studies on genetic transformation of black gram (vigna mungo l.)
TRANSCRIPT
STUDIES ON GENETIC TRANSFORMATION OF BLACK GRAM (VIGNA MUNGO L.) WITH COLD
INDUCED TRANSCRIPTOME GENE (ICE- 1) FOR ABIOTIC STRESS TOLERANCE
A
THESIS SUBMITTED TO THE ORISSA UNIVERSITY OF AGRICULTURE AND TECHNOLOGY,
BHUBANESWAR, ODISHA
IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE DEGREE OF
MASTER OF SCIENCE IN AGRICULTURE (BIOTECHNOLOGY)
By
KUMARA SWAMY R.V
DEPARTMENT OF AGRICULTURAL BIOTECHNOLOGY COLLEGE OF AGRICULTURE
ORISSA UNIVERSITY OF AGRICULTURE & TECHNOLOGY BHUBANESWAR, ODISHA
2013
THESIS ADVISOR: DR. K. C.SAMAL
id1989667 pdfMachine by Broadgun Software - a great PDF writer! - a great PDF creator! - http://www.pdfmachine.com http://www.broadgun.com
CERTIFICATE - I
This is to certify that the thesis entitled �STUDIES ON
GENETIC TRANSFORMATION OF BLACK GRAM (VIGNA
MUNGO L.) WITH COLD INDUCED TRANSCRIPTOME GENE
(ICE- 1) FOR ABIOTIC STRESS TOLERANCE� submitted in partial
fulfillment of the requirement for the award of the Degree of �MASTER
OF SCIENCE IN AGRICULTURAL BIOTECHNOLOGY� to the
Orissa University of Agriculture & Technology, Bhubaneswar is a record
of bona fide research work carried out by KUMARA SWAMY R.V.
(Adm.No.08ABT/11) under my guidance and supervision. No part of the
thesis has been submitted elsewhere for any degree or diploma or
published in any other form. All sorts of help and sources of information
availed during this investigation have been duly acknowledged.
(K.C. SAMAL)
Place: Bhubaneswar Chairman Date: Advisory Committee
Dr. K.C. SAMAL, Ph.D.
Associate Professor
Department of Agricultural Biotechnology,
College of Agriculture,
Orissa University of Agriculture & Technology,
Bhubaneswar- 751 003.
E-mail: [email protected]
CERTIFICATE � II
This is to certifying that the thesis entitled �Studies on genetic
transformation of black gram (Vigna mungo L.) With cold induced
transcriptome gene (ICE- 1) for abiotic stress tolerance� submitted by
KUMARA SWAMY R.V (Adm.No.08ABT/11) to the Orissa University
of Agriculture & Technology, Bhubaneswar�751003 in partial fulfillment
of the degree of �MASTER OF SCIENCE IN AGRICULTURAL
BIOTECHNOLOGY� has been approved by the student�s advisory
committee after oral examination in collaboration with external examiner.
ADVISORY COMMITTEE:
CHAIRMAN: Dr. K.C. Samal
Associate Professor Department of Agricultural Biotechnology College of Agriculture OUAT, Bhubaneswar _________________
MEMBERS:
Prof. G.R. Rout Professor and Head Department of Agricultural Biotechnology College of Agriculture OUAT, Bhubaneswar __________________
Prof. M. Kar Vice- chancellor OUAT, Bhubaneswar.
EXTERNAL EXAMINER: ____________________
ACKNOWLEDGEMENT
As a pretty long and eventful journey of my life is nearing an end, it is the right moment to extol my profound gratitude to the virtues of those who have directly or indirectly helped me during the tenure of this work. At this moment of accomplishment, my heart is overwhelmed with gratitude and I wish if these words could convey the subtle feelings.
I express my sincere gratitude to Prof. M. Kar, Vice-Chancellor and my advisor for their valuable advice and necessary suggestions during my work.
I am ineffable in expressing my heartfelt gratitude and indebtedness to the chairman of my advisory committee, Dr. K.C Samal, Associate Professor, Department of Agricultural Biotechnology, College of Agriculture, OUAT, Bhubaneswar, for his sweet gentility pulsated with undiminished enthusiastic support, inspiring guidance, constant supervision and encouragement throughout the course of my research period and teaching me how to be cool and patient in adverse situations.
I thank with great honour and reverential gratitude to Prof. G. R. Rout, Professor and Head, Department of Agricultural Biotechnology, College of Agriculture, OUAT, Bhubaneswar for his valuable advice, moral support, constructive criticism, relevant suggestion and facilities provided during the course of this investigation.
I also owe my deep sense of gratitude and sincere thanks to Dr. A.B. Das, Associate Professor and I.C Mohanty Assistant Professor, Department of Agricultural Biotechnology for their timely advice, valuable suggestions and help at the time of need.
I thank with heartfelt gratitude and indebtedness to my great teachers who make my strengthen Dr. R.L Ravi Kumar, Professor, UAS(B), Dr. P.H. H. Ramanjini Gowda ,Professor, UAS(B), Dr.Mallikarjuna Gowda, Associate Professor UHS(B) and Dr.M.A. Shankar, Dean Director of Research, University of Agricultural Sciences, Bengaluru.
I would especially like to express my heartful gratitude to Prof. Lingaraj Sahaoo Dept. Biotechnology, Indian Institute of Technology, Guwahati, for providing gene construct as well as constant inspiration. I would also like to express my sincere thanks and gratitude to Department Seed Sciences for providing quality seed materials for my research work.
I also avail this opportunity to express my sincere gratefulness to my beloved seniors Mrs. Subhadra, Ms. Netravati ,Mr. Sairam, Mr. Anupam, Ms. Dipti, Mr. Pardip, Mr. Ravimdra, Ms. Divya, Mr.Yogesh, Ms. Seema, Ms. Bhanupriy, Mr. Pravin, Ms.
Sunanda, Ms. priyadharshini, Ms. Amrita, and Mr. Rahul for their prompt help and cooperation for the entire period of study.
Words fail to express my indebtedness with veneration and devotion to my friends Kundansingh, Ratanpal, Shyam, Shantosh, Shital, Ranjeev, Krishna and Ashuthosh who helped me in several ways for the completion of this venture. Due to their kind co-operation and friendly nature, I couldn�t recognise how the time passed away.
I also like to thank my juniors Kirath singh, Sachin, Navanath, Nihar, Dhamadri, and, Pallavi and Rinny for their help.
I am in dearth of words to thank my best friends Akash D., Raghu R , Rajani H.G., Rashmi H.P., Pramod, Prasanna, Prabhu, Sukruth and Vinyaraj who stood by me during all the hard times.
I wish to extend my sincere thanks Amiya, Preedip.M, Preedip B., Naik babu and saria for the help and assistance.
The financial assistance in form of DBT fellowship from the Department of Biotechnology, Ministry of Science and Technology, Government of India is greatly acknowledged.
I wish to extend my sincere gratitude to Mr. Atratran Kar, for his kind co-operation neat & clean editing and formatting of manuscript.
Above all, I am forever beholden to my loving parents, Vishwanath and Pramila B.S, Brother Chandan R.V and family members for their constant prayers, affection, moral support, personal sacrifice and sincere encouragement throughout the period of my studies.
Finally I bow to the lotus feet of Kalikamba Devi whose grace had endowed me the inner strength, patience, will power and health to complete this endeavour successfully.
A word of apology to those I have not mentioned in person and a note of thanks to one and all who worked for the successful completion of this endeavour.
Date: Place: Bhubaneswar (Kumara Swamy R.V.)
Name of student : KUMARA SWAMY R.V Admission No. : 08ABT/11 Title of the thesis : Studies on genetic transformation of black gram
(Vigna mungo L.) with cold induced transcriptome gene (ICE- 1) for abiotic stress tolerance
Degree for which thesis : M.Sc. (Agri.) Biotechnology is submitted Name of department : Department of Agri. Biotechnology, College of
Agriculture Orissa University of Agriculture & Technology Bhubaneswar, Odisha.
Year of submission : 2013 Name of the advisor : Dr. KAILASH CHANDRA SAMAL Associate professor, Dep. of Agri. Biotechnology, CA, OUAT, Bhubaneswar
ABSTRACT
Black gram (Vigna mungo L. Hepper, syn. Phaseolus mungo L.) is one of the
most important pulse crops grown in India. It belongs to the family Fabaceae. It is a
day neutral, warm season, annual legume crop commonly grown in semi-arid to sub-
humid low land tropics and sub-tropics. It is originated in India and has been
cultivated from ancient times. India is the largest producer and consumer of black
gram in the world. The production and productivity of black gram is severely
affected by number of biotic and abiotic stresses. Low temperature seriously
affects the productivity and production of black gram in the Northern and
Eastern parts of India. Classical breeding for tolerance to low temperature have
achieved limited success due to the absence of adequate and satisfactory level of
genetic variability within the available germplasm and genes conferring resistance to
biotic and abiotic stress are mostly available in many wild relatives. But these genes
can be successfully transferred to cultivated crop like black gram, employing
biotechnological tools. ICE1 gene, one of the potential genes conferring resistance to
abiotic stress, has been identified and isolated from Arabidopsis. It is an upstream
transcription factor and a positive regulator of CBF-3 which plays a critical
role in cold tolerance in Arabidopsis. The present study was under taken to
introduce cold tolerance in the popular cultivar of Blackgram �T-9�. For this
purpose, an efficient in-vitro regeneration and transformation protocol was first
standardized. Callus was induced from leaf as well as shoot tip explants on MS
medium supplemented with 3 mg/l 2.4.D, 1mg/l Kinetin and 0.2% cocoanut water.
In spite of several combinations of Phytohormones, vitamins and other organic
compounds in MS medium, organogenesis from callus was not achieved. Direct
regeneration through multiple shoot induction was achieved using cotyledonary
node and shoot tip as explants. Multiple shoots were induced on MS medium
supplemented with 3.0 mg/l BAP and 0.05mg/l IBA. MS medium supplemented
with TDZ (0.1mg/l) and IBA (0.05mg/l) also induced better multiple shoot
induction. Multiple shoots were subcultured on the shoot elongation MS medium
fortified with 1.0 mg/l GA3. The best rooting from multiple shoots were achieved
on MS medium fortified with 0.5 mg/l NAA as well as 0.25 mg/l NAA. The genetic
transformation through co-cultivation has been established by using cotyledonary
node explants inoculated with EHA-105 Agrobacterium strain harbouring a binary
vector pCAMBIA2301 containing Neomycin phosphotransferase (nptII) gene as
selectable marker, ß-glucuronidase (GUS) as a reporter gene and ICE-1gene.
Important parameters like optical density, pre-culture period and co-cultivation time
were standardized to maximize the transformation frequency. Optical density of 0.6
at 600nm, co-cultivation period of 3 days (72 hours) and Pre-culture period of 4
days (96 hours) were found suitable for optimum transformation and better survival
frequency. Lethal dose of Kanamycin was found to be 80 mg/l which inhibits the
growth and proliferation of untransformed/ control plants. Transformation
efficiency on the basis of Kanamycin selection was found to be 9.23%. Transient
GUS expression percentage was observed about 95% in transformed shoots after
screening on selection medium containing antibiotics. Transformed plantlets were
hardened in the greenhouse in pots containing soil: sand: vermicompost (1:1:1).
Based on PCR analysis with nptII primer transformation efficiency was found to be
about 1.53%.
CONTENTS
CHAPTER PARTICULARS PAGE
I INTRODUCTION 1-9
II REVIEW OF LITERATURE 10-62
III MATERIALS AND METHODS 63-79
IV EXPERIMANTL RESULT 80-103
V DISCUSSION 104-111
VI SUMMARY AND CONCLUSION 112-114
BIBLIOGRAPHY i-xliii
APPENDIX xliv-liii
LIST OF TABLES
TABLE TITLE PAGE
1 Taxonomic classification of Black gram 1
2 Nutrition composition of black gram 5
3 Area, Production and Productivity of Blackgram in Major States (2011-12)
7
4 ICE1-CBF/DREB1-dependent signalling components conferring plant cold tolerance
24
5 Amount of stock solutions added to the media 70
6 PCR reaction mixture 77
7 PCR conditions followed 77
8 cDNA sequence (5�-3�) of ICE1 gene (2559 b) 79
9 Effect of surface sterilants on the aseptic culture and survival of explant
81
10 Effect of plant growth regulators (PGR) on callus induction of black gram cultivar �T-9�
82
11 Effect of plant growth regulators on shoot multiplication from shoot tip and cotyledon node
85
12 Effect of plant growth regulators on shoot elongation of multiple shoots
89
13 Effect of plant growth regulators on rooting of multiple shoots
91
14 Detection of lethal concentration of Kanamycin for selection medium
94
15 Effect of pre-culture period on co-cultivation 95
16 Effect of Duration on co-cultivation 96
17 Determine the sensitivity of Agrobacterium to various level of cefotaxime
98
18 Transient GUS expression percentage 101
19 Transformation efficiency based on kanamycin selection and PCR analysis
101
LIST OF PLATES
PLATE TITLE PAGE
1 Botanical description of black gram 3
2 Explant source for regeneration and transformation 65
3 Effect of plant growth regulator on callus induction from leaf explant
84
4 Effect of plant growth regulator on callus induction from shoot tip explant
84
5 Effect of plant growth regulators on shoot multiplication from shoot tip and cotyledon node
87
6 Effect of plant growth regulators shoot elongation of multiple shoots
90
7 Effect of plant growth regulators on rooting of multiple shoots
90
8 Hardening of plantlets 93
9 Determination of Kanamycin sensitivity 100
10 Kanamycin based selection transformants 100
11 GUS histochemical assay 102
12 PCR analysis of Putative transformants using nptII as Primer
103
LIST OF FIGURS
FIGURE TITLE PAGE
1 Scheme illustrating the molecular response of plants to low-temperature stress
20
2 The CBF (C-repeat-binding factor) pathway in plants. 22
3 Schematic map of vector pCAMBIA2301 66
4 Linear map of T-DNA region of vector pCAMBIA2301
66
5 Effect of plant growth regulator on callus induction of the black gram cultivar T-9
88
6. Effect plant growth regulator on shoot multiplication from shoot tip and cotyledon node
88
7. Effect of plant growth regulator on shoot elongation of multiple shoot
92
8. Effect of plant growth regulator on rooting of multiple shoot
92
9 Effect of pre-culture period on co-cultivation 97
10. Effect of duration on co-cultivation 97
ABBREVIATION
BAP : Benzylamino purine CaMV : Cauliflower Mosaic Virus cDNA : Complementary deoxyribonucleic acid cm : centimetre cv. : Cultivar DMSO : Dimethylsulphoxide DREB : Drought responsive binding element EDTA : Ethylene diamine tetra acetic acid Fig. : Figure g : Gram GFP : Green Fluorescent Protein GUS : â-glucuronidase ha : Hectare HCl : Hydrochloric acid h : Hours hpt : Hygromycin phosphotransferase IAA : Indole-3-acetic acid IBA : Indole-3- butyric acid Kn : Kinetin l : Litre LB : Luria Bertani Luc : Luciferase M : Molar mg : Milligram min. : Minute ml : Millilitre MS : Murashige and Skoog medium M.W. : Molecular weight mg/l : Milligram per Litre N : Normal NAA : á-Naphthalene acetic acid NaOH : Sodium hydroxide Npt : Neomycin phosphotransferase nm : Nanometre OD : Optical density PCR : Polymerase chain reaction rpm : Revolution per minute TE : Tris-EDTA TDZ : Thidiazuron T : Treatment pH : Hydrogen ion concentration µM : Micro molar µg : Microgram 2,4-D : 2,4-Dichlorophenoxy acetic acid
1
INTRODUCTION
Black gram (Vigna mungo L. Hepper) (2n-22) is popularly known as
Urad in Hindi, Biri in Odia and Uddu in Kannada. It belongs to the Family
Fabaceae. It is the third most important pulse crop in India after chickpea and
pigeon pea and grown mostly as a fallow crop in rotation with cereals. Its
reference that has also been found in Vedic texts such as Kautilya�s �Arthasasthra�
and in �Charak Samhita� lends support to the presumption of its origin in India.
India is the largest producer and consumer of black gram in the world.
1.1 TAXONOMICAL CLASSIFICATION OF BLACK GRAM
Black gram belongs to the sub-genus Ceratotropis of the genus Vigna.
The genus �Vigna�, together with the closely related genus Phaseolus, forms a
complex taxonomic group, called Phaseolus-Vigna complex. Verdcourt (1970).
Two botanical varieties have been recognized in V.mungo. V.mungo var.
mungo is the cultivated form of black gram and V.mungo var.silvestris is the
wild ancestral form of black gram.They are diploid in nature with 2n=2x=22.
Blackgram have small genome sizes estimated to574 Million Base pairs (Mbp).
Table.1 Taxonomic classification of Black gram
Kingdom Plantae Subkingdom Tracheobionta Super division Spermatophyta Division Magnoliophyta Class Magnoliopsida Subclass Rosidae Order Fabales Family Fabaceae Genus Vigna Species Mungo
id2005860 pdfMachine by Broadgun Software - a great PDF writer! - a great PDF creator! - http://www.pdfmachine.com http://www.broadgun.com
2
1.2 BOTANICAL DESCRIPTION
Black gram is an erect or sub-erect herb, 0.5-1.3m tall with stem lightly
ridged, covered with brown hairs and much branches from the base. The leaves
are large, trifoliate and are also hairy, generally with a purplish tinge. Flower is
pale yellow. The seed colour exhibits a wide range of variations from yellow,
greenish yellow, light green, shiny green, dark green, dull green, black, brown,
and green mottled with black. Pod colour is either black or brown or pale gray
when mature and 100 seeds weight is 3-7g.
1.3 GEOGRAPHICAL DISTRIBUTION
It is widely cultivated in Indian subcontinent and to lesser extent in
Thailand, Australia and other South Pacific countries. It is popular pulse crop
of India, Pakistan, Burma, Bangladesh, Ceylon and most of the African
countries. It is an important pulse crop grown throughout the country.
In India black gram is very popularly grown in Andhra Pradesh,
Orissa, Maharashtra Madhya Pradesh, Uttar Pradesh, West Bengal, Punjab,
Haryana, Karnataka, Tamil Nadu and Bihar.
1.4 CULTIVATION CONDITIONS
Black gram is a warm weather crop and grows in areas receiving an
annual rainfall ranging from 600 to 1000 mm. It is mainly cultivated in a
cereal-pulse cropping system primarily to conserve soil nutrients and utilize the
left over soil moisture, particularly, after rice cultivation. Hence, although it is
grown in all the seasons, majority of black gram cultivation falls in either Rabi
or late Rabi seasons, particularly in peninsular India. The optimum temperature
range for growth is 27-30ºC. A dry harvest period is desirable as this forces the
crop to mature and reduces the risk of weather damage, although black gram is
3
Plate-1 Botanical Description of black gram A. Black gram plant. B. Inflorescence of black gram C. Dissected flower D. Immature pod E. mature seeds of Black gram
4
more susceptible than green gram. Black gram grows on most soils, with a
preference to loamy soil condition with a pH of 5.5-7.5. It comes up well on water
retentive soils but cannot stand saline and alkaline conditions. Root growth can be
restricted on heavy clays, with a consequent limitation to growth. Black gram is
more tolerant to water logging as compared to green gram.
1.5 AGRICULTURAL IMPORTANCE
This crop is itself a mini-fertilizer factory, as it has a unique
characteristic of maintaining and restoring soil fertility through fixing
atmospheric nitrogen in symbiotic association with Rhizobium bacteria, present
in the root nodules. The crop is suitable for inter cropping with various crops
such as cotton, sorghum, pearl millet, green gram, maize, soybean, groundnut,
for increasing production and maintaining soil fertility.
1.6 FOOD AND NUTRITION VALUE OF BLACK GRAM
Among the grain legumes, black gram is the second most important food
grain in the world for his protein content (first is soybean). Grain legumes contain
2 to 3 times more protein than cereals, ranging approximately between 20 to 40
per cent. This protein is rich in essential amino acids such as arginine, leucine,
lysine, isoleucine, valine and phenylalanine etc. In addition to being an important
source of human food and animal feed. The presence of fats with low degree of
saturation has contributed significantly to the increasing popularity of blackgram.
In the South Asia, black gram is used to make �dal�, which is the most
common dish made from various kinds of split legumes with spices. In the
Southeast and East Asian countries, it is used to make various kinds of sweet,
bean jam, sweetened bean soup, vermicelli, and bean sprout. Due to various
health benefits of black gram, they are extensively used in the preparation of
5
dishes in China, Taiwan, Thailand, Pakistan, Korea, Southeast Asia and India.
They are eaten whole and as sprouts. The starch extracted from black gram is used
in making noodles. They are also used in making desserts and soups. Black gram
is a wonderful food that helps in reducing weight. Urad beans are rich in protein,
vitamin A, B, C, E and are a perfect source of minerals such as potassium, iron
and calcium. According to Chinese medicine, the sprouts are considered as a
cooling food with anti-cancerous properties. They are used to treat inflammations
that can arise as a result of infections, hypertension and heat strokes.
Black grams have high fiber content and complex carbohydrates that
are helpful in digestion. The complex carbohydrates balance the blood sugar
levels in the body and halt the rise of sugar levels just after meal consumption.
These properties of black gram are beneficial for people suffering from high
cholesterol or diabetes. The high nutritional value of Urad bean gave this pulse
a special importance in Ayurveda medicine.
Blackgram is one of the rich sources of vegetable protein and some
essential minerals and vitamins for the human body.
Table-2: Nutrition composition of black gram
Component Quantity (%) Protein 20-25% Fat 1. 3% Ash 3. 40% Crude fibers 4. 2% Starch 40 � 47% Vitamin A (IU) 300 Vitamin B1 (mg / 100g ) 0. 52- 0. 66 Vitamin B2 (mg / 100g ) 0. 29 - 0. 22 Niacin (mg / 100g ) 2. 0 Vitamin C (mg / 100 g ) 5 Iron (mg / 100g ) 7. 8 Calcium (mg / 100g ) 145
6
1.7 PRODUCTION AND PRODUCTIVITY CONSTRAINTS
India is producing 14.0lakh tons from an area of 31 lakh hectare, which
is one of the largest producing and consuming countries in the world. The
major producing states which includes Andhra Pradesh, Maharashtra, Madhya
Pradesh, Uttar Pradesh, Tamil Nadu, Karnataka and Odisha. Maharashtra is the
largest producing state contributing for about 24 per cent of total production
followed by Andhra Pradesh and Uttar Pradesh with 19 per cent and 12.29 per
cent, respectively. The total area under black gram in Odisha is about 1.50 lakh
hectares with total production 0.42 lakh tones. But the productivity of black gram is
280.0 kg ha-1 which is far below than the national average productivity (451.61 kg
ha-1) and overall production and productivity of black gram has not been improved
significantly in spite of consistent efforts of the plant breeders due to several biotic
and abiotic stresses. The traditional strategies of conventional breeding such as
selection, crossing and back cross, multiple cross have generated very few crop
varieties with improved stress tolerance. Much improvement could not be achieved
through these techniques because of narrow genetic base of agronomically
important gene responsible for abiotic stress tolerances and limited natural variation.
Contrary to the classical breeding and marker assisted selection approaches, direct
introduction of gene by genetic engineering offers a more promising and quick
solution for improving stress tolerance (Wang, 2005).Low temperature seriously
affects the crop causing loss in production and productivity in northern and eastern
parts of India. Genetic improvement of black gram to induce abiotic stress tolerance
could be achieved through genetic engineering so that to produce variety showing
regulation of higher expression of abiotic stress responsive gene.
Stresses induce various biochemical and physiological responses in
plants. Products of a number of genes are thought to function in stress tolerance
7
and response. The term tolerance is defined as the ability of cells and
organisms to endure an internal stress induced by an externally applied stressor.
Identification of the key genes underlying cold stress has thus become a major
priority in the search for improving the crop for winter hardiness. A deeper
understanding of the regulation of these genes, and of their response to low-
temperature stress, would allow clarification of the ways in which plants adjust
to the stress. Knowledge of this type is widely expected to provide
opportunities for the manipulation of gene expression in crop plants, with a
view to engineering higher levels of cold tolerance. Stress-inducible genes
were used to improve stress tolerance of plants by gene transfer (Shinozaki and
Yamaguchi-Shinozaki, 2000). Neither DNA norm RNA can identify how much
protein is produced inside a cell or what it does. Once created chemical
modifications such as phosphorylation play a key role in controlling protein
activity; these modifications cannot be detected by screening nucleotides.
Messenger RNA tells you what might happen, and the protein tells what is
happening. Various types of libraries are used to study genomics or proteomics.
Table 3. Area, Production and Productivity of Blackgram in Major States (2011-12)
S. No. Particulars
Area (lakh ha)
% Share
Production (lakh t)
% Share
Productivity (kg ha-1)
1 Andhra Pradesh 5.03 16.23 2.59 18.50 514.91
2 Karnataka 1.26 4.06 0.64 4.57 507.94
3 Madhya Pradesh 4.72 15.23 1.66 11.86 351.69
4 Maharashtra 5.75 18.55 3.27 23.36 568.70
5 Uttar Pradesh 3.91 12.61 1.72 12.29 439.90
6 Rajasthan 1.45 4.68 0.60 4.29 413.79
7 Tamil Nadu 3.41 11.00 1.21 8.64 354.84
8 Orissa 1.50 4.84 0.42 3.00 280.00
8
Being from Leguminosae family, the genetic transformation in black
gram have been difficult and challenging till now (Jaiwal,2001), but significant
progress has been made in recovery of transformed plant via Agrobacterium in
soybean, pea, chickpea, Vigna aconitifolia (Eapenet al.,1990). Black gram
transformation system require development of (a) Suitable gene construct for
desired trait (b) a source of totipotent cells or gametes that serve as recipients
of delivered DNA, (c) a means of delivering DNA into the target cells, and (d)
a system for selecting or identifying transformed cells.
1.8 TRANSCRIPTIONS FACTOR FOR ABIOTIC STRESS TOLERANCE
In plants, one transcription factor can control the expression of many
target genes through the specific binding of the transcription factor to the cis�
acing element in promoters of the target gene (shinozaki and Yamaguchi,
2000). Northern analysis of dehydration inducible gene revealed that there
appear to be at least four independent regulons in Arabidopsis i.e. 1)
Dehydration responsive element (DREB) /CBF regulon, 2) zinc finger home
domain (ZE-HD) regulon 3) ABA responsive element binding protein /ABA-
responsive element binding factor (AREB/ABF) regulon, and 4)
Myelocytomatosis oncogenes (MYC) and myelocytotomatosis oncogene
(MYB) regulon. Transgenic plant over expressing either CBF1, 2 or 3
constitutively express CBF targeted cold- induced gene, the CBF regulon,
exhibit an increase in freezing tolerance that is independent of a cold stimulus
(Liu and Zhu, 1998).
Since CBF transcripts begin accumulating within 15min of plants�
exposure to cold, Gilmour, et al., 2000 proposed that there is a transcription
factor already present in the cell at normal growth temperature that recognizes
9
the CBF promoters and induces CBF expression upon exposure to cold stress.
He named the unknown activator(s) �ICE� (inducer of CBF expression)
protein(s) and hypothesized that upon exposing a plant to cold, modification of
either ICE or an associated protein would allow ICE to bind to CBF promoters
and activate CBF transcription.
Over expression of ICE-1/CBF3 in transgenic Arabidopsis plant
showed increased tolerance to freezing, drought and high salt concentration,
suggesting that the ICE-1/CBF3 proteins function without modification of the
proteins in the development of stress tolerance.
The present work was carried out to address the constraints of
production and productivity problem in the black gram and was planned with
the following objectives;
Standardization of in vitro technique of regeneration of the black gram
cultivar.
Standardization of Transformation protocol.
Selection of transformed cells/ tissues/ plants.
Molecular characterization of transformed cell/ plant
10
REVIEW OF LITERATURE
Classical breeding have met with limited success due to the absence of
adequate and satisfactory level of genetic variability within the available
germplasm. There is intense pressure to produce further improvements in
crop quality and quantity. Rapid progress has been made in genetic
engineering techniques to transfer and achieve stable integration and
expression of useful genes in crop plants. Genes are introduced either with
the aid of Agrobacterium tumefaciens or through direct delivery of DNA
into cells and protoplasts that use cultures of meristematic cells as source of
totipotent cells. Though, genes conferring resistance to biotic and abiotic stress
have been available in many wild and relative species, these are sexually
incompatible with cultivated ones (Varalaxmi, et al., 2013). In the present
study, an attempt has been made to regenerate transgenic Blackgram
conferring resistance to cold. The success of the previous attempt
understanding different adaption, avoidance, escaping and tolerance
mechanism of plant to different stress condition and the regeneration and
genetic transformation of Vigna mungo L. has been reviewed in this chapter.
2.1 ABIOTIC STRESS AND THEIR CONSEQUENCES
Abiotic stresses include potentially adverse effects of salinity, drought,
flooding, metal toxicity, nutrient deficiency, UV exposure, photo-inhibition,
high temperature, low temperature and air pollution etc. Plants can experience
abiotic stress resulting from the shortage of an essential resource or from the
presence of high concentrations of toxic or antagonistic substance.The stresses
id2017576 pdfMachine by Broadgun Software - a great PDF writer! - a great PDF creator! - http://www.pdfmachine.com http://www.broadgun.com
11
adversely affect growth, productivity and trigger a series of morphological,
physiological, biochemical and molecular changes in plants.
Cold stress is a major environmental factor that limits the agricultural
productivity of plants. Only one-third of the total land area on Earth is free of
ice and 42% of land experiences temperatures below −20°C. Cold stress can be
classified as chilling (0�15 °C) and freezing (<0 °C) stresses. Plants respond
and adapt to this stress to survive under stress conditions at the molecular and
cellular levels as well as at the physiological and biochemical levels. However,
expression of a variety of genes is induced by different stresses in diverse
plants. Generally, plants originating from temperate regions, like spinach and
Arabidopsis, exhibit a variable degree of chilling tolerance and can increase
their freezing tolerance during exposure to chilling and non-freezing
temperatures. This process is known as cold acclimation (Thomashow, 1999).
On the other hand, plants of tropical and subtropical origins are sensitive to
chilling stress and lack the cold acclimation mechanism.
In such areas, plants require specialized mechanisms to survive
exposure to low temperature. Low temperature often affects plant growth and
crop productivity, which causes significant crop losses (Xin and Browseb,
2001). Plants differ in their tolerance to chilling (0-15 ºC) and freezing (< 0ºC)
temperatures. The most obvious detriment concerning abiotic stress involves
farming. It has been claimed by one study that abiotic stress causes the most
crop loss of any other factor and that most major crops are reduced in their
yield by more than 50% from their potential yield (Wang, et al., 2006) it has
also been speculated that this yield reduction will only worsen with the
dramatic climate changes expected considered as a detrimental effect on yield
and the quality of production.
12
In general, plants from temperate climatic regions are considered to be
chilling tolerant with variable degree, and can increase their freezing tolerance
by being exposed to chilling, non-freezing temperatures, a process known as
cold acclimation (Levitt and Guch, 1980), which is associated with biochemical
and physiological changes (Gilmour, et al.., 2000) and ultimately showed
marked changes in gene expression, Bio-membrane lipid composition, and
small molecule accumulation (Yamaguchi and Shinozaki, 2006).
The tolerance of plants to stress has been widely shown to vary with
physiological growth stage, developmental phase, size of plants and genetic
variability. There is also growing evidence that all of these stresses are inter
connected, for instance during drought stress, however water shortages effect
transport of materials in different parts of the plants and imbalanced
localization of these products can cause toxification.
2.2 STRESS AVOIDANCE AND TOLERANCE
The two distinct strategies taken by plants to combat low-temperature
stress are avoidance and tolerance. Stress avoids acne entails preventing the
freezing of sensitive tissues. Some succulent species (with thick tissue mass
and abundant water content) are able to accumulate residual heat during the day
and dissipate it slowly during the cold night many annual herbs survive in the
form of dormant organs or seed; others protect the shoot meristem with leaves
(Kacperska, 1999). A more elaborate avoidance strategy involves supercoiling,
in which endogenous ice nucleation is prevented by inhibiting the formation of
ice nucleators, even where the temperature falls as low as -400C. Extremely
winter hardy species can generate within their cells so-called �liquid glass�, a
highly viscous solution that prevents ice nucleation even at -196 0C. Such cells
become osmotically, thermally and mechanically desensitized to the presence
13
of external ice. Where the severity of the stress is more progressive, tolerant
plants have evolved the ability to acclimatize, defined by Kacperska (1999) as
the non-heritable modification of structure and function in response to stress, in
a way that reduces harm and there by improves fitness.
The plant response to low-temperature stress can be divided into three
distinct phases. The first is cold acclimation (pre-hardening), which occurs at
low, but above zero temperatures. The second stage (hardening), during which
the full degree of tolerance is achieved, requires exposure to a period of sub-
zero temperatures. The final phase is plant recovery after winter (Li, et al.,
2008). Some plants (especially trees) need a combination of short photoperiod
and low temperature to fully develop their cold tolerance. In these cases,
tolerance can be lost if the temperature is raised above zero and the
photoperiod is lengthened (Kacperska, 1999). Plant organs differ in their level
of tolerance typically the roots are much more sensitive than the crown
(McKersie, 1994), which is understandable given that the crown is the site of
the major meristem responsible for production of new roots and shoots at the
end of the cold period.
2.2.1 Morphological bases of cold tolerance
The temperate and cool regions are those where altitudes ranged from
1600-2500 above mean sea level (amsl) regions, low temperature is the primary
abiotic stress which limits the crop productivity. The low temperature at
seedling and reproductive stages is the major problem, results in slow
establishment and low seed set which leads to poor yield of the crop. The low
temperature limits the crop productivity when temperatures remain above
freezing that is > 0 oC; it is called as chilling stress. Chilling sensitive cultivars
are typically tropical genotypes. There is wide range of cold stress in temperate
14
areas differing in both timing and intensity of low temperature. Yield losses are
more severe when cold stress occurs during reproductive stage/ anthesis in rice
which lead to high spikelet sterility. Ability of crop genotypes / lines to survive
/ perform better under low temperature than other genotypes is called as cold
tolerance. Ordinarily, it is the consequence of cold hardening that is an earlier
exposure to a low temperature for a specific period as a result of which chilling
tolerance of the concerned plants increases. Cold tolerance involves increased
chlorophyll accumulation, reduced sensitivity of photosynthesis, improved
germination, pollen fertility and seed set which are desirable as
2.2.2 Increased chlorophyll accumulation
Low temperature inhibits chlorophyll accumulations in actively growing
leaves. In rice, cold tolerant lines, for example, �japonica� accumulates more
chlorophyll under cold stress than do cold sensitive line, for example
of �indica rice� (Glaszmann, et al., 1990). Rasolofo,1986 evaluated 181
accessions to identify donor and outstanding cold tolerant lines using leaf
discoloration score and found 19 remained green (dark) after 10 days in the
120C cold water tank. (Sanghera, et al., 2001) Found 18 cold tolerance
�IRCTN� rice genotypes based on dark green colour and high spikelet fertility
(>90%) under temperate conditions.
