to aunt riri - university of floridaufdcimages.uflib.ufl.edu/uf/e0/04/33/54/00001/dyer_l.pdf ·...
TRANSCRIPT
1
ATM FUNCTION IN HOMEOSTASIS AND TUMOR SUPPRESSION WITHIN THE MOUSE MAMMARY GLAND
By
LISA MARIE DYER
A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY
UNIVERSITY OF FLORIDA
2011
2
© 2011 Lisa Marie Dyer
3
To Aunt Riri
4
ACKNOWLEDGMENTS
I thank my family for teaching me that anything is possible with hard work and
dedication. It has shaped me into the person I am today and I am forever grateful. I
specifically thank my mom and dad, Nancy and Fred Dyer, for their constant curiosity
and support of my research, and the choices I make regarding life or career. Sadly, I
thank my Aunt Riri for providing me with the motivation to study breast cancer. She is
never forgotten and deeply missed. I thank my little sister, Nancy, for keeping me “cool”
and my niece, Olive Marie for countless hours of enjoyment. I look forward to watching
her grow and become the smartest person in our family.
I thank my boyfriend, Jason Jatsko, for putting up with me during the writing of this
dissertation and for all his help fixing my computer problems. I look forward to spending
more less-stressful time with him and moving on to the next stage our lives together.
I thank my mentor, Dr. Kevin Brown, for giving me the chance to join his laboratory
and study mammary and breast cancer development and for careful review of this
manuscript. He has given me countless opportunities to be involved in collaborations,
grant writing and journal reviews. The experience in his lab was very fulfilling and I am
very appreciative. I thank Dr. Wan Ju Kim, a former postdoctal associate, for teaching
me the basics of molecular biology and biochemistry, and becoming a friend who could
always make me laugh. Additionally, I thank all coworkers, Dr. Lingbao Ai for reagents
and experimental tips, Dr. Kevin Schooler for being my personal Dr. Drew, and Dr.
Frank Orlando for his continued support after leaving the lab. Although Dr. Eugene
Izumchenko is the newest addition to the laboratory, he has quickly become my partner
in crime. Dr. Kladde’s lab has also been the best lab neighbor anyone can ask for. I
5
thank them for the countless times I have borrowed reagents, used their nanodrop and
have listened to my complaining.
6
TABLE OF CONTENTS page
ACKNOWLEDGMENTS .................................................................................................. 4
LIST OF TABLES ............................................................................................................ 9
LIST OF FIGURES ........................................................................................................ 10
LIST OF ABBREVIATIONS ........................................................................................... 12
ABSTRACT ................................................................................................................... 13
CHAPTER
1 INTRODUCTION .................................................................................................... 15
Ataxia-Telangiectasia.............................................................................................. 15
Ataxia-Telangiectasia Mutated (ATM) ..................................................................... 18
Atm-Deficient Mice .................................................................................................. 27
Breast Cancer Risk Factors .................................................................................... 30
Breast Cancer-related Predisposition Syndromes ............................................ 31
Breast Cancer Susceptibility Genes ................................................................. 32
ATM and Breast Cancer Susceptibility .................................................................... 35
Epidemiological Evidence ................................................................................. 35
Molecular Evidence .......................................................................................... 37
Mus Musculus Mammary Gland Development ....................................................... 47
Embryonic ........................................................................................................ 47
Postnatal .......................................................................................................... 48
Pregnancy and Lactation .................................................................................. 50
Involution .......................................................................................................... 51
Hormonal Regulation ........................................................................................ 53
Oxidative Stress ............................................................................................... 59
2 METHODS .............................................................................................................. 62
Construction of the Mouse Line Containing a Floxed Atm Allele ............................ 62
Generation of the Conditional Atm Mouse Line ...................................................... 62
Introducing a Floxed p53 Allele into the Atm cKO Mouse Line ............................... 63
Genotyping ............................................................................................................. 63
RNA Isolation and Purification ................................................................................ 64
Reverse-Transcription PCR .................................................................................... 65
Quantitative Real-Time Reverse-Transcription PCR .............................................. 65
Cloning of Atm Exon 58 .......................................................................................... 66
Isolation and Preparation of Mammary Glands ....................................................... 66
