised in this paper have led to the model shown in Fig. 5 in which initiation com plexes assemble at yeast replication origins in several discrete stages. ORC rebinds replication origins shortly after initiation and remains bound at replication origins throughout the cell cycle and during long periods o f quiescence. That ORC is bound post-replicatively indicates that ORC binding is not sufficient to drive the

Fig. 4. Effect of Dbf4 deletions on ARS1 and Cdc7 interactions. Full length (FL) Dbf4 and a series o f Dbf4 deletions were fused to the GAL4 transcriptional activation domain and tested for ARS 1 interaction in the one-hybrid assay described above. Black bars indicate the region of Dbf4 present in the fusions. The same deletions were fused to the Lex A DNA binding domain and tested for their interaction with full length Cdc7 fused to the GAL4 transcriptional activation domain in a two-hybrid assay. All of the Dbf4 deletion constructs were also tested for their ability to complement the dbf4-2 mutation. Adapted from Fig. 4 of Dowell et al. (1994).

initiation of replication. However, the fact that the ACS is essential for DNA replication together with genetic results with the RRR1/ORC2 gene described above indicate that ORC is necessary for initiation.

It is upon a ‘scaffold’ o f ORC that additional com ponents of initiation com plexes assem ble during the cell cycle. A t the end of mitosis, origin chromatin is converted to the pre-replica- tive state or com plex (pre-RC). Results discussed here and data not shown suggest that, in the pre-RC, an additional protein com plex binds across the ACS and the ACS-flanking sequence which includes domains B l and B2 at ARS1 consistent with the hypothesis that the pre-RC contains ORC and a novel G i- specific protein. Candidates for com ponents o f this G i-specific protein include the M em proteins and the Cdc6 protein. The M em proteins have been genetically im plicated in the initiation o f DNA synthesis (Tye, 1994). Furtherm ore, three family mem bers (Cdc46/M cm 5, M cm2 and M cm3) enter the nucleus at the end o f mitosis - approxim ately the same time that the pre-RC forms - and disappear from the nucleus upon entry into S phase- the tim e of disappearence o f the pre-RC. The Cdc6 protein has also been im plicated in origin function in budding yeast (reviewed by Bell, 1995) and Cdc6 mutants blocked at the non-perm issive tem perature do not contain pre-RCs (Diffley et al., 1994). The role o f these proteins in the pre-RC is currently under investigation.

The pre-RC appears at the end o f mitosis at the time that the mitotic form of the Cdc28 protein kinase is destroyed (Surana et al., 1993). Several lines o f evidence from the fission yeast Schizosaccharomyces pom be indicate that it is inactivation of the m itotic form of the p34cdc2 kinase and not m itosis itself that is critical for resetting nuclei for another round o f replication. First, transient inactivation of cdc2+ kinase promotes diploidi- sation (Broek et al., 1991). Second, overexpression of a cdk inhibitor, ru m l+, drives m ultiple rounds of re-replication (M oreno and Nurse, 1994). And finally, deletion of c d c l3 +, the single B-type cyclin required for mitosis (Hayles et al., 1994),

• CLN Synthesis —̂

• CDC28 Kinase A ctivation

START

DBF4Synthesis

CLB5, 6 Synthesis

Fig. 5. Summary of interactions at yeast replication origins in vivo. Details of the model are described in the text.

also drives m ultiple rounds o f re-replication. It is tempting to speculate that inactivation of the mitotic cdc2+/Cdc28 kinase directly promotes pre-RC formation. In this regard, it is inter­esting that a B-type cyclin is also required for entry into S phase (Schwob et al., 1994) suggesting that the very conditions required to activate DNA replication may also block the form ation of new pre-RCs and thus prevent re-replication in a single cell cycle. The ability to directly examine the pre-RC at origins together with the ability to m anipulate levels o f B cyclin-Cdc28 kinase activity in vivo should allow examination o f this hypothesis.