2.2. 3 Reduced sensitivity of photosynthesis
Chloroplast and photosynthesis is major site of cold injury. Tolerance in
these aspects is expressed in native vegetation adapted to growing under cool
conditions. The reduced sensitivity of photosynthesis to cold have been
observed in maize inbreeds adapted to low temperature which is partly related
to specific enzymes of the process. (Singh, B.D., 2000).
15
2.2.4 Improved Pollen Fertility and Seed Set
Cold tolerance at reproductive stage is expressed as improved seed set
and pollen fertility. It is largely a function of floral structure and function under
stress. Lia, et al. (1998) reported plant cold tolerance in rice is associated with
anther size, number of pollen grain, diameter of fertile pollen grains at booting
stage. However, Sanghera, et al. (2001) reported that cold tolerance is
associated with high spikelet fertility (>90%) and well panicle exertion under
temperate conditions. Cold snaps cause a reaction in the plant that prevents
sugar getting to the pollen. Without sugar there is no starch build-up which
provides energy for pollen germination. And without pollen, pollination cannot
occur, thereby, no grain is produced. All the ingredients for starch are present
but they are not getting into the pollen grain where they are needed. A cell
layer surrounding the pollen, called the �tapetum�, is responsible for feeding the
pollen with sugar. The tapetum is only active for 1-2 days so if a cold snap
occurs at this time, then there is no further chance for pollen growth. But the
sugar cannot freely move into the tapetum and pass through it to the pollen.
Instead the sugar has to be broken down then transported in bits to the pollen
(Oliver, et al., 2005). �Invertase� is the catalyst that helps in breakdown of the
sugar molecule to transport it into the tapetum before it is transported to the
pollen. Quantities of invertase are decreased in conventional rice when it is
exposed to cold temperatures, but they remain at normal levels in a cold
tolerant variety when it experiences cold. By comparing a cold tolerant strain
of rice with conventional rice found that the gene responsible for invertase
looks exactly the same in the cold tolerant variety as it does in conventional
rice. So the invertase gene itself does not make the rice plant cold tolerant but
instead a mechanism that regulates the invertase gene is different. Early
research indicates that the invertase gene is regulated by the hormone abscisic
16
acid (Oliver, et al., 2007). He had experimented with injecting plants with
ABA the resulting rice plants are sterile, just like that if they experienced a cold
snap. Also, ABA levels increase when conventional rice is exposed to cold, but
they remain the same in the cold tolerant variety. Recent studies have indicated
that the difference between cold-sensitive and tolerant rice is due to a different
ability to control ABA levels. It has also been shown that this mechanism may
require interactions with other plant hormones like auxins further (Zhao et al.,
2008), also reported that low temperature turns off the genes responsible for sugar
transport into the pollen grains and therefore starch cannot be produced in the
pollen in cold conditions. Cold did not cause repression of sugar delivery in
cold tolerant Chinese rice and fertile pollen was still produced following cold
treatment. The sugar metabolism genes also continued to function normally
during cold treatment of cold tolerant rice. Ample genetic variation for cold
tolerance is available in well adapted breeding population. Germplasm
collected from high altitude and low temperature areas, cold tolerant mutant,
somaclonal variants and wild species can be exploited for breeding improved
cold tolerant genotypes in hilly areas.
2.3 COLD ADOPTION
Species adapted by natural selection to cold environments have
evolved a number of physiological and morphological means to improve
survival in the face of extended cold periods (Guy, 1999).
Morphologically these species are of short stature hade a low leaf
surface area and a high root / shoot ratio. Their growth habit takes full
advantage of any heat emitted from the ground during the day and minimizes
night chilling, since air temperature is maintained most effectively near the soil
surface. Cold-adapted plants tend to be slow growing, have the C3 mode of
17
photosynthesis and store sugars in underground tissues. Plants well adapted to
cool environments have evolved an efficient respiration system, which allows
them to rapidly mobilize stored reserves during the short growing season. The
timing of developmental and physiological responses to environmental stress is
under strict genetic control (Guy, 1999).
Plant species acclimatize during autumn, physiologically and
metabolically redirected towards synthesis of cryprotectant molecules such as
soluble sugars (saccharose, raffinose, stachyose, and trehalose), sugar alcohols
(sorbitol, ribitol, and inositol) and low-molecular weight nitrogenous
compounds (proline, glycine betaine). These, in conjunction with dehydrin
proteins (DHNs), cold-regulated proteins (CORs) and heat-shock proteins
(HSPs), act to stabilize both membrane phospholipids and proteins, and
cytoplasmic proteins, maintain hydrophobic interactions and ion homeostasis,
and scavenge reactive oxygen species (ROS); other solutes released from the
symplast serve to protect the plasma membrane from ice adhesion and
subsequent cell disruption. The process of solute release, especially of vacuolar
fructans, to the extracellular space is a vesicle-mediated, tonoplast derived
exocytosis (Valluru, et al., 2008). Fructans are transported to the apoplast by
post-synthesis mechanisms, probably in response to cold stress. The activity of
fructans exohydrolase, which generates increased sugar (glucose, fructose,
sucrose) content, is an important part of the hardening process. Symplastic and
apoplastic soluble sugar not only fructan precursors, but also trehalose,
raffinose, as well as fructo and gluco-oligosaccharides contributes directly to
membrane stabilization (Livingston, et al., 2006). Also important is the
increased activity of the antioxidative enzymes superoxide dismutase,
glutathione peroxidase, glutathione reductase, ascorbate peroxidase and
18
catalase, as well as the presence of a series of non-enzymatic antioxidants, such
as tripeptidthiol, glutathione, ascorbic acid (vitamin C) and a-tocopherol
(vitamin E) (Chen, et al., 2009).
In addition to the production of protective compounds that participate
in membrane stabilization, cold acclimation also affects cell lipid composition,
which is necessary for the maintenance of plasma membrane functionality. In
particular, the proportion of unsaturated fatty acids making up the
phospholipids is increased (Rajashekar, 2000). De Palma, et al., 2008
suggested that both the composition of the phospholipids and their ability to
interact with other protective proteins are important for generating a higher
level of freezing resistance. Phospholipase D, in particular, participates in the
degradation of phospholipids, and its suppression may therefore be relevant in
improving freezing tolerance (Rajashekar, 2000). Some plants respond to cold
stress by the synthesis of proteins that inhibit the activity of ice nucleators.
Some of these so called �antifreeze� proteins are highly similar in sequence to
plant pathogen-related (PR) proteins (particularly in winter rye), and
accumulate in response to cold, drought or the exogenous supply of ethylene
(Moffatt, et al., 2006). These proteins assemble as oligomers, which can bind
to the surface of a newly formed ice crystal, and thereby influence its
subsequent shape and growth. Their antifreeze activity is modulated by Ca+,
which is either released from pectin or bound to specific proteins. An altered
ratio of abscisic acid (ABA) to gibberellin content, in favor of ABA, results in
the retardation of growth required for pre-hardening (Junttila, et al., 2002).
Gibberellin content is regulated by a family of nuclear growth-repressing
proteins called DELLAs, and these are components of the C-repeat (CRT)
binding factor 1 (CBF1)-mediated cold stress response.
19
2.4 COLD SENSING AND SIGNALING
The identity of the plant sensors of low temperature remains as yet
unknown (Chinnusamy, 2006). Multiple primary sensors may be involved, with
each perceiving a specific aspect of the stress, and each involved in a distinct
branch of the cold signaling pathway (Xiong, et al., 2002). Potential sensors
include Ca2+ influx channels, two-component histidine kinase and receptors
associated with G-proteins. Certain cytoskeletal components (microtubules and
actin filaments) participate in cold sensing by modulating the activity of
Ca2+channels following membrane rigidification (Abdrakhamanova, et al., 2003).
Because of its basic role in separating the internal from the external
environment, the plasma membrane has been considered as a site for the
perception of temperature change (Wang, et al., 2006), with its rigidification
representing an early response (Vaultier, et al., 2006). The phosphorylation of
proteins, together with the suppression of protein phosphatase activity, may
also provide a means for the plant to sense low temperatures (Rajashekar
2000). Thus, a variety of signalling pathways is triggered, including secondary
messengers, ROS, Ca2+dependent protein kinases (CDPKs), mitogen-activated
protein kinase (MAPK) cascades and the activation of transcription factors
(TFs), all of which promote the production of cold-responsive proteins. These
products can be divided into two distinct groups: regulatory proteins
controlling the transduction of the cold stress signal, and proteins functionally
involved in the tolerance response. The latter include LEA (late embryogenesis
abundant) proteins, antifreeze proteins, mRNA-binding proteins, chaperones,
detoxification enzymes, proteinase inhibitors, transporters, lipid-transfer
proteins and enzymes required for Osmoprotectants biosynthesis (Yamaguchi-
Shinozaki & Shinozaki 2006). An outline of these processes is given in Fig. 1
20
Fig. 1 Scheme illustrating the molecular response of plants to low-temperature stress, realised as changes in transcriptome, proteome, metabolome and phenotype.
2.5 THE MOLECULAR BASIS OF COLD TOLERANCE (CBF / DREB RESPONSIVE PATHWAY)
The CBF / DREB responsive pathway provides one of the most
important routes for the production of cold responsive proteins. The major cis-
acting element involved in CBF / DREB is DRE (dehydration-responsive
element) / CRT. Two major groups of transcription factors bind to DRE/ CRT
sequences, namely CBF / DREB1 (CRT-binding factor / DRE-binding protein)
in low-temperature signalling, and DREB-2 during osmotic stress (Nakashima
& Yamaguchi-Shinozaki, 2006). CBF1, 2 and 3 are all responsive to low
temperature, and their encoding genes are present in tandem on Arabidopsis
21
thaliana chromosome 4. The genes carry the conserved AP2 / ERF domain
DNA-binding motif. CBF2 / DREB1C is a negative regulator of both CBF1 /
DREB1B and CBF3 / DREB1A. CBF3 is thought to regulate the expression
level of CBF2 (Chinnusamy, 2006). Thus, the functions of CBF1 and CBF3
differ from those of CBF2, and act additively to induce the set of CBF-
responsive genes required to complete the process of cold acclimation (Novillo,
et al., 2004). Upstream of CBF lie both ICE1 (inducer of CBF expression), a
positive regulator of CBF3, and HOS1 (high expression of osmotically
sensitive), a negative regulator of ICE1. The HOS1 product is a RING E3
ligase targeting ICE1 for degradation in the proteasome (Dong, et al., 2006).
Because of the rapid (within a few minutes) induction of CBF transcripts
following plant exposure to low temperature, ICE1 is unlikely to require de-
novo synthesis, but rather is already present in the absence of cold stress and is
only activated when the temperature decreases (Chinnusamy et al., 2003). The
LOS1 (low expression of osmotically responsive genes) product is a translation
elongation factor 2-like protein, which negatively regulates CBF expression.
The likely regulators of CBF1 and CBF2 are bHLH proteins other than ICE1.
To obtain transient expression of CBFs, the levels of CBF1 and CBF3
transcript, after their induction by ICE1, are subsequently lowered by CBF2.
Accordingly, the peak expression of CBF2 in response to low temperature has
been shown to occur about 1 h later than that of either CBF1 or CBF3 (Novillo,
et al., 2004). In addition to ICE1, a further positive regulator of CBF
expression is LOS4, an RNA helicase-like protein (Gong, et al., 2002) .
However, CAX1(cation exchanger), which plays a role in returning cytosolic
Ca2+ concentrations to basal levels following a transient increase in response to
low-temperature stress, is a negative regulator of CBF1, 2 and 3 (Catala, et al.,
2002). The ICE1-CBF pathway provides positive regulation of the expression
22
of certain Zn finger transcriptional repressors and the SFR6 (sensitivity to
freezing) protein, which is required for CBF function. SFR6 may be part of an
adaptor complex required for CBF action, or alternatively, may be involved in
the translation machinery of CBF transcripts and in CBF protein stability
(Chinnusamy, 2006). Further pathways, not under CBF control, are also
involved in the regulation of cold-responsive genes (Van Buskirk &
Thomashow, 2006). In particular, Chinnusamy,2006 have shown that both
HOS9 and HOS10 transcription factors play a role in the regulation of freezing
tolerance in a CBF-independent manner.
Fig. 2. The CBF (C-repeat-binding factor) pathway in plants. ICE1 (inducer of CBF expression) is activated by low temperature and is inhibited by HOS1 (high expression of osmotically sensitive). This triggers the expression of CBF3, which promotes the accumulation of COR (cold regulated)gene products. CBF3 expression also positively regulates the expression of CBF2, which, in turn, leads to the down-regulation of CBF3 and CBF1. LOS4 (low expression of osmotically responsive genes) is a positive regulator of CBF expression, and LOS1 a negative regulator
Knowledge gained from the study of the model plant A.thaliana has
proven to be largely, but not completely, transferable to crop plants.
Unfortunately, many key stress responses are not transferable, and Oh, et al.
(2007) experienced with over-expression of the barley low temperature induced
gene HvCBF4 in rice, which resulted in the up-regulation of a set of genes not
23
predicted from the heterologous expression of AtCBF3 in rice. For cereal
species, this disadvantage is to some extent balanced by the availability of the
rice genome sequence, and its increasing level of annotation, since the cereal
species genomes are all closely related to one another (Moore, et al., 1995). In
barley, the CBF genes HvCBF3, HvCBF4 and HvCBF8 are all components of
the frost resistance quantitative trait locus (QTL) located on chromosome 5H
(Francia, et al., 2004). A contrasting approach has targeted comparisons
between spring- and winter-sown cereal cultivars. Thus, for example, Monroy,
et al., (2007) observed that spring and winter wheats share the same initial
rapid expression of cold-inducible genes, but that their transcriptional profiles
diverge widely during cold acclimation. While in winter cultivars the
expression of cold acclimation genes continues over time, in spring cultivars,
their levels of expression decline and the cold acclimation process is
overridden by the transition from the vegetative to the reproductive stage.
Although the regulation of genes in the CBF-responsive pathway has been only
marginally explored to date in woody plants, there are some indications that
their regulation is more complex than in herbaceous species. For example four
Eucalyptus gunnii CBF1 genes displayed differential expression in response to
cold treatment (Kayal, et al., 2006; Navarro et al., 2009).
24
Table-4 ICE1-CBF/DREB1-dependent signaling components conferring plant cold tolerance
Gene Transgenic host Source plant Phenotype and effects References AtICE1 Arabidopsis thaliana
Arabidopsis thaliana
Freezing tolerance ;activation of CBF3/DREB1A
Chinnusamy, et al., 2003
AtICE2 Arabidopsis thaliana
Arabidopsis thaliana
Freezing tolerance; activation of CBF3/DREB1A Fursova,.et al.,2009
AtICE1 Cucumis sativus
Arabidopsis thaliana
Chilling tolerance; dwarf Liu, et al.,2010
SlICE1
Solanum lycopersicum Solanum lycopersicum
Chilling tolerance; accumulation of antioxidants
Miura, et al.,2012
TaICE141, TaICE187
Arabidopsis thaliana
Triticum aestivum Freezing tolerance Badawi, et al.,2008
AtCBF1, AtCBF2, AtCBF3
Arabidopsis thaliana Arabidopsis thaliana
Freezing, salt and drought tolerance; constitutive expression of COR
Gilmour, et al.,2005,, et al. Fursova, et al., 2009 and Hu, et al., 2011
OsDREB1A, OsDREB1B, OsDREB1C.
Oryza sativa Oryza sativa Chilling, salt and drought tolerance; dwarf Ito, et al.,2006
HvCBF4 Oryza sativa Hordeum vulgare Chilling, drought and salt tolerance Oh,. et al.,2007
TaDREB2, TaDREB3
Triticum aestivum Triticum aestivum Freezing and drought tolerance; dwarf Morran, et al.,2011
AtCBF1, AtCBF2.
Brassica napus Arabidopsis thaliana
Freezing tolerance; constitutive expression of COR Jaglo,et al.,2001
AtCBF1 Fragaria ananassa
Arabidopsis thaliana
Freezing tolerance Owens,et al.,2002
25
Gene Transgenic host Source plant Phenotype and effects References
AtCBF3 Solanum tuberosum Arabidopsis thaliana
Freezing tolerance Behnam, et al.,2007
AtCBF1 Populus tremula x
Arabidopsis thaliana
Freezing tolerance
Benedict, et al.,2006
AtCBF3 Triticum aestivum Arabidopsis thaliana Freezing tolerance Pellegrineschi, et al.,2004
AtCBF3 Nicotiana tabacum Arabidopsis thaliana Freezing tolerance Kasuga, et al.,2004
SlCBF1 Arabidopsis thaliana Solanum lycopersicum Freezing tolerance Zhang, et al.,2004
OsDREB1A Arabidopsis thaliana Oryza sativa Freezing, drought and salt Tolerance Dubouzet, et al.,2003
VrCBF1, VrCBF4
Arabidopsis thaliana Vitis riparia Freezing and drought tolerance; dwarf Qin, et al.,2004
HvCBF3 Arabidopsis thaliana Hordeum vulgare Freezing tolerance Siddiqua, et al.,2011
LpCBF3 Arabidopsis thaliana Lolium perenne Freezing tolerance; dwarf Skinner, et al.,2005
SlCBF1 Arabidopsis thaliana Solanum lycopersicum Chilling and oxidative tolerance Xiong, et al.,2006 Zhao, et al.,2008
MbDREB1 Arabidopsis thaliana Malus baccata Chilling, drought and salt tolerance
Hsieh, et al.,2002
GmDREB3 Arabidopsis thaliana Glycine max Freezing, drought and salt tolerance Yang, et al.,2011
BpCBF1 Arabidopsis thaliana Betula pendula Freezing tolerance; dwarf Chen, et al.,.2008
26
2.4.1 Sugars as signaling molecules
Sugars represent not just an energy source, but are also carbon
precursors, substrates for polymers, storage and transport compounds and
signalling molecules (Wormit, et al., 2006). In cold-induced barley cell
cultures, the extracellular sugar concentration regulates expression of the
stress-responsive genes BLT4.9 (non-specific lipid transfer protein) and DHN1
(Tabaei-Aghdaei, et al., 2003). Three different glucose signalling pathways are
known in plants: one is hexokinase-dependent, the second glycolysis
dependent, and the third hexokinase-independent (Xiao, et al., 2000).
Hexokinase functions as an intracellular glucose sensor, while some membrane
receptors probably act as extracellular sensors (Moore et al., 2003; Rolland, et
al., 2006). It is also believed that plants have a disaccharide sensing system,
involving sucrose and trehalose. Sucrose transport to the cell and its subsequent
cleavage by invertase or sucrose synthase is the source of the signal
(Iordachescu & Imai, 2008). Trehalose, a disaccharide confined mostly to
organisms adapted to situations of extreme desiccation, where its role is to
protect proteins and membranes, plays, together with its precursor trehalose-6-
phosphate, an important regulatory role in sugar metabolism and plant
development. In barley, trehalose induces the expression and activity of fructan
biosynthesis enzymes. However, for fructan accumulation, glucose or mannitol
is also required. From a microarray analysis following trehalose treatment, Bae,
et al.(2005) showed that the expression of a wide range of other genes was also
influenced by trehalose. A role for trehalose and trehalose-6-phosphate in
abiotic and biotic stress signalling has been confirmed by the observation that
coordinated changes occur in transcript levels of the enzymes involved in their
metabolism, especially after exposure to cold, osmotic and salinity stresses and
27
in response to Pseudomonas syringae infiltration. Fructose-based polymers
(fructans) also contribute to the cold and drought tolerance of several plant
families. These molecules are synthesized from sucrose by
fructosyltransferases, and help to stabilise membranes by binding to the
phosphate and choline groups of membrane lipids. This stabilisation results in
reduced water loss from the dry membranes (Valluru & Van den Ende, 2008).
In addition, fructans are suspected of stimulating the production of alternative
cryoprotectants (Valluru, et al., 2008). Both size- and species dependent
differences are thought to exist among cereal fructans (Hincha, et al., 2007).
Some Poaceae species can accumulate fructans (Triticum, Hordeum, Avena,
Poa, Lolium), but others cannot (Oryza). This difference was supposed by Ji, et
al., (2006) to reflect an evolutionary event that separated the Panicoideae (rice,
sorghum, maize, etc.) from the Pooidae (wheat, barley, rye, etc.). Although all
cereal species have invertases (from which fructan biosynthesis enzymes
evolved), the fructan non-accumulators lack fructan biosynthesis enzymes.
Some data have also been generated to suggest a role for ß-amylase during cold
and other abiotic stresses. The hypothesis put forward by Kaplan et al., (2006)
was that this enzyme provides some protection to photosystem II
photochemical efficiency by catalysing the synthesis of maltose.
2.4.2 Signalling cross-talk
The signalling pathway associated with cold stress is believed to be
rather less dependent on ABA than those involved in the response to either
moisture or salinity stress (Zhang, et al., 2004). However, it is clear that some
cross-talk does occur between the various abiotic stress signalling pathways, as
the transcription of members of identical gene families is induced, and rather
similar products are accumulated (Chinnusamy, et al., 2004). For instance, in
28
A. thaliana the hydrophilic proteins COR15a and COR78 are accumulated as a
response to both cold and moisture stress (Rajashekar, 2000). Because many
abiotic stresses including freezing, drought and salinity result in cellular
dehydration, it is hardly unexpected to find some overlap in the various
signaling pathways that all deliver protection against cellular dehydration. This
commonality presumably lies behind the involvement of the CBF regulon in
the abiotic stress response (Fowler, et al., 2005). A key link between the
various pathways is the ROS network, which balances scavenging with
production (Torres & Dangl, 2005). Plants are thought to have evolved a high
degree of control over ROS toxicity, to the extent that ROS are exploited as
signalling molecules (Timperio, et al., 2008). The plant cell senses ROS via
redox-sensitive transcription factors (e.g. nitrogen permease reactivator or heat-
shock factors), which activate functional proteins involved in the re-
establishment of cellular homeostasis (Mittler, et al., 2004). Freezing tolerance
has been identified as a multigene trait. Some interspecific variation has been
identified among relevant gene products (Rajashekar, 2000), but the regulation
of many of the genes induced during cold acclimation are conserved between
species Zhu, et al., (2008) have suggested that histone acetylation / deacetylation is
an important player in gene activation and repression during cold acclimation, and
in particular showed that the HOS15 gene product, a nuclear localised repressor
protein that functions as a histone deacetylator, specifically interacts with histone
H4. A recent research focus has centered on the role of microRNAs (miRNAs) as
regulators of stress responses. Several stress related elements are present in the
promoter regions of certain miRNAs, and some miRNAs are known to be inducible
by abiotic stress. miRNA expression profiling has also been used to demonstrate the
existence of cross-talk between the salinity, cold and drought stress signalling
pathways (Liu, et al., 2008).
29
2.5 Functional proteins involved in cold acclimation
The level of cold hardiness has been successfully correlated with the
level of expression of COR genes (Pearce, et al., 1996). During the cold
acclimation process, COR genes such as COR tmc-ap3 and COR14b are up-
regulated, as are BLT (barley low temperature) genes (BLT14, BLT63, BLT801,
BLT4) and ELIP (early light inducible protein) genes (Cattivelli, et al., 2002).
Other genes are down-regulated, most typically those associated with
photosynthesis, such LHC (light harvesting complex) and plastocyanin. Atienza,
et al, (2004) investigated the induction of the three genes, DHN5, DHN8 and
COR14b, in barley, and found them to be cold specific. Other up-regulated
genes included those encoding enzymes involved in amino acid metabolism
(chloroplast-dependent, except for proline, which was chloroplast-
independent).
2.5. 1 Late Embryogenic abundant (LEA) Proteins
The Dehydrins are a group of heat-stable, glycine-rich Late
Embryogenic abundant (LEA) proteins thought to be important for membrane
stabilization and the protection of proteins from denaturation when the
cytoplasm becomes dehydrated. Nakayama, et al., 2008 have suggested that
some of them, especially COR15am, function as a protectant by preventing
protein aggregation. The Dehydrins ERD10 (early response to dehydration) and
ERD14 function as chaperones and interact with phospholipid vesicles through
electrostatic forces (Kovacs, et al., 2008). Several dehydrins are significantly
accumulated during cold stress (Renaut, et al., 2004). Microarray experiments
have shown that the expression profile of specific combinations of dehydrin
genes can provide a reliable indication of low temperature and drought stress
(Tommasini, et al., 2008). COR413im was identified by Okawa, et al., (2008)
30
as an integral membrane protein targeted to the chloroplast inner envelope in
response to low temperatures, where it contributes to plant freezing tolerance.
However, the SFR2 protein, which is protective of the chloroplast during
freezing, is localised in the chloroplast outer envelope membrane (Fourrier, et
al., 2008).
2.5. 2 Heat shock proteins (HSP)
Osmotic, cold and salt stresses are the strongest inducers of HSP
expression in plants (Timperio, et al., 2008). Some HSPs (in particular HSP90,
HSP70, several small HSPs and chaperonins 60 and 20) increase in abundance
following exposure to low temperature, and unlike the HSPs produced in
response to high temperature stress, which function as molecular chaperones,
these have a strong cryoprotective effect, participating in membrane protection,
in the refolding of denatured proteins and in preventing their aggregation
(Timperio, et al., 2008). Small HSPs are not themselves able to refold non-
native proteins, but do facilitate refolding effected by HSP70 and HSP100
(Mogk, et al., 2003).
2.6 Stress avoidance and tolerance
The two distinct strategies taken by plants to combat low-temperature
stress are avoidance and tolerance. Stress avoids acne entails preventing the
freezing of sensitive tissues. Some succulent species (with thick tissue mass
and abundant water content) are able to accumulate residual heat during the day
and dissipate it slowly during the cold night many annual herbs survive in the
form of dormant organs or seed; others protect the shoot meristem with leaves
Kacperska, 1999. A more elaborate avoidance strategy involves supercoiling,
in which endogenous ice nucleation is prevented by inhibiting the formation of
ice nucleators, even where the temperature falls as low as -400C. Extremely
31
winter hardy species can generate within their cells so-called �liquid glass�, a
highly viscous solution that prevents ice nucleation even at -196 0C. Such cells
become osmotically, thermally and mechanically de-sensitised to the presence
of external ice (Wisniewski & Fuller, 1999). Where the severity of the stress is
more progressive, tolerant plants have evolved the ability to acclimatise,
defined by Kacperska, 1999) as the non-heritable modification of structure and
function in response to stress, in a way that reduces harm and thereby improves
fitness. The plant response to low-temperature stress can be divided into three
distinct phases. The first is cold acclimation (pre-hardening), which occurs at
low, but above zero temperatures. The second stage (hardening), during which
the full degree of tolerance is achieved, requires exposure to a period of sub-
zero temperatures. The final phase is plant recovery after winter (Li, et al.,
2008). Some plants (especially trees) need a combination of short photoperiod
and low temperature to fully develop their cold tolerance. In these cases,
tolerance can be lost if the temperature is raised above zero and the
photoperiod is lengthened. Plant organs differ in their level of tolerance
typically the roots are much more sensitive than the crown (McKersie, 1994),
which is understandable given that the crown is the site of the major meristem
responsible for production of new roots and shoots at the end of the cold
period.
2.7 ENZYMATIC AND METABOLIC RESPONSE
Many enzymes are involved in the cold response machinery. In
addition to those associated with osmolyte metabolism, detoxification cascades
and photosynthesis, lignin metabolism (caffeic acid 3-O-methyltransferase),
secondary metabolism, cell wall polysaccharide remodelling, starch
metabolism, sterol biosynthesis and raffinose family oligosaccharide (myo-
32
inositol-1-phosphate synthase and galactinol synthase) synthesis are all
participants in the global response to cold stress (Renaut, et al., 2006). Whereas
the transcription level of genes involved in photosynthesis, tetrapyrrole
synthesis, cell wall, lipid and nucleotide metabolism is negatively correlated
with freezing tolerance, the level of transcription of genes associated with
carbohydrate, amino acid and secondary metabolism (e.g. flavonoids) is
positively correlated with freezing tolerance (Hannah, et al., 2006). Much
attention has been paid to studying the response of saccharide metabolism to
low-temperature conditions. The transcriptional up-regulation of the raffinose
oligosaccharide pathway results in accumulation of monosaccharides and
disaccharides (including glucose, fructose, sucrose, galactinol, melibiose and
raffinose) (Usadel, et al., 2008). A key enzyme in the synthesis of raffinose
oligosaccharides is galactinol synthase, which catalyses the first committed step
in raffinose synthesis. Transcription of this enzyme, along with that of raffinose
synthase and to some extent that of a number of enzymes involved in the
synthesis of precursors for the raffinose pathway, such as members of the
Myoinositol phosphate synthase family, is induced by a fall in temperature .
Raffinose accumulation on its own, however, is neither sufficient nor necessary
for the induction of freezing tolerance or cold acclimation in A. thaliana.
Nishizawa, et al., 2008 have also suggested the possibility that both galactinol
and raffinose are ROS scavengers. The drought, salinity and cold tolerance of
rice transformed with an over-expressed Escherichia coli trehalose biosynthetic
gene were all significantly better than the wild type (Garg, et al., 2002). In
addition to those in the raffinose pathway, other sugar metabolism enzymes are
also involved in the cold response. In A. thaliana, sucrose synthesis genes,
among which are those encoding sucrose phosphate synthase (SPS), are known
to be induced by low temperature (Usadel, et al., 2008), while transcript levels
33
of several members of the invertase family (along with the overall level of
invertase activity in the plant) are suppressed. In other plant species, such as
wheat and tomato for example, invertase activity is up-regulated by a fall in
temperature, although this effect is weak in accessions that are chilling tolerant
(Vargas, et al.,2007). Recent research has underlined a key role for metabolite
transporters in carbohydrate metabolism under low temperature conditions, as
well as their partitioning between the chloroplast and the cytosol (Guy, et al.,
2008). The metabolism of nitrogenous compounds is also responsive to low-
temperature stress (Usadel, et al., 2008), in particular that of certain amino
acids and polyamine compounds (Davey, et al., 2009). Transcript signal levels
of A. thaliana enzymes involved in amino acid metabolism are notably affected
by cold stress, with some being increased (especially those associated with
proline biosynthesis, those within the glutamate and ornithine pathways, and
those encoding cysteine and polyamine synthesis), and others, such as the
genes responsible for branched-chain amino acid degradation, tending to be
repressed (Usadel, et al., 2008). The metabolic fingerprinting of several
ecotypes of A. lyrata ssp. petraea has suggested a significant influence of cold
stress on the expression level of genes within the glutamine-associated
pathways (e.g.an increase in glutamine synthetase and suppression of
asparagine synthetase), which are important for the metabolism of nitrogen
(Davey, et al., 2009). GABA (c-aminobutyric acid) is an important amine-
containing metabolite associated with cryoprotection in barley and wheat
(Mazzucotelli, et al., 2006). It is synthesised in the cytosol via the
decarboxylation of glutamine by glutamate decarboxylase (GAD). In A.
thaliana, GAD genes are rapidly up-regulated by the imposition of cold stress,
well before any observable increase in GABA content (Kaplan, et al., 2007).
These data support the notion that glutamate availability and GAD activity are
34
associated with freezing tolerance and GABA biosynthesis (Guy, et al.,
2008).Transcript levels associated with lipid metabolism genes are generally
suppressed by a decrease in temperature (Hannah, et al., 2006). However, some
evidence derived from
A. thaliana shows that a number of lipid catabolism enzymes (in
particular, phospholipase A and D) are activated by a fall in temperature, and
this is followed by a rise in the amount of free fatty acids present (Usadel, et
al., 2008). Another important group of hydrolases, the galactolipases, are less
markedly cold-induced than the phospholipases, although an increase in their
activity is thought to contribute significantly to chilling susceptibility in plants.
Their lipo-hydrolytic activity is more likely to be linked to freezing tolerance
than to cold acclimation (Wang, et al., 2006). The expression of secondary
metabolism genes is generally well correlated with freezing tolerance (Usadel,
et al., 2008). In A. thaliana, cold stress induces the biosynthesis of flavonoids
and anthocyanins, glucosinolates, terpenoids and phenylpropanoids
(Kaplan, et al., 2007). Anthocyanin content is also positively correlated with
cold tolerance in some ecotypes, and its level in the leaf has been observed to
rise significantly during cold acclimation (Marczak, et al., 2008). This response
is also widespread among other plant species (Chalker-Scott, 1999). Above
normal levels of anthocyanin and the blue light absorbing flavonols in the leaf
ensure that chlorophyll is not over-excited under conditions of extreme cold
(Korn, et al., 2008). The presence of salicylic acid, which plays an important
role in plant defence against pathogens, can also be heightened by cold stress,
together with that of a range of secondary metabolism precursors, such as
phenylpropanoids, free fatty acids and branched or aromatic amino acids. This
suggests, perhaps, a link between the plants� defence machinery and protection
35
from cold-induced damage. Nevertheless, the, biosynthesis of certain
secondary metabolites (e.g. terpenoid, indole alkaloids in Catharanthus roseus)
is suppressed by low temperature (Dutta, et al., 2007). Transcriptome profiling
studies have also demonstrated increases in the expression level of genes
associated with ABA signalling, as well as of ABA responsive genes
(Usadel, et al., 2008). Finally, genes regulating other metabolic pathways,
along with signalling genes associated with secondary metabolism products
(such as jasmonic acid and ethylene) are down-regulated by cold. Overall,
these observations underline that the regulation of secondary metabolism is
highly complex in plants.
2.8 IN VITRO REGENERATION
Grain legume crops like pigeon pea, chickpea, Uradean, mungbean,
groundnut and soybean are extensively grown in the rainfed and dryland areas
of India. Despite large acreage under these crops, total productivity remains
low and has been stagnating for the last few decades. A number of biotic and
abiotic stresses are severely affecting full realization of the yield potential of
these crops. There is need to increase productivity and enhance the nutritional
value of these pulse crops. Cultivars resistant to biotic and abiotic stresses and
which have better protein quality and quantity are needed. Grain legumes have
a narrow genetic base since they are essentially self-pollinated (although cross-
pollination does take place, it is at very low frequency).Thus, there is need to
widen the genetic base and incorporate desirable characters. There is an urgent
need to use transgenic technologies for improvement of leguminous crops.
Worldwide, soybean is the only transgenic grain legume being cultivated in
nearly 63% of the total area under transgenics. Routine transformation
protocols are limited in most grain legumes. The low success has been
36
attributed to poor regeneration ability (especially via callus) and lack of
compatible gene delivery methods, although some success has been achieved in
soybean. This review is an attempt to summarize the studies on regeneration
and genetic transformation in grain legume and to identify the hurdles being
faced in the efficient recovery of transgenic plants. The review presents a
comparative account of explants used, mode of regeneration, gene delivery
techniques and recovery of transgenics in crops considered here.
Plant tissues regenerate in vitro through two pathways, namely
�organogenesis (it may be direct or indirect via callus mediated organogenesis).
The regeneration of complete plants via tissue culture has made it possible to
introduce foreign genes into plant cells and recover transgenic plants.
Morphogenesis could occur directly from the explant or indirectly via the
formation of a dedifferentiated callus.