Immunohistochemical (IHC) Analysis ..................................................................... 67
Histology and Whole Mount Analysis ...................................................................... 68
7
Pup Growth Curves ................................................................................................ 69
Terminal Deoxynucleotidyl Transferase dUTP Nick End Labeling (TUNEL) Assay ............................................................................................................ 69
GTC-phenol-chloroform Total RNA/DNA Isolation Method ..................................... 70
High Performance Liquid Chromatography-Electro Chemical Detection (HPLC-ECD) .................................................................................................................... 71
Ionizing Irradiation .................................................................................................. 72
Cell Culture and Chemicals .................................................................................... 72
RNA Interference (RNAi) ........................................................................................ 72
Immunoblot ............................................................................................................. 73
Cell Viability Assay ................................................................................................. 73
Statistical Analysis .................................................................................................. 74
3 ATM FUNCTION IN MAMMARY GLAND HOMEOSTASIS .................................... 77
Mammary Gland Development in Atm Mutant Mouse Models ................................ 77
Cre-Mediated Recombination ................................................................................. 77
Cre-Mediated Gene Deletion in the Mammary Gland ............................................. 78
Results .................................................................................................................... 79
Atm -/- Mammary Glands Have Developmental Defects .................................. 79
Generation of the Atm cKO Mouse Line ........................................................... 80
Characterization of WAP-Cre Mediated Deletion of Atm Exon 58 .................... 81
Reduced Litter Weight of Atm cKO Dams ........................................................ 84
Histological Analysis of Atm cKO Mammary Glands ........................................ 85
Atm mRNA Expression in L10 Atm cKO Mammary Epithelium ........................ 86
Relative mRNA Expression Levels of Milk Proteins ......................................... 87
Immunohistochemical Analysis of p-Stat5a ...................................................... 88
Quantifying Apoptosis via TUNEL Staining ...................................................... 88
Expression of Involution Markers in Atm cKO Mice .......................................... 89
Immunohistochemical Analysis of p-Stat3 ........................................................ 91
Oxidative Stress in Atm cKO Mammary Glands ............................................... 92
Sensitivity to Oxidative Stress in Atm Knockdown Mammary Epithelial Cells .. 92
Antioxidant Gene Expression in Atm-knockdown NMuMG and Atm cKO Mammary Glands .......................................................................................... 93
Discussion .............................................................................................................. 94
4 ATM AND MAMMARY TUMOR SUPPRESSION ................................................. 130
Mammary Tumor Development in Atm Heterozygous Mouse Models .................. 130
Increasing Mammary Tumorigenesis in the Mouse Mammary Gland ................... 132
Results .................................................................................................................. 135
Mammary Tumor Development in Aged Atm cKO Mice ................................. 135
Generation of the Atmflox/flox;p53flox/+;WAP-Cre Mouse Line ........................... 136
Mammary Tumor Development in Irradiated Atmflox/flox;p53flox/+;WAP-Cre Mice ............................................................................................................ 137
Discussion ............................................................................................................ 138
8
5 FUTURE DIRECTIONS ........................................................................................ 145
Hormonal Supplementation of Atm -/- Mice .......................................................... 146
Mammary Gland Development and Signaling in MMTV-Cre Atm cKO Mice ......... 147
Exongenous Antioxidant Administration to Atm cKO Mice .................................... 148
Atm-dependent Sod2 Expression in Mammary Epithelial Cells ............................ 148
New Strategy for Driving Mammary Tumorigenesis in the Atm cKO Mouse Line . 149
APPENDIX
A RADIATION EFFECTS ......................................................................................... 150
B ATM AND IGF-1R IN MAMMARY GLAND DEVELOPMENT ............................... 154
LIST OF REFERENCES ............................................................................................. 158
BIOGRAPHICAL SKETCH .......................................................................................... 188
9
LIST OF TABLES
Table page 2-1 List of genotyping primers .................................................................................. 75
2-2 List of mus musculus RT and Q-PCR primers .................................................... 76
10
LIST OF FIGURES
Figure page 3-1 Whole mount analysis of mammary gland structure in Atm -/- mice. ................ 101
3-2 Histological analysis of H and E stained mammary sections. ........................... 102