The product o f the CDC14 gene may also play a key role in assembly o f the pre-RC. cd c l4 mutants block at the end of m itosis before the pre-RC forms (Diffley et al., 1994). Both c d c l4 and cdc6 m utants exhibit an elevated rate of plasm id loss in vivo. This loss is primarily 1:0 loss suggesting a defect in DNA replication rather than chrom osom e segregation. Fur­therm ore, this high plasmid loss rate can be suppressed by inclusion of m ultiple replication origins on the plasm id sug­gesting that these mutants may have a defect specifically in the initiation of replication. W hy c d c l4 mutants block in mitosis and not S phase while cdc6 mutants arrest prior to entering S phase (Bueno and Russell, 1992) is unclear and may suggest a second essential function for C d c l4 in mitosis.

The pre-RC is lost rapidly when cells enter quiescence (Diffley et al., 1994). W hether this loss o f the pre-RC is simply a consequence o f degradation of inherently unstable protein com ponents, decay of an unstable post-translational modifica­

tion state or is due to a more active mechanism is unknown. Cells re-entering the cell cycle from quiescence form the pre- RC before DNA synthesis (data not shown) dem onstrating that the resetting of replication origins can occur at tim es other than the end of mitosis.

The products o f the CDC7 and D BF4 genes are required at the end of Gi for entry into S phase. Cells blocked at the end o f G i by raising a cdc7ts m utant to the restrictive tem perature can com plete S phase in the presence of cyclohexim ide indi­cating that new protein synthesis is not required after this point for DNA replication. Thus, the finding that Dbf4, w hich interacts with and positively regulates Cdc7 protein kinase activity, also interacts directly w ith initiation com plexes suggests strongly that Cdc7 also acts directly at initiation com plexes to trigger initiation. The identification of the direct target o f Dbf4 interaction as well as the target o f Cdc7 phos­phorylation represent im portant challenges for the near future.

However, the activation of DNA synthesis is not likely to be controlled entirely by Dbf4 synthesis and activation o f the Cdc7 kinase for two reasons. First, Sclafani and co-workers have isolated a mutant ib o b l) that bypasses the requirem ent for both Dbf4 and Cdc7 (Jackson et al., 1993). W hile the nature o f the b o b l mutation is still unclear, its existence suggests that there might be a second pathway also required for initiating DNA synthesis. And second, as described above, at least one B cyclin is required for S phase entry from Gi (Schwob et al.,1994). Thus there are at least two START-dependent kinases

72 J. F. X. Diffley and others

required to initiate DNA synthesis. Whether these kinases operate in the same or parallel pathways is currently unknown.

Together, the results described in this paper and the model presented suggest that DNA replication is regulated at least in part by co-ordinating the assembly of initiation complexes with major cell cycle events such as the completion of mitosis and START.

REFERENCES

Bell, S. P. and Stillman, B. (1992). Nucleotide dependent recognition of chromosomal origins of DNA replication by a multi-protein complex. Nature 357, 128-134.

Bell, S. P., Kobayashi, R. and Stillman, B. (1993). Yeast origin recognition complex functions in transcription silencing and DNA replication. Science 262, 1844-1849.

Bell, S. P. (1995). Eukaryotic replicators and associated protein complexes. Curr. Opin. Genet. Dev. 5, 162-167.

Broek, D., Bartlett, R., Crawford, K. and Nurse, P. (1991). Involvement of p34cdc2 in establishing the dependency of S phase on mitosis. Nature 349, 388-393.

Buchman, A. R. and Kornberg, R. D. (1990). A yeast ARS-binding protein activates transcription synergistically in combination with other weak activating factors. Mol. Cell. Biol. 10, 887-897.

Bueno, A. and Russell, P . (1992). Dual functions of Cdc6 - a yeast protein required for DNA replication also inhibits nuclear division. EMBO J. 11, 2167-2176.