2.8.1 Callus mediated regeneration
Immature embryos were used induce the callus, regeneration of viable
plants was obtained in soybean (Glycine max (L.) Merr). Regeneration
occurred via embryogenesis or via organogenesis. Embryogenesis resulted
when embryos were plated on (MS) medium containing 43 µM á-
naphthaleneacetic acid. To get effective result the addition of 5.0µM thiamine-
HCl increased embryogenesis from 33% to 58% of the embryos plated. By
giving External addition of 30µM nicotinic acid to the MS medium enhanced
embryogenesis further to 76%. Organogenesis was obtained when medium
containing 13.3 µM 6-benzylaminopurine, 0.2µM and á-naphthaleneacetic acid
and four times the normal concentration of MS minor salts was used
(Barwale, et al.,1986).
37
Ignacimuthu and Franklin (1998) reported formation of from
cotyledons and embryonal axis explants cultured on BA (N6- benzyladenine)
and NAA (á-naphthalene acetic acid) supplemented medium. The percentage
of callus induction increased with an increase in the BAP concentration. This
also exhibited a concomitant decrease in shoot initiation.
(Muhammad et al., 2008) five-day-old in vitro grown seedlings of
cowpea was obtained in MS supplemented with 0.50 mg/l BAP - 0, 0.10, 0.30 and
0.50 mg/l NAA. Callusing was recorded on all cultures containing 0.5 mg/l BAP
with and without NAA. However, increased diameter of calli was recorded on MS
medium containing 0.5 mg/l BAP - 0.1, 0.3 and 0.5 mg/l NAA.
Harisaranraj, et al., 2008. In this study used half seed explants in Vigna
mungo (L) Hepper organogenesis. Half seed explants were inoculated onto B5
medium supplemented with kinetin (4.7ìM to 23.5ìM), 6-benzyladenine
(4.4ìM to 22.2ìM), á-naphthalene acetic acid (5.4ìM to 27.0ìM), indole
butyric acid (4.9ìM to 24.5ìM) and 2, 4- dichlorophenoxyacetic acid (4.5ìM
to 22.5ìM). Callus initiation was observed in all media evaluated and the
highest cell proliferation was obtained from explants cultivated in the presence
of 13. 3ìM BAP and 13.5ìM 2, 4-D.
Priya Srivastava et al., 2011 developed the regeneration protocol by
using leaf explant in Vigna mungo (L) silvestris organogenesis. Primary
immature leaf segment were inoculated on MS medium supplemented with 2,
4-dichlorophenoxyacetic acid (0.5ìM to 72.5ìM), Callus initiation was beastly
observed on media and having the highest cell proliferation was obtained from
explants cultivated in the presence of 2, 4-dichlorophenoxyacetic acid. Shoot
induction was obtained from callus induced on 6.0ìM 2, 4-D at 6 weeks after
transferring the callus and then regenerated media.
38
2.8.2 Direct organogenesis
Axillary shoot proliferation of Vigna mungo L. Hepper has been
reported from cotyledons (with intact cotyledonary nodes) cultured on
cytokinin-containing medium (Gill, et al., 1987).
The beneficial effect of BAP in increasing shoot regeneration
efficiency during seed germination (pre-conditioning) from cotyledonary node
explants has been observed previously in the legumes Glycine max (Thorne, et
al., 1995), Cajanus cajan (Shiv Prakash, et al., 1997) and Phaseolus species
(Santalla, et al., 1998).
The effect of adenine sulphate (AdS) was similar to that of the control.
The shoots developed on kinetin, 2-ip and zeatin were robust and longer than
those induced on BAP. BAP alone was found to be effective in multiple shoot
induction from similar explants of other grain legumes like Phaseolus vulgaris
(Aragao, et al., 1998) and Vigna unguiculata (Brar, et al., 1997).
Ignacimuthu and Franklin, (1998) reported formation of multiple
shoots in 15 days from cotyledons and embryonal axis explants cultured on BA
(N6- benzyladenine) and NAA (á-naphthaleneacetic acid) supplemented
medium. The percentage of callus induction increased with an increase in the
BAP concentration. This also exhibited a concomitant decrease in shoot
initiation. Similar results were found with shoot apical meristem cultures of
grain legumes, using combinations of an auxin and a cytokinin for callus
induction and differentiation (Gulati and Jaiwal, 1992).
Thidiazuron has been demonstrated as a better induction factor for
organogenesis and somatic embryogenesis in chickpea (Murthy et al., 1996;
Rizvi et al., 2000). N-phenyl-N�-(1-2- 3-thidiazol-5-yl) urea or thidiazuron
39
(TDZ) having a high cytokinin like activity have been found very useful for
rapid regeneration protocol by direct organogenesis (Malik and Saxena, 1992;
Murthy et al., 1996).
Das, (1998) reported that regeneration has been achieved in Vigna
mungo L. through organogenesis using explants from axillary shoots
originating from the nodes of seedlings germinated in cytokine containing
medium. He germinated Seeds in thidiazuron (TDZ) at 0. 5 mg /L
supplemented MS medium produced: 11 axillary shoot: cotyledonary node.
Stem and petiole explants derived from these axillary-shoots produced callus
along with shoot-buds after 2 weeks of culture on half strength MS
supplemented with 0.1 mg/L á-napthalene acetic acid. Shoot-buds were also
produced from various sites of injury caused by incisions on the stem explants.
Full strength MS salts inhibited bud formation. The pH of the regeneration
medium had a significant effect on regeneration efficiency. The shoot-buds
elongated and rooted on one third strength MS medium. The plantlets were
transferred to soil after 3 weeks and 90�95% of the plantlets thus obtained
could survive transfer to soil.
Das, (2002) reported more efficient regeneration system in black gram
by using liquid culture method. Young multiple shoots obtained by germinating
the seeds in 2mg/L BAP (8.9mM), N6- benzyladenine-supplemented
Murashige and Skoog (MS) medium were used as a source of tissue to initiate
the liquid culture. The liquid medium consisted of half-strength B5 or MS salts
supplemented with MS organics, a naphthalene acetic acid (0.1 mg/L, 0. 4mM)
and N6-benzyladenine (0.5 mg/L, 2.2mM). Transferring the growing tissues to
fresh medium every third day resulted in 142% increase in the number of shoot
buds produced after 24 days.
40
Muruganantham, et al., 2004 used eighteen day old immature
cotyledonary nod explants of black gram produced multiple shoot in MS salt
+B5vitamins containing medium in presence of (1.0 mg/L), TDZ(0.1 mg/L)
and Ads (15mg/L) maximum shoot proliferation (28 shoot/explants) occurred
at the end of second subculture after 45d. The combination of TDZ and Ads
with significantly increased shoot proliferation. Elongation were performed in
GA3 (0.6mg/l) containing media.
Varalaxmi, et al, (2007) soaked black gram seed in sterilled water for
18h in dark from the imbibed seed were separated the cotyledon along with
embryonal axis was placed in such a way that the embryonal axis was in
contact with the medium MS containing b5 vitamins, and combinations of
different plant growth regulators, BAP, NAA and IAA. The plant regulator
combination tested were BAP (1, 2, 3, mg/lit) alone and in combination with
0.5mg/l NAA or with 1mg/lit IAA. One subculture done after 1wk. they were
subsequently transferred to regeneration media containing 3mg/l BAP and
maintained in light for 20days. after 20 days transfer on media containing
575mg/lit proline, 760mg/lit glutamine, 3. 0mg/l BAP, or 0.5 mg/l IBA was
tested in MS1/2 strength MS+B5 regeneration medium for assessing their
effect on shoot development. Cotyledonary node of Vigna mungo by culturing
them on low concentration of (1, 2, 3 mg/L BAP ) followed by transfer to
hormone free MS medium. After 10 days transfer on medium containing 1.0
mg/L BAP gave higher number of shoots (9.33/explant) compared to culture of
the explants on hormone free medium for 15 days followed by transfer to
medium containing 1.0 mg/L BAP (8.33/explants). (Mony et al., 2010).
Muhammad, et al., (2008) Five-day-old in vitro grown seedlings of
cowpea was obtained in MS supplemented with 0.50 mg/l BAP - 0, 0.10, 0.30
41
and 0.50 mg/l NAA. The highest frequency (%) of shoot regeneration and
mean number of shoots per explant was recorded on MS medium containing
0.5 mg/l BAP without NAA. Addition of any concentration of NAA resulted in
significant decrease in the frequency shoot regeneration and mean number of
shoots per explant. Maximum mean number of 2.60 shoots per explant was
obtained on MS without NAA
Andres and Gatica, (2010) achieved regeneration done in common bean
(Phaseolus vulgaris) by using N6-benzylaminopurine(BAP) and adenine
sulphate (AS) was established. Embryogenic axes of the common bean were
cultured on MS Medium supplemented with BAP (0, 5 and 10 mg/L), AS (0,
20 and 40 100, mg/L). Regardless of the concentration of BAP and AS in the
induction medium, the higher average of shoots was obtained. , the induction
medium supplemented with 5 mg/L BAP and 20 or 40 mg/L AS resulted in the
higher average of shoots formation.
Yadavetal et al. (2010) reported yielding up to 27 shoot using double
cotyledonary node explants of cultivar ML 267 of green gram. The explants
were derived from 3 days �old seedling germinated on MS and B5 media
containing (2.0 mg/L- BAP). They were initially culture on MS B5 media
augmented with different concentration of BAP and very low concentration of
different auxins (NAA, IAA, &IBA) and cytokinin for shoot bud induction. the
explants showing multiple shoot bud initial were transferred to MS, B5 media
containing reduced concentrations of BAP for shoot proliferation. Among the
different auxins and cytokinins tested, best regeneration response.
Firoz Anwar et al. (2011) reported regeneration system for Vicia faba
(L), using single cotyledon explants with half embryonal axis. MS medium
42
supplemented with 6 µM TDZ (thidiazuron), 10 µM 2-iP and 4 µM kinetin
induced 30 to 50 adventitious buds /shoots after two weeks of culture, which
were elongated on MS medium supplemented with 6 µM 2-iP and 2 µM
kinetin. With healthy and strong roots established on MS medium
supplemented with 5 µM IBA within 10 to 14 days.. TDZ promoted
adventitious bud formation while 5 µM IBA was most suitable for rooting,
higher concentrations were toxic to plantlets.
Sumita Acharjee et al. (2012) regenerated blackgram (Vigna mungo)
using Thidiazuron (TDZ) in the culture medium. The explanted cotyledon with
wounded embryonic axes produced the highest number (9.75-10.45) of healthy,
elongated shoots when cultured on shoot bud regeneration medium (SRI)
composed of 2 µM BAP, 2 µM KIN, 2 µM TDZ, and 0.5 µM NAA followed
by multiple shoot regeneration (SRII) medium containing 2 µM BAP, 2 µM
KIN, and multiple shoot elongation (SE) medium (0.5 µM of BAP + 0.5M of
KIN). The presence of TDZ in combination with BAP and NAA in the SRI
medium for one sub-culture cycle (10 - 14 days) significantly increases
formation of multiple shoot buds per explant. Independent, healthy shoots
obtained were selected for both in vitro rooting and grafting. Establishment of
plantlets in the soil was highest (80 - 100%) in the case of in vitro rooted
compared to grafted shoots (40%).
2.8.3 Somatic embryogenesis
Somatic embryogenesis, the production of bipolar embryo structures
from somatic cells, other than zygote, is of considerable theoretical and
practical importance. The information regarding direct or indirect plant
regeneration via somatic embryogenesis may be useful for production of
43
somaclonal variants, clonal multiplication and genetic transformation studies
(Hartweek, et al., 1988)
The role of ABA in somatic embryo development has been well
documented ABA was found to be essential for the maturation process because
it increased fatty acid content (Feirer, et al., 1989) or because it induced
specific protein synthesis (Hatzopoulos, et al.,, 1990) favoring somatic embryo
maturation. ABA has been shown to significantly increase the frequency of the
induction of torpedo-shaped embryos and their maturation
Produced a large number of globular, heart-shaped, and torpedo shaped
embryos in the medium containing 0.25mg/L 2, 4- D and 20mg/l L-glutamine.
Increased concentrations of 2, 4-D resulted in a decline in the frequency of
embryogenesis. The presence of 2, 4-D in the initial callus forming medium has
been shown to be essential for the induction of somatic embryogenesis in V.
acontifolia, V. mungo, and V. radiata as well as other legumes (Anbazhagan
and Ganapathi, 1999). Subsequently, V. mungo callus developed somatic
embryos in suspension culture with a reduced level of 2, 4- D to permit further
development (Sankara Rao. 1996)
Eapen and George (1990) reported the induction of somatic embryos
from immature cotyledon-derived call us of V. mungo on L6 liquid medium
with picloram, GA3, casein hydrolysate, and sorbitol with a cytokinin.
However, Eapen and George (1990) were not able to induce the development
of embryos past the torpedo stage (Patel, et al., 1991) reported that
benzyladenine was essential for the induction of somatic embryos from leaf-
derived callus of V. mungo cultured on MS medium.
44
In vitro somatic embryogenesis from cell suspension cultures of
cowpea (Vigna unguiculata (L) Walp). Torpedo-shaped embryos began to
mature to cotyledonary stage within 7 d of transfer into MS liquid medium
containing 0.5mg/L (ABA). Mature cotyledonary stage embryos are capable of
converting into complete plantlets. At the end of the maturation treatment, most
embryos changed colour from deep yellow to dull white and are
physiologically mature with the initiation of root and shoot primordia. Similar
results were observed in cowpea by (Ramakrishnan, et al., 2005).
The somatic embryogenesis by using liquid shake culture of
embryogenic calluses was achieved in black gram by Muruganantham et al.
(2010).The production of embryogenic callus was induced by seeding primary
leaf explants of V. mungo onto (MS) medium supplemented (optimally) with
1.5mg/l 2, 4-dichlorophenoxyacetic acid. The embryogenic callus was then
transferred to liquid MS medium supplemented (optimally) with 0.25mg/l 2, 4-
dichloro phenoxyacetic acid. Globular, heart-shaped, and torpedo-shaped
embryos developed in liquid culture. The optimal carbohydrate source for
production of somatic embryos was 3% sucrose (compared to glucose, fructose,
and maltose). L-Glutamine (20 mg/l) stimulated the production of all somatic
embryo stages significantly. Torpedo-shaped embryos were transferred to MS
liquid medium containing 0.5mg/l abscisic acid to induce the maturation of
cotyledonary-stage embryos. Cotyledonary-stage embryos were transferred to
1/2-MS semi-solid basal medium for embryo conversion. Approximately 1�
1.5% of the embryos developed into plants.
Sivakumar, (2010) optimized somatic embryogenesis was processes in
Urad beans [Vigna radiata (L.) Wilczek cv.Vamban]. Primary leaf explants
were used for embryogenic callus induction in MS medium with B5 vitamins)
45
containing 2.0 mg/L 2, 4-dichlorophenoxyacetic acid (2, 4-D), 150 mg/L
glutamine and 3 % sucrose. Fast growing, highly embryogenic cell suspensions
were established from 21-d-old callus in MS medium supplemented with 0. 5
mg/L 2, 4-D and 50 mg/L proline (Pro), and maximum recovery of globular
(39.0 %), heart-shaped (26. 3 %) and torpedo-stage (21.0 %) somatic embryos
were observed in this medium. Mature cotyledonary-stage somatic embryos
were cultured for 5 d in half strength B5 liquid medium containing 0.05mg/L 2,
4-D, 20mg/L Pro, 5ìM abscisic acid, 1000mg/L KNO3, 50mg/L polyethylene
glycol (PEG 6000) and 30 g/L D- mannitol. Mature somatic embryos were
germinated after dessication for 3 d and complete development of plantlets
accomplished in MS medium containing 30 g dm-3 maltose, 0.5 mg dm-3
benzyladenine and 500 mg dm-3 KNO3.
2.8.4 Rhizogenesis
Along with percentage response of shoots for rooting, quality and
number of roots produced per shoot is also important, which is determined by
the type and concentration of auxins, Bassiri, et al., (1985) reported that only
IBA 1. 0 mg/L produced 10 roots per explants sometimes auxin- auxin
combination.
Altaf and Ahmad, 1986 (0. 5 ìMBA + 1-10ìM NAA) Mallikarjuna, et
al., 1993 (1/10 B5 medium + 2 mg L-1 IAA + 0.5 mg/l NAA) Vani and Reddy,
1996 (B5+IAA (4mg/l) + KIN (0.5mg/l); Chakrabarty, et al., 2000 (MS salts +
B5 vitamins + 3 sucrose + 5.0mg/l IAA + 0.5mg/l KIN; Reddy, et al., 2001 (B5
medium 2 mg/l IAA + 2mg/l BAP).) used Auxins (IAA, IBA, NAA) and
cytokinins (kinetin and BAP) for rooting inducers in chickpea. For root
induction, IBA has been most frequently used by many workers at various
concentrations.
46
Barna and Wakhlu, 1994 (1ìM/L), Sharma and Amla, 1998 (2ìM/l),
Arachiasamy, 2000 (2.46ìM and 4.92ìM/l, and Jayanand et al, 2003 (5ìM/L)
and Rizvi, et al., 2000 (2.5ìM/l). IBA proved the above combination of auxins
and cytokinins to be the best rooting factor which induced high percentage of
rooting (71.5%) in chickpea.
The best medium was WH supplemented with 2.5ìM IBA. A novel
rooting system was developed by Jayanand, et al. (2003) by placing the
elongated shoots on a filter bridge immersed in MS liquid medium
supplemented with 5ìM IBA which resulted in rooting frequency of up to 90
per cent.
Next to IBA, NAA is the frequently used auxin. Better rooting
response was reported when the media was supplemented with 2.5ìM NAA
(Malik and Saxena, 1992). It was found that excised shoots were difficult to
root if exposed to TDZ for a period longer than 2-3 weeks. So also is the case
when TDZ was used at 5ìM or higher concentration where it suppressed the
primary roots and as well as secondary roots. Similar trend was observed by
Polisetty et al.(1997) when BA was used at higher concentrations (Briggs et
al., 1988). To induce rooting different concentrations of NAA was tested by
Surya-Parkash et al.(1992). Frequency of root differentiation declined when
NAA was deleted from the medium. They also highlighted the importance of
quality of shoots cultured on RIM (root induction medium) to get normal
rooting. Increased concentration of agar-agar (1.2%) and inclusion of activated
charcoal (0.2%) improved the degree and percentage of root differentiation.
Similarly other workers Adkins, et al.,1995 (half MS salts and B5
vitamins + 2 mg/l NAA + 0.5 g activated charcoal), Murthy, et al., 1996, (MS
47
+ 2. 5 f M NAA), Rao et al., 1997 (½ MS + 1 mg/L NAA), Altinkut, et al.,
1997 (1 mg/l NAA), Ramana and Sadanandam, 1997 (1 mg/l NAA),
Senthil, et al., 2004 (2. 5mM/L NAA) used NAA at different levels to induce
rooting. Few workers reported that the rooting response is also dependent on
the genetic background of explant. Brandt and Hess (1994) observed
differential response for rooting in desi and kabuli cultivars. The highest rate of
rooting shoots (71. 5%) in case of A-1 and 68. 3 per cent in ICCV-2 with
simultaneous good shoot growth was obtained on WH medium supplemented
with 2.5ìM IBA.
Similarly IAA was used by Subhadra et al. (1998) and Batra et al.
(2002) at the concentration of 1 mg/L. The rooting response is also dependent
on the nature of media. Significant differences were noticed between liquid and
solid rooting medium supplemented with NAA, with average rooting of 16.5
per cent and 84.7 per cent in solid and liquid medium respectively Chaturvedi
and Chand, (2001) obtained 50 per cent rooting with 0.8 mg/l NAA in solid
medium and 70 per cent with 1.2 mg/l NAA and 0.04 mg/l IBA. The induced
roots were thicker and longer in liquid medium than in solid medium.
Proliferation of roots was observed only when transferred to liquid plain ½ MS
after the root induction (Kar, et al., 1996). Similarly, Polisetty, et al., (1997)
subcultured plant lets on ¼ th strength MS medium without agar to get good
root growth. Quality of roots can be improved by increasing the agar-agar
concentration in the medium and also helps the normal growth of the plantlets
by reducing the degree of vitrification.
Shoots were rooted in half strength MS under partial dark conditions
(Batra, et al., 2002). Some workers used ¼th strength of MS medium (Singh, et
al., 2002), ½ strength MS medium (Sharma and Amla, 1998) and ½ strength
48
B5 medium (Ramana and Sadanandam, 1997) for root induction. Whereas,
Malik and Saxena, (1992) did not find any difference between media that
contained half or full strength of MS salts for rooting. Singh B. D. (2007) also
highlighted that exogenous carbon source was not needed.
Rooting and transplantation of chickpea is now no more a hurdle for
chickpea transformation. Healthy and strong rooting was achieved by exposing
cut ends of the in vitro raised shoots (3-5 cm) to 5-10 sec pulse treatment with
100 ì moles/ml IBA followed by their transfer to liquid MS basal medium.
Potting-mixture with good aeration and les ser capacity to retain water was
most suitable for successful establishment of plantlets. Garden soil mixed with
sand and bio-manure in equal proportion was most suitable for achieving cent
percent transplantation success. Cent percent of plantlets acclimatized in pots
and showed normal growth, development, flowering, pods and seeds setting. In
this communication, we have shown that shoot length, pulse treatment of cut
ends of shoots with 100 moles /ml IBA (1st report) and aeration of potting
mixture are key factors for rapid micro-propagation and successful
establishment of in vitro raised chickpea plantlets.
Muhammad, et al., 2008 five-day-old in vitro grown seedlings of
cowpea was obtained in MS supplemented with 0.50 mg/l BAP - 0, 0.10, 0.30
and 0.50 mg/l NAA. Regenerated shoots were rooted on MS containing 0.50
mg/l IBA where up to seven adventitous secondary shoots arose from the base
of mother shoot were also recorded. These shoots could also be rooted easily
on the same rooting medium. Rooted plants were adapted at room temperature
in soil mix in pots. All plants flowered and set seeds in the growth room after
three months.
49
In black gram shoot buds elongated on one-third-strength MS (MS1/3)
semisolid medium and plantlets were obtained by transferring the shoots onto
ms1/3 semisolid medium supplemented with indolebutyric acid (1 mg/L, 4.
9mM) for rooting Das( 2002). The rooting development in black gram
observed in half MS medium with NAA, IAA, IBA (-mg/L). (Muruganantham,
2004), The high frequency (100. 0%) of rooting was observed with MS
medium supplemented with 0. 5 mg l-1 IBA. Mony, et al., (2010)
2.8.5 Hardening and Establishment of regenerated plants
Ultimately regenerated plants were establishment in soil. It is
recommended that removal of sugar from the support medium, pre-
conditioning to low relative humidity, high light intensity and high temperature
can ensure higher survival during transfer of plantlets to natural conditions. The
gradual removal of sugar is known to stimulate photosynthetic ability. Neelam,
et al., (1986) used autoclaved soil: sand: compost (1:1:1) mixture, as potting
mixture. Obtained only 30-40 per cent survivability. The mortality was due to
soft, weak stems and roots without good differentiation of vessels and due to
inability to pick the nutrients from soil when transferred from agar medium.
Among the different potting mixtures used, pure vermiculite was the best and
supported the survival of 85.4 per cent plants. Only 20.4 per cent plants
survived when transferred to the vermiculite and perlite (1:1) mixture whereas
the plants transferred to the sand, soil and sawdust mixture (1:1:1) did not
survive (Barna and Wakhlu, 1994).
Surya- Parkash et al., 1992 made attempts to transfer rooted plantlets
to sterilized pots containing soil, sand and vermiculite in 1:1:1 ratio. However,
no success was achieved. Soil rite was used as inert supporting powder. Kumar,
et al., (1994) obtained matured plantlets by adding soil rite to liquid ¼ strength
50
MS medium without sucrose. Polisetty, et al., (1997) irrigated potted plants
with ¼ strength Hoagland�s nutrient medium. Rooted plantlets of black gram
(ca. 5 cm) were transferred to autoclaved vermiculite in 6-cm plastic pots and
covered with a plastic cover to maintain humidity. Two weeks after transfer to
pots, the covers were gradually removed over a period of 7 days, before the
plantlets were finally transferred to soil Das, et al. (2002). Jayanand, et al.,
(2003) derived a comprehensive method for the hardening and transplantation
to glasshouse.
Among the various potting media tried such as black soil, red soil,
smooth sand, coarse sand and vermiculite individually and in combination with
each other, coarse sand showed the best results with about 80 per cent survival.
As the regenerate plantlets have to be adopted not only to soil but to higher
light intensities and lower atmospheric humidity as well, they standardized the
requirement of temperature, humidity, light intensity and photoperiod during
different stages of plant growth (Singh, 2007).
2.9 TRANSFORMATION STUDIES
2.9.1 Efficient techniques for transformation
The development of efficient transformation method is frequently not
straight forward and can take many years of painstaking research with a range of
different methods (Potrykus, 1991). Although several approaches have been tried
successfully for integrative transformation (Potrykus, 1991)only three are widely
used to introduce genes into a wide range of crop plants (Dale et al.,, 1993). These
include (i) Agrobacterium mediated gene transfer, (ii) microprojectile
bombardment with DNA or biolistics and (iii) direct DNA transfer into
isolated protoplasts. Of these techniques the first two approaches have been
more successfully used in many of crops and chickpea in specific.
51
2.9.2 Indirect method of Gene transformation (Agrobacterium mediated)
A. tumefaciens plasmid transfers only T-DNA. In principle, desired
DNA sequence can be intentionally introduced into plant genomes (Zambryski,
et al., 1983; Trieu, et al., 2000). The oncogenic T-DNA region is deleted from
Agrobacterium strain in order to prevent over production of phytohormones,
which interfere regeneration from tissue and with normal plant development.
The strain with disarmed T-DNA has only the �vir� region and is a suitable
system for plant transformation. The T-DNA transfer is mediated by products
encoded by the �vir� (virulence) region of the Ti-plasmid, which is composed
of at least six inducible operons that are activated by signal molecules, mainly
small phenolics, certain class of monosaccharides and acidic pH acts
synergistically with phenolic compounds (Riva, et al., 1998).
Induction of �vir� operons by inclusion of phenolics like
acetosyringone in the co-cultivation medium could therefore enhance T-DNA
transfer to plant cells. Addition of 50ìM acetosyringone to the bacterial re-
suspension medium as well as co-cultivation medium resulted in non-
significant increase in transformation frequency from 88 % in cultures without
acetosyringoneto 95 % with large GUS positive sector(s). Acetosyringone
enhances vir functions during transformation (Stach, et al., 1996) and has been
shown to increase transformation potential of Agrobacterium strain with
moderately virulent vir region in several plant species (Atkinson and Gardner
1991, Janssen and Gardner, 1993:Kaneyoshi, et al., 1994).
Injuries implicated with the help of hypodermic needle, enhanced the
frequency of transient GUS expression, at the regeneration and cotyledons
detachment sites of the cotyledonary nodes up to 98 %. Wounding the plant
material before co-cultivation allows better bacterial penetration into the tissue
52
facilitating the accessibility of plant cells for Agrobacterium or possibly stimulated
the production of potent �vir� gene inducers like phenolic substances such as
acetosyringone and hydroxyl acetosyringone (Stach et al.1996) and enhanced the
plant cell competence for transformation (Binns and Thomashow, 1988).
Wounding the plant material before co-cultivation has also been shown
to increase transformation frequency. Mechanical injury of the meristematic
region probably induces meristem reorganizations promoting formation of
large transgenic sectors and enhanced recovery of transformants. Pre-culture of
explants on regeneration medium prior to inoculation and co-cultivation with
Agrobacterium has been reported to enhance efficiency of transformation in
some grain legumes, e. g. Vigna unguiculata (Muthukumar, et al., 1996) and
Cajanus cajan (Geetha, et al., 1999).
These signal molecules are recognized especially by Agrobacterium to
induce �vir� gene expression and thereby activate T-DNA transfer (Zambryski,
1992). When preculture was combined with mechanical injury the results were
reversed that leads to increase in transient GUS expression up to 100 % and
specifically at the regeneration site of the cotyledonary node explants. This
may be attributed to visually more clear regeneration site on the pre-cultured
explants for mechanical injury as compared to non-pre-cultured and freshly
release of phenolics as a result of mechanical injury. High vigor of pre-cultured
explants was also found to increases the regenerability of mechanically injured
explants. It is concluded that inoculation of pre-cultured and mechanically
injured cotyledonary node explants of V. mungo for 30 min with A. tumefaciens
at a density of 108 cells cm-3 followed by co-culture on SR medium for 3 d has
been found more beneficial and resulted in the production of significant
number of transgenic plants to efficiency of 4.31 %. (Saini, et al., 2007).
53
In Agrobacteria mediated transformation many co-cultivation, culture
and micro environmental condition affected the transformation efficiency. The
length of co-cultivation period required for achieving maximum gene transfer
was found to be 2 - 3 d with no significant difference between them for
cotyledonary node explants of Vigna mungo. Further extension in co-culture
time decreased the transformation frequency resulting in bacterial overgrowth
and had detrimental effect on regeneration potential of explants. A short co-
culture period of 2 or 3 d has also been found to be optimum in other plant
species such as Antirrhinum majus (Holford, et al., 1992), Vigna unguiculata
(Muthukumar, et al., 1996), Vigna radiate (Jaiwal, et al., 2001), Cajanus cajan
(Mohan and Krishnamurthy, 2003), Glycine max (Li ,et al., 2004) and
Nicotiana tabacum (Uranbey, et al., 2005).
The modification in the co-cultivation media for avoiding necrosis
which occurring during incubation for 72 h, due to the Agrobacterium over
infection to plant and hypersensitivity reaction given by the plant against to
Agrobacterium for this modifying LPGM medium with acetosyringone, sodium
thiosulphate, L-cysteine and di-thiothreitol and incubated at 25°C±20C in the
dark given in chickpea genetic transformation with Agrobacterium mediated
protocol. (S. Ignacimuthu and Prakas, 2006)
The improvement in black gram for salt stress tolerance through
Agrobacterium mediated genetic transformation was done by the over-
expression of the Glyoxalase 1 (Gly 1) gene. (Muruganantham, et al., 2007)
reported the herbicide tolerant (Vigna mungo L. Hepper) plants were produced
using cotyledonary-node and shoot-tip explants from seedlings. In vitro
selection was performed with phosphinothricin as the selection agent. Explants
were inoculated with Agrobacterium tumefaciens strain LBA4404 (harboring
54
the binary vector pME 524 carrying the nptII, bar, and uidA genes) in the
presence of acetosyringone. Shoot regeneration occurred for 6 wk on
regeneration medium (MS medium with 4.44ìM benzyl adenine, 0.91ìM
thidiazuron, and 81.43ìM adenine sulfate). Transgenic black gram plants were
produced at a 1% transformation. Frequency using kanamycin (75 mg/l) from
cotyledonary-node explants (Saini and Jaiwal, 2003), where chimeras (79%)
were observed as a result of a high level of antibiotic tolerance in the explants.
More than 50% of the putatively transformed mungbean shoots growing in
kanamycin-containing media were escapees after co-cultivation of
cotyledonary-node explants (Jaiwal, et al., 2001). PPT (10 mg/l) proved to be
more efficient than kanamycin for rapid selection, production, and
identification of putative pea transformants.
The potential of genetic engineering to incorporate insect resistance
cholesterol oxidase gene (choM) into mung bean plants through Plasmid
pCAMBIA 1301-choA was transformed into Agrobacterium rhizogenes strain
K599 and A. tumefaciens strain EHA 105 for mungbean transformation. The
two-day-old cotyledons that were co-cultured with hairy root bacteria showed
higher ability to produce branched roots than the others. An average of 10
branched roots was formed on both the wounded axial site and the hypocotyl
cut end. Ten of 75 individual lines (13.25%) showed GUS positive. In addition,
cotyledons that were cut and cultured on MB medium supplemented with
2mg/L BAP for 4 days before co-culture with A. tumefaciens using hairy root
method revealed high transformation ability (31.25%) discovered by(Potjamarn
suraninpong, et al., 2004).
Sita Mahalakshmi, et al.(2006) was reported Transgenic mungbean
plants were developed via primary leaf explants with disarmed Agrobacterium
55
tumefaciens strain C-58 harbouring a binary plasmid, pCAMBIA� 1301
(containing genes for b-glucuronidase (GUS) and hygromycin
phosphotransferase (hpt)]. By using of primary leaf explants (cut at the node)
from four-day old and ten-day-old seedlings.
Jaiwal.,2007 first time reported the normal and fertile transgenic plants
of mungbean with two transgenes, bar and á-amylase inhibitor, Cotyledonary
node explants were transformed by co-cultivation with Agrobacterium
tumefaciens strain EHA105 harboring a binary vector pKSB that carried
bialaphos resistance (bar) gene and Phaseolus vulgaris á-amylase inhibitor-1
(áAI-1) gene. Green transformed shoots were regenerated and rooted on
medium containing phosphinothricin (PPT).
Islam and Islam (2010) used two different types of explants, namely
cotyledonary leaf and cotyledon attached with embryonic axis (CAEA) were
used in different experiments. CAEA and cotyledonary leaf explants were
infected with A.tumefaciens strain LBA4404 harboring the binary plasmid
pBI121 containing gusA and Neomycin phosphotransferase (nptII) marker
genes to determine theirtransformation ability. Between two explants, CAEA
showed better response towards transformation than the cotyledonary leaf.
Maximum transformation of CAEA explants was obtained following 45 min of
infection with Agrobacterium suspension having an OD of 1.3 at 600 nm and
72 hours of co-cultivation as judged by transient GUS assays.
Sushil Kumar Yadav et al. (2012) reported highly efficient protocol for
genetic transformation mediated by Agrobacterium has been established for
green gram (Vigna radiata L. Wilczek). Double cotyledonary node (DCN)
explants were inoculated with Agrobacterium tumefaciens strain LBA 4404
56
harbouring a binary vector pCAMBIA 2301 containing neomycin
phosphotransferase (npt II) gene as selectable marker, ß-glucuronidase (GUS)
as a reporter (uidA) gene and annexin 1bj gene. Important parameters like
optical density of Agrobacterium culture, culture quantity, infection medium,
Infection and co-cultivation time and acetosyringone concentration were
standardized to optimize the transformation frequency. Kanamycin at a
concentration of 100 mg/l was used to select transformed cells. Transient and
stable GUS expressions were studied in transformed explants and regenerated
putative plants, respectively. Transformed shoot were produced on regeneration
medium containing 100 mg/l kanamycin and 250 mg/l cefotaxime and rooted
on ½ MS medium. Transient and constitutive GUS expression was observed in
DCN explants and different tissues of T0and T1 plants.
Yellisetty Varalaxmi et al.(2013) used Agrobacterium tumefaciens
strain LBA4404 harbouring binary vector pCAMBIA 2301, which contains a
neomycin phosphotransferase gene (nptII) and a -glucuronidase (GUS) gene
(uid A) for transformation of Vigna mungo cotyledon derived calli. Wounding
of explants before infection, osmotic effects of infection and co-cultivation
media had an effect on the competence of the tissue as well as transforming
ability of Agrobacterium cells. Transient GUS expression studies revealed
that a cell.