3-3 Gene targeting scheme used to introduce loxP sites flanking Atm exon 58. .... 103
3-4 Location of loxP sites and genotyping primers within the Atm allele.. ............... 104
3-5 Genotyping of the Atm cKO mouse line. ........................................................... 105
3-6 WAP-Cre mediated recombination results in Atm exon 58 excision. ................ 106
3-7 Total Atm mRNA expression in Atm cKO mice. ................................................ 107
3-8 Quantification of Atm exon 58 mRNA expression in Atm cKO mice. .............. 108
3-9 Immunohistochemical characterization of Atm protein expression in Atmflox/flox mammary glands.. ............................................................................................ 109
3-10 Immunohistochemical analysis of Atm protein expression in Atm cKO mammary glands.. ............................................................................................ 110
3-11 Reduced pup weight of Atm cKO dams. ........................................................... 111
3-12 Histological analysis of Atmflox/flox and Atm cKO mammary glands throughout mammary gland development.. ........................................................................ 112
3-13 Histological analysis of Atmflox/flox and Atm cKO mammary glands at L10. ....... 113
3-14 Relative Atm expression in Atm cKO dams at L10. .......................................... 114
3-15 Relative milk protein gene expression in Atm cKO dams. ................................ 115
3-16 Immunohistochemical analysis of p-Stat5 in Atmflox/flox and Atm cKO mammary glands.. ............................................................................................ 118
3-17 TUNEL analysis of Atmflox/flox and Atm cKO mammary glands. ......................... 119
3-18 Relative expression of first-phase involution-associated genes in Atm cKO dams.. ............................................................................................................... 120
3-19 Relative expression of second-phase involution-associated genes in Atm cKO dams. ........................................................................................................ 121
11
3-20 Immunohistochemical analysis of p-Stat3 expression in Atmflox/flox and Atm cKO mammary glands.. .................................................................................... 122
3-21 Quantification of 8-oxoGuo in total RNA harvested from Atmflox/flox and Atm cKO mammary glands. ..................................................................................... 123
3-22. oxidative stress.. ............................................................................................... 124
3-23 Loss and inhibition of Atm in MDA-MB-231 cells results in increased sensitivity to oxidative stress. ........................................................................... 126
3-24 Atm is required for Catalase and Sod2 expression. .......................................... 128
4-1 Histological analysis of mammary gland sections from aged multiparous Atmflox/flox and Atm cKO mice. ........................................................................... 142
4-2 Genotypes of irradiated mice. ........................................................................... 143
4-3 Histological analysis of mammary gland sections from irradiated mice. ........... 144
A-1 Body weight after 5 Gy of whole body irradiation in 10-week old mice. ............ 152
A-2 Body weight of experimental and control mice after 5 Gy of whole body irradiation. ......................................................................................................... 153
B-1 Atm is required for Igf1-R expression. .............................................................. 156
12
LIST OF ABBREVIATIONS
bp basepair
CI confidence interval
DAB 3,3’ Diaminobenzidine
del deletion
EBV Epstein-barr virus
GTC guanidinium thiocyanate
Guo guanine
Gy gray
HSV herpes simplex virus
kDa kilodalton
nt nucleotide
Mn maganese
mV millivolts
PLG phase lock gel
SD standard deviation
Tyr tyrosine
13
Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy
ATM FUNCTION IN HOMEOSTASIS AND TUMOR SUPPRESSION WITHIN THE
MOUSE MAMMARY GLAND
By
Lisa Marie Dyer
August 2011
Chair: Kevin D. Brown Major: Medical Sciences-Biochemistry and Molecular Biology
Ataxia-telangiectasia mutated (ATM) is a high molecular weight protein kinase
activated in response to DNA damage and oxidative stress. Transgenic mice
haploinsufficient for Atm on a Brca1-deficient background (Atm+/-; Brca1-MG-ex11)
show abnormal mammary gland development, such as a reduction in ductal bifurcation
and less dense alveolar structures. To examine the role of ATM in mammary gland
development, we generated a mouse line with a conditional deletion of Atm (Atm cKO)
in the mammary epithelium under control of the whey-acidic protein (WAP) promoter.
Characterization of the Atm cKO mouse line revealed approximately 40-50% of the mice
displayed a lactation defect and a premature entry into involution. ATM has been
implicated in metabolic regulation and is known to be required for normal growth by
stabilizing the intracellular redox status. Based on this, we analyzed 8-oxoGuo by
HPLC-ECD of mammary tissue obtained from Atm cKO and control mice and
determined cell viability to hydrogen peroxide in Atm-deficient mouse mammary
epithelial cells (NMuMG). This analysis revealed increased 8-oxoGuo content in Atm
cKO mammary glands and reduction in cell viability after 24hr treatment in Atm-deficient
NMuMG cells compared to controls. We also found Atm-dependent expression of the
14
antioxidant enzymes, catalase and superoxide dismutase in Atm-deficient mouse
mammary epithelial cells and Atm cKO mice. These results suggest that Atm is
required for mammary gland development, perhaps by acting as an important sensor of
reactive oxygen species.