Celniker, S. E., Sweder, K., Srienc, F., Bailey, J. E. and Campbell, J. L.(1984). Deletion mutations affecting autonomously replicating sequence AES1 of Saccharomyces cerevisiae. Mol. Cell. Biol. 4 ,2455-2466.

Chapman, J. W . and Johnston, L. H. (1989). The yeast gene, DBF4, essential for entry into S phase is cell cycle regulated. Exp. Cell. Res. 180 ,419-428.

Diffley, J. F. X. and Stillman, B. (1988). Purification o f a yeast protein that binds to origins of DNA replication and a transcriptional silencer. Proc. Nat. Acad. Sci. USA 85, 2120-2124.

Diffley, J. F. X. and Cocker, J. H. (1992). Protein-DNA interactions at a yeast replication origin. Nature 357, 169-172.

Diffley, J. F. X., Cocker, J. H., Dowell, S. J. and Rowley, A. (1994). Two

steps in the assembly o f complexes at yeast replication origins in vivo. Cell 78, 303-316.

Dowell, S. J., Romanowski, P. and Diffley, J. F. X . (1994). Interaction of Dbf4, the Cdc7 protein kinase regulatory subunit, with yeast replication origins in vivo. Science 265, 1243-1246.

Foss, M., M cNally, F. J., Laurenson, P. and Rine, J. (1993). Origin recognition complex (ORC) in transcriptional silencing and DNA replication in S. cerevisiae. Science 262, 1838-1844.

Hayles, J., Fisher, D., Woollard, A. and Nurse, P. (1994). Temporal order of S phase and mitosis in fission yeast is determined by the state o f the p34cdc2- mitotic B cyclin complex. Cell 78, 813-22.

Jackson, A. L., Pahl, P. M., Harrison, K., Rosamond, J. and Sclafani, R. A. (1993). Cell cycle regulation of the yeast CDC7 protein kinase by association with the DBF4 protein. Mol. Cell. Biol. 1 3 ,2899-2908.

Kitada, K., Johnston, L. H., Sugino, T. and Sugino, A. (1992). Temperature- sensitive cdc7 mutations of Saccharomyces cerevisiae are suppressed by the DBF4 gene, which is required for the G l/S cell cycle transition. Genetics 131,21-9.

M arahrens, Y. and Stillman, B. (1992). A yeast chromosomal origin o f DNA replication defined by multiple functional elements. Science 255, 817-823.

M arahrens, Y. and Stillman, B. (1994). Replicator dominance in a eukaryotic chromosome. EM BO J. 13, 3395-3400.

M icklem, G ., Rowley, A., Harwood, J., Nasmyth, K. and Diffley, J. F. X. (1993). Yeast origin recognition complex is involved in DNA replication and transcriptional silencing. Nature 366, 87-89.

M oreno, S. and Nurse, P. (1994). Regulation o f progression through the GI phase of the cell-cycle by the rum l(+) gene. Nature 367, 236-242.

Rowley, A., Dowell, S. J. and Diffley, J. F. X. (1994). Recent developments in the initiation of chromosomal DNA replication: a complex picture emerges. Biochim. Biophys. Acta 1217, 239-256.

Rowley, A., Cocker, J. H., Harwood, J. and Diffley, J. F. X. (1995). Initiation complex assembly at budding yeast replication origins begins with the recognition of a bipartite sequence by limiting amounts of the initiator, ORC. EM BO J. 14,2631-2641.

Schwob, E., Bohm, T., M endenhall, M. D. and Nasmyth, K. (1994). The B- type cyclin kinase inhibitor p40SIC l controls the G i to S transition in S. cerevisiae. Cell 79, 233-44.

Surana, U., Am on, A., Dowzer, C., McGrew, J., Byers, B. and Nasmyth, K. (1993). Destruction of the CDC28/CLB mitotic kinase is not required for the metaphase to anaphase transition in budding yeast. E M BO J. 12, 1969-1978.

Tye, B.-K. (1994). The MCM2-3-5 proteins: are they replication licensing factors? Trends Cell Biol. 4, 160-166.