Density of 108cells/ml, 100 µM acetosyringone and 330 µM cysteine
were effective in increasing the transformation frequency and obtaining stable
transformants with a3.8% transformation efficiency. IBA pulse treatment was
effective in root induction of kanamycin selected putative transformants.
Molecular analysis using polymerase chain reaction (PCR) of nptII gene
confirmed the transgenic nature of T0 transformants.
57
2.9.3 Direct DNA transfer
Physical as well as chemical methods have been developed to facilitate
DNA delivery across the plasma membrane, which lead to both stable and
transient gene expression. The first report on direct delivery of DNA molecules
into plant protoplasts was documented by Davey, et al. (2009). However, in
Blackgram there are no reports on direct DNA transformation.
Microinjection, sonication, electroporation and biolistic mediated transfer are the
main procedures to let desired DNA molecules enter any living cell; plant, animal,
or microbial. Microinjection involves immobilization of protoplasts and micro
injecting DNA directly into the nucleus. Miki, et al. (1987) reported
transformation efficiencies of 12-66 per cent in tobacco. In the sonication process,
ultra sound waves are used to facilitate uptake of nucleic acids into plant cells and
protoplasts. Joersbo and Brunstedt (1992) used mild sonication (20 KHz) to
facilitate uptake of chloramphenicol transferase (cat gene) in tobacco and achieved
a maximum of 81per cent transient expression with no significant loss of viability.
The electroporation method was originally developed to introduce
DNA in prokaryotic cell (Fromm et al., 1985). This has been successfully
used for transformation of wide range of crop species including pigeonpea
(Christou et al., 1987)
2.9.4 Microprojectile bombardment with DNA or biolistic
Acceleration of heavy microprojectile (0.5-5.0 µ m diameter
tungsten or gold particles) coated with DNA has been developed into a
technique that carries genes into virtually every type of cell and tissue
(Klein, et al., 1988; Sanford, et al.,1990; Taylor and Vasil, 1991). This
method allows the transport of genes into many cells at nearly any desired
58
position in a plant. The technology basically involves loading tiny
tungsten or gold particles with vector DNA and then spreading the
particles on the surface of a mobile plate.
Then, under a partial vacuum, the microprojectile is fired
against a retaining plate or mesh by a shock wave caused by helium
under pressure achieving speeds of one to several hundred meters per
second. The particles are capable of penetrating several layers of cells and
allow the transformation of cells within tissue explants (Register, et al.,
1994). This technique, although not as efficient as the Agrobacterium-
mediated gene transfer, has a distinct advantage in that virtually any type
of meristematic totipotent cells, tissues, organs and monocots that are not readily
amenable to agro-infection can be used with a reasonable success rate. Another
major advantage lies in its application in transient gene expression studies in
differentiated tissues (Fitch et al., 1990).
2.9.5 Selectable markers
The genetic transformation of plants requires �marker� genes
that allow the recognition of the transformed cells in the background of
untransformed ones. These genes are dominant, usually of microbial origin
and placed under the control of strong, constitutive, eukaryotic promoters,
often of viral origin (Birch, 1997). The most popular selectable marker
genes used in plant transformation vectors include constructs providing
resistance to antibiotics such as kanamycin and hygromycin and genes that
allow growth in the presence of herbicides such as phosphinothricin,
glyphosate, bialaphos and several other chemicals. For successful
selection, the target plant cells must be susceptible to relatively low
concentrations of the antibiotic or herbicide. The utility of any particular
59
gene construct as a transformation marker varies depending on the plant
species and explant involved (Li, et al., 2002).
Kanamycin has proven to be the most widely applicable selective agent but
the concentration is species specific. Species like Vigna mungo L., Cicer arietinum
(Fontana, et al.,1993; Sanyal, et al., 2003; Sarmah, et al.,2004), Kanamycin has
been used for selection in most of the chickpea transformation studies
reported (Fontana et al.,1993; Kar et al.,1996, ; Krishamurthy, et al.,2000) are
selected at low concentration of kanamycin (15-100 mg/l). However, recently
Tewari-Singh, et al., (2004) used a desensitized aspartate kinase (AK) gene as a
non-antibiotic selection marker for production of transgenic chickpea, which was
found to be a better selection marker than kanamycin as transgenic plants could be
identified more easily and rapidly using the marker.
2.14.6 Molecular and genetic characterization of transgenic plants
The integration of the target gene is confirmed by technique
�polymerase chain reaction� (PCR) routinely, which screens putative transgenic
and classify either as positive or negative (Edwards et al.,1991). Another
technique could be used to detect the presence of a given sequence of DNA or
RNA in the non-fractionated (not subjected to electrophoresis) DNA is �Dot
blot�, where sample DNA�s from several individuals can be tested in a single
test run. Dot blots are useful in detecting presence of the sequence being
transferred in a number of suspected transgenic individuals and a presence of
specific mRNA in several such individuals or in different tissues of a single
individual. Southern blotting or southern hybridization (Southern, 1975) is used
to demonstrate the presence of the gene in question in transgenics, where
detection of DNA fragments which are complementary to given DNA is critical
(Sambrook and Russell, 2001). This is the common method to confirm the
60
stable integration of DNA in the genome and also to know the number of
copies integrated. Few examples of use of the Southern blotting to know the
presence of transgene are available in chickpea (Krishnamurthy, et al.,, 2000;
Kar, et al.,, 1996; Tewari-Singh, et al.,, 2004 and Sarmah, et al.,, 2004),
pigeonpea (Geetha, et al.,, 1999; Lawrence and Koundal, 2001). The number of
copies of a transgene construct inserted is variable for all transformation
methods. Data from several different transgenic dicotyledonous species showed
an average of three T-DNA inserts, with occasionally upto 20-50 copies in
some plants. Kar, et al., (1996) noted multiple gene inserts in all transgenic
chickpea plants while, Krishnamurth, et al. (2000) and Tewari-Singh, et al.
(2004) found 50 per cent single insert and 50 per cent multiple (4-6) gene
inserts. However, single copy insertion of the target gene based on strong
signal generated by hybridization of GUS and npt II specific homologous
probes was reported by (Sarmah, et al., 2004; Sanyal, et al., 2003).
The expression of transgenes can vary considerably between different
independently transformed plants (Hobbs, et al.,1990; Jefferson, et al., 1990;
Blundy, et al., 1991). In some instances there is a positive association between
transgene expression and copy number, but other studies have shown no
association or even a negative one (Hobbs, et al.,, 1990).
Transgene expression many a times be unstable or may decline over
generations. Several techniques have been used for detection of expression of inserted
gene such as northern hybridization, immunoblotting and western blotting
(Sambrook, et al.,1989; Saghai-Mahroof, et al.1984). Unlike Southern hybridization,
northern hybridization detects transcription of DNA sequence that is used as a probe.
This technique has been used to know the expression of cowpea protease inhibitor at
mRNA level in transgenic pigeon pea (Lawrence and Koundal, 2001).
61
Bhattacharya et al., (2002), used Southern confirmed plants for northern
blotting of Bt (cry IA(b)) transformants in cabbage and reported differences in the
level of transgene expression. Western blotting is used to detect proteins of a
particular specificity. When a transferred gene expresses in transformed cells, the
translated product in from of protein can be identified by this technique. Sarmah, et
al., (2004) analyzed PCR positive transgenic lines through western blotting and
compared with bean seed protein. The chickpea a-AII polypeptides detected by
western blotting had similar size to those found in bean seeds. This indicated that
the primary translation product, which is proteolytically processed in bean seeds,
was similarly processed in chickpea seeds. They also used this assay to estimate the
level of a-A II in the T1 seeds of transgenic lines.
The immunoblotting technique is based on antigen-antibody reaction. In
this method total protein from plants is fractioned on SDS-PAGE (10% polyacryl
amide) and transferred to PVDF and detected by antiserum of specific antigen.
Bhattacharya et al., (2002) detected Bt cry1Ab proteins using the rabbit anti cry
IA(b) serum and a goat antirabbit IgG coupled to alkaline phosphtase as secondary
antibody. They could detect 81.3 kDa cry protein through this method which was
further tested to know viability of second instar larvae of Plutella xylostella. They
observed high reduction in growth rate and mortality. Sarmah, et al., (2004) used
this technique to confirm the expression of the bean a- amylase inhibitor gene
against Callesobruchus maculatus in putative transgenic chickpea.
Sanyal et al., (2005) reported the expression of Cry1Ac in chickpea by
elisa method and he observed that there was variation in protein content in all
transgenic plants and it is because of site of its integration and number of
copies integrated into plants. There could be several reasons for non-expression
62
or low expression of the transgene in transgenic plants (Finnegan and
Mc Elroy, 1994; Matzke and Matzke, 1995).
These include pleiotropic effects from transgenes, somaclonal
variations in the regenerated transgenic plants or environmental effects on the
promoters driving the transgenes (Senthil et al., 2004)reported partial
suppression of Uid gene due to presence of two inserts in a tandem array which
tend to become inactivated as result of gene silencing. Although the CaMV35S
promoter is considered constitutive, its level of expression is found to change
with respect of cell cycle or the various tissues (Nagata et al., 1987).
Molecular characterization on the expression of Cry1Ac gene in chickpea
plants was carried out by Indurkar, et al. (2007) and reported the level of protein
expression in transgenic plants showing variation found 6-20 ng/ mg. The practical
way of avoiding problems associated with variation in transgene expression and
stability and somaclonal variation is to produce a large number of independently
transformed plants (often>100) and to select those with a desirable phenotype
(Birch, 1997). Except for vegetatively propagated crop plants, it is usually desirable
to identify genotypes 1with single inserts of the transgene construct which will have
simpler inheritance patterns and are likely to have more predictable transgene
expression levels in subsequent segregating populations. Following initial analysis,
the transgenic plants need to be moved into a containment glasshouse for further
phenotypic and genotypic analysis using the original non-transgenic genotype as a
control. Further evaluation of transgenic plants is done under agronomic conditions
by carrying out field assessment studies.
63
MATERIALS AND METHODS
The present work was carried out on �Studies on genetic
transformation of black gram (Vigna mungo L.) with cold induced
transcriptome gene (ICE- 1) for abiotic stress tolerance� during 2011-2013 at
the Department of Agricultural Biotechnology, College of Agriculture, Orissa
University of Agriculture and Technology, Bhubaneswar-751003 (Odisha).
The details of materials used and the experimental techniques adopted during
the entire course of investigation are presented in this chapter.
3.1 MATERIALS
3.1.1 Genotypes
The cultivar used in the present investigation is Type-9�(T-9) which is
released from Agriculture University, Kanpur. It is popular, high yielding
(8q/ha) and suitable for different agro- climatic situations of entire Orissa as
well as throughout India. The seeds of these varieties were collected from State
Seed Corporation, Odisha.
3.1.2 Explant source
Different types of explants from four days old sterile seedlings of cultivars
�T-9� were used for in vitro regeneration and transformation studies. The explants
used were Cotyledonary node and Cotyledonary node with Shoot tip.
3.1.3 Plant nutrient medium
For in vitro culture experiments Murashige and Skoog (1962) basal
salts were used (Appendix-I).
id2031101 pdfMachine by Broadgun Software - a great PDF writer! - a great PDF creator! - http://www.pdfmachine.com http://www.broadgun.com
64
3.1.4 Plant growth regulators
The following different plant growth regulators at different
concentrations in different experiments (Appendix-III) were used.
Auxins
Indole Butyric Acid (IBA)
Naphthalene Acetic Acid (NAA)
Cytokinins
Benzylamino purine (BAP)
Thidiazuron (TDZ)
Kinetin (Kn)
Gibberellin
Gibberllic acid (GA3)
3.1.5 Agrobacterium strain and plasmid vector
The disarmed Agrobacterium strain EHA105 harboring binary vector
pCAMBIA2301 was used for in vitro transformation. pCAMBIA2301 contains
ICE1 gene, nptII marker and GUS reporter gene linked to CaMV35S promoter
and nos terminator.
3.2 METHODOLOGY
3.2.1 Sterilization of Glassware and Media
Sterilization refers to any process that effectively kills or eliminates
transmissible agents (such as fungi, bacteria, viruses, spore forms, etc.) from a
working surface, equipment, article of food or medication, or biological culture
medium. Sterilization can be achieved through application of heat, chemicals,
irradiation, high pressure or filtration.
65
Plate . 2 Explant source of regeneration and transformation A. Seeds of black gram cultivar �T-9� B. sterile explants culture of 4 days C. Shoot tip with Cotyledonary node D. shoot tip
66
Fig -3 Schematic map of vector pCAMBIA2301
Fig- 4 Linear map of T-DNA region of vector pCAMBIA2301
67
3.2.2 Steam sterilization
A widely-used method for heat sterilization is the autoclave.
Autoclaves commonly use steam heated to 121°C or 134°C. To achieve
sterility, a holding time of at least 15 minutes at 121°C or 3 minutes at 134 °C
is required. Additional sterilizing time is usually required for liquids and
instruments packed in layers of cloth, as they may take longer to reach the
required temperature. After sterilization, autoclaved liquids must be cooled
slowly to avoid boiling over when the pressure is released.
3.2.3 Sterilization by filters
Hormones that would be damaged by heat, irradiation or chemical
sterilization can be sterilized by mechanical filtration. This method is
commonly used for sensitive pharmaceuticals and protein solutions in
biological research.
A filter with pore size 0.2 µm will effectively remove bacteria. If
viruses must also be removed, a much smaller pore size around 20 nm is
needed. Solutions filter slowly through membranes with smaller pore
diameters. Prions are not removed by filtration. The filtration equipment and
the filters themselves may be purchased as presterilized disposable units in
sealed packaging, or must be sterilized by the user, generally by autoclaving at
a temperature that does not damage the fragile filter membranes.
3.2.4 Glasswares and chemicals:
Glasswares like culture tubes, conical flasks, petriplates, beakers etc.,
are of Borosil make. All the chemicals and plant growth regulators are of
analytical grade and are procured from standard chemical manufacturing
companies.
68
3.2.5 Cleaning of glasswares
Glasswares were rinsed in water and then soaked in 0.15% chromic
acid overnight. The chromic acid were drained out and the glasswares were
washed with clean soap solution. The thoroughly washed glasswares are rinsed
in distilled water and dried in a hot air oven. The instruments like forceps,
scalpels etc., were also cleaned and dried.
3.2.6 Sterilization of glasswares:
Clean glasswares were rinsed in double distilled water and dried in
oven at 80C and sealed with aluminum foil, petriplates placed in autoclavable
covers, instruments like scalpel, forceps, and blade holders wrapped in
aluminum foil were autoclaved at 121 C and at 15 lbs. pressure for 15
minutes. The glasswares were then transferred to sterile inoculation chambers.
3.2.7 Sterilization of laminar- flow chamber:
All steps in this experiment like the sterilization, preparation,
inoculation of the explants, sub culturing were conducted under aseptic
condition in the laminar- flow cabinet. Before the laminar flow cabinet was
used, the working surface of the chamber is sterilized by swabbing with 70%
alcohol. The chamber was then exposed to UV light for 15 minutes. The walls
of the chamber were also swabbed with 70% alcohol to ensure total sterility.
Before taking the materials into cabinet, they were swabbed with 70% alcohol.
In case of glasswares, the mouth of the bottles, flasks etc. are flamed before
and after use. Also, before starting the experiment, the hands are swabbed well
with alcohol.
69
3.3 PREPARATION OF EXPLANTS
Seed were surface sterilized with 70% ethanol (v/v) for 1 minute
followed by washing twice with sterilized distilled water for 2-3 times. Seeds were
treated with 0.2% HgCl2 (w/v) solution for 3 minutes followed by thorough
washing for 4 to 5 times with sterile distilled water to remove all the traces of
HgCl2 and blot dried on sterilized filter paper. Sterilized seeds were germinated
under aseptic conditions on MS medium with 2 mg/l BAP for 4 days.
The following explants were taken from 4 day old seedlings under
sterile conditions using scalpel and blade.
Cotyledonary node
Cotyledonary node with Shoot tip
3.4. PREPARATION OF MEDIA
MS basal salts supplemented with different concentrations of different
growth regulators were used depending on the purpose of the individual
experiment. Separate stock solutions of macronutrients, micronutrients, iron
source and organic supplements (except Myoinositol) were prepared (Appendix
I). The medium was prepared by adding appropriate quantities of the stock
solutions and correct volume was made up with distilled water. Sucrose 30 g/l
and Myoinositol 100 mg/l were added freshly to the medium. The pH of the
medium was adjusted to 5.6 to 5.8 using 0.1N HCL or 0.1N NaOH. Then agar
7.5 g/l was added and dissolved by warming the medium. Then appropriate
quantities of medium were poured in test tube (150x25 mm diameter) or bottles
(300 ml capacity) before it solidify. The test tubes were then plugged with non-
absorbent cotton plugs or glass bottles with suitable caps. The media was
autoclaved at 1210C for 15 minutes and kept for solidification. Medium, where
70
thermolabile compounds had to be added, filter sterilized solutions were added
to warm (40-500c) autoclaved medium and then dispensed in pre-autoclaved
containers.
Table-5 Amount of stock solutions added to the media
Sl. no. Stock solution Strength Amount to be
added (ml)
1 Macronutrients 20X 50
2 Micronutrients 1000X 1
3 Iron source 200X 5
4 Organic supplements 1000X 1
Agar (8g/l) and Myoinositol(100mg/l) were added separately
3.5 PHYSICAL FACTORS FOR IN VITRO CULTURE
All the in vitro culture work was carried out aseptically in a laminar
airflow chamber and the plant tissue culture experiments were conducted under
defined conditions of the culture room maintained at 25±20C, uniform light
(1000 lux) was provided by fluorescent tubes over a photoperiod of 16/8 hours.
3.6 PREPARATION OF ANTIBIOTIC STOCKS
Kanamycin, cefotaxime and carbenicillin stocks of 100 mg/l were
prepared in sterile double distilled water and rifampicin stock of 100 mg/l was
prepared in DMSO. All the stocks were filter sterilized and stored at 40C for
future work (Appendix- IV).
71
3.7 STANDARDIZATION OF REGENERATION PROTOCOL
3.7.1 Callus induction
The different explants were cultured on MS medium supplemented
with different growth regulators and coconut water and incubated in culture
room for callus induction. Observations were recorded on days to callus
initiation, number of explants responding, type of callus, and color of callus,
visual callus quality and percentage of callus induction. MS medium with
different combinations of growth regulators were used for callus induction.
Response of explants to callus initiation was assessed by calculating
number of explants responded for callus initiation and expressed in percentage.
Percent callus induction ∶= No. of explants with callus initiation Total no. of explants cultured × 100
3.7.2 Multiple shoots induction
Different explants like cotyledonary node and cotyledonary node with
shoot tip were cultured on MS medium supplemented with different levels of
BAP, TDZ, IBA, and kinetin for induction of multiple shoots. Observations
were recorded on number of days for shoot induction. Shoot percentage and
number of shoots. Shoots were subcultured on different medium for elongation.
Shoot induction at the end of culture period was assessed by
calculating number of explants responded for multiple shoot induction and
expressed in percentage.
Percent shoot induction = No. of explants with multiple shoots Total no. of explants cultured X 100
72
3.7.3 Rooting and hardening
Elongated shoots were transferred to MS medium supplemented with
different concentrations of IBA and NAA for rooting. Number of shoots
producing roots and types of roots produced and rooting percentage were
recorded. Rooted shoots were transferred to pots containing soil: sand: FYM
(1:1:1) mixture for hardening. Response of regenerated shoots to rooting was
assessed by calculating number of shoots responded for rooting and expressed
in percentage.
Percent rooting induction = No. of shoots with rooting Total no. of shoots cultured X 100
3.8 TRANSFORMATION
In this study Agrobacterium mediated genetic transformation method
was tried for gene transfer in Blackgram.
3.8.1 Maintenance and growing of Agrobacterium
The Agrobacterium strain EHA105 carrying plasmid vector
pCAMBIA2301 containing ICE1 gene construct was maintained on solid LB
(Appendix-VIII) medium containing 50 mg/l kanamycin and 10mg/l
rifampicin. Sub culturing was done every fortnight in fresh medium. Single
Agrobacterium colony was taken from the plate with the help of sterilized loop
and inoculated into 100ml LB broth containing 25 mg/l kanamycin and was
incubated on shaker for 16 hrs. At room temperature and fresh culture was used
for transformation. The culture having O.D. 0.6 to 0.8 at 620 nm wavelength
was used for bacterial infection.
73
3.8.2 Co-cultivation
Cotyledonary node with shoot tip explants were taken from different
days old seedlings and co-cultivated with Agrobacterium. The overnight grown
culture of Agrobacterium was centrifuged at 6000 rpm for 5 minutes, the
supernatant was discarded and the bacterial pellet was suspended in liquid plant
growth medium (LPGM). Explants were suspended in Agrobacterium
suspension containing 100 µM acetosyringone and kept for different interval of
time on shaker at 100 rpm. Excess bacteria were blot dried and explants were
placed in petriplates lined with blotting paper soaked in LPGM (Appendix II).
Petriplates was wrapped with aluminum foil and kept for different days
intervals in culture room for co-cultivation. Then the explants were washed
with sterile distilled water and cefotaxime 500 mg/l, blot dried and inoculated
on the MS medium containing 2.0 mg/l BAP +0.05mg/l IBA+ 500mg/l
cefotaxime + 80 mg/l kanamycin medium and transformation efficiency
recorded based on observation kanamycin positive selection and GUS positive
selection.
3.8.2 GUS histochemical assay
To conform the presence of transgene, histochemical staining of the
co-cultivated explants, after washing with antibiotics, the explants were
blot dried on sterile blotting paper and analyzed. The best substrate for
localization â-glucuronidase activity in tissue and cell is 5-Bromo 4-Chloro-3
indolylglucronide (x-Gluc) that gives a blue precipitate at the site of enzymatic
activity. The product of â-glucuronidase action is not colored. The derivative
produced must undergo an oxidative dimerization to from the insoluble and
highly coloured blue dye. GUS test was carried out to analyses transient
expression of GUS reporter.
74
Protocol for GUS Histochemical Staining
The explants were washed in phosphate buffer and incubated in
phosphate buffer with 1%Triton X-100 (Appendix VII) at 37˚C for 1
hr.
Then the explants were transferred to X-Glu staining solution (1mM)
and incubated at 37˚C in incubator for 16 to 24 hr.
After incubation explants were washed with alcohol and analyzed for
GUS expression.
The GUS expression cell are detected microscopically by distinct blue
coloration, which is a result of enzymatic cleavage of 5-Bromo 4-chloro
3-indolylglucronide.
3.8.3 Cefotaxime sensitivity test
To know the minimal level of cefotaxime which would completely
eliminate the excess bacteria after co-cultivation and to find out the suitable
concentration of cefotaxime/ carbenicillin to avoid bacterial contamination, this
test was conducted at 0, 100, 200,300, 400 and 500 mg/l cefotaxime..
3.8.4 Kanamycin sensitivity test
Kanamycin sensitivity test was carried out to find out the minimum
concentration of kanamycin required to inhibit the growth of untransformed explants
in order to design the selection medium. The test was carried out by culturing the
explants on regeneration medium along with different levels of kanamycin (0, 20, 40,
60, and 80 mg/l). Putative transformants and percent of putative transformants were
calculated on the basis of kanamycin selection as fallows.
Percent putative transformants = ୭୲ୟ୪ ୬୭.୭ ୣ୶୮୪ୟ୬୲ୱ ୱ୳୰୴୧୴ୣୢ ୭୬଼ ୫/୪ ୩ୟ୬ୟ୫୷ୡ୧୬୭୲ୟ୪ ୬୭.୭ ୱ୦୭୭୲ୱ ୭ୠ୲ୟ୧୬ୣୢ ୰୭୫େ୭ିୡ୳୪୲୧୴ୟ୲ୣୢ ୣ୶୮୪ୟ୬୲ୱ X 100
75
3.9 ISOLATION OF PLASMID DNA FROM AGROBACTERIUM (ALKALILYSIS METHOD-SAMBROOK AND RUSSEL, 2001)
A single Agrobacterium colony was picked up aseptically using a
inoculation loop and was grown overnight in 50 ml LB broth containing (25
mg/l kanamycin) in sterile conical flask.
Culture of 1.5 ml was taken and centrifuged at 10,000 rpm for 10
minutes at 40C
The supernatant was discarded and cell pellet was dried.
The 200 µl ice cold suspension buffer (Appendix-IX) was added and
pellet was dissolved by vortexing.
Freshly prepared lysis buffer (Appendix- IX ) of about 200 µl was added
and kept on ice for 5 minutes.
The 200 µl of 1.5 M Potassium acetate (Appendix-IX) was added,
mixed well without vortexing and kept on ice for 10 minutes.
Then lysate was centrifuged for 15 minutes at 12,000 rpm. Supernatant
was transferred to a fresh tube.
Equal volume of phenol-chloroform was added, vortexed and
centrifuged for 10 minutes at 10,000 rpm. Aqueous upper layer was
transferred to a fresh tube.
DNA was precipitated by adding 600 µl of isopropanol and kept at -
200C for overnight.
Suspension was centrifuged at 12,000 rpm for 15 minutes and DNA
pellet was dried.
76
Pellet was washed with 1 ml of 70% ethanol and dried completely.
The pellet was dissolved in 30 µl of T10E1 buffer (Appendix- V).
RNAse (2 µl) of was added and incubated at 370C for 1 hr.
Purified sample was stored at -200C for further use.
3.10 EXTRACTION OF PLANT GENOMIC DNA (CTAB METHOD- EDWARDS ET AL., 1991)
Collected plant tissue (2g) was macerated in pestle and mortar at room
temperature without buffer for 15 sec.
Extraction buffer (0.4 ml) (Appendix-V) was added and sample was
vortexed for 5 sec. (can be kept at room temperature for more than 1 hr.).
The solution was centrifuged at 13000 rpm for 2 minutes and 300 µl of
supernatant was transferred to fresh eppendorf tube.
Supernatant was mixed with 300µl isopropanol and incubated at room
temperature for 5 minutes and centrifuged at 13,000 rpm for 2 min.
Pellet was dried and suspended in 100µl 1x T10E1 buffer.
RNAse (1 mg/ml) was added to the DNA and incubated at 37°C in water
bath for half an hour.
DNA was precipitated using 1/10th volume of 3M Sodium acetate and
ethanol and incubated overnight at 4°C
The solution was centrifuged at 13000 rpm for 2 minutes and pellet was dried.
Pellet was suspended in 50µl 1x T10E1 buffer.
3.11 POLYMERASE CHAIN REACTION
The genomic DNA of plants obtained from co-cultivated explants,
control plants and plasmid DNA (positive control) were used as template for
77
PCR confirmation of the targeted transgene with primers nptII gene.
Nucleotide sequence of specific primer nptII is as follows
Forward: 5�GAGGCTATTCGGCTATGACTG3�
Reverse: 5�ATCGGGAGCGGCATACCGTA3�
Table -6 PCR reaction mixture
Components Stock 25µl
reaction 10 reactions (µl)
Taq assay buffer 1X 2.5 25
Taq polymerase 3U 0.5 µl 5
Primer
Forward 2.5 µM 1.0µl 10
Reverse 2.5 µM 1.0µl 10
dNTPs 200µM 1.0µl 10
Template DNA 2 2.0µl 20
PCR water - 15.0 150
Table � 7 PCR conditions were as follows
Stage Temperature (00C) Duration (min) Cycles
Initial Denaturation 94 5 1
Cycle/Loop
Denaturation 94 30 sec
Annealing 52 30 sec 35
Primer extension 72 30 sec
Final extension 72 10 1
Soak 4 1
After the completion of required number of cycles of amplification the
samples were stored at 4°C in a refrigerator and the contents were loaded on
agarose gel for electrophoresis.
78
3.11.1 Separation of PCR amplified products by agarose gel electrophoresis
The PCR amplified products from each reaction (25µl) along with 5 µl
of loading dye (Bromophenol blue) (AppendixVI) were loaded on 1.2 %
agarose gel. The electrophoresis was carried out using 1X TBE buffer
(Appendix VI ) at 60 V for I hr. Molecular weight marker was run in a
separate lane. The DNA bands on the gels were visualized under UV trans-
illuminator and documented.
3.11.2 Transformation efficiency
After the PCR analysis of putative transformants the transformation
efficiency was calculated by using following formula.
= ܡ܋ܖ܍ܑ܋ܑ܍ ܖܗܑܜ܉ܕܚܗܛܖ܉ܚ܂ + ܀۱۾ ܗ.ܗܖ ܔ܉ܜܗ܂ ܗ܋ ܕܗܚ ܌܍ܖܑ܉ܜ܊ܗ ܛܜܗܗܐܛ ܗ.ܗܖ ܔ܉ܜܗ܂ ܛܜܖ܉ܔܘ ܍ܞ − ܆ ܜܖ܉ܔܘܠ܍ ܌܍ܜ܉ܞܑܜܔܝ܋
3.12 STATISTICAL METHODS
As all the studies were done in laboratory under well-defined
conditions of medium of growth, temperature and light, completely
randomized design (CBD) was employed for the experiment. The �f� test
was carried out after ANOVA and CD (p=0.5) and CV% values were
calculated. Data from different explants and different Medium
combinations obtained from similar experiments were pooled. The pooled
data were analyzed as factorial experiment.
79
Table-8 cDNA sequence (5�-3�) of ICE1 gene (2559 b)
AGAGAGATAAGCTTAAGCCAAAATTAAGCAGAAAAATGGAGAAATAGTGACGGTGAGAGAGAGAGAGATACGGTAAACGAAGCAAAGCAAAGAGAGTCACGAGAAATCTGGGGTATGTGTTCAATGATAAAGCAATTTCATGGTGGCCGAAATTGAATCCATCAAAAAAAAAGTTTCAATTTTTAAGCTCTGAGAAATGAATCTATCATTCTCTCTCTCTATCTCTATCTTCCTTTTCAGATTTCGCTTCTTCAATTCATGAAATCCTCGTGATTCTACTTTAATGCTTCTCTTTTTTTACTTTTCCAAGTCTCTGAATATTCAAAGTATATATCTTTTGTTTTCAAACTTTTGCAGAATTGTCTTCAAGCTTCCAAATTTCAGTTAAAGGTCTCAACTTTGCAGAATTTTCCTCTAAAGGTTCAGACTTTGGGGTAAAGGTGTCAACTTTGGCGATGGGTCTTGACGGAAACAATGGTGGAGGGGTTTGGTTAAACGGTGGTGGTGGAGAAAGGGAAGAGAACGAGGAAGGTTCATGGGGAAGGAATCAAGAAGATGGTTCTTCTCAGTTTAAGCCTATGCTTGAAGGTGATTGGTTTAGTAGTAACCAACCACATCCACAAGATCTTCAGATGTTACAGAATCAGCCAGATTTCAGATACTTTGGTGGTTTTCCTTTTAACCCTAATGATAATCTTCTTCTTCAACACTCTATTGATTCTTCTTCTTCTTGTTCTCCTTCTCAAGCTTTTAGTCTTGACCCTTCTCAGCAAAATCAGTTCTTGTCAACTAACAACAACAAGGGTTGTCTTCTCAATGTTCCTTCTTCTGCAAACCCTTTTGATAATGCTTTTGAGTTTGGCTCTGAATCTGGTTTTCTTAACCAAATCCATGCTCCTATTTCGATGGGGTTTGGTTCTTTGACACAATTGGGGAACAGGGATTTGAGTTCTGTTCCTGATTTCTTGTCTGCTCGGTCACTTCTTGCGCCGGAAAGCAACAACAACAACACAATGTTGTGTGGTGGTTTCACAGCTCCGTTGGAGTTGGAAGGTTTTGGTAGTCCTGCTAATGGTGGTTTTGTTGGGAACAGAGCGAAAGTTCTGAAGCCTTTAGAGGTGTTAGCATCGTCTGGTGCACAGCCTACTCTGTTCCAGAAACGTGCAGCTATGCGTCAGAGCTCTGGAAGCAAAATGGGAAATTCGGAGAGTTCGGGAATGAGGAGGTTTAGTGATGATGGAGATATGGATGAGACTGGGATTGAGGTTTCTGGGTTGAACTATGAGTCTGATGAGATAAATGAGAGCGGTAAAGCGGCTGAGAGTGTTCAGATTGGAGGAGGAGGAAAGGGTAAGAAGAAAGGTATGCCTGCTAAGAATCTGATGGCTGAGAGGAGAAGGAGGAAGAAGCTTAATGATAGGCTTTATATGCTTAGATCAGTTGTCCCCAAGATCAGCAAAGTAAACACTTACTTTGTCTCTTTTATCTCCTTAAGAGCTTGTTTACTTGTTGCTGTTATAGAGAATTGTTGTGTTGTAGCTTTGTAGGGCCTTTGTTGTTGTCAAACTTTGCATGTAGTTGCTTACTCTTTTGAGGAAGAGGCTCGTGATAGTGTTTTATGGATTTTCGATGAATTTGCAATGGATAGAGCATCAATACTTGGAGATGCAATTGATTATCTGAAGGAACTTCTACAAAGGATCAATGATCTTCACAATGAACTTGAGTCAACTCCTCCTGGATCTTTGCCTCCACTTCATCAAGCTTCCATCCGTTGACACCTACACCGCAAACTCTTTCTTGTCGGTCAAGGAAGAGTTGTGTCCCTCTTCTTTACCAAGTCCTAAAGGCCAGCAAGCTAGAGTAAGGACTATATTCTGTATAACTTTTGCTTAGACTGGAAAGAAGAAAACAAAGATTCATGTTTGAGAGTTACTCTGCTTCTTTTTCACAGGTTGAGGTTAGATTAAGGGAAGGAAGAGCAGTGAACATTCATATGTTCTGTGGTCGTAGACCGGGTCTGTTGCTCGCTACCATGAAAGCTTTGGATAATCTTGGATTGGATGTTCAGCAAGCTGTGATCAGCTGTTTTAATGGGTTGCCTTGGATGTTTTCCGCGCTGAGGTGATCTTCTACTCTCAGTTGAAAGGTTAAGGATTTGTAGAACAGTTTTAGTAGTAACATGTTTTCTTTTGTCTATCAGCAATGCCAAGAAGGACAAGAGATACTGCCTGATCAAATCAAAGCAGTGCTTTTCGATACAGCAGGGATGCTGGTATGATCTGATCTGATCCTGACTTCGAGTCCATTAAGCATCTGTTGAAGCAGAGCTAGAAGAACTAAGTCCCTTTAAATCTGCAATTTTCTTCTCAACTTTTTTTCTTATGTCATAACTTCAATCTAAGCATGTAATGCAATTGCAAATGAGAGTTGTTTTTAAATTAAGCTTTTGAGAACTTGAGGTTGTTGTTGTTGGATACATAACTTCAACCTTTTATTAGCAATGTTAACTTCCATTTATGTTTCATCTTAAAGCTATGCTCAAGAATT
80
EXPERMINTAL RESULTS
The present investigation was carried out to develop cold tolerant black
gram variety in order to meet the demand of the farmers for cultivation under
cold stress condition. Transformation of Blackgram variety �T-9� was carried
out with ICE-1 gene which is a positive regulator CBF-3. The results of present
investigations form different experiments were presented in this chapter.