Epidemiological evidence indicates obligate female ATM heterozygotes have an
increased risk of breast cancer development. Also, tumor prone ATM heterozygote
mouse models have demonstrated a role for ATM in breast cancer tumorigenesis and
severity. To test this, we monitored mammary tumor development in a cohort of aged
multiparous Atm cKO mice and irradiated Atm cKO mice on a heterozygote p53 floxed
background (Atmflox/flox;p53flox/+;WAP-Cre) and controls. Consequently, after 2 years, no
mammary tumors development in aged Atm cKO dams, and after 36 weeks, only 1/45
mice developed a mammary tumor in the irradiated cohort. Therefore, no association
between Atm and mammary tumor development could be calculated in either cohort of
mice due to a lack of mammary tumor development.
15
CHAPTER 1 INTRODUCTION
Ataxia-Telangiectasia
Ataxia-telangiectasia (A-T) is a rare early-onset autosomal pleiotropic disease that
is characterized by progressive cerebellar neurodegeneration, ocular telangiectasias,
which are permenant dilations of the fine blood vessels, immunodeficiency, premature
aging, radiosensitivity and increased cancer predisposition, specifically lymphoid tumors
(1). A-T was initially first documented in 1926, but was not described as a distinct
disorder until 1957 by Boder and Sedgwick who both had independently recognized the
syndrome at the University of Southern California (2). The frequency of A-T live births
is estimated to range from 1 in 40,000 to 1 in 100,000 depending on ethnic group and
the ability to differentiate the syndrome from similar neurological disorders (3).
The most prominent characteristic of A-T is early-onset progressive cerebellar
ataxia (1, 2). Generally, infants later diagnosed with A-T, do not present signs or
symptoms until 1-4 years of age (4). In most cases, infants appear to develop normally
until shortly after learning to walk, at which time, they begin to regress and display
features of ataxia in both the upper and lower limbs (4). Loss of motor control is evident
in the truncal region and progresses further into severe neuromotor dysfunction that
results in loss of peripheral coordination such as vertical and horizontal eye movement,
slurred speech, and choreoathetosis, which is the occurrence of involuntary movements
of the hands and feet (5, 6). By teenage years, A-T patients are confined to a
wheelchair and need assistance for everyday activities like eating, drinking and going to
the bathroom. Histological analysis of deceased patients revealed gradual loss of
granular and Purkinje cells in the cortex of the cerebellum, but the adjacent GABAergic
16
basket cells remain unaffected (7). Purkinje cells play a fundamental role in coordinated
movement and their loss is primarily responsible for the progressive neurodegeneration
phenotype (3, 7).
Immunodeficiency occurs in the majority (60-80%) of A-T patients and is a major
cause of death (8, 9). A-T patients display dysregulation of cell-mediated immunity
such as abnormal development of the thymus and reduction of both mature CD4+ and
CD8+ circulating T-lymphocytes (10, 11) that results from a defect in recombination of
the T-cell receptor locus (12). Defects in humoral immunity are inconsistent between
patients (13) however; the most common immunodeficiency is the poor primary
antibody response to pneumococcal polysaccharide vaccines (14). This observation led
to the identification of low serum concentrations of immunoglobulins IgA, IgE, and IgG2
(14-16). Antibody responses to other vaccines such as diphtheria and tetanus toxin are
normal (17). Immunodeficiency in A-T does not appear to be progressive, but lower
respiratory tract infections seemingly increase in patients over the age of 20 (13).
Upper respiratory tract infections such as pneumonia occur in 15%, otitis media (middle
ear infection) in 46%, recurrent sinusitis in 27%, and recurrent bronchitis in 19% of
patients (13). The most common viral infection is warts, but others have been reported
including varicella, varicella zoster, herpes simplex and EBV, but only occasionally do
these viral infections become severe enough for hospitalization (13). Moreover, clinical
and laboratory analysis of A-T patients have demonstrated great variability of immune
dysfunction between patients and even within families (13, 14).