4.1 IN-VITRO REGENERATION
A successful application of in vitro techniques for crop improvement
was rested upon a reproducible plant regeneration protocol. Two methods viz. a
direct and indirect regeneration method with intervening callus mediation, were
commonly employed for genetic transformation. In the present investigation,
direct regeneration method was employed for obtaining an efficient and
reproducible in vitro regeneration protocol in Black gram cv. �T-9� for genetic
transformation.
4.1.1 Effect of surface sterilants
Surface sterilants are commonly used to obtain contamination free
culture in tissue culture experiments. Concentration and duration of
treatment greatly affect the germination and survival percentage of the
seeds of black gram. In this study 0.2 % HgCl2 was used as surface
sterilants for sterilization of black gram seeds. Among the various
treatments, the best result was observed in treatment of seeds with of 0.2%
HgCl2 for a period four minutes. In this treatment 91.25 % aseptic culture
and 88.75 % survivability of explants were recorded. Increasing the exposure
time of HgCl2 treatment (more than 4 minutes) resulted into better aseptic
id2075359 pdfMachine by Broadgun Software - a great PDF writer! - a great PDF creator! - http://www.pdfmachine.com http://www.broadgun.com
81
culture percentage and poor germination percentage. Increase in time of treatment
increases the percentage of ascetic culture but reduces the germination or
survival percentage of seeds. The effect of time on aseptic culture and germination
or survival percentage of seeds is presented in Table 9.
Table-9 Effect of surface sterilants on the aseptic culture and survival of explants
Treatments 0.2% HgCl2 treatment in
minutes
Aseptic culture
percentage
Death percentage
Survival / Germination percentage
T1 0 0.00 0.00 0.00
T2 1 14.00 6.75 93.00
T3 2 53.50 6.50 92.25
T4 4 91.75 10.00 88.75
T5 5 78.50 12.25 86.50
T6 8 89.75 36.50 75.50
T7 10 89.25 37.25 56.25
T8 12 83.50 36.00 20.00
C.D(p=0.05) 6.25 4.03 7.52
C.V% 6.52 14.39 7.67
4.1.2 Indirect regeneration
Callus refers to the actively unorganized mass of cell induced in culture.
Generally, a higher auxins concentration in growth medium induces callus
formation. Establishment of callus, which retains high morphogenetic potential, is a
preliminary step in tissue culture of any species. The quantity and quality of callus
produced depends on a wide variety of conditions like explants genotype, growth
regulators and light/dark incubation etc. For induction of callus from leaf and shoot
tip cotyledonary node explants were cultured on MS medium supplemented with
different concentration of 2.4.D (0.5, 1.0, 1.5, 2.0 &3.0 mg/l) in combination with
Kinetin (1mg/l), IAA (1mg/l), NAA (1mg/l) and coconut water. The influence of
different treatments presented Table-10, Fig-5 and Plate 3.
82
Table -10 Effect of Plant growth regulators (PGR) on callus induction of black gram cv. �T-9�
Treatments Media used No. of days to induce
Callus induction
(%)
Morphological observation
T1 MS 0 0 No callus proliferation
T2 MS+ 0.5 mg/l 2.4. D 14.25 31.25 Light green, loses
T3 MS+1.0 mg/l 2.4. D 15.00 50.00 Watery, light green
T4 MS+ 1.5 mg/l 2.4. D 16.25 53.75 Light green, soft
T5 MS+ 2.0 mg/l 2.4. D 16.75 57.5 Greenish white, watery
T6 MS+ 3.0 mg/l 2.4. D 12.5 63.75 compact whitish calli
T7 MS+3.0 mg/l 2.4. D +1mg/l Kn 12.00 87.25
Whitish green , friable
T8 MS+ 2.0 mg/l BAP+ 0.5mg/l NAA 15.25 78.75
Brownish ,slight friable
T9 MS+ 3.0 mg/l 2.4. D+1mg/l Kn+ 0.1% Cocoanut water 14.00 61.25 Greyish ,compact
T10 MS+ 3.0 mg/l 2.4. D+1mg/l IAA+ 0.1% Cocoanut water 13.25 73.75 Brownish , hard
T11 MS+ 3.0 mg/l 2.4. D+1mg/l Kn+ 0.2% Cocoanut water 11.00 87.5
Whitish green, friable
T12 MS+ 3.0 mg/l 2.4. D+1mg/l IAA+ 0.1% Cocoanut water 16.25 28.75
Light greenish, compact
C.D(p=0.05) 2.10 3.10 C.V% 10.17 14.76
*Each treatment replicated four times. Twenty observations per replication
Out of the twelve different treatments, the medium supplemented with 3
mg/l 2.4.D along with 1mg/l Kinetin resulted highest callus induction from
87.25% explants within 12 days of incubation (Plate-3D). Callus obtained from
leaf and cotyledonary node explant cultured on MS medium supplemented with
2.4.D (3 mg/l) and kinetin (1 mg/l) were found to be loose friable whitish green
callus colour. The time taken for the callus induction is comparatively reduced
in MS medium supplemented with same concentration of Phytohormones along
with organic supplement (Cocoanut water) and callus induction were found to
83
be 87.5% response with average of 11 days to induce callus. Where in plane
MS medium callus proliferation was not observed in leaf as well as shoot tip
explant (Plate-3A). As compared to the former, the callus obtained from inter
cotyledonary node was not better in quality than leaf. Callus induction from
cotyledonary node had taken more time as compared to leaf. But Callus
obtained from the above experiments when cultured on the MS medium
supplemented with various combination of growth regulator for regeneration of
callus failed to regenerate the complete plant.
4.1.3 Induction of Multiple shoot
Both the explants (cotyledonary node and shoot tip) harvested from
four days old in-vitro raised seedlings were tested on MS medium. The
multiple shoot induction response varied with the type of phytohormone and
their combination. In the present study, MS medium supplemented with
different concentrations of BAP, Kinetin, and TDZ and in combination of IBA
was used for multiple shoot induction. Among the various treatments tested
(Table 11, Fig 6 and Plate 5) for multiple shoots induction, the medium SIM-4
(Shoot Induction Medium) supplemented with 3mg/l BAP, 0.05mg/l IBA
(including adenine sulphate (100mg/l) exhibited the best induction of multiple
shoots (Plate 5E) among thirteen treatments. This treatment resulted
development of shoots from cotyledon node in reasonable time frame of 13
days with more than 84.33% of the explants responding with average of 7.17
shoots per explant.
84
PLATE - 3 Effect of plant growth hormone on callus induction from leaf
explant A. MS (control) B. MS+ 1.5 mg/l 2.4. D C. MS+ 2.0 mg/l 2.4. D D. MS+3.0 mg/l 2.4. D +1mg/l Kn E. MS+ 3.0 mg/l 2.4. D+1mg/l Kn+ 0.2% Cocoanut water F. MS+ 3.0 mg/l 2.4. D+1mg/l IAA+ 0.1% Cocoanut water
PLATE NO. 4 Effect of plant growth hormone on callus induction from shoot tip explant
A. MS+ 1.5 mg/l 2.4. D B. MS+ 2.0 mg/l 2.4. D C. MS+3.0 mg/l 2.4. D +1mg/l Kn D. MS+ 3.0 mg/l 2.4. D+1mg/l Kn+ 0.2% Cocoanut water E. MS+ 3.0 mg/l 2.4. D+1mg/l IAA+ 0.1% Cocoanut water
85
Table-11 Effect of Plant growth regulators on shoot multiplication from of shoot tip and cotyledon node
Treatments
No.
Treatment
MS+ growth regulators(mg/l)
Shoot tip with cotyledon node Shoot tip explant No. of days to
induce No. of explants
response No. of
shoots/explant No. of days to
induce No. of explants
response No. of shoots/explant
SIM 0 MS 0.00 0.00 0.00 0.00 0.00 0.00
SIM 1 MS+1.0 BAP + 0.05 IBA 15.17 31.33 2.33 17.67 21.33 2.00
SIM 2 MS+2.0 BAP + 0.05 IBA 14.50 44.67 3.00 17.83 39.67 2.33
SIM 3 MS+3 BAP + 0.05 IBA 13.00 84.33 7.17 15.67 77.67 5.50
SIM 4 MS+6 BAP + 0.05 IBA 14.33 52.33 3.67 14.50 49.00 2.33
SIM5 MS+0.1 TDZ 13.83 59.67 4.00 14.17 46.00 2.17
SIM 6 MS+0.5 TDZ 13.33 45.00 4.00 16.83 45.00 2.67
SIM7 MS+0.1 TDZ + 0.05 IBA 15.33 80.00 5.17 14.00 74.33 3.67
SIM 8 MS+0.5 L TDZ+ 0.05 IBA 14.33 59.67 3.67 13.67 56.33 3.33
SIM 9 MS+0.5 Kinetin 12.17 48.67 3.17 15.83 45.67 3.67
SIM 10 MS+1.0 Kinetin 12.00 33.67 3.17 16.67 41.33 2.67
SIM 11 MS+0.5 Kinetin +0.05 IBA 14.17 34.00 3.33 13.33 30.33 2.83
SIM 12 MS+1.0 Kinetin +0.05 IBA 12.67 60.33 4.33 14.17 56.33 2.67
SIM 13 MS+2.0 Kinetin+0.05 IBA 14.67 56.67 2.67 15.67 48.67 3.00
C.D(p=0.05) 2.21 3.72 0.83 1.78 2.42 0.63
C.V% 12.53 13.08 12.03 10.80 6.22 18.24
*Each treatment replicated four times. Twenty observations per replications
86
Similarly, better shooting percentage was also observed in the medium SIM-7
(fortified with TDZ 0.1 mg/l and 0.05 mg/l IBA) with average shoot induction
of 80.00% with 5.17 shoots per explant (Plate 5D). In case of shoot tip explant
multiple shoots were observed after 15.67 days of incubation with 77.67%
response and 5.50 shoots per explant (Plate 5E). The treatment (with the TDZ
0.1mg/l +IBA 0.05mg/l) showed about 74.33% percentage of shoot induction
with 3.67 shoots per explant. Lowest response (15-18%) and shooting (2-3
shoots per explant) was recorded in the treatment of 1mg/l BAP and 0.05mg/l
IBA. The explant shoot tip with cotyledonary node showed better response
(84.33% response with average multiple shoots 7.17 per explant) than that of
shoot tip explant (77.67% with 5.5 shoots per explant).
4.1.4 Elongation of Multiple shoots
The number of shoots produced per explant was invariably less until
the optimum concentration 3mg/l BAP + 0.05mg/l IBA. Even though 7.17
Shoots per explant were obtained, but shoots were stunted and did respond well
while cultured on fresh media. For elongation of multiples shoots, these were
cultured on the MS medium supplemented with various combination of GA3
and adenine sulphate (100mg/l). Among different medium combination, the
better elongation of shoots was observed with MS medium fortified with
1.0 mg/l GA3 and this medium promoted the maximum elongation of shoots
(11.23 cm) within a week incubation period (Table 12, Fig 7 and Plate 6). The
MS medium supplemented with the 1.2 mg/l GA3 showed elongation about
10.42 cm (Plat 6E) and the lowest elongation (5.6 cm) was observed in MS
medium supplemented with 0.2mg/l GA3.
87
Plate - 5 Effect of the Plant growth regulators on Direct organogenesis : initiation of multiple shoots from cotyledonary node (above) and shoot tip (below) A. MS+1.0 BAP + 0.05 IBA B. MS+0.5 Kinetin +0.05 IBA C. MS+0.5 TDZ D. MS+0.1 TDZ + 0.05 IBA E. MS+3 BAP + 0.05 IBA
88
Fig. 5. Effect of Plant growth regulators (PGR) on callus induction of black gram cv.�T-9�
Fig. 6 Effect of Plant growth regulators on shoot multiplication from
of shoot tip and cotyledon node
0
20
40
60
80
100
0
5
10
15
20
T1 T2 T3 T4 T5 T6 T7 T8 T9 T10 T11 T12
Callu
s in
duct
ion
(%)
No.
of d
ays
to in
duce
Treatment
No. of days to induce Callus induction(%)
0
10
20
30
40
50
60
70
80
SIM 0 SIM 1 SIM 2 SIM 3 SIM 4 SIM5 SIM 6 SIM7 SIM 8 SIM 9 SIM 10 SIM 11 SIM 12 SIM 13
Surv
ival
(%)
Treatment
No. days to induce No. of explants response No. Of shoots/explant
0
10
20
30
40
50
60
70
80
90
SIM 0 SIM 1 SIM 2 SIM 3 SIM 4 SIM5 SIM 6 SIM7 SIM 8 SIM 9 SIM 10 SIM 11 SIM 12 SIM 13
Surv
ival
(%
)
Treatment
No. days to induce No. of explants response No. of shoots/explant
89
Table -12 Effect of Plant growth regulators on shoot elongation of multiple shoots
Treatments No.
Treatment MS+ growth
regulators(mg/l)
No. of Days to induction
No. of explants response
Length of shoots in cm
EIM 0 MS 0.00 0.00 0.00
EIM 1 MS+GA3 0.2 11.00 36.00 5.60
EIM 2 MS+GA3 0.4 12.33 55.00 9.88
EIM 3 MS+GA30.6 16.00 48.33 5.46
EIM 4 MS+GA3 0.8 12.83 55.33 8.26
EIM 5 MS+GA3 1.0 6.67 77.33 11.28
EIM 6 MS+GA3 1.2 13.33 58.00 10.42
EIM 7 MS+GA3 1.4 13.83 59.33 8.44
C.D(p=0.05) 3.41 0.89 0.75
C.V% 13.21 14.08 13.13
*Each treatment replicated four times. Twenty observations per replication
4.1.5 Rhizogenes of Multiple shoots
The rooting of shoots was significantly affected by auxins
concentration. The healthy in vitro raised shoots (6-11cm long) obtained from
direct regeneration method was transferred to different media such as MS
medium supplemented with various concentrations of IBA and same media
composition with NAA and agar- agar 0.5% for rhizogenes. Within 10-15
days, roots growth was observed. After 15 days, formations of healthy
secondary roots were observed. As indicated from (Table-13, Fig 8 and Plate-7),
72.5% of shoots responded for rooting in MS medium supplemented with NAA
(0.5 mg/l) with 6.2 roots per shoots (Plate 7D). About 68.9% (Plat-7E) explant
90
3ODWH�-��(IIHFW�RI�SODQW�JURZWK�UHJXODWRU�RQ�VKRRW�HORQJDWLRQ� $��06�*$3 ����PJ�O %��06�*$������PJ�O &��06�*$������PJ�O '��06�*$3 ����PJ�O (��06�*$�����PJ�O )��06�*$������PJ�O
3ODWH-���(IIHFW�RI�3ODQW�JURZWK�UHJXODWRUV�RQ�URRWLQJ�RI�PXOWLSOH�VKRRWV�
A. MS+IBA 0.25 mg/l
B.MS+ IBA 0.5 mg/l
C.MS+ IBA 5 mg/l
D.MS+NAA 0.5
E.MS +NAA 0.25 mg/l
91
responded for rooting in medium NAA (0.25mg/l) which was comparatively
lower percentage response than the 0.5mg/l NAA but number of roots per
shoots are quite higher(8.40).
Table -13 Effect of Plant growth regulators on rooting of multiple shoots
Treatments No.
Treatments MS + growth regulators(mg/l)
No. of Days to
induction
No. of explants
response(%)
No. of roots/shoots
RIM 0 MS 0 0 0.00
RIM 1 MS+IBA 0.25 10 21.2 2.45
RIM 2 MS+ IBA 0.5 12 32.4 3.60
RIM 3 MS+ IBA 1 14 55.5 2.80
RIM 4 MS+ IBA 2 15 59.2 3.60
RIM 5 MS+ IBA 3 10 53.33 4.00
RIM 6 MS+ IBA 4 15 63.4 4.20
RIM 7 MS+ IBA 5 16 61.5 3.80
RIM 8 MS +NAA 0.25 12 68.9 8.40
RIM 9 MS+NAA 0.5 10 72.5 6.20
RIM 10 MS+NAA 1 13 59.2 3.80
C.D(p=0.05) 2.68 0.93 2.12
C.V% 9.63 13.56 12.25
*Each treatment replicated four times. Twenty observations per replication
4.1.6 Hardening of rooted plantlets
The pre- hardening was done for the rooted plantlets (about 13-15cm
height) and these plantlets were transferred in to liquid plant growth medium
(LPGM) for 48 hours so as to acclimatize them. Then, the plants were
transferred to pots containing soil: sand: FYM (1:1:1) and kept in green house
at 90% humidity. Seventy percentage of plantlets were survived and
completely established in Green house (Plate-8A &B).
92
Fig. 7 Effect of Plant growth regulators on shoot elongation of multiple shoots
Fig. 8 Effect of Plant growth regulators on rooting of multiple shoots
0
2
4
6
8
10
12
0
10
20
30
40
50
60
70
80
90
EIM 0 EIM 1 EIM 2 EIM 3 EIM 4 EIM 5 EIM 6 EIM 7
Leng
th o
f sho
ots
(cm
)
No.
of d
ays
to in
duct
ion/
No.
of e
xpla
nts
res
pons
e
Treatment
No. of Days to induction No. Of explants response Length Of shoots in cm
0
10
20
30
40
50
60
70
80
RIM 0 RIM 1 RIM 2 RIM 3 RIM 4 RIM 5 RIM 6 RIM 7 RIM 8 RIM 9 RIM 10
Surv
ival
(%
)
Treatment
No. of Days to induction No. of explants response.(%) No. Of roots/shoots
93
Plate - 8 Hardening of plantlets A. Pre-hardening of rooted plantlets B. Hardening of rooted plantlets in soil: sand: vermicompost (1:1:1)
94
4.2 Transformation studies
4.2.1 Kanamycin sensitivity test
To standardize lethal dose of kanamycin, putative transgenics explants
were cultured on MS medium containing the different concentration of
Kanamycin (20.40.60 and 80mg/l). At the 20 and 40 mg/l kanamycin explant
were not inhibited by the antibiotic and were able to grow healthy. The
treatment with 60mg/l kanamycin appear to have a slightly toxic effect over the
explant causing loss of chlorophyll, but the explants were able to overcome this
toxicity in later stages. Kanamycin at 80mg/l had a deleterious effect. (Plate-9E).
The plant become albino at the higher concentration of the kanamycin and caused
immediate death of the explant as shown in the Table- 14
Therefore in the present transformation studies, 80 mg/l kanamycin
was used as a selection agent. The co-cultivated explants that grew uninhibited
on this concentration of kanamycin considered a putative transformants.
Table -14 Detection of lethal concentration of Kanamycin for selection medium
Treatments Kanamycin (mg/l)
No. of explants
inoculated
Explant survival after 20
day
Percentage of survival
Appearance of explant
T1 0 20 19.66 98.00 Dark green
T2 20 20 12.00 60.00 Dark green
T3 40 20 7.33 36.65 Pale green
T4 60 20 2.66 13.33 Yellowish
green
T5 80 20 0 0 White
C.D(p=0.05) 1.29
C.V % 10.43
95
4.5 Optimization of Agrobacterium mediated transformation protocol.
4.3.1 Effect of pre-culture period of explant in the co-cultivation protocol
Pre-culture is one of the important steps for co-cultivation experiment.
Variations in the pre-culture period in co-cultivation were taken at 0 - 96 hours.
The effect of pre-culture on survivability of explants after co-
cultivation is presented in Table 15 and Fig 9. Significant difference was
found in explants pre-cultured for 48 (68.30%) and 72 hours (76.65%) and
GUS expression (about 60, 78.30%) was observed respectively. The significant
survivability (85.00%) with 88.33% GUS expression was recorded in pre-
culture for 96 hours. Compared with all treatment, it showed highest
survivability and GUS expression percentage after co-cultivation. Therefore
it was concluded that 96 hours is the best pre-culture period in order to
obtain maximum survivability and also found to be suitable for co-
cultivation found based on the percentage Gus expression.
Table -15 Effect of pre-culture period on co-cultivation
Treatment Duration of
pre-culture in hours
Average no. explant alive after co-
cultivation
Percent survival
GUS expressio
n %
T1 0 9.00 45.00 36.65
T2 24 12.33 61.45 40
T3 48 13.67 68.30 60
T4 72 15.33 76.65 78.3
T5 96 17.00 85.00 88.3
C.D(p=0.05) 1.29 2.77
C.V% 5.42 12.85
*Each treatment replicated four times. Twenty observations per replication
96
4.3.2 Co-cultivation period
Explants were immersed with Agrobacterium suspension under
shaking condition for 20 to 30 minutes. Then the explants were taken out,
blot dried and co-cultivated on liquid MS medium (without sucrose)
supplemented with BAP (2mg/l) for different periods (24 to 96 hours) in order
to determine the optimum co-cultivation period to get maximum survivability.
The effect of different co-cultivation period on survivability of explants is
presented in Table 16 and Fig 10. Significant survivability and GUS expression
were found from the explants co-cultivated for 72 hours (78.35 and 75%
respectively). GUS expression (88.33%) was recorded in co-cultivation period
of 96 hours but survivability percentage was reduced to 51.65%. Hence 72
hours found to be suitable for co-cultivation.
Table-16 Effect of Duration of co-cultivation
Treatment Duration of co-culture in
hours
Average no.explant alive after co-cultivation
GUS expression %
Bacterium growth
T1 24 14.33 35 +
T2 48 14.67 55 +
T3 72 15.67 75 +
T4 96 10.33 88.3 +++
C.D(p=0.05) 1.54 1.43
C.V% 6.15 5.9
+ Slight growth , +++ Prominent growth of Agrobacterium, *20 explants used for the experiment with 4 replication was done.
97
Fig. 9 Effect of pre-culture period on co-cultivation
Fig. 10 Effect of duration of co-cultivation
0
10
20
30
40
50
60
70
80
90
100
0
20
40
60
80
100
120
T1 T2 T3 T4 T5
Perc
enta
ge o
f sur
viva
l
Dur
atio
nof p
re-c
ultu
re in
hou
rs/A
vera
ge n
o. o
f ex
plan
t al
ive
afte
r co
-cul
ture
Treatment
Duration of pre-culture in hours
Average no. explant alive after co-cultivation
Percent survival
GUS expression %
0
10
20
30
40
50
60
70
80
90
100
0
20
40
60
80
100
120
T1 T2 T3 T4
Perc
enta
ge o
f su
rviv
al
Dur
atio
nof p
re-c
ultu
re in
hou
rs/A
vera
ge n
o. o
f exp
lant
al
ive
afte
r co
-cul
tiva
tion
Treatment
Duration of co-culture in hours
Average no.explant alive after co-cultivation
GUS expression %
98
4.3.3 Optimization of antibiotic concentration for inhibition of Agrobacterium tumefaciens growth
Sensitivity of Agrobacterium tumefaciens to various levels of
antibiotics was determined by culturing the co-cultivated explants on MS
medium containing 2.0 mg/l BAP and different concentrations of
cefotaxime (0 to 500 mg/l). The effect of different concentrations of
antibiotics on growth of Agrobacterium is presented in Table 17.
The percentage of reappearance of Agrobacterium was t h e
maximum (100 %) on growth medium without antibiotic and it was found
to be gradually decreased with increase in concentration of antibiotics from
100 to 500 mg/l. The growth of Agrobacterium was totally inhibited at 500
mg/l concentration of both cefotaxime. So 500 mg/l cefotaxime was
added in the selection medium for getting contamination free
transformants.
Table-17 Determine the sensitivity of Agrobacterium to various level of cefotaxime
Treatment Concentration of cefotaxime
mg/L
Bacterium growth
Reappearance
Bacterium growth
reappearance percentage
Bacterium growth
T1 0 20 100 ++++
T2 100 15.75 78.75 +++
T3 200 13.5 67.5 +++
T4 300 9.75 48.5 ++
T5 400 3.5 17.5 +
T6 500 0 0 -
C.D(p=0.05) 1.46
C.V% 7.62
- No growth,+ little growth , ++ moderate ,+++ Prominent growth , ++++ over growth of Agrobacterium, *20 explants used for the experiment with 4 replication was done.
99
4.3.4 Transformation efficiency of Agrobacterium on selection of putative transformants on Kanamycin medium.
The cotyledonary nodes and shoot tips were co-cultivated with strain
EHA-105 containing the gene construct ICE -I. Four days pre-cultured shoot
tips were dipped in the bacterial suspension and then resuspended in LPGM
medium containing Acetosyringone (100µM) for 20 min, Then cotyledonary
nodes and shoot tips were incubated for 72 hours and subsequently cultured in
the shooting medium without selection pressure and grown for the next 3 days
followed by sub culturing on selection medium. Inclusion of the selective
agent, Kanamycin (80 mg/l) in the selection medium allowed transformed cells
to proliferate (Plate-10H) however, with a few albino shoots. These explants
were then sub-cultured after every 2 weeks on selection medium. A total of 130
explants of cv. �T-9� were obtained after co-cultivation. Out of these 12
explants of �T-9� were survived on selection medium containing 80 mg/l
Kanamycin. A transformation frequency of 9.23%.was achieved (Table-19).
The growth of the resistance shoots was rapid. Kanamycin- resistant shoots
were subjected to further high selection pressure and were maintained for
evaluation of transgenic black gram.
100
Plate - 9 Determination of Kanamycin sensitivity A. control (0mg/l) B. 20mg/l C. 40mg/l D. 60mg/l E. 80mg/l
�Plate - 10 Kanamycin based selection of transformants
F. control G. a week culture on selection medium H. two week old culture on selection medium
101
4.3.5 Gus assay of transformants
The different tissue of transformants was stained in X-gal. High GUS
expression was detected in the leaf (Plate-11 A & B) and cotyledonary node. The
relative expression of GUS was analyzed as blue colour development (Plate-11).
About 95% percentage of transient GUS expression was recorded (Table-18). The
explant which were not inoculated with Agrobacterium, showed no GUS activity.
The cross section of GUS positive (Plate-11 E&F) as well as negative explants
were made (Plate-11C&D) and observed in microscope at 10X and 20X
magnification.
Table-18 Transient GUS expression percentage
Total no of explant assayed
No. putative GUS +ve
Transformation efficiency in %
20 19 95
*Each treatment replicated four times. Twenty observations per replication
4.3.6 Molecular analysis of putative transformants
Putative transformants were screened by the PCR for presence of nptII
genes. For this purpose total genomic DNA was isolated from the explants
survived on the selection medium (Kanamycin 80 mg/l) and control. Then the
PCR reaction was carried out using primers specific for nptII gene and plasmid
DNA used as a positive control. The PCR amplified product was electrophoresed
on 1.2% agarose gel (Plate-12). Expected band of about 700 bp was obtained
only in two samples (out 10 samples). The transformation efficiency found to be
about 1.53% (Table-19).
Table 19 Transformation efficiency based on kanamycin selection and PCR analysis
Total no of explant assayed
No. of shoots obtained after co-
cultivation
No. shoots selected based on Kanamycin
selection
Transformation efficiency (%)
based on Kanamycin
selection
No. plants selected based on
PCR analysis
Transformation
efficiency (%) based on PCR
165 130 12 9.23 02 1.53
102
Plate� 11 GUS histochemical assay A. Control B. Transformants (+ve for GUS) C. T.S of Untransformed cells (10X) D. L.S of Untransformed cells (10X) E. T.S of transformed cells (GUS +ve )(20X) F. callus showing GUS +ve
103
Plate - 12 PCR analysis of putative transformants using nptII as primer M. 20 bp ladder
1. Positive control 2. negative control 3. untransformed 4-11. putative transformants
104
DISCUSSION
Transformation of crop plants with desired genes is the focus of many
plant genetic engineering programs. The stable introduction of foreign genes
into plants is one of the significant advances in crop improvement programme,
which would help in transforming desirable genes into local adopted varieties,
thus supplement conventional breeding programme. Among the several
methods used for transformation of plants, Agrobacterium tumefaciens
mediated transformation is preferred in many cases because of several distinct
advantages over other methods. These include single copy integration, greater
precision with excellent stability. The rate of transformation is influenced by
various factors like plant genotype, Agrobacterium strains, plasmid vectors,
temperature etc. Along with these factors, like Agro-inoculum treatment
duration and co-cultivation period also influences transformation rate.
5.1 IN- VITRO REGENERATION
A highly in-vitro plant regeneration system is very essential for carrying
out genetic transformation work. In case of legume crops, direct organogenesis
of shoots from cotyledonary nodes, shoot apices, leaflets and embryo axes is
the most common regeneration pathway.
5.1.1 Effect of surface sterilants
In present study 0.2 % HgCl2 was used as surface sterilants for
sterilization of black gram seeds. Among the various treatments, the best
result was observed in treatment of seeds with of 0.2% HgCl2 for a period four
minutes. In this treatment 91.25 % aseptic culture and 88.75 %
survivability of explants were recorded. The present result is in congruent with
id2085031 pdfMachine by Broadgun Software - a great PDF writer! - a great PDF creator! - http://www.pdfmachine.com http://www.broadgun.com
105
the result reported by Saini, et al., 2007, Yadav, et al., 2010 and Varalaxmi, et
al., 2007 where 0.1% of HgCl2 treatment for 5 � 8 minute duration also
resulted higher aseptic culture with greater survival percentage.
5.1.2 Indirect regeneration
A very rapid and efficient regeneration method of Vigna mungo L. has
been established using liquid culture (Das, et al., 2002) by using a leaf explant
in liquid culture medium. The callus induction and plant regeneration of Indian
soybean (Glycine max L.) via half seed explant culture was also carried out
(Radhakrishnan and Ranjithakumari, 2007). Protocol for callus induction and
plant regeneration was established by using half seed explant on B 5 media of
Vigna mungo (L.) Hepper. The callus was induced in almost all media
combinations supplemented with varying levels of phytohormones. In the
present investigation among all the media and phytohormone combination
tested, the MS medium supplemented with 2.4.D (3.0 mg/l) and kinetin
(0.1mg/l) along with coconut water had induced profuse callusing in both types
of explants like leaf and inter cotyledonary node. The calli so developed were
loose, friable, whitish green coloured and of good quality as compared to calli
produced on other media combinations. Harisaranraj (2008) reported the best
callus development in MS medium supplemented with 2.0 mg/l BAP and 0.5
mg/l NAA. Further attempt to convert callus into plants was not successful.
Successful regeneration of calli of black gram to whole plant had not been
reported yet by any researchers.
5.1.3 Multiple shoot induction
The efficiency of in vitro multiple shoot formation and regeneration
was found to be dependent on various parameters, viz. explant size, age of
explant donor seedling, explant type, genotype, media composition, and growth
106
regulators (Gulati and Jaiwal,1992). For in vitro regeneration of black gram
various explants viz. stem, epicotyl, cotyledonary node explants (Gill et
al.,1987), excised cotyledonary and hypocotyl segments (Sen and Guha, 1998),
cotyledons and embryo axes (Ignacimuthu and Franklin,1997) were utilized
for in vitro multiple shoot induction. In the present investigation shoot tips and
cotyledonary nodes were used for efficient regeneration. Multiple shoots (7.17
shoots/ explant) were achieved from the inoculated explant excised from 4 days
old germinating seedling when cultured on half-strength MS medium
supplemented with 3mg/l BAP, 0.05mg/l IBA. Yadav et al., 2010 used MS B5
media for induction of multiple shoots. Cotyledonary node with embryonic
axis were used by Sumita et al., 2012 for induction of the of multiple shoot.
They reported that MS medium fortified with BAP (2mg/l),Kinetin (2mg/l)
was found to be only 3.24 shoots per explant in the �T-9� cultivar which is
comparatively lower percentage of multiple shoot induction as compared to our
present result. In present investigation similarly, better shooting percentage
was also observed in the medium SIM-7 (fortified with Thidiazuron (TDZ )0.1
mg/l and 0.05 mg/l IBA) with average shoot induction of 80.00% with 5.17
shoots per explant obtained. The TDZ has been reported to induce the
adventitious shoots. Mean multiple shoots per explant decrease with the
increase (up to 3mg/l) of TDZ and also causes shunted shoots with abnormal
morphology. Similar results were reported when TDZ used longer time in the
media (Jayanaand, et al., 2003).
5.1.4 Elongation of Multiple shoots
The explants with multiple shoots from various experiments were
sequentially sub-cultured on to shoot elongation media containing low
concentrations of BAP and Kinetin for production of healthy elongated shoots.
107
In the Blackgram cv. Co-5, the highest (10.45) mean numbers of healthy
elongated shoots per explant was obtained in medium supplemented with 0.5
µM of BAP and 0.5 µM of Kinetin which significantly differed from the mean
number of elongated Shoots per explant in all the other media tested. The mean
number of healthy elongated multiple shoots per explant in the cultivar T-9 and
local market collection was found 10.10 and 9.75, respectively (Sumita, et
al.,2012). A positive effect of a low concentration of the cytokinins group of
growth hormones (BAP, Kinetin, etc.) on multiple shoot elongation was also
observed in other legumes such as V. raditata (Chandra and Pal 1995; Gulati
and Jaiwal 1994), cowpea (V. unguiculata) (Muthukumar, et al. 1996), and
chickpea (Cicer aritenum) (Chakraborti, et al., 2006; Das, et al., 2004; Sarmah,
et al., 2004). In the present work medium supplemented with various
combination of GA3 and adenine sulphate (100mg/l) were used for elongation
of multiple shoots. Among different medium combination, the better elongation
of shoots was observed with MS medium fortified with 1.0 mg/l GA3 and this
medium promoted the maximum elongation of shoots (11.23 cm) within a
week incubation period. The MS medium supplemented with the 1.2 mg/l GA3
showed elongation about 10.42 cm. The phytohormone GA3 showed greater
elongation as compared to the result reported by Sumita, et al., 2012.
5.1.5 Rhizogenes of Multiple shoots
The rooting of shoots was significantly affected by the auxins
concentration. MS medium supplemented with 0.25 mg/l IBA and 0.2 mg/l
NAA performed better rooting within least number of days (8.33) for rooting.
Khawar and Özcan (2002) reported that MS medium containing 0.25 mg/l. IBA
performed best and required four weeks for rooting. Geetha, et al. (1999)
reported that roots emerged within 15 days. A higher percentage of rooting
108
(100%) was found with 0.5 mg/l IBA in the study. Raman, et al. (2004)
reported that efficient rooting (100%) of the shoots on medium containing half
MS salts, full MS vitamins and IBA (2.5 ìM). Khawar and Özcan (2002)
reported that medium containing 0.25 mg/l IBA obtained only 25% roots and
Geetha, et al. (1999) reported that medium containing 3 mg/l IBA showed
78.3% of rooting. The maximum number of roots (14.33) per shoot was
recorded in medium containing 0.5 mg/l NAA. Geetha, et al. (1999) reported
that medium containing 3.0 mg/l IBA produced 14.5 roots/plants. It was clear
from the above discussion that 0.5 mg/l IBA was better for root formation than
any other treatments. Das, et al. (2002) and Geetha, et al. (1999) reported that
IBA was effective for rooting of black gram, while Roy et al. (2007) reported
that NAA was effective for rooting.
In our study we found higher percentage of rooting in MS medium
supplemented with NAA (0.5 mg/l) and in this treatment about 72.5% of shoots
responded well for rooting with an average of 6.2 roots per shoots. Similarly,
68.9% explant responded for rooting in medium containing NAA (0.25mg/l)
which was comparatively lower percentage response than the 0.5mg/l NAA but
number of roots per shoots are quite higher (8.40). in vitro raised healthy
plantlets of 13-15 cm in height were planted in a mixture of soil: sand: FYM
present in the ratio of 1:1:1. Survival rate of the transplanted plantlets was
recorded to be 70%.
5.2 Transformation studies
Agrobacterium-mediated transformation involves interaction between
two biological systems and is affected by various physiological conditions.
Therefore optimization of some of the aspects that enhance the virulence of
Agrobacterium for T-DNA transfer and factors that improve survival and
109
regeneration of transformed cells is crucial for a recalcitrant crop like
black gram. Transient GUS expression provides an easy and clear indication of
the expression of transferred genes and can be used to assess the frequency of
transformation. In the present study, sub-culturing of explants prior to agro
infection facilitated entry of Agrobacterium cells and production of �vir� gene
inducers. Compromise between the efficiency of infection and survival rate
after transfer.
Inclusion of synthetic phenolic compound acetosyringone in co-
cultivation medium enhanced transient expression of GUS when used at a final
concentration of 100 µM. Acetsyringone enhances �vir� functions during
transformation (Stachel, et al., 1985) and has been shown to increase
transformation potential of Agrobacterium strain with moderately virulent �vir�
region in several plant species (Atkinson and Gardner, 1991; Janssen and
Gardner, 1993; Kaneyoshi et al., 1994). Also the acidic pH (5.2) used in the
infection medium acts synergistically with acetosyringone for increasing the
transformation efficiency.
The blue coloration in the infected cotyledon explants upon histochemical
assay suggested the introduction and expression of GUS gene. Based on molecular
characterization using PCR, the integration of nptII gene was confirmed in
transgenics. The untransformed control did not show any amplification with these
primers. Two transgenic lines expressing the nptII. The transformation frequency
increased with increase in concentration of Agrobacterium cells up to 108 and,
thereafter, decreased with further increase in number of Agrobacterium cells.
Similar results were mobtained in Nicotiana tabacum and Arabidopsis thaliana
and in most of the grain legumes (Bean, et al. 1997).
110
The length of co-cultivation period required for achieving maximum
gene transfer was found to be 3 days. Further extension in co-culture time
decreased the transformation frequency resulting in bacterial overgrowth and
had detrimental effect on regeneration potential of explants. A short co-culture
period of 2 or 3days has also been found to be optimum in other plant species
such as Antirrhinum majus (Holford, et al.,1992), Vigna unguiculata
(Muthukumar, et al., 1996), Vigna radiate (Jaiwal, et al., 2001), Cajanus cajan
(Mohan and Krishnamurthy, 2003), and Glycine max (Li, et al. 2004)
Wounding the plant material before co-cultivation allows better bacterial
penetration into the tissue facilitating the accessibility of plant cells for
Agrobacterium or possibly stimulated the production of potent �vir� gene
inducers like phenolic substances such as acetosyringone and
hydroxyacetosyringone (Stachel, et al.,1985) and enhanced the plant cell
competence for transformation (Binns and Thomashow,1988). Wounding the
plant material before co-cultivation has also been shown to increase
transformation frequency. Mechanical injury of the meristematic region
probably induces meristem reorganizations promoting formation of large
transgenic sectors and enhanced recovery of transformants.
Pre-culture of explants on regeneration medium prior to inoculation and co-
cultivation with Agrobacterium has been reported to enhance efficiency of
transformation in some grain legumes, e.g. Vigna unguiculata (Muthukumar, et al.
1996) and Cajanus cajan (Geetha, et al. 1999). However, in present study, no
such results were obtained. This may be due to the specificity of species to pre-
culture. In contrast, pre-culture (0 - 3 days) of cotyledonary node explants prior
to co-culture with bacteria reduced the frequency of transient GUS expression
high. This may be due to the healing of the wounding site, because wounding is
111
a prerequisite for Agrobacterium-mediated transformation. The reduction may
be attributed to the secretion of compounds that inhibit �vir� gene induction or
dilution of the �vir� gene inducing signal molecules released as result of
wounding. Wounding induced division and production of phenolic compounds
such as acetosyringone and hydroxyacetosyringone. These signal molecules are
recognized especially by Agrobacterium to induce �vir� gene expression and
thereby activate T-DNA transfer (Zambryski, 1983). Pre-culture was found to
reduce transformation efficiency in other plant species also such as kiwifruit
(Janssen and Gardner, 1993) had no effect in peanut transformation (Sharma
and Anjaiah, 2000). When preculture was combined with mechanical injury the
results were reversed that leads to increase in transient GUS expression and
was found to be up to 95 %. This may be attributed to visually more clear
regeneration site on the pre-cultured explants for mechanical injury as
compared to non-pre-cultured and freshly release of phenolics as a result of
mechanical injury. High vigour of pre-cultured explants was also found to
increases the regenerability of mechanically injured explants. These optimized
transformation factors were used for the stable genetic transformation of Vigna
mungo. One hundred sixty five cotyledonary node explants co-cultured with
Agrobacterium produced a total of 12 shoots on kanamycin selection medium.
The green shoots (2 to 3 cm) were subjected to a second round of selection at
the rooting stage. These plantlets were subsequently transferred to soil. The
plant genomic DNA was isolated for PCR analyses. PCR results showed
amplification of a 700 kb band corresponding to the coding region of nptII
gene, indicating the presence of transgene in 2 out of 10 putatively transformed
plants established in soil, with an overall transformation frequency of 1.53%.
112
SUMMARY AND CONCLUSION
Black gram (Vigna mungo L. Hepper) is popularly known as Urad in
Hindi, Biri in Odia and Uddu in Kannada. It belongs to the family Fabaceae. It
is diploid in nature with 2n=2x=22. It has a small genome size containing 574
million base pairs. It is the third most important pulse crop in India after
chickpea and pigeon pea and grown mostly as a fallow crop in rotation with
cereals. In India total area under cultivation is about 31.0 lakh hectares with the
average production and productivity of 14.0 lakh tones and 451.61 kg/ha
respectively. The total area under black gram in Odisha is about 1.50 lakh
hectares with total production 0.42 lakh tones. But the productivity of black
gram is 280.0 kg/ha which is far below than the national average productivity
(451.61 kg/ha). Its yield is highly affected by a number of abiotic stresses
particularly cold and moisture stress. Abiotic stress causes the crop loss more
than 50% from their potential yield (Wang et al., 2006). Varietal improvement
against abiotic stress tolerance is the major remedy for increasing productivity
and production of black gram. Varietal improvement of black gram through
genetic engineering of plant for tolerance to abiotic stress could be achieved by
the regulated expression of a large number of stress responsive genes. Among
available genes, ICE-1 gene has been identified as one of the potential genes
conferring resistance to abiotic stress. This gene had been isolated from the
model plant Arabidopsis thaliana and well characterised. It is an upstream
transcription factor and is a positive regulator of CBF-3 and plays a critical role
in cold tolerance. The present research aimed at developing an efficient
regeneration and transformation system for genetic improvement of black
gram cv. �T-9�.
For development of an efficient in vitro regeneration protocol, different
explant like leaf, shoot tips, shoot tips with cotyledon nodes were tested for
callus initiation. The leaf was found to be more responsive for callus initiation
id2099165 pdfMachine by Broadgun Software - a great PDF writer! - a great PDF creator! - http://www.pdfmachine.com http://www.broadgun.com
113
than other explants. The MS medium supplemented with 2.4.D (3 mg/l) and
kinetin at (1mg/l) was found to be the most responsive in the callus formation.
Callus induction was achieved in 87.25% explants cultured in this medium
after 12 days of incubation. Further conversion of callus to whole plants could
not be achieved in spite of different media, phytohormone combination and
organic supplements The direct multiple shoots induction from different
explants was observed in medium SIM-4 (Shoot Induction Medium)
supplemented with 3mg/l BAP, 0.05mg/l IBA (including adenine sulphate
(100mg/l). This treatment resulted development of shoots from cotyledon node
in reasonable time frame of 13 days with more than 84.33% of the explants
responding with average of 7.17 shoots per explant. The explants shoot tip with
cotyledonary node showed better response than that of shoot tip. About 84.33%
response of direct regeneration were recorded with average multiple shoots of
7.17 per explant. During sub-culturing MS medium fortified with 1.0 mg/l GA3
promoted the maximum elongation of shoots (11.23 cm) within a week
incubation period. About 68.9% explant responded for rooting in medium
NAA (0.25mg/l) which was comparatively lower percentage response than the
0.5mg/l NAA but number of roots per shoots are quite higher (8.40).
Transformation of regenerated shoots was achieved by employing
Agrobacterium mediated indirect transformation protocol. EHA-105
Agrobacterium strain harbouring a binary vector pCAMBIA2301 containing
Neomycin phosphotransferase (nptII) gene as selectable marker, ß-
glucuronidase (GUS) as a reporter gene and ICE-1gene was used for co-
cultivation with regenerated multiple shoots for genetic transformation.
Kanamycin based selection system performing Agrobacterium mediated
transformation of black gram Kanamycin at 80mg/l used for screening of
putative transformants. Explants were co-cultivated and regenerated multiple
shoots were subjected to Kanamycin (80 mg/l) selection for screening of
transformants. Transformation efficiency on the basis of Kanamycin selection
was found to be 9.23%. Transient GUS expression percentage was observed
about 95% in transformed shoots after screening on selection medium
114
containing antibiotics. Based on PCR analysis with nptII primer transformation
efficiency was found to be about 1.53%. The genetically modified plants were
hardened in the greenhouse and then transferred to the field for further agro-
morphological and biochemical characterization.
Transgenics technology supplements the breeding programme for
genetic improvement of crop plants where conventional genetic transfer cannot
achieved due to sexual barrier and limited availability of genes within the
germplasm. The Agrobacterium mediated transformation which has been
successful in other dicot crops has not been as efficient in grain legumes like
black gram. The present investigation is a foot step for transgenic development
in legume crop by increasing the efficiency of gene delivery and expression
system. Further enhancement in transgenic technology in legume crop can be
achieved by development new vector and its delivery system and efficient
regeneration protocol.
i
REFERENCES
Abdrakhamanova, A., Wang, Q.Y., Khokhlova, L. and Nick, P., 2003. Is
microtubule for cold disassembly a trigger acclimation?. Plant & Cell
Physiology, 44: 676�686.
Adkins, A.L., Godwin, J.D. and Adkins, S.W., 1995. An efficient in vitro
regeneration system for Australian grown chickpea (Cicer arietinum)
cultivars. Australian Journal of Botany, 43: 491-497
Allagulova, C.R., Gimalov, F.R., Shakirova, F.M. and Vakhitov, V.A.2003.
The plant dehydrins: structure and putative functions. Biochemistry
(Moscow), 68:945�951.
Allen, M. D., Yamasaki, K., Ohme-Takagi, M., Tateno, M., and Suzuki, M.,
1998, a novel mode of DNA recognition by a -sheet revealed by the
solution structure of the GCC-box binding domain in complex with
DNA. European Molecular Biology Organization Journal,
17:5484�5496
Altaf, N. and Ahmad, M.S., 1986. Plant regeneration and propagation of
chickpea through tissue culture techniques. International Atomic
Energy Authority, WienIAEA.407-417
Altimkut, A., Bajororic using callus derived plantlets and seedlings
.International chickpea Newsletter,4:30-31
Ammirato, P. V., 1983. The regulation of somatic embryo development in plant
cell cultures: suspension culture techniques and hormone requirements.
Biotechnology. 1. 68�74
id2115217 pdfMachine by Broadgun Software - a great PDF writer! - a great PDF creator! - http://www.pdfmachine.com http://www.broadgun.com
ii
Amutha, M., M. S. and Ganapathi, A. 2010. Somatic embryo productions by
liquid shake culture of embryogenic calluses in Vigna mungo (L.)
Hepper, In Vitro Cell. Dev. Biol. - Plant 46:34�40
Anbazhagan, V. R. and Ganapathi, A. 1999. Somatic embryogenesis in
suspension cultures of pigeon pea (Cajanus cajan). Plant Cell Tissue
Organ Cul. 56: 179�184.
Anderson, M. D. and Brar., 1997. Differential gene expression in chilling
acclimated maize seedlings and evidence for the involvement of
abscisic acid in chilling tolerance. Plant Physiol. 105: 331�339
Andres, M. and Gatica Arias., 2010. In vitro plant regeneration system for
common bean (Phaseolus vulgaris): effect of N6-benzylaminopurine
and adenine sulphate. Electronic journal biotechnology.140-146
Anthony, T.T., Stephen, H.B., Igor, V.K., Ignacio, E.M.M., Wayne, K.V.,
Laura, A.B., Heungsop, S., TZYY, J.C., Hiroaki, K., Gary, R.D.,
Detlef, W. and Maria, J.H., 2000. Transformation of Medicago
truncatula via infiltration of seedlings of flowering plants with
Agrobacterium. The Plant Journal. 22 (6): 531-541.
Arachiasamy, S., Varghese, G. and Ignarcimuthu, S., 2000. High frequency
regeneration of chickpea (Cicer arietinum L.) plantlets from leaf callus.
Phyto-morphology, 50 (3-4): 297-302.
Aragao F. J. L., Ribeiro, S. G., Barros, L. M. G., Brasileiro, A. C. M., Maxwell,
D. P,.. Rech, E. L. and Faria. J. C.1998. Transgenic beans (Phaseolus
vulgaris L.) engineered to express viral antisense RNAs show delayed
and attenuated symptoms of bean golden mosaic Gemini virus. Mol
Breed. 4:491�499.
Arora, P.P., 1988, Line x tester analysis for combining ability in bengalgram.
Himachal Journal of Agriculture Research,14: 6-12.
iii
Atienza, S.G., Faccioli, P., Perrotta, G., Dalfino, G., Zschiesche, W.,Humbeck,
K., Stanca, and Cattivelli L A.M. 2004. Large-scale analysis of
transcript abundance in barley subjected to several single and combined
abiotic stress conditions. Plant Science, 167:1359�1365.
Atkinson, R.G. and Gardner. R. 1991. Agrobacterium-mediated transformation
of pepino and regeneration of transgenic plants. Plant Cell Rep. 10:
208-212.
Badawi, M., Reddy, Y.V., Agharbaoui, Z., Tominaga, Y., Danyluk, J., Sarhan,
F. and Houde, M. 2008.Structure and functional analysis of wheat ICE
(inducer of CBF expression) genes. Plant Cell Physiol. 49:1237�1249
Bae, H.H., Herman, E., Bailey, B., Bae, H.J. and Sicher R. 2005 Exogenous
trehalose alters Arabidopsis transcripts involved in cell wall
modification, abiotic stress, nitrogen metabolism, and plant defense,
Physiologia Plantarum, 125:114�126.
Barna, K.S. And Wakhlu, A.K., 1994. Whole plant regeneration of Cicer
arietinum from plantlets from leaf callus, Phytomorphology, 50 (3-4):
297-302.
Barwale, U. B., Kerns H. R. and Widholm. J. M.1986. Plant regeneration from
callus cultures of several soybean genotypes via embryogenesis and
organogenesis. Plant biotechnology. 167(4): 473-481.
Bassiri, A., Slinkard, A.E. and F. Ahmad., 1985.Rooting of stem cutting in
Cicer. International Chickpea Newsletter. 13: 10-11.
Bean, S. J., Gooding. P. S., Mullineaux. P. M. and D.R. Davies., 1997. A
simple system for pea transformation, Plant Cell Rep. 16:513-519.
Behman , 2007. The Arabidopsis DREB1A gene driven by the stress-inducible
rd29A promoter increases salt tolerance in proportion to its number in
tetrasomic tetraploid potato, Plant Biotechnology. 23.169-177.
iv
Benedict, C., Skinner, J.S., Meng, R., Chang, Y., Bhalerao, R., Huner, N.P.,
Finn, C.E.; Chen, T.H. and Hurry, V. 2006 The CBF1-dependent low
temperature signalling pathway, regulons and increase in freeze
tolerance are conserved in Populous spp. Plant Cell Environ, 29:1259�
1272.
Bhatnagar Mathur, P., Vadez, V. and Sharma, K.K. 2008. Transgenic
approaches for abiotic stress tolerance in plants: retrospect and
prospects. Plant Cell Rep. 27:411-419.
Bhattacharya, R. C., Viswakarma, N., Bhat, S. R.,. Kirti, P. B. and. Chopra, V.
L. 2002. Development of insect resistant transgenic cabbage plants
expressing a synthetic cry1A(b) gene from Bacillus thuringensis.
Current Science. 83:146-150.
Binns, A. N. and Thomashow M. F.1998.Cell biology of Agrobactrium
infection and transformation of plant. Annual Review of
Microbiology.42:575-606.
Birch, R. G., 1997. Plant transformation: problem and strategies for practical
application . Annual Review of Microbiology .42: 297-326.
Blumwald, E., Aharon, G.S. and Lam, B.C.H.1998. Early signal transduction
pathways in plant�pathogen interactions. Trends in Plant Sci. 3:342�
346
Blundy, K. S., Blundym, M. A. C.and Carter, D. 1991. The expression of
class-1 patatin gene fusions in transgenic potato varies with both gene
and cultivar. Plant Molecular Biology. 16: 153-160.
Brandt, E.B. and Hess, D., 1994. In vitro regeneration and propagation of
chickpea (Cicer arietinum) from meristem tips and cotyledonary nodes.
In vitro Cell Development Biology. 30(1): 75-80.
v
Brar, M.S., Al-Khayri, J.M., Shamblin, C.E., McNew, R.W., Morelock T.E.
and Anderson E.J. 1997. In vitro shoot tip multiplication of cowpea
Vigna unguiculata L . Walp. In Vitro Cell. Dev. Biol. 33: 111-118
Briggs, B.A., Mc CULLOUDS, S.M. and Edick, L.A., 1988.
Micropropagation of azaleas using thidiazuron. Acta Horticulturae.
226: 205-208.
Budar, F., Thia-Toong, L., Montagu, V.M. And Hernalsterns, J.P., 1986.
Agrobacterium � mediated gene transfer results mainly in transgenic
plant transmitting T-DNA as a single Mendalian factors. Genetics.44:
303-313.
Catala, R., Santos, E., Alonso, J.M., Ecker, J.R., Martinez-Zapater., Cattivelli,
L., Baldi, P., Crosatti C., Di-Fonzo, N., Faccioli, P., Grossi, M.,
Mastrangelo, A.M., Pecchioni, N. and Stanca, A.M. 2002.
Chromosome regions and stress-related sequences involved in
resistance to abiotic stress in Triticeae. Plant Molecular Biology.
48:649�665.
Cattivelli, L., Baldi, P., Crosatti, C., Di Fonzo, N., Faccioli P., Grossi M.,
Mastrangelo A.M., Pecchioni N. and Stanca A.M. 2002. Chromosome
regions and stress-related sequences involved in resistance to abiotic
stress in Triticeae. Plant Molecular Biology. 48:649�665.
Chakrabarty, R., Viswakarma, N., Bhat, S.R., Kirti, P.B., Singh, B.D. and
Chopra, V.L. 2002. Agrobacterium mediated transformation of
cauliflower: Optimization of protocol and development of transgenic
cauliflower. Journal of Biosciences. 27(5): 495-502.
Chalker-Scott, L. 1999.Environmental significance of anthocyanins in plant
stress responses. Photochemistry and Photobiology, 70:1�9.
vi
Chaturvedi, C.P. and L. Chand. 2001. Efficient plantlet regeneration in
chickpea. International Chickpea Newsletter. 8: 20-21.
Chandra, M. and Pal, A.1995. Differential response of the two cotyledon of
Vigna mungo in vitro. Plant cell repo.15:248-253
Chauhan, Richa, Tiwari, A. and Singh, N.P., 2003.Differential requirement of
mature and immature embryo of chickpea (Cicer arietinum L.) for in
vitro regeneration. Indian Journal of Plant Physiolog.8 (1): 28-33.
Chen W.P. and Li, P.H. 2002.Attenuation of reactive oxygen production during
chilling in ABA-treated maize cultured cells. Palva E.T. (Eds), Plant
cold hardiness. Kluwer Academic Publishers, Dordrecht, The
Netherlands, 223�233.
Chen, M., Xu, Z., Xia, L., Li, L., Cheng, X., Dong, J., Wang, Q. and Ma, Y.
2009.Cold-Induced modulation and functional analyses of the DRE-
binding transcription factor gene, GmDREB3, in soybean (Glycine max
L.). J. Exp. Bot. 60: 121�135
Chen, T.H. and Murata, N. 2008.Glycinbetaine: an effective protectant against
abiotic stress in plants. Trends in Plant Science.13: 499�505
Chen, W.J. and Zhu, T. 2004.Networks of transcription factors with roles in
environmental stress response. Trends in Plant Science.9:591�596
Chilton, M.D., 1993. Agrobacterium gene transfer: progress on a �poor man�s
vector� for maize. Proc. Natl. Acad. Sci. USA. 90:3119-3120.
Chinnusamy, V., 2006. Gene regulation during cold acclimation in plants.
Physiol Plant. 126: 52�61.
Chinnusamy, V., Ohta, M., Kanrar, S., Lee, B.H., Hong, X.,Agarwal, M., Zhu,
J.K.2003,. ICE1: A regulator of cold-induced transcriptome and
freezing tolerance in Arabidopsis. Genes Dev. 17:1043�1054
vii
Chinnusamy,V., Schumaker, K. and Zhu J.K. 2004. Molecular genetic
perspectives on cross-talk and specificity in abiotic stress signalling in
plants. Journal of Experimental Botany. 55:225�236.
Choi, D. W., Rodriguez, E. M., Close, T. J., 2002. Barley Cbf3 gene
identification, expression pattern, and map location. Plant Physiol. 129:
1781�1787.
Chowdhury, Surya-Prakash, J.B., Jain, R.K. and Chowdhury, V.K., 1992.
Factors affecting plant regeneration in chickpea. Indian Journal of
Experimental Biology. 30: 1149-1153.
Christou, P., Murphy, J. E. and Swain, W. F. 1987. Stable transformation of
soybean by electroporation and root formation from transformed callus.
In: Proceedings of National Academy of Science. 84: 3962-3966.
Dale, P.J., Irwin, J.A and Scheffler, J.A.1993. The Experimental and
Commercial release of transgenic plants, Plant Breeding.111:1-22
Das Dilip K., Prasanna Bhomkar, N. Shiva Prakash and Neera Bhalla-
sarin.2002.Improved method of regeneration of black gram (Vigna
mungo l.) through liquid culture, in vitro cell. dev. biol.plant. 38:456�
459
Das Dilip, K., N. Shiva Prakash, Neera Bhalla-Sarin., 1998. An efficient
regeneration system of black gram (Vigna mungo L.) through
organogenesis Plant Science .134:199�206.
Davey M.T., Rech, E.L. and Mulligan, B.J.1989.Direct DNA transfer to plant
cell. Plant Molecular Biology, 13: 273-285
Davey, M.P., Woodward, F.I. and Quick W.P.2009.Intraspecific variationin
cold-temperature metabolic phenotypes of Arabidopsis lrata ssp.
petraea. Metabolomics, 5:138�149.
viii
De, Palma, M., Grillo, S., Massarelli, I., Costa, A., Balogh, G., Vigh, L. and
Leone, A.2008. Regulation of desaturase gene expression, changes in
membrane lipid composition and freezing tolerance in potato plants.
Molecular Breeding, 21:15�26.
Deng W, Pu, X-A, Goodman, R.N., Gordon, M.P., Nester, E.W.1995. T- DNA
genes responsible for inducing a necrotic response on grape vines. Mol.
Plant-Microbe Interact. 8: 538-548.
Ditt, R., Nester, E.W. and Comai L., 2001. The plant gene expression response to
Agrobacterium tumefaciens. Proc. Natl. Acad. Sci. USA.98: 10954-10954.
Donaldson, P.A. And Simmonds, D.H., 2000. Susceptibility to Agrobacterium
tumefaciens and cotyledonary node transformation in short season
soybean. Plant Cell Reports. 36: 1276-1279
Dong, C.H., Agarwal, M., Zhang, Y., Xie, Q. and Zhu, J.K.2006.The negative
regulator of plant cold responses, HOS1, is a RING E3 ligase that
mediates the ubiquitination and degradation of ICE1.Proceedings of the
National Academy of Sciences USA, 103:8281�8286
Dubouzet, J. G., Sakuma, Y., Ito, Y., Kasuga, M., Dubouzet, E. G., Miura, S.,
Seki, M., Shinozaki, K., Yamaguchi-Shinozaki, K. 2003. OsDREB
genes in rice, Oryza sativa L., encode transcription activators that
function in drought, high-salt and cold-responsive gene expression.
Plant. J .33: 751-763.
Durham, R. E., and Parrott, W. A.1992. Repetitive somatic embryogenesis
from peanut cultures in liquid medium. Plant Cell Rep. 11: 122
Dutta, A., Sen, J. and Deswal, R .2007.Downregulation of terpenoidindole
alkaloid biosynthetic pathway by low temperature and cloning of a AP2
type C-repeat binding factor (CBF) from Catharanthus roseus (L). G.
Don. Plant Cell Reports, 26:1869�1878.
ix
Eapen S., and George, L. 1990. Ontogeny of somatic embryos of Vigna
aconitifolia, Vigna mungo and Vigan radiate. Ann. Bot. 66: 219� 226
Eapen, S. 2008. Advances in development of transgenic pulse crops. Biotech.
Ad. 26:162-168.
Edwards, K., Johnstone, C. and Thompson. C. 1991. A simple and rapid
method for the preparation of plant genomic DNA for PCR analysis.
Nucleic Acids Research. 19(6): 1349.
Estruch, J.J.1997. Transgenic plants: an emerging approach to pest control.
Nat. Biotechnol.66:141-151.
Feirer, P. R., Conkey, H. J, and Verhagen, A. S.1989. Triglycerides in conifer
calli: A comparison with zygotic embryos. Plant Cell Rep. 8: 207�209.
Finnegan, J. and McElroy D. 1994. Transgene inactivation: plants fight back.
Biotechnology. 12: 883-888.
Firoz Anwar, Salem, S., Alghamdi, Megahed, H., Ammar and Siddique, K. H.
M.2011. An efficient in vitro regeneration protocol for faba bean (Vicia
faba L.) Journal of Medicinal Plants Research. 5(28): 6460-6467
Fitch, M. M. M., Hanshardt, R. M., Gonsalves, D., Slightom, J. L. and Sanford,
J. C.1990. Stable transformation of papaya via microprojectile
bombardment. Plant Cell Reports. 9: 189-294.
Fontana, G.S., Santini, L., Caretto, S., Frugis, G. and Hariotti, D., 1993.
Genetic transformation in the grain legume Cicer ariteinum L.
(Chickpea). Plant Cell Reports, 12: 194-198
Fourrier, N., Bedard, J., Lopez-Juez, E., Barbrook, A., Bowyer, J., Jarvis, P.,
Warren, G. and Thorlby, G .2008.A role for SENSITIVETO
FREEZING2 in protecting chloroplasts against freeze induced damage
in Arabidopsis. The Plant Journal, 55:734�745
x
Fowler, D. B., 1996. Relationship between low-temperature tolerance and
vernalization response in wheat and rye. Can. J. Plant Sci. 76: 37�42
Fowler, S. and Thomashow, M. F.2002. Arabidopsis transcriptome profiling
indicates that multiple regulatory pathways are activated during cold
acclimation in addition to the CBF cold response pathway. The Plant
Cell, 14: 1675�1690.
Fowler, S.G., Cook, D. and Thomashow, M.F.2005.Low temperature induction
of Arabidopsis CBF1, 2, and 3 is gated by the circadian clock. Plant
Physiology, 137:961�968.
Franciaan, E., Rizza, F., Cattivelli, L., Stanca, A.M., Galiba, G., Toth, B.,
Hayes, P.M., Skinner, J.S. and Pecchioni, N.2004.Two loci on
chromosome-5H determine low-temperature tolerance in a
��Nure��(winter) � ��Tremois�� (spring) barley map. Theoretical and
Applied Genetics, 108:670�680.
Fromm, M., Taylor, L. P. and Walbot, U.1985. Expression of genes transferred
into monocot and dicot plant cells by electroporation. In: Proceedings
of National Academy of Science, 82: 5824-5828
Fursova, O.V., Pogorelko, G.V. and Tarasov, V.A., 2009.Identification of
ICE2, a gene involved in cold acclimation which determines freezing
tolerance in Arabidopsis thaliana. Gene, 429:98�103.
Garg, A.K., Kim, J.K., Owens, T.G., Ranwala, A.P., Choi, Y.D., Kochian, L.V.
and Wu, R.J. 2002. Trehalose accumulation in rice plants confers high
tolerance levels to different abiotic stresses. Proceedings of the
National Academy,of Sciences USA, 99:15898�15903.
Geetha, N., Venkatachalam, P. and Lakshmisita, G.1999. Agrobacterium
mediated genetic transformation of pigeonpea (Cajanus cajan L.) and
development of transgenic plants via direct organogenesis. Plant
Biotechnology. 16: 213-218.
xi
Gheysen, G.,G. Angenon, M. and Van Montagu., 1998. Agrobacterium
mediated plant transformation: A scientifically intriguing story with
significant application. In Transgenic Plant Research. Plant
cell.104:57-56
Gill, R., Eeapen, S. and Rao, P. S. 1987. Morphogenetic studies of cultured
cotyledons of Urdbean (Vigna mungo L. Hepper). J. Plant Physiol.
1330:1�5.
Gilmour, S. J., Sebolt, A. M., Salazar, M. P., Everard, J. D. and Thomashow,
M. F. 2000. Overexpression of the Arabidopsis CBF3 transcriptional
activator mimics multiple biochemical changes associated with cold
acclimation. Plant Physiol.124: 1854�1865.
Glaszmann, J.C., Kaw, R.N. and Khush G.S.1990.Genetic divergence among
cold tolerant rices (Oryza satva L.) Euphytica. 45:95�104.
Gong, Z., Lee, H., Xiong, L., Jagendorf, A., Stevenson, B. and Zhu,
J.K.2002.RNA helicase-like protein as an early regulator of
transcription factors for plant chilling and freezing tolerance.
Proceedings the National Academy of Sciences USA.99: 11507�11512.
Goodman, R.N. and Novacky, AJ.1994. The hypersensitive reaction in plants
to pathogens. A resistant phenomenon. APS PRESS, St. Paul,
Minnesota.244.
Grennan, A.K. 2006. Abiotic stress in rice. An ��omic�� approach. Plant
Physiology,14:1139�1141
Griffith, M. and Yaish, M.W.F.2004.Antifreeze proteins in over wintering
plants: a tale of two activities. Trends in Plant Science, 9:399�405.
Gulati, A. and P. K. Jaiwal., 1992. In vitro induction of multiple shoots and
plant regeneration from shoot tips of mungbean (Vigna radiata L.
Wilczek). Plant Cell Tissue Org. Cult 23: 1-7.
xii
Gusta, L.V., Wisniewski, M., Nesbitt, N.T. and Gusta, M.L.2004.The effect of
water, sugars, and proteins on the pattern of ice nucleation and
propagation in acclimated and non-acclimated canola eaves. Plant
Physiology,135:1642�1653.
Gustavo A. R, Gonzalez-Cabrera, J., Vazquez-Padron, R. and Ayra-Pardo, C.,
1998. Agrobacterium tumefaciens: A natural tool for plant
transformation. Electronic J. Biotechnol.1 http://www/ ejb.org/ content/
vol1/ issue3/full/1.
Gutha, L. and Reddy. 2008. A. Rice DREB1B promoter shows distinct stress-
specific responses, and the overexpression of cDNA in tobacco confers
improved abiotic and biotic stress tolerance. Plant Mol. Biol. 68:533�
555
Guy, C. 1999. The influence of temperature extremes on gene expression,
genomic structure, and the evolution of induced tolerance in plants. In:
Lerner H.R. (Ed.), Plants responses to environmental stresses. from
Phytohormone to genome reorganization. Marcel Dekker, Inc., New
York, Basel, 497�548.
Guy, C., Kaplan, F., Kopka, J., Selbig, J. and Hincha, D.K. 2008. Metabolomics of
temperature stress. Physiologia Plantarum, 132:220�235.
Hammond �Kosack, K.E.and Jones, J. D.G.1996. Resistance gene�dependent
plant defence responses. Plant Cell. 8:1773�1791.
Hannah, M.A., Wiese, D., Freund, S., Fiehn, O., Heyer, A.G. and Hincha,
D.K.2006.Natural genetic variation of freezing tolerance in
Arabidopsis. Plant Physiology, 142: 98�112.
Hare, P.D., Cress, W.A. and Van Staden, J.1998.Dissecting the roles of
osmolyte accumulation during stress. Plant, Cell and
Environment.21:535�553.
xiii
Harisaranraj, R., Saravana Babu, S. and Suresh, K. 2008 . Callus Induction and
Plant Regeneration of Vigna mungo (L.)Hepper via Half Seed Explant.
Ethno-botanical Leaflets. 12: 577-85.
Hartweek, L. M., Lazzeri, P. A., Cui, D., Collins, G. B. and.Williams, E.
G.1988. Explant orientation effects on somatic embryogenesis from
immature soybean cotyledons. In vitro Cell Division and Biology. 24:
821-828.
Hatzopoulos, P., Fong, F., and Sung, R. Z.1990. Abscisic acid regulation of
DC8, a carrot embryogenic gene. Plant Physiol. 94: 690�695.
Higashi, Y., Hirai, M.Y., Fujiwara, T., Naito, S., Noji, M. and Saito, K., 2006.
Proteomic and transcriptomic analysis of Arabidopsis seeds: molecular
evidence for successive processing of seed proteins and its implication
in the stress response to sulfur nutrition. Plant J. 48: 557-571.
Hincha, D.K., Livingston, D.P., Premakumar, R., Zuther, E., Obel, N., Cacela,
C. and Heyer, A.G. 2007. Fructans from oat and rye: composition and
effects on membrane stability during drying. Biochimical. Biophysica.
Acta.1768:1611�1619.
Hirschi, K.D.1999.Expression of Arabidopsis CAX1 in tobacco: altered calcium
homeostasis and increased stress sensitivity. The Plant Cell.11:2113�
2122
Hobbs, S. L. A., Kpodar, P. and C.M.O. Delong.1990. The effect of T-DNA
copy number, position and methylation on reporter gene expression in
tobacco transformants. Plant Molecular Biology.15: 851-864.
Holford P, Hernandez, N, and Newburg, H. T., 1992. Factors influencing the
efficiency of T-DNA transfer during co-cultivation of Antirrhinum
majus with Agrobacterium tumefaciens. Plant Cell Rep. 11: 196-199.
xiv
Hooykas, P.J. And Schilperoort.1992. Agrobacterium and plant genetic
engineering. Plant Molecular Biology. 14: 5-8.