Another clinical phenotype of A-T are telangiectasias (1) or small, dilated blood
vessels. Telangiectasias are found in the eyes, mucous membranes, ears and face and
17
appear later in the course of disease (1, 18). Some patients may never display
telangiectasias (4).
Cancer is the second leading cause of death in A-T patients with approximately
10-25% of A-T patients develop a malignancy during their lifetime, with the vast majority
being T-cell lymphomas and leukemias (19). Morrell et al. have estimated a ~70-fold
increase of leukemias and ~250-fold increase of lymphomas compared to the general
population (9). In a study of 108 A-T patients, non-Hodgkins lymphoma accounted for
41% of neoplasms and leukemias accounted for 23% reported in this cohort of A-T
patients (20). Solid tumors were also common, representing 26% of neoplasms
reported (20). Completed autopsies dating back to 1964 have identified solid tumors
including renal, gastric, brain, ovarian, liver and various sarcomas (20).
Boder and Sedgwick et al. first documented a premature aging phenotype when
they noticed characteristics of patients that included wasting of the face, sunken eyes
and stooping posture (2). Graying of the hair and accelerated loss of subcutaneous fat
have also been documented (21). Another important feature of A-T is infertility, seen in
both male and female patients (21).
Defects in A-T cells are complex and generally point to deficiencies involving
response to DNA damage whether by normal processes or external DNA damaging
agents. The main defects include increased genomic instability, radiosensitivity, and
faulty cell cycle checkpoints (22, 23). Increased chromosomal breakage and
translocations, specifically translocations involving T cell receptor (TCR) genes and
immunoglobin heavy chain loci (22, 24) are seen in cultured lymphocytes and
fibroblasts. Clonal expansion of these lymphocytes is thought to be the initiating
18
process towards malignancy in A-T patients (25). Laboratory findings also have
uncovered an increased rate of chromosomal end associations and reduced telomere
length in A-T fibroblasts despite normal telomerase activity (26-28).
Clinical radiosensitivity of A-T patients was uncovered by in vitro colony survival
assays that show increased sensitivity to ionizing radiation (IR) and radiomimetic
chemicals (23, 29, 30). A-T cells also display an inability to inhibit DNA synthesis after
irradiation, a phenomenon termed radioresistant DNA synthesis (RDS) (31), and is a
result of a faulty S-phase checkpoint. The identification of this characteristic was of
extreme clinical importance with regards to typical dosing requirements of radiation
treatment for lymphoma/leukemia as full dosing might result in toxicity of normal tissues
or death (32). A-T cells also display faulty G1/S and G2/M cell cycle checkpoints in
response to DNA damage, particularly ionizing radiation (33-35).
Ataxia-Telangiectasia Mutated (ATM)
The ataxia-telangiectasia gene was localized to the chromosomal region 11q22-23
by genetic linkage analysis of 31 affected A-T families (36), and this discovery was the
driving force behind the initial positional cloning attempts. Lange et al. narrowed the A-
T locus region to a 500 kilobase interval on 11q23.1, and of the candidate genes found
in this region, only one was mutated in all complementation groups (37). Yosef Shiloh’s
group found the gene responsible for A-T and termed it Ataxia-telangiectasia, mutated
(ATM) in 1995 (38). The genomic organization of ATM spans 160kb of DNA, and the
ATM protein is transcribed from a 13kb transcript with 66 exons and has a molecular
weight of 370 kDa (39). A-T causing mutations are located across the full length of the
ATM protein and are usually truncating or splice-site mutations that result in a
catalytically dead ATM protein product and reduced protein expresion (40).
19
The ATM protein is compromised of 3056 amino acids and has a C-terminal
domain with high sequence homology to a large, well-studied group of proteins termed
the phosphoinositide 3-kinase-related protein kinase (PIKK) family (41). The members
of the PIKK family are high molecular weight serine/threonine protein kinases known to
play a role in cell cycle progression, genome stability, and the DNA damage response
(42). Mammalian members of this family include, DNA-PKcs, which plays a large role in
DNA double-stranded break (DSB) repair via non-homologous end joining (NHEJ) (43),
ATR (ATM and Rad-3 related) that principally responds to stalled replication forks (44),
and FRAP and TRRAP that both regulate protein synthesis in response to growth
factors (45, 46).