Horsch, R.B., Fry, J., Hoffmann, M., Wallroth, M., Eichholtz, D., Rogers, S.
and Fraley, R.T., 1985. A simple and general method for transferring
genes into plants. Science, 227: 1229-1231.
Hsieh, T.H., Lee, J.T., Yang, P.T., Chiu, L.H., Charng, Y.Y., Wang, Y.C. and
Chan, M.T. 2002.Heterology expression of the Arabidopsis C-
repeat/dehydration response element binding factor1 gene confers
elevated tolerance to chilling and oxidative stresses in transgenic
tomato. Plant Physiol. 129:1086�1094.
Hu, Y., Zhang, L., Zhao, L., Li, J., He, S., Zhou, K., Yang, F., Huang, M., Jiang,
L. and Li, L.2011. Tricho statin A selectively suppresses the cold-induced
transcription of the ZmDREB1 gene in maize. PLoS One. 6: e22132
Iba, K. 2002.Acclimative response to temperature stress in higher plants:
approaches of gene engineering for temperature tolerance. Annual
Review of Plant Biology. 53:225�245.
Ignacimuthu and Prakash. 2006. Agrobacterium � mediated transformation of
chickpea with alpha- amylase inhibitor gene for insect resistance.
J.Biosci.31:331-345
Ignaeimuthu, S., Franklin, G. And Melchias, G.1997. Multiple shoot formation
and in vitro fruiting of Vigna-mungo L. Hepper. Curr. Sci.73:733-735.
Indurkar, S., H. S. Mistra, and E. Susan., 2007. Genetic trasnfermation of
chickpea (Cicer arietinum L.) with insecticidal crystal proteins using
particle gun Bombardment. Plant Cell Rep. 26: 755-763.
Iordachescu, M. and Imai, R.2008.Trehalose biosynthesis in responseto abiotic
stresses. Journal of Integrative Plant Biology.50:1223�1229
xv
Islam .R, Malik .T., Husnain .T and Riazuddin S., 1994. Strain and cultivar
specificity in the Agrobacterium chickpea interaction. Plant Cell
Reports. 13: 561-563.
Islam,M.N. and Islam,K.T. 2010. Agrobacterium � mediated genetic
transformation of Vigno mungo L.Hepper. Cuur.sci.73:733-735
Ito Y., Katsura K., Maruyama K., Taji T, Kobayashi M., Seki M., Shinozaki
K., Yamaguchi-Shinozaki K., 2006. Functional analysis of rice
DREB1/CBF-type transcription factors involved in cold-responsive
gene expression in transgenic rice. Plant Cell Physiol. 47: 141�153.
J.M. and Salinas, J.2003.Mutations in the C2+/ H+ transporter CAX1 increase
CBF / DREB1 expression and the cold-acclimation response in
Arabidopsis. The Plant Cell. 15:2940�2951.
Jaglo, K. R., Kleff, S., Amundsen, K. L., Zhang, X., Haake, V., Zhang, J. Z.,
Deits, T. and Thomashow, M. F. 2001. Components of the Arabidopsis
C-repeat/dehydration-responsive element binding factor cold-response
pathway are conserved in Brassica napus and other plant species. Plant
Physiol.127: 910�917
Jaglo-Ottosen, K. R., Gilmour, S. J., Zarka, D. G., Schabenberger, O. and
Thomashow M. F. 1998. Arabidopsis CBF1 overexpression induces cor
genes and enhances freezing tolerance. Science .280: 104-106
Jaiwal, P.K., 2001. Agrobacterium tumefaciens mediated genetic
transformation of mungbean A recalcitrant grain legume. Plant Science.
161: 239-247.
Jaiwal, P.K., Kumari, R., Ignacimuthu, S., Potrykus, I., Sautter, C. 2007.
Agrobacterium tumefaciens mediated genetic transformation of
mungbean (Vigna radiata L. Wilczek)-a recalcitrant grain legume.
Plant Sci .16:239-47
xvi
James, D.J., Passey, A.J., Barbaro, D.J. and Bevan, M., 1989. Genetic
transformation of apple (Malus pumila M.) using a disarmed Ti-binary
vector. Plant Cell Reports.7: 658-661.
Janssen, B. J., Gardner R. C.,1993. The use of transient GUS expression to
develop an Agrobacterium-mediated gene transfer system for
kiwifruit. Plant Cell Rep. 13: 28-31.
Jayanand, B., G. Sudarsanam, and K. K. Sharma., 2003. An efficient protocol
for the regeneration of whole plant of chickpea (Cicer arietinum) by
using axillary meristem explants derived from in vitro germinated
seedlings. In vitro Cell Division and Biology. 39: 171-179.
Jefferson, R., Goldsbrough, A. and Beven, M. 1990. Transcriptional regulation
of patatin-1 gene in potato. Plant Molecular Biology. 14: 995-1006.
Ji, X., Vanden Ende, W., Schroeven, L., Clerens, S., Geuten, K.,Cheng, S., and
Bennett, J. 2006. The rice genome encodes two vacuolar invertases
with fructan exohydrolase activity but lacks there lated fructan
biosynthesis genes of the Pooideae. New Phytologist.173:50�62.
Joersbo, M. and Brunstedt, J.1992. Direct gene transfer to plant protoplast by
mild sonication. Plant Cell Reports.9: 207-210.
Juntilla, O. and Robberecht, R. 1999. Ecological aspects of cold-adapted plants
with special emphasis on environmental control of cold hardening and
dehardening. In: Margesin R., Schinner F. (Eds),Cold-adapted
organisms ecology, physiology, enzymology and molecular biology.
Springer-Verlag, Berlin, Germany. 57�77.
Junttila, O., Welling, A., Li, C., Berhany, A.T., Palva, E.T.2002. Physiological
aspects of cold hardiness in northern deciduous tree species. Academic
Publishers, Dordrecht, The Netherlands.65�76.
xvii
Kacperska, A. 1999.Plant response to low temperature: signalling pathways
involved in plant acclimation. Springer-Verlag, Berlin,Germany,79�103
Kaneyoshi, J., S. Kobayashi, Y. Nakamura, N. Shigemoto and Y. Doi., 1994. A
simple and efficient gene transfer system of trifoliate orange. Plant Cell
Rep. 13: 541-545.
Kannaiyan, S., 1999. Bioresources Technology for sustainable Agriculture.
Associated publishing Company.New Delhi. 422.
Kaplan, F., Sung, D.Y. and Guy C.L. 2006. Roles of ß-amylase and starch
breakdown during temperature stress. Physiologia Plantarum.126:120�128.
Kar, S., Johnson, T. M., Nayak, P. and Sen, S. K.1996. Efficient transgenic
plant regeneration through Agrobacterium mediated transformation of
chickpea (Cicer arietinum L.). Plant Cell Reports. 16 (1-2): 32-37.
Kasuga, Yamaguchi-Shinozaki, K. and Shinozaki, K.,1994. A novel cis-acting
element in an Arabidopsis gene is involved in responsiveness to
drought, low-temperature, or high-salt stress. Plant Cel. 6: 251�264.
Kasuga, M., Setsuko Miura, Kazuo Shinozaki and Kazuko Yamaguchi-
Shinozaki.2004. A Combination of the Arabidopsis DREB1A Gene and
Stress-Inducible rd29A Promoter Improved Drought and Low-
Temperature Stress Tolerance in Tobacco by Gene Transfer. Plant Cell
Physiol. 45(3): 346�350.
Kasuga, M., Liu, Q., Miura, S., Yamaguchi-Shinozaki, K. and Shinozaki, K., 1999.
Improving plant drought, salt and freezing tolerance by gene transfer of a
single stress-inducible transcription factor. Nat. Biotechnol. 17: 287�291.
Kayal, W.E., Navarro, M., Marque, G., Keller, G., Marque, C. and Teulieres.
C.2006. Expression profile of CBF-like transcriptional factor genes
from Eucalyptus in response to cold. Journal of Experimental
Botany.57: 2455�2469.
xviii
Kenji, Miura and Tsuyoshi, Furumot. 2013. Cold Signalling and Cold
Response in Plants. Int. J. Mol. Sci., 14:5312-5337
Khawer, M. K., Sancak, G., Uranbey, S. and Ozan, S. 2004. Effect of
Thidiazuron on shoot regeneration from different explants of Lentil
(Lens cutlinaris Medik) via organogenesis. Turk. J. Bot.2: 45-47.
Khawar, K. M. and Ozcan, S. 2002.Effect of Indole-3-Butryic acid on in vitro
root development in lentil.J.Bot.26:109-111
Khlifi, S. and Tremblay, F. M., 1995 . Maturation of black spruce somatic
embryos. I. Effect of L-glutamine on the number and germinability of
somatic embryos. Plant Cell Tissue Organ Cult. 41: 23� 32.
Klein, T. M., Fromm, M. E. and Gradziel, T.1988. Factors influencing gene,
delivery into Zea mays cells by high velocity microprojectiles.
Biotechnology.6: 559-564.
Komari ,T., Hiei, Y., Saito, Y., Murai N and Kumashiro T., 1996. Vectors
carrying two different T-DNAs for co-transformation of higher plants
mediated by Agrobacterium tumefaciens and segregation of
transformants free from selection markers. Plant J. 10: 165-174.
Komatsu, S., 2007. Over-expression of calcium-dependent protein kinase 13
and calreticulin interacting protein 1 confers cold tolerance on rice
plants. Mol. Genet. Genomics 227: 713�723
Korn, M., Peterek, S., Mock, H.P., Heyer, A.G. and Hincha, D.K.
2008.Heterosis in the freezing tolerance, and sugar and flavonoid
contents of crosses between Arabidopsis thaliana accessions of widely
varying freezing tolerance. Plant, Cell and Environment.31:813�827.
Kovacs, D., Kalmar, E., Torok, Z. and Tompa, P. 2008.Chaperone activity of
ERD10 and ERD14, two disordered stress-related plant proteins. Plant
Physiology.147:381�390.
xix
Krishnamurthy, K. V., K. Suhasini, A. P. Sagare, M. Meixner, A. De-Kathen,
T. Pickardt and Schieder., 2000. Agrobacterium mediated
transformation of chickpea (Cicer arietinum L.) embryo axes. Plant
Cell Reports. 19 (3): 235-240.
Kumar, V. D., P. B. Kirti, J. K. S. Sachan, and V. L. Chopra., 1994. Plant
regeneration via somatic embryogenesis in chickpea. Plant Cell
Reports. 13: 468-472.
Lane, A. and A. Jarvis. 2007. Changes in Climate will modify the Geography
of Crop Suitability: Agricultural Biodiversity can help with Adaptation.
eJournal. 4(1): 1-12, 2007.
Lawrence, P. K. and Koundal, K. R. 2001. Agrobacterium tumefaciens mediated
transformation of pigeonpea (Cajanus cajan L. Millsp) and molecular
analysis of regenerated plants. Current Science. 80: 1428-1432.
Lee, B., Henderson, D.A. and Zhu J.K.2005. The Arabidopsis cold responsive
transcriptome and its regulation by ICE1. The Plant Cell. 17:3155�3175.
Lee, B.H., Henderson, D.A. and Zhu, J.K. 2005.The Arabidopsis cold-
responsive transcriptome and its regulation by ICE1. Plant Cell
17:3155�3175
Lee, J. T., Prasad, V., Yang, P. T., Wu, J. F., Ho, T. H, D., Charng, Y. Y. and
Chan, M. T. 2003.Expression of Arabidopsis CBF1 regulated by an
ABA/stress promoter in transgenic tomato confers stress tolerance
without affecting yield. Plant Cell Environ 26: 1181�1190
Levitt guch, J. 1980. In: Chilling, Freezing, and High Temperature Stress.
Plant Physiology.123:265�274.
Li W., Wang, R., Li, M., Li, L., Wang, C., Welti ,R. and Wang, X.
2008.Differential degradation of extra plastidic and plastic lipids during
freezing and post-freezing recovery in Arabidopsis thaliana. The
Journal of Biological Chemistry, 283:461�468.
xx
Li, H.Y., Zhu, Y.M., Chen, Q., Conner, R, L. and Ding, X.D. 2004.Production
of transgenic sorghum plants with two anti-fungal protein genes via
Agrobacterium and particle bombardment. Biol Plant. 48:367�374
Li, W., Wang, R., Li, M., Li, L., Wang, C., Welti, R. and Wang X.
2008.Differential degradation of extraplastidic and plastidic
lipidsduring freezing and post-freezing recovery in Arabidopsis
thaliana. The Journal of Biological Chemistry.283:461�468.
Lia, X.H., Dai, L.Y. and Zhang J.H.1998. Factors related to cold tolerance at
booting stage in Oryza sativa L. Chinese J. Rice Sci.12:6�10.
Litz, R. E., 1986. Effect of osmotic stress on somatic embryogenesis in Carica
suspension culture. J. Am. Soc. Hortic. Sci. 111: 969�972.
Liu Y., Burch-Smith T., Schiff M., Feng, S. and Dinesh-Kumar S, P., 2004.
Molecular chaperone Hsp90 associates with resistance protein N and
its signaling proteins SGT1 and Rar1 to modulate an innate immune
response in plants; J. Biol. Chem. 279 2101�2108.
Liu, J. and Zhu, J. K. 1998. A calcium sensor homolog requireed for plant salt
tolerance. Science. 280: 1943-1945
Liu, L., Duan, L., Zhang, J.,Zhang, Z., Mi, G. and Ren, H.2010 Cucumber
(Cucumis sativus L.) over-expressing cold-induced transcriptome
regulator ICE1 exhibits changed morphological characters and
enhances chilling tolerance. Sci. Hortic.124, 29�33
Liu, Q., Kasuga, M., Sakuma, Y., Abe, H., Miura, S., Yamaguchi-Shinozaki,
K. and. Shinozaki, K. 1998. Two transcription factors, DREB1 and
DREB2, with an EREBP/AP2 DNA binding domain separate two
cellular signal transduction pathways in drought- and low-temperature-
responsive gene expression, respectively, in Arabidopsis. Plant
cell.10:1391�1406.
xxi
Liu, Q., Kasuga, M., Miura, S., Yamaguchi-Shinozaki, K. and Shinozaki,
K.1999. Improving plant drought, salt, and freezing tolerance by gene
transfer of a single stress-inducible transcription factor. Nat.
Biotechnol. 17: 287�291.
Liu, W., Parrot, W. A., Hilderbrand, D. F., Collins, G. B. and Williams, E. G.,
1990. Agrobacterium induced gall formation in bell pepper (Capsicum
annuum L.) and formation of shoot like structures expressing
introduced genes. Plant Cell Reports. 9: 360-364.
Livingston, D.P., Premakumar, R. and Tallury, S.P. 2006. Carbohydrate
partitioning between upper and lower regions of the crown in oat and
rye during cold acclimation and freezing. Cryobiology,52:200�208.
Llorente, F., 2000. A freezing-sensitive mutant of Arabidopsis, frs1, is a new
aba3 allele. Planta. 211: 648�655
Loiseau, J., Marche, C., and Deunff, Y. L. 1995. Effects of auxins, cytokinins,
carbohydrates and amino acids on somatic embryogenesis induction
from shoot apices of pea. Plant Cell Tissue Organ Cult. 41: 267�275.
Kasuga, M., Miura1, S., Shinozaki, K. and Yamaguchi-Shinozakil. K. 2004. A
Combination of the Arabidopsis DREB1A Gene and Stress-
Inducible rd29A Promoter Improved Drought-and Low- Temperature
Stress Tolerance in Tobacco by Gene Transfer. Plant Cell Physiol. 45
(3):346-350.
Malik, K.A. and Saxena, P.K., 1992.Thidiazuron induces high-frequency shoot
Regeneration from elite chickpea genotypes. International Chickpea
Newsletter. 29: 4-6.
Mallikarjun, N., Moss, J.P. and Mallikarjun, N., 1993. Regeneration from elite
chickpea genotypes. International Chickpea Newsletter, 29: 4-6.
xxii
Marczak, L., Kachlicki, P., Kozniewski, P., Skirycz, A., Krajewski ,P. and
Stobiecki, M. 2008.Matrix-assisted laser desorption »� LRQL]DWLRQ� WLPH-
of-flight mass spectrometry monitoring of anthocyanins in extracts
from Arabidopsis thaliana leaves. Rapid Communications in Mass
Spectrometry.22:3949�3956.
Maruyama, K., Sakuma, Y., Kasuga, M., Ito, Y., Seki, M., Goda, H., Shimada,
Y., Yoshida, S., Shinozaki, K. and Yamaguchi-Shinozaki, K.2004.
Identification of cold-inducible downstream genes of the Arabidopsis
DREB1A/CBF3 transcriptional factor using two microarray systems.
Plant J. 38:982�993
Matzke, M. A. and Matzke, A. J. M., 1995 . How and why do plants
inactivate homologous (trans) genes. Plant Physiology. 107: 679-685.
Mazzucotelli, E., Tartari, A., Cattivelli, L. and Forlani, G. 2006.Metabolism of
gamma-amino-butyric acid during cold acclimation and freezing and its
relationship to frost tolerance in barley and wheat. Journal of
Experimental Botany.57:3755�3766.
Mckently, A.M., Moore, G.A., Doostdar, N. and Niedz, R.P., 1995,
Agrobacterium mediated transformation of peanut embryoaxes and the
development of transgenic plants. Plant Cell Reports.14: 699-703.
McKersie,B.D.,1994.Oxidativestress.http://www.agronomy.psu.edu/Courses/A
GRO518/Oxygen.htm.
Mehdy, M.C.1994. Active oxygen species in plant defence against pathogens.
Plant Physiol. 105:467�472.
Mehra, K., 1993. Scope of plant biotechnology in developing countries. An
Indian case study in plant tissue culture. J. Sci. Indian Indian Res.
52:795-802.
xxiii
Merkle, S. A., Parrott, P. A., and Flinn, B. S. 1995. Morphogenic aspects of
somatic embryogenesis. In: Thorpe TA (ed) In vitro embryogenesis in
plants. Kluwer, Dordrecht. 155�203.
Meyer, P., 1995. Variation of transgene expression in plants. Euphytica, 85:
359-366.
Miki, B. L.A., Reich, T.J and Iyer, V.N. 1987. Microinjection an experimental
tool for studying and modifying plant cells. In: plant DNA infectious
agent.Ed. Hohn, T. and Schell, J. Springer Verlag, New York, 349-365
Mittler, R., Vanderauwera, S., Gollery, M. and Van Breusegem, F.
2004.Reactive oxygen gene network of plants. Trends in Plant
Science.9:490�498.
Miura, K., Sato, A., Shiba, H. Kang, S.W., Kamada, H. and Ezura, H.
2012.Accumulation of antioxidants and antioxidant activity in tomato,
Solanum lycopersicum, are enhanced by the transcription factor
SlICE1. Plant. Biotechnol.29:261�269.
Miura, K., Shiba, H., Ohta, M., Kang, S.W., Sato, A., Yuasa, T., Iwaya-Inoue,
M. Kamada, H. and Ezura, H. 2012. SlICE1 encoding a MYC-type
transcription factor controls cold tolerance in tomato, Solanum
lycopersicum. Plant Biotechnol.29:253�260.
Moffatt, B., Ewart, V. and Eastman, A. 2006. Cold comfort: plant antifreeze
proteins. Physiologia Plantarum. 126:5�16.
Mogk, A., Schlieker. C., Friedrich, K.L., Schonfeld, H.J., Vierling, E., Bukau,
B.2003.Refolding of substrates bound to small Hspsrelies on a
disaggregation reaction mediated most ef¿FLHQWO\� E\� &OS%� »� 'QD.��
Journal of Biological Chemistry.278:31033�31042.
xxiv
Mohan, K.L. and Krishnamurthy, K,V. 2003.Plant regeneration from
decapitated mature embryo axis and Agrobacterium mediated genetic
transformation of pigeon pea. Biol Plant.46:519�527
Monroy, A.F., Dryanova, A., Malette, B., Oren, D.H., Farajalla, M.R.,Liu, W.,
Danyluk, J., Ubayasena, L.W.C., Kane. K., Scoles, G.J., Sarhan F.and
Gulick P.J.2007. Regulatory gene candidates and gene expression
analysis of cold acclimation in winter andspring wheat. Plant
Molecular Biology. 64:409�423.
Mony Shariful Alam, M.D. Shahidul Haque, Mahabub Alam, Mirza Hasanuzzaman.
2010. Regeneration of Blackgram (Vigna mungo L.) on Changes of
Hormonal Condition.), Not. Bot. Hort. Agrobot. Cluj 38:140-145.
Moore, B., Zhou, L., Rolland, F., Hall, Q., Cheng, W.H., Liu, Y.X., Hwang, I.,
Jones, T., Sheen, J.2003. Role of the Arabidopsis glucosesensor HXK1
in nutrient, light, and hormonal signaling. Science. 300:332�336.
Moore, G., Devos, K.M., Wang, Z., and Gale, M.D.1995,Grasses, line up and
form a circle. Current Biology.5:737�739.
Morran, S., Eini, O., Pyvovarenko, T.,Parent, B.,Singh, R., Ismagul, A., Eliby,
S., Shirley, N.; Langridge, P. and Lopato, S.2011.Improvement of
stress tolerance of wheat and barley by modulation of expression of
DREB/CBF factors. Plant Biotechnol. J. 9: 230�249.
Muhammad, Aasim.,Khalid, mahhmood., Khawar and Sebahattin,ozca. 2008.
In-vitro Micropropagation from shoot Meristems of Turkish cowpea
(Vigna Unguiculata L.) Cv. Akkiz. Bangladesh J. Bot. 37(2): 149-154
Muller, J., Aeschbacher, R.A., Sprenger, N., Boller, T. and Wiemken A. 2000
Disaccharide-mediated regulation of sucrose: fructan-
6fructosyltransferase, a key enzyme of fructan synthesis in barley
leaves. Plant Physiology, 123:265�274
xxv
Murthy, B.N.S., Victor, J., Singh, R.P., Fletcher, R.A. and Saxena, P.K., 1996.
In-vitro regeneration of chickpea (Cicer arietinum L.) stimulation of
direct organogenesis and somatic embryogenesis by thidiazuron. Plant
Growth Regulation. 19: 233-240
Muruganantham, M., Amutha, S., Ganapathi,A. 2010. Somatic embryo productions
by liquid shake culture of embryogenic calluses in Vigna mungo (L.) Hepper
In Vitro Cellular & Developmental Biology. 46(1): 34-40
Muruganantham, M., Ganapathi, A., Samutha, G., Vengadesan and Selvaraj,
N.2005.Shoot regeneration from immature cotyledonary nodes in black
gram. India journal of biotechnology. 4:551-555
Muthukumar, B., Mariamma, M., Veluthambi, K., Gnanam, A. 1996. Genetic
transformation of cotyledon explants of cowpea (Vigna unguiculata L.
Walp.) using Agrobacterium tumefaciens. Plant Cell Rep. 15: 980-985
Nagata, T., K. Okada, T. Kavazu and I. Takale., 1987. Cauliflower mosaic
virus 35S promoter directs S-phase specific expression in plant cells.
Molecular Genera.36: 1276-1279
Nakashima, K. and Yamaguchi-Shinozaki K.2006.Regulons involved in
osmotic stress-responsive and cold stress-responsive gene expression in
plants. Physiologia Plantarum.126:62�71.
Nakayama, K., Okawa, K., Kakizaki, T. and Inaba, T.2008.Evaluationof the
protective activities of a late embryogenesis abundant (LEA) related
protein, Cor15am, during various stresses in vitro. Bioscience,
Biotechnology and Biochemistry. 72:1642�1645.
Navarro, M., Marque, G., Ayax, C., Keller, G., Borges, J.P., MarqueC. And
Teulieres, C.2009. Complementary regulation of four Eucalyptus CBF
genes under various cold conditions. Journal of Experimental Botany,
60:2713�2724.
xxvi
Neelam, A., Reddy, C. S., and Reddy, G. M.1986. Plantlet regeneration from
callus cultures of Cicer arietinum. International Chickpea Newsletter.
14: 12-13.
Nick, P., 2000.Control of the response to low temperatures. Springer, Berlin.
Germany, 121�135
Nishida,I. And Murata, N., 1996. Chilling sensitivity in plant and cyan
bacteria: The cucial contribution of membrane lipids .Annu. Rev. Plant
Physiology. Plant Mol.Biol.47.541-568.
Nishizawa, A., Yabuta, Y. and Shigeoka, S.2008.Galactinol and raffinose
constitute a novel function to protect plants from oxidative damage.
Plant Physiology. 147:1251�1263.
Novillo, F., Alonso, J.M., Ecker, J.R. and Salinas, J. 2004.CBF2 »�'5(%�& is a
negative regulator of CBF1 »�'5(%�% and CBF3 »�'5(%�$ expression
and plays a central role in stress tolerance in Arabidopsis. Proceedings
of the National Academy of Sciences USA.101:3985�3990.
Odutayo, O. I., Akinirinusi, F. B., Odunbososye, I. and Oso, R. T. 2005.
Multiple shoot induction from embryo derived callus cultures of
cowpea (Vigna ungimculata L.). Walp. African J. of Biotechnology. 4:
1214-1216.
Oh, S.J., Kwon, C.W., Choi, D.W., Song, S.I. and Kim, J.K.2007. Expression
of barley HvCBF4 enhances tolerance to abiotic stress in transgenic
rice. Plant Biotechnology Journal. 5:646�656.
Oh, S.J., Song, S.I., Kim, Y.S., Jang, H.J., Kim, S.Y., Kim, M., Kim, Y.K.,
Nahm, B.H. and Kim, J.K. 2005. Arabidopsis CBF3/DREB1A and
ABF3 in transgenic rice increased tolerance to abiotic stress without
stunting growth. Plant Physiol.138: 341�351.
xxvii
Okawa, K., Nakayama, K., Kakizaki, T., Yamashita, and T., Inaba T.2008
Identification and characterization of Cor-413im proteins as novel
components of the chloroplast inner envelope. Plant, Cell and
Environment. 3:1470�1483.
Oliver, S.N, Dennis, E.S. and Dolferus, R. 2007. ABA regulates apoplastic
sugar transport and is a potential signal for cold induced pollen sterility
in rice. Plant Cell Physiol.48:1319�1330.
Oliver, S.N, Van Dongen, J.T., Alfred, S.C., Mamun, E.A., Zhao, X.C., Saini,
H.S., Fernandes, S.F., Blanchard, C.L., Sutton, B.G., Geigenberger, P.,
Dennis, E.S. and Dolferus, R. 2005.Cold induced repression of the rice
anther-specific cell wall invertase gene OSINV4 is correlated with sucrose
accumulation and pollen sterility. Plant Cell Environ.28:1534�1551.
Oono, Y., Sekim, M., Nanjo,T., Narusaka, M., Fujita, M., Satoh, R., Satou, M.,
Sakurai, T., Ishida, J., Akiyama, K., Iida, K., Maruyama, K., Satoh, S.,
Yamaguchi-Shinozaki,K., and Shinozaki, K., 2003. Monitoring
expression profiles of Arabidopsis gene expression during rehydration
process after dehydration using ca.7000 full-length cDNA microarray.
Plant J. 34: 868�887.
Orvar, B. L., 2000. Early steps in cold sensing by plant cells: the role of actin
cytoskeleton and membrane fluidity. Plant J. 23: 785�794
Owens,C. L ., Thomashow, M. F., Hancock, J. F. and Iezzoni, A. F. 2002. CBF1
orthologs in sour cherry and strawberry and the heterologous expression
of CBF1 in strawberry. J.Am. Soc. Hortic. Sci. 127: 489�494.
Patel M. B., Bhardwa, R., and Johi, A.1991. Organogenesis in Vigna radiata
(L.)Wilczek. Indian J. Exp. Biol. 29: 619�622.
Pearce, R.S., Dunn, M.A., Rixon, J.E., Harrison, P. and Hughes M.A.1996.
Expression of cold-induced genes and frost hardiness inthe crown
meristem of young barley (Hordeum vulgare L. cv.Igri) plants grown in
different environments. Plant, Cell and Environment.12:275�290.
xxviii
Pellegrineschi, A., Reynolds, M., Pacheco, M., Brito, R.M., Almeraya, R.,
Yamaguchi-Shinozaki, K. and Hoisington, D.2004.Stress-Induced
expression in wheat of the Arabidopsis thaliana DREB1A gene delays water
stress symptoms under greenhouse conditions. Genome 47:493�500.
Perl A., Lotan O., Abu-Abied M., Holland D., 1996. Establishment of an
Agrobacterium-mediated transformation system for grape (Vitis
vinifera L.): The role of antioxidants during grape-Agrobacterium
interactions. Natur Biotechnol. 14: 624-628.
Philips, G. C. and Gamborg, O. L. 2005. Plant cell tissue and organ culture.
Published by N. K. Mehra. Narosa publishi ng house 6, community
centre. New Delhi, India.91-93.
Polisetty, R., Paul, V., Devashwar, J.J., Khetarpal, S., Suresh, K. And
Chandra, P., 1997. Multiple shoot induction by benzyladenine and
complete plant regeneration from seed explants of chickpea (Cicer
arietinum L.). Plant Cell Report. 16 (8): 565-571.
Potjamarn Suraninpong.,Sontichai Chanprame, Hyeon-JE CHO., Jack M.
Widholm and Areewaranyuwat., 2004. Agrobacterium-mediated
Transformation of Mungbean [Vigna radiata(L.) Wilczek]. Walailak. J
Sci & Tech . 1(2):38-48.
Potrykus, I. 1991. Gene transfer to plants: Assessment of published approaches
and results. Annu.Rev.Plant Physiol.Plant Mol.Biol, 42:205-225
Priya Srivastava., Anjana Pandey., 2011.Standardization of Callus Induction
and Plant Regeneration from Leaf Explants of Black Gram (Vigna
mungo var. silvestris). International Journal of Innovations in
Biological and Chemical Sciences .1: 1-6.
Pu, X-A. and Goodman R.N. 1992. Induction of necrosis by Agrobacterium
tumefaciens on grape explants. Physiol. Mol. Plant Pathol. 41: 245--254.
xxix
Qin, F., Sakuma, Y., Li, J., Liu, Q., Li, Y.Q., Shinozaki, K. and Yamaguchi-
Shinozaki, K. 2004.Cloning and functional analysis of a novel
DREB1/CBF transcription factor involved in cold-responsive gene
expression in Zea mays L. Plant Cell Physiol., 45, 1042�1052.
Rajashekar C.B. 2000. Cold response and freezing tolerance in plants. In:
Wilkinson R.E.(Ed.), Plant�environment interactions, 2nd edition.
Marcel Dekker, Inc., New York, USA. 321�341
Ramakrishnan, K., Gnanam, R., Sivakumar, P. and Manickam, A. 2005. In
vitro somatic embryogenesis from cell suspension cultures of cowpea
[Vigna unguiculata (L.) Walp]. Plant Cell Rep 24: 449�461.
Radhakrishna and Ranjithakumari, 2007. Morphological and agronomic
evaluation of tissue culture derived Indian soybean plants[J]. Acta
Agriculturae Scandinavica. 91:391-396
Ramana, R.V. and Sadanandam, D.A., 1997. Differential morphogenic
response of chickpea and Agrobacterium mediated genetic
transformation. In vitro, 33(3): 2,56A.
Raman,S., Sonia, M.,Seema, B., Anila, B. and Jaiwal, P.K.2004.An improved
protocol of plant regeneration via somatic embryogenesis in cell
suspension culture of black gram.Physiol.Mol.plants.24:121-125
Rasolofo, P.R.1986.Screening rice cultivars at seedling stage and anthesis for
low temperature tolerance in Madagascar. IRRN. 11:12�13.
Raveendar.S. and. Ignacimuthu. 2010. Improved Agrobacterium Mediated
Transformation in Cowpea Vigna unguiculata L. Walp. Asian Journal
of Plant Sciences.9: 256-263.
Reddy, K.J., Vanidevi, K., Redy, S.M., Rao, D. and Vidyavati. 2001.
Perspectives in biotechnology. Proceedings of a National Symposium,
Warangal, India. 131-132.
xxx
Reddy, K.J., Vanidevi, K., Redy, S.M., Rao, D. and Vidyavati., 2001.
Perspectives in biotechnology. Proceedings of a National Symposium,
Warangal, India, 26-27February.131-132.
Register, J. C., Peterson, D. J., Bell, B. J., Bullock, W. P., Evans, I. J. and Jiao,
S.1994. Structure and function of selectable and non-selectable
transgenes in maize after introduction by particle bombardment. Plant
Molecular Biology.25(6): 951-961.
Renaut, J., Lutts, S., Hoffmann, L. and Hausman J.F.2004. Responses of poplar
to chilling temperatures: proteomic and physiological aspects. Plant
Biology, 6:81�90
Richter T.E, Ronald P.C.2000. The evolution of disease resistance genes. Plant
Mol. Biol. 42: 195�204.
Riva, de laz., 1998. Agrobacterium tumefaciens: a natural tool for plant
transformation EJB Electronic Journal of Biotechnology .3
Rizvi, S.M.H., Jaiwal, P.K. and Singh, R.P., 2002. A possible involvement of
cellular polyamine level in thidiazuron induced somatic embryogenesis
in chickpea. Role(Cicer arietinum L.). Indian Journal of Experimental
Biology, 36 (6): 605-609.
Rolland, F., Baena-Gonzales E. and Sheen, J.2006. Sugar sensing and
signalling in plants: conserved and novel mechanisms. Annual Review
of Plant Biology, 57:675�709
Roy, S. K., Haque, M.S. and Siddiqua, M.K.2007.Plant regeneration through
direct regeneration through multiple shoot formation in black gram.
Progress.Agric. 18(2):11-16
Saghai-Maroof, M. A., K. M. Salimar, R. A. Jorgenson, and R. S. Allard.,
1984. Ribosomal DNA-spacer length polymorphism in barley,
Mendalian inheritance, Chromosomal location and population
dynamics. Proc. Natl. Acad. Sci. USA. 81: 8014-8018.
xxxi
Sahoo, L., Sugla, T., Jaiwal, P.K., 2003. In vitro regeneration and
transformation of cowpea, mungbean, urdbean, and azukibean. In:
Biotechnology for the improvement of legumes. Part-B. Kluwer Acad.
Publishers. Netherlands.89-120.
Saini J.P., Tandon J.P., 1985. Evaluating rices for cold
tolerance. IRRN.10:9�10.
Saini, R. and Jaiwal, P.K.2007.Agrobacterium tumifacines mediated
transformation of Blackgram: an assessment of factors influcing the
efficiency of UidA gene transfer. Biologia Plantarum.51(1):69-74
Sambrook, J. and D. W. Russel., 2001. Molecular Cloning - A Laboratory
Manual, Cold Spring Harbour Laboratory, Cole Spring Harbour, New
York.108-112
Sambrook, J., E. F. Fritsch and T. Maniatis., 1989. Molecular Cloning. A
laboratory manual, second edition, cold spring, Harbour Laboratory
Pres .103-107.
Sanford, J. C., Wolf, E. D. and Allen, N. K.1990. Method for
transporting substances into living cells and tissues and apparatus
therefore. US Pat No,4: 954-1050.
Sanghera G.S., Wani S.H., 2008. Innovative approaches to enhance genetic
potential of rice for higher productivity under temperate conditions of
Kashmir. J. Plant Sci. Res.24:99�113.
Sanghera G.S., Zarger M.A., Anwar A., Singh S.P., Ahmad N., Rather M.A.,
2001.Studies on spikelet fertility and incidence of leaf blast on certain
IRCTN rice genotypes under temperate conditions. Paper presented at
National Symposium on plant Protection Strategies for sustainable
Agri-Horticulture, SKAUST-Jammu. Oct 12-13, p. 125.
xxxii
Sangwan. R.S, Bourgeois, Y., Brown, S., Yasseur, G. and Sangwan-Norreel,
B., 1992.Characterization of competent cells and early events of
Agrobacterium-mediated genetic transformation in Arabidopsis
thaliana. Planta 188: 439-456.
Sangwan, V.,2001. Cold-activation of Brassica napus BN115 promoter is
mediated by structural changes in membranes and cytoskeleton, and
requires Ca2+ influx. Plant J. 27: 1�12.
SankaraRao, K.1996. Embryogenesis in flowering plants: Recent approaches
and prospects. J. Biosci.21: 827�841.
Santalla. M., Power J. B and. Davey, M. R 1998. Efficient in vitro shoot
regeneration responses of Phaseolus vulgaris and P. coccineus.
Euphytica 102:195�202.
Sanyal, I., Singh, A. K. and Amla, D. V. 2003. Agrobacterium tumefaciens
mediated transformation of chickpea (Cicer arietinum L.) using mature
embryonic axes and cotyledonary nodes. Indian Journal of
Biotechnology. 2: 524-532.
Sarmah, B. K., Moore, A., Tate, W., Molvig, L., Morton, R. L., Rus, D. P.,
Chiaiese, P., Maarten, J. C.,. Tabe, L. M. and Higgins, T. J. V. 2004.
Transgenic chickpea seeds expressing high levels of a bean á-amylase
inhibitor. Molecular Breeding. 14: 73-82.
Satoh, R., Nakashima, K., Seki, M., Shinozaki, K. and Yamaguchi-Shinozaki,
K. 2002. ACTCAT, a novel cis-acting element for proline and hypo
osmolality responsive expression of the ProDH gene encoding proline
dehydrogenase in Arabidopsis. Plant Physiol. 130: 709�719.
Senthil, G., Williamson, B.,. Dinkins, R. D. and G. Ramsay., 2004. An efficient
transformation system for chickpea (Cicer arietinum). Plant Cell
Report. 23: 297- 303.
xxxiii
Shalini, Shikha., BATRA, P., Sindhu, A. and Chowdhury, U.K., 2001. Multiple
shoot induction and complete plant regeneration of chickpea (Cicer
arietinum L.). Crop Research Hisar, 21 (3): 308-311.
Sharma, K.K. and Anjaiah, V. 2000. An efficient method for the production of
transgenic plants of peanut (Arachis hypogaea L.) through Agrobacterium
tumefaciens-mediated genetic transformation. Plant Sci. 159: 7�19.
Sharma, L. and Amla, D.V., 1998. Direct shoot regeneration in chickpea (Cicer
arietinum L.). Indian Journal of Experimental Biology, 36 (6): 605-609.
Shen, Y. G., Zhang, W. K., He, S. J., Zhang, J. S., Liu, Q. and Chen, S. Y.
2003. An EREBP/AP2-type protein in Triticum aestivum was a DRE-
binding transcription factor induced by cold, dehydration and ABA
stress. Theor Appl Genet. 106: 923�930
Shinozaki, K. and Yamaguchi-Shinozaki K.1996.Molecular response to
drought and cold stress. Curr. Opin. Plant Biol.7:161�167.
Shinozaki, K. and Yamaguchi-Shinozaki K.2000.Molecular response to
dehydration and low temperature: differences and cross-talk between
two stress signalling pathways. Current Opinion in Plant
Biology.3:217�223.
Shinozaki, K. and Yamaguchi-Shinozaki, K., 1997. Gene expression and signal
transduction in water stress response. Plant Physiol. 115: 327�334.
Shinozaki, K., Yamaguchi-Shinozaki, K. and Seki, M., 2003. Regulatory
network of gene expression in the drought and cold stress
responses. Curr. Opin. Plant Biol. 6:410�417.
Shiv Prakash, N., Pental, D. and Bhalla-Sarin, N.1994. Regeneration of
pigeonpea (Cajanus cajan) from cotyledonary node via multiple shoot
formation. Plant Cell Rep. 13:623�627
xxxiv
Shivakumar, P., Gnanam1, R., Ramakrishnan K. and Manickam, A. 2010.
Regeneration of Vigna radiate. Biologia. plantaru. 54 (2): 245-251,
Siddiqua, M. and Nassuth, A. 2011. Vitis CBF1 and Vitis CBF4 differ in their
effect on Arabidopsis abiotic stress tolerance, development and gene
expression. Plant Cell Environ. 34:1345�1359.
Sing, B. D.2007. Biotechnology Expanding Horizon. Kalyani publishers,
Ludhiana, India. 343.
Singh B.D.2000. Plant Breeding. Kalyani Publishers, Ludhiana, India. 443�
460.
Singh, Rajendrer., Jat, R. S., Sahoo, P.D., Srinivasan and Singh, R. 2002.
Thidiazuron induced multiple shoot formation in chickpea (Cicer
arietinum L.). Journal of Plant Biochemistry and Biotechnolog. 11 (2):
129-131.
Sita Mahalakshmi, L., Leela, T, Kiran, B., Naresh, B. and Devi, P.2006. In
vitro plant regeneration from the petioles of primary leaves of
Mungbean Vigna radiata L. Plant Biotech. 23: 409-411.
Sita Mahalakshmi, L., Leela, T., Manoj Kumar, S., Kiran Kumar, B., Naresh,
B. and Prathibha, D. 2006. Enhanced genetic transformation efficiency
of mungbean by use of primary leaf explants, Current science, 91:1.
Skinner, J.S., von Zitzewitz, J., Szucs, P., Marquez-Cedillo, L., Filichkin, T.,
Amundsen, K., Stockinger, E.J., Thomashow, M.F., Chen, T.H. and Hayes,
P.M. 2005.Structural, functional, and phylogenetic characterization of a
large CBF gene family in barley. Plant Mol. Biol. 59:533�551.
Skokut, T. A., Manchester, J. and Schaefer, J.1985. Regeneration in Alfalfa
tissue culture: Stimulation of somatic embryo production by amino
acids and N-15 NMR determination of nitrogen utilization. Plant
Physiol. 79: 579�583.
xxxv
Skoog and Miller. 1957. Chemical regulation of growth and organ formulation
in plant tissue culture in-vitro . Symposium of soxen Experiment
Biology.11:118-131.
Smith. V. H. and Jimmerson, J. 2005.Chick pea (Garbanzo Beans) Briefing No.
55:25-30.
Sonia, saini R. and jaiwal, P. K., 2007. Agrobacterium tumefaciens mediated
transfer of Phaseolus Vugaris á �amylase inhibitor-1 gene into Vigna
radiate (L) Wilczek using bar as selectable marker. Plant Cell Rep.
26:187-198.
Southern, E. M.1975. Detection of specific sequences among the DNA
fragments separated by gel electohorosis. J. Nol. Biol. 98: 503-517.
Srivastava, P. And Pandey, A. 2011. Standardization of callus induction and
plant regeneration from leaf explants of black gram (vigna mungo var.
Silvestris). International Journal of Innovations in Biological and
Chemical Sciences I: 1-6.
Stachel, S.E., Nester, E. W. And Zambryski, P., 1996.A plant cell factor
induces Agrobacterium tumefaciens vir gene expression. Proc. Nat.
Acad. Sci.USA. 83:379-383.
Stachel, S.E., Messens, E., Van,M. And Zambryski, P.,1985.Identification of
signal molecules produced by wounded plant cell that activates T-DNA
transfer in Agrobacterium tumefaciens. Nature.318:624-629.
Strickland, S. G., Nichol, J. W., and Stuart, D. A. 1987. Effect of carbohydrate
source on alfalfa somatic embryogenesis. Plant Sci. 48: 113�121.
Stuart, S., and Strickland, S.1984. Somatic embryogenesis from cell cultures of
Medicago sativa L. II. The interaction of amino acids with ammonium.
Plant Sci. Lett. 34: 174�181.
xxxvi
Subhadra, R.K., Vashishat, J.B., Chowdhury, M., Singh and Sareen, P.K.,
1998. Multiple shoots from cotyledonary node explants of non-
nodulating genotype (ICC 435 M) of chickpea (Cicer arietinum L.).
Indian Journal of Experimental Biology.36:1276-1279
Sukapinda, K., Kozuch, M. E., Wilson, B. R., Aniley, W. M. and Merlo, D. J,
1993.Transformation of maize protoplast and regeneration of haploid
transgenic plants. Plant Cell Reports. 13: 63-68.
Sumitha, A., Pratap, J.H. and Bidyut, K.S.2012. Effect of TDZ on in vitro
Regeneration of black gram embryonic Axes.j. crop sci.
Biotech.15(4):311-318
Sun, W., Van Montagu, M. and Verbruggen, N.2002.Small heat shock proteins
and stress tolerance in plants. Biochimica Biophysica Acta, 1577:1�9.
Surya-Prakash., Chowdhury, J.B., Jain, R.K. And Chowdhury, V.K., 1992.
Factors affecting plant regeneration in chickpea. Indian Journal of
Experimental Biology. 30: 1149-1153.
Sushil, K.Y., Sweety, K., Varalaxmi, Y., Annapuma, K., Jyothi, L.N.,Vanaja,
M., Maheswari M.,Aurn,K.S.,Venkateswralu, B. and Pulugurtha, B.
2012.optimization of Agrobacterium mediated genetic transformation
of cotyledonary node explant of Vigna radiata. Springer plus.1:59
Tabaei-Aghdaei, S.R., Pearce, R.S. and Harrison, P.2003.Sugars regulate cold-
induced gene expression and freezing-tolerance in barley cell cultures.
Journal of Experimental Botany. 54:1565�1575.
Tantau, H., Balko C., Brettschneider, B., Melz, G. and Dorffling, K.2004.
Improved frost tolerance and winter survival in winterbarley (Hordeum
vulgare L.) by in vitro selection of proline over accumulating lines.
Euphytica, 139:19�32
xxxvii
Tateishi, Y.1996. Systematics of the species of Vigna subgenus Ceratotropis.
In "Mungbean Germplasm: Collection, Evaluation and Utilization for
Breeding Program" JIRCAS Working Report .2:9- 24.
Taylor, M. G. and Vasil, I. K. 1991. History of the physical factors affecting
transient GUS expression in pearl millet embryos following
microprojectile bombardment. Plant Cell Reports, 10: 120-125.
Tewari-Singh, N., Sen, J., Kiesecker, M., Reddy, V. S., Jawbsen, H. J. and
Guhamukherjee, S. 2004. Use of a herbicide or lysine plus threonine for
no antibiotic selection of transgenic chickpea. Plant Cell Reports. 22:
576-583
Thomashow, M. F., 1998. Role of cold-responsive genes in plant freezing
tolerance. Plant Physiol. 118: 1-7
Thomashow, M.F. 1999.Plant cold acclimation: Freezing tolerance genes and
regulatory mechanisms. Annu. Rev. Plant Physiol. Plant Mol. Biol.
50:571�599.
Thomson, A. M., Brown, R. A., Rosenberg, M. J., Izaurralde, R. C. and
Benson, V.2005. Climate change impacts for the conterminous USA:
An integrated assessment. Part 3. Dry land production of grain and
forage crops. Climent Change. 69: 43-65.
Thorne, G. C. H., Santarem, E. R. and Ferreira, A. G.1995. Adventitious bud
induction and plant regeneration from soybean cotyledonary nodes. Int
J Expt Bot. 57:127�35.
Timperio, A.M., Egidi, M.G., and Zolla, L.2008.Proteomics applied onplant
abiotic stresses: role of heat shock proteins (HSP). Journal of
Proteomics. 71 :391�411.
xxxviii
Tommasini, L., Svensson, J.T., Rodriguez, E.M., Wahid, A., Malatrasi, M.,
Kato, K., Wanamaker, S., Resnik, J. and Close, T.J.2008. Dehydrin
gene expression provides an indicator of low temperature and drought
stress: transcriptome-based analysis of barley (Hordeum vulgare L.).
Functional and Integrative Genomics.8:387�405.
Torres, M.A. and Dangl, J.L.2005.Functions of the respiratory burstoxidase in
biotic interactions, abiotic stress and development. Current Opinion in
Plant Biology, 8:397�403.
Trieu, A.T., Burleigh, S.H., Kardailsky, I.V., Maldonado-Mendoza, I.E.,
Versaw, W.K., Blerplock, L.A., Shin, M., Chiou, T.J., Katageri, H.,
Derobre, G.R., Weigel, D. and Harrison, M.J., 2000. Transformation of
Medicago truncatula via infilteration of seedlings or flowering plants
with Agrobacterium. Plant Journal.22: 531-541.
Uemura, M., Tominaga, Y., Nakagawara, C., Shigematsu, S., Minami, A. and
Kawamura, Y.2006. Responses of the plasma membrane to low
temperatures. Physiologia Plantarum, 126:81�89.
Uranbey S, Sevimay, .S., Kaya, M., Ipek , Sancak , Basalma , Ozcan, .S., 2005
. Influence of different co-cultivation temperatures, periods and media
on Agrobacterium tumefaciens-mediated gene transfer. Biol. Plant. 49:
53-57.
Usadel, B., Blasing, O.E., Gibon, Y., Retzlaff, K., Hoehne, M.,Valluru R., Van
den Ende W.2008. Plant fructans in stress environments: emerging
concepts and future prospects. Journal of Experimental
Botany.59:2905�2916.
Vagujfalvi, A., Galiba, G., Cattivelli, L. and Dubcovsky, J.2003. The cold
regulated transcriptional activator Cbf3 is linked to the frost-tolerance
locus Fr-A2 on wheat chromosome 5A. Mol Genet Genomics. 269: 60�67.
xxxix
Valluru, R., Lammens, W., Claupein, W., Van den Ende, W. 2008. Freezing
tolerance by vesicle-mediated fructan transport. Trends in Plant
Science, 13: 409�414.
Van Buskirk, H.A. and Thomashow, M.F.2006. Arabidopsis
transcriptionfactors regulating cold acclimation. Physiologia
Plantarum.126:72�80.
Vani, A.K.S, Reddy, V.D. 1996. Morphogenesis from callus cultures of
chickpea Cicer arietinum L. Indian Journal of Experimental Biology.
34: 285-287.
Vargas, W.A., Pontis, H.G. and Salerno G.L. 2007.Differential expression of
alkaline and neutral invertases in response to environmental stresses:
characterization of an alkaline isoform as a stress-response enzyme in
wheat leaves. Planta.226:1535�1545.
Varisai Mohamed, S., Wang, C. S., Tiruvengadam, M., and Jayabalan, N. 2004.
In vitro plant regeneration via somatic embryogenesis through cell
suspension cultures of Horsegram [Macrotyloma uniflorum (Lam.)
Verdc.]. In Vitro Cell Dev. Biol. Plant 40: 284�289.
Vaultier, M.N., Cantrel, C., Vergnolle, C., Justin, A.M., Demandre,C.,
Benhassaine-Kesri, G., Cicek, D., Zachowski, A., and Ruelland E.
2006. Desaturase mutants reveal that membrane rigidification acts as a
cold perception mechanism upstream of the diacylglycerol kinase
pathway in Arabidopsis cells. FEBS Letters.580:4218�4223.
Verdcourt,B. 1970. Studies in the Leguminosae - Papilionoideae for the "Flora
of Tropical East Africa". Kew Bulletin. IV:24.
Vergnolle, C.2005. The cold-induced early activation of phospholipase C and
D pathways determines the response of two distinct clusters of genes in
Arabidopsis cell suspensions. Plant Physiol. 139: 1217�1233.
xl
Viswanathan, C. and Zhu, J. K.2002. Molecular genetic analysis of cold-
regulated gene transcription. Philos. Trans. R. Soc. Lond. B. 357: 877�
886.
Wang, W., Vinocur, B. and Altman, A. 2007. Plant responses to drought,
salinity and extreme temperatures towards genetic engineering for
stress tolerance. Planta. 218: 1-14.
Wang, X., Li, W., Li, M. and Welti, R. 2006. Profiling lipid changes in plant
response to low temperatures. Physiologia Plantarum.126:90�96
Wang, Y.2005. Molecular tailoring of farnesylation for plant drought tolerance
and yield protection.Plant J.43:413-449.
Wang,W., Vinocur, B. and Altman, A. 2003. Plant responses to drought,
salinity and extreme temperatures: towards genetic engineering for
stress tolerance. Planta, 218:1�14.
Welling, A. and Palva, E.T. 2008.Involvement of CBF transcription factors in
winter hardiness in birch. Plant Physio.l147: 1199�1211.
Wetherell, D. F.1984. Enhanced adventive embryogenesis resulting
fromplasmolysis of cultured wild carrot cell. Plant Cell Tissue Organ
Cult. 3: 221�227.
Williams, M. E., 2005. Mutations in the Arabidopsis phosphoinositide
phosphatase gene SAC9 lead to overaccumulation of PtdIns (4, 5) P2
and constitutive expression of the stress-response pathway. Plant
Physiol. 138: 686�700.
Wisniewski, M. and Fuller, M.1999. Ice nucleation and deep super cooling in
plants: new insights using infrared thermography. In :Margesin R.,
Schinner F. (Eds),Cold-adapted organisms ecology,physiology,
enzymology and molecular biology. SpringerVerlag, Berlin,
Germany:105�118.
xli
Wojtaszek, P., 1997. Oxidative burst: an early plant response to pathogen
infection. Biochem. J. 322: 681 - 691.
Wormit, A., Trentmann, O., Feifer, I., Lohr, C., Tjaden, J., Meyer, S., Schmidt,
U., Martinoia, E. and Neuhaus, H.E.2006. Molecular identification and
physiological characterization of a novel monosaccharide transporter
from Arabidopsis involved in vacuolar sugar transport. The Plant
Cell.18:3476�3490
Xiao, W., Sheen, J. and Jang, J.C. 2000 The role of hexokinase in plant sugar
signal transduction and growth and development. Plant Molecular
Biology, 44:451�461.
Xin, Z. and Browse, J. 2001. Cold comfort farm: the acclimation of plants to
freezing temperatures. Plant Cell Environ. 23:893�902.
Xiong, L. 2001. The Arabidopsis LOS5/ABA3 locus encodes a molybdenum
cofactor sulfurase and modulates cold stress- and osmotic stress�
responsive gene expression. Plant Cell. 13: 2063�2083.
Xiong, L. and Zhu J.K. 2001.Abiotic stress signal transduction in plants.
Molecular and genetic perspectives. Physiologia Plantarum. 112:152�
166
Xiong, L., Schumaker, K.S. and Zhu, J.K.2002.Cell signaling during cold,
drought, and salt stress. The Plant Cell. 14:S165�183.
Xiong, Y. and Fei, S.Z.2006. Functional and phylogenetic analysis of a
DREB/CBF-like gene in perennial ryegrass (Lolium perenne L.).
Planta, 224: 878�888
Varalaxmi, Y., Prasanna, A., Yadav, S.K., Venkateswarlu, B. and Maheswri.
M.2013. optimization of parameters for Agrobacterium mediated
transformation of black gram using cotyledon explant.12(11):1209-
1216
xlii
Varalaxmi,Y., Vijaylakshmi, A., Yadav, S.K., Venkateswarlu, B.and
Maheswri, M.2007. Efficient plant regeneration from cotyledons of
Black gram. India Journal of biotechnology. 6:414-417.
Yadav, S.K., Sreenu, P., Maheswari, M., Vanaja, M. and Venkateswarlu,
B.2010.Efficient shoot regeneration from double cotyledonary node
explants of green gram (vigna radiate (L) Wilczek) India journal of
biotechnology .9:403-407.
Yamaguchi-Shinozaki K. and Shinozaki K., 1996.A novel cis-acting element in
an Arabidopsis gene is involved in responsiveness to drought, low-
temperature, or high-salt stress. Plant Cell.6 (2):251�264.
Yamaguchi-Shinozaki, K, and Shinozaki K.2006.Transcriptional regulatory
networks in cellular responses and tolerance to dehydration and cold
stresses. Annu. Rev. PlantBiol.57:781�803
Yamaguchi-Shinozaki, K. and Shinozaki, K., 2005.Organization of cis-acting
regulatory elements in osmotic- and cold-stress-responsive promoters.
Trends Plant Sci. 10: 88�94.
Yamaguchi-Shinozaki., K. and Shinozaki,K., 1994. A novel cis-acting element
in an Arabidopsis gene is involved in responsiveness to drought, low-
temperature, or high-salt stress. Plant Cell. 6: 251�264.
Yang, W., Liu, X.D., Chi, X.J., Wu, C.A., Li, Y.Z., Song, L.L., Liu, X.M.,
Wang, Y.F., Wang, F.W., Zhang, C., and Liu, Y.2011.Dwarf apple
MbDREB1 enhances plant tolerance to low temperature, drought, and
salt stress via both ABA-dependent and ABA-independent pathways.
Planta, 233: 219�229
Zambryski, P., Joos, H., Genetello, C., Leemans, J., Vanmontagu, M.
Andschell, J.1983. Ti plasmid vector for the introduction of DNA into
plant cells without alteration of their normal regeneration capacity.
European Molecular Biology Organization Journal. 2: 2143-2150.
xliii
Zarka, D.G., Vogel, J.T., Cook, D. and Thomashow, M.F.2003. Cold induction
of Arabidopsis CBF genes involves multiple ICE (inducer of CBF
expression) promoter elements and a cold-regulatory circuit that is
desensitized by low temperature. Plant Physiology, 133:910�918.
Zhang, X., Fowler, S.G., Cheng, H., Lou, Y., Rhee, S.Y., Stockinger, E.J. and
Thomashow, M.F. 2004.Freezing-sensitive tomato has a functional
CBF cold response pathway, but a CBF regulon that differs from that
of freezing-tolerant Arabidopsis. Plant J.39:905�919
Zhao X., Dolferuf R., Darvey N., 2008. Precision breeding of cold tolerant
rice. IREC Farmers Newsletter. 177:12�13.
Zhu, J. K., J. Liu, and L. Xiong .1998. Genetic analysis of salt tolerance in
Arabidopsis: evidence for the critical role of potassium nutrition. Plant
Cell 10: 1181-1191.
Zhu, J., Jeong, J.C., Zhu, Y., Sokolchik, I., Miyazaki, S., Zhu, J.K., Hasegawa,
P.M., Bohnert, H.J., Shi, H., Yun, D.J. and Bressan, R.A.2008.
Involvement of Arabidopsis HOS15 in histone deacetylation and cold
tolerance. Proceedings of the National Academy of Sciences USA,
105:4945�4950.
xliv
APPENDICES
Appendix I. Tissue culture Media composition
MS media composition:
The basal media used for all the experiments is MS medium (Murashige
and Skoog, 1962).
Stock solutions:
Stock solutions are prepared by dissolving the chemicals of analytical
grade in double distilled water and storing them in brown bottles.
A.20X MS macro nutrients stock (per litre);
All the chemicals are mixed well on a magnetic stirrer and the volume is
made up to one litre using double distilled water and refrigerated at 40C.
B. 1000X MS micro nutrients stock (per litre);
Chemical Required amount
(in g/L)
H3BO3 6.22 g
MnSO4.H2O 22.40 g
ZnSO4 8.60 g
KI 0.83 g
Na2MoO4.2H2O 0.25 g
CuSO4.5H2O 25 mg
CoCl2.6H2O 25 mg
Chemical Required amount (in g/L)
KNO3 38.0 g
NH4 NO3 33.0 g
CaCl2.H2O 8.8g
MgSO4.7H2O 7.4g
KH2PO4 3.43g
id2129678 pdfMachine by Broadgun Software - a great PDF writer! - a great PDF creator! - http://www.pdfmachine.com http://www.broadgun.com
xlv
All the chemicals are mixed on a magnetic stirrer and the volume is
made up to one litre using double distilled water and refrigerated at 40C.
C. 200X MS Iron stock (per litre):
FeSO4.7H2O 2785 mg in 250 mL H2O
Na2- EDTA 3725 mg in 250 mL H2O
Both the dissolved solutions are combined and boiled for a few minutes
until it turned clear and is then stored in a brown bottle at 40C.
D. 1000x MS Vitamin stock:
Glycine 200 mg
Nicotinic acid 50 mg
Thiamine HCl 10 mg
Pyridoxine 10 mg
All the vitamins are dissolved and refrigerated at 40C.
Preparation of culture medium:
Composition of MS basal medium (per liter)
Stock solution Volume to be taken ml/l
10X MS Macro nutrient stock 50
1000X MS Micro nutrient stock 1 mL
200X MS Iron stock 5 mL
Myoinositol 100 mg
Sucrose 30 g
Agar 8 g
H2O 800 mL
xlvi
All the ingredients are dissolved and then volume is made up to 1000
ml. The required concentrations of hormones are added and the pH is adjusted
to 5.8 with 1N NaOH and 1N HCl. Agar is added and autoclaved.
The medium is then distributed into conical flasks making sure that each
flask is filled with not more than half of its capacity to ensure proper
autoclaving. The flasks are plugged with cotton and autoclaved at 1210C and 15
lbs pressure for 15 min.
Appendix II. Preparation of LPGM (Liquid Plant Growth Medium)
LPGM was prepared same as MS medium except sucrose and agar
Appendix III Preparation of Phytohormones stocks
a. IAA (1mg/ml) stock solution 10 ml
Ten milligram of IAA was dissolved in 1N NaOH (1-2 ml) and
sterile double distilled water was added slowly with constant stirring to
make up of volume up to 10ml and stored in refrigerator at 40C.
b. IBA (1mg/ml) stock solution 10 ml
Ten milligram of IAA was dissolved in ethanol (1-2 ml) and sterile
double distilled water was added to make up of volume up to 10 ml and
stored in refrigerator at 40C.
c. NAA (1 mg/ml) stock solution 10 ml
Ten milligram of IAA was dissolved in DMSO (1-2 ml) and sterile
double distilled water was added to make up of volume up to 10 ml and
stored in refrigerator at 40C.
d. 2.4. D (1mg/l) stock solution 10ml
Ten milligram of 2.4.D was dissolved in 1N NaOH (1-2 ml) and
sterile double distilled water was added to make up of volume up to 10 ml
and stored in refrigerator at 40C.
xlvii
e. BAP (1mg/ml) stock solution 10 ml
Ten milligram of BAP was dissolved in 1N NaOH (0.3-0.5 ml) and
double distilled water was added to make up of volume up to 10 ml and
stored in refrigerator at40 C.
f. TDZ (1mg/ml) stock solution 10ml
Ten milligram of TDZ was dissolved in 1N NaOH (0.3-0.5 ml) and
double distilled water was added to make up of volume up to 10 ml and stored
in refrigerator at 40C.
g. Kinetin (Kn) 1mg/l stock in 10ml
Ten milligram of TDZ was dissolved in 1N NaOH (0.3-0.5 ml) and
double distilled water was added to make up of volume up to 10 ml and stored
in refrigerator at 40C.
h. GA3 1mg/l stock in 10ml
Ten milligram of TDZ was dissolve well with some alcohol drops and
double distilled water was added to make up of volume up to 10 ml and stored
in refrigerator at 40C.
Appendix IV. Preparation of antibiotic stock solution
a. Kanamycin (100mg/ml)
One gram of kanamycin was dissolved in 10 ml of sterile double
distilled water. After dissolving completely, filter sterilized into sterile
eppendorf tubes aseptically and stored in refrigerator at 40C.
b. Rifampicin (100mg/l)
One gram of rifampicin was dissolved in 5 ml of DMSO and volume
was made to 10ml with sterile double distilled water. After dissolving
completely, filter sterilized into sterile eppendorf tubes aseptically and
stored in refrigerator at 40C.
xlviii
c. Cefotaxime (100mg/ml)
One gram of cefotaxime was dissolved in 10 ml of sterile double
distilled water. After dissolving completely, filter sterilized into
sterile eppendorf tubes aseptically and stored in refrigerator at 40C.
Appendix V. Reagents for DNA Isolation
a. Tris-HCl 1.0 M (pH 8.0)
12.114 g of Tris-HCl was dissolved in sterile de-ionized water, pH
adjusted to 8.0 and volume was made to 100 ml with de-ionized water
and autoclaved at 15 psi for 20 min.
b. EDTA 0.25 M (pH 8.0) (dissolved salt; Mw - 372.3)
18.61g of EDTA was dissolved in sterile de-ionized water, pH
adjusted to 8.0, volume made to 100 ml with de-ionized water and
autoclaved at 15 psi for 20 min.
c. NaCl 0.5 M
29.2g of NaCl was dissolved in 100 ml de-ionized water.
d. 10% working CTAB
10% CTAB - 10 g
5 M NaCl - 14 ml
Dissolved and volume made up to 100 ml with de-ionized water
and autoclaved at 15 psi for 20 min.
e. CTAB buffer (100 ml)
2.0 g CTAB Powder (2%)
10.0 ml 1M Tris-HCl pH8 (100 mM)
4.0 ml 0.5 M EDTA (20 mM)
28.0 ml 5 M NaCl (1.4 M)
Make the solution up to 100ml with sterile distilled water (SDW)
xlix
f. Sodium Acetate 3M (pH 6.8)
Sodium Acetate 40.83gm of Sodium acetate was dissolved in 80ml
de-ionized water and pH was adjusted to 6.8. Volume was made to 100ml
with de-ionized water and autoclaved at 15 psi for 20 min.
g. Choloroform: Iso-amyl alcohol mixture (24:1)
Chloroform - 96 ml
Iso-amyl alcohol - 4 ml
h. Ethanol 70%
Absolute alcohol - 70 ml
Double distilled water - 30 ml
i. RNase stock
1 M Tris- HCl (pH 8.0) - 100 µl
5 M NaCl - 300 µl
RNase - 10 mg
Volume adjusted to 1 ml with de-ionized water, boiled for 15 minutes
and allowed to cool slowly and stored at -20ºC.
j. TE (10:1)
1 M Tris-HCl (pH 8.0) - 1 ml
0.25 M EDTA (pH 8.0) - 0.4 ml
Dissolved and volume made up to 100 ml with de-ionized water
and autoclaved at 15 psi for 20 min.
l
Appendix VI. Preparation of Reagents for Gel Electrophoresis
a. Loading dye Bromophenol Blue)
- 0.25% Bromophenol Blue
- 40% (w/v) sucrose in water
Stored at 40C
b. Ethidium bromide stock
Ethidium bromide stock was prepared by dissolving 25mg of ethidium
bromide in 25ml of distilled water. The final concentration was 1mg/l.
c. 10xTBE
Tris Base 121 g
Boric Acid 51.3 g
EDTA 3.7 g
Distilled Water to 1 L
Dissolve components, sterilize. Store at room temperature
Appendix VII. Preparation of GUS assay reagents
Potassium fericyanide 50mM
Potassium ferrocyanide 50mM
Sodium EDTA (10mM) 1.46gm of EDTA was dissolved in 10ml of double
distilled water and pH was adjusted to 7.0.
0.1% Triton-X
Sodium phosphate (Na2HPO4.2H20) Buffer, 0.5M, pH7.0
NaH2PO4.2H2O - 36 ml
KH2PO4 - 64 ml
pH was adjusted to 7.0 and the buffer was autoclaved or 0.5 KH2PO4(PH
7.0, Autoclaved)
X-gal
Dimethyl formide
li
a. Substrate �A preparation
Reagent Volume taken for 25µl in ml
0.1M Na2HPO4.2H20 or 0.5 KH2PO4 5
Sodium EDTA 2.5
Potassium fericyanide 50mM 2.5
Potassium ferrocyanide 50mM 2.5
0.1% Triton-X 2.5
Distilled water 10
Above substrate prepared by mixing the chemical in the sterile condition
kept in the -200C (freshly prepared)
b. X-gal preparation
Weighed and dissolved 25mg of X-gal (Himedia) substrate in the 250µl
of Dimethyl formide mixed till it become clear, wrapped aluminum foil and
added this to substrate-A mixed. Syringe filter sterilization (25mm Axiva) was
done and stored at -200C.
Appendix VIII. Preparation of LB agar and Broth Media
LB agar medium (100ml)
Chemical Quantity
Tryptone 1.0gm
Nacl 1.0gm
Yeast extract 0.5gm
Agar 1.5gm
Dissolve each component in about 80 ml of double distilled water and
make up the volume to 100ml .Adjust the pH to 7.2-7.4 .Autoclave the above
medium and store at 40C.
LB broth Medium (100ml)
Dissolve each component except agar in about 80 ml of double distilled
water and make up the volume to 100ml .Adjust the pH to 7.2-7.4 .Autoclave
the medium and store at 40C.
lii
Appendix IX. Plasmid isolation (Alkali lysis method)
a. Solution �I (Re-suspension solution)
0.9% Sucrose 2.25g
10nM EDTA, PH8 5ml (0.5M stock)
25nM Tris-HCl 6.25ml (1ml stock)
Made the volume to 250 ml by using sterile distilled water (stored at 4oC)
b. Solution II (cell lysis solution) 250ml.
0.2N NaOH 50ml (1stock)
1% SDS 2.5gm
Make volume with sterile distilled water to250 ml.
c. Solution III (Neutralizing solution) 100ml
1.32M Sodium acetate 100ml.
26.4ml (5 M stock).
Make the volume to 100ml with sterile distilled water.
d. Solution IV
TE buffer (250ml)
Tris- HCl 2.5m (0.1M stock)
EDAT 0.125 ml (0.5M stock)
The pH was adjust to 8.0with 1N HCl and final volume was made up
250ml.The solution was autoclaved before use.
e. EDTA 0.5M, pH-8.0
Weighed 186.1g of Na2EDAT.2H2O and the final volume was made up
to 800ml with and pH was then adjusted to 8.0 using NaOH pellets .Then the
volume was adjusted to 100ml with distilled water.
liii
Appendix X: Equipment�s u s e d
Autoclave (Arch Tech)
B.O.D. incubator (Remi)
Deep freeze -20 0C (Blue star)
Electronic balances (Sartorios)
Hot air oven (Wiswo)
Laminar flower (Clear)
Microwave ovens (Samsung)
Magnetic stirrer (Remi)
Microscope (Zeiss)
PH meter (EU-Tech)
Refrigerated Centrifuges (Remi)
Refrigerator (Whirlpool)
UV transilluminator (UVI Tech)
Vortex mixer (Geni)
Gel Documentation Unit (UVI Tech)
Horizontal Gel electrophoresis unit (Geni)
Ice maker (orumsem)
Incubator shaker (Pelican)
Mini centrifuge (Biofuge)
PCR (Peq Star)
Spectrophotometer (BL-190)
Water bath (GFL)
Water purification system (Borosil)
Lyophilizer (Christ)
Rotary shaker (Remi)