Other domains of ATM include a highly conserved distal C-terminal FATC (FRAP,
ATM, TRRAP C-terminal) domain that is thought to play a role in redox-dependent
structural and cellular stability (47), a FAT (FRAP, ATM and TRRAP) domain involved in
protein-protein interactions. Structural confirmation of the FATC domain of target of
rapamycin (TOR) in yeast suggests it may help stabilize ATM’s kinase domain (48).
Two nuclear localization sequences (NLS) and a HEAT repeat are located within the N-
terminal domain (47) and are also thought to mediate protein-protein interactions (47).
ATM is ubiquitously expressed in all tissues, but is highly expressed in the thymus,
testis and spleen (41). Localization of the ATM protein is mainly in the nucleus (49), but
also has been shown to be present in the cytoplasm of oocytes (50), cerebellar neurons
(51) and mammary epithelium (52). In the cytoplasm, ATM has shown to be associated
with cytoplasmic vesicles (53) and peroxisomes (54) which are membrane bound
organelles involved in peroxide-based respiration and oxidation of long chain fatty acids
20
(55). Specifically, ATM was found to co-localize with catalase, an enzyme whose
molecular mechanism is to decompose the oxidative species, hydrogen peroxide, to
water and oxygen (54). This finding provided evidence for the involvement of ATM in
monitoring oxidative stress and may be the source of the premature aging and
neurodegeneration phenotypes seen in A-T patients (56).
Prior to the identification of ATM, early discoveries of the cellular A-T phenotype
revolved around hypersensitivity to IR and defects in cell cycle control. Both were
discovered as a consequence of radio-resistant DNA synthesis during the S-phase of
the cell cycle, and this observation was similar to that later seen p53 defective cells
(57). Thus, it was also shown that A-T cells may fail to induce p53 in response to IR
and lead to a defective G1/S checkpoint (34). The G1/S cell cycle checkpoint is
dependent on the stabilization and activation of the p53 tumor suppressor, allowing p53
to activate the downstream gene, p21WAF1/CIP1, involved in the G1/S checkpoint (34).
Also, after irradiation, A-T cells were shown to have increased amounts of unrepaired
chromosomal breaks when compared to normal human fibroblasts (58). These initial
observations of A-T cells led researchers to believe that ATM plays a role in DNA
damage repair and signaling, specifically to DNA DSBs, the most cytotoxic lesion
caused by irradiation (30). Moreover, this finding is consistent with its localization in the
nucleus (30) .
ATM activation. ATM exists as an inactive dimer in undamaged cells and
undergoes intermolecular phosphorylation on Serine (Ser) 1981 in response to DNA
DSBs that results in its dissociation into active monomers (59). DNA-damage
recognition repair proteins are recruited to DSB lesions in a DNA damage dependent
21
manner; the major protein complex is the MRN-complex and its recruitment to
chromatin is dependent on the adaptor protein, MDC-1 (mediator of DNA damage
checkpoint protein 1) (60). The MRN-complex is composed of three proteins, MRE11,
RAD50 and NBS1 and the C-terminal domain of NBS1 is responsible for recruiting ATM
to the damaged site (61). ATMs localization to the break site results in its full activation
(62). The MRN-complex is also a substrate of ATM suggesting ATM and the MRN-
complex work together to foster an effective DNA damage response (62). Protein
phosphatases also regulate ATM activation by maintaining ATM in a basal
unphosphorylated state (63). The phosphatase, WIP1 can directly dephosphorylate
ATM in vitro on Ser1981 causing deactivation of ATM, and absence of this enzyme
causes upregulation of ATM activity (64). Once activated, ATM phosphorylates H2AX
to produce H2AX, a histone H2A variant that marks DNA-DSBs (65), and p53, the
tumor suppressor protein responsible for initiating the G1/S cell cycle checkpoint (66).
The formation of H2AX and the phosphorylation of MDC1 by ATM are thought to
provide a docking station for the additional components of DNA-damage repair pathway
such as RING-finger ubiquitin ligases, RNF8 and RNF168, BRCA1 (breast cancer
associated protein 1) and 53BP1 (67-69).
ATM and cell cycle checkpoints. Cell cycle checkpoints are required to slow
cell-cycle progression allowing the cell time to respond and repair challenges such as
stress and DNA damage (70). Kastan et al., was the first to show A-T cells are
defective in the IR-induced G1/S checkpoint due to failed p53 induction (34). After the
identification of ATM as a serine/threonine kinase (41), it was shown that in response to
IR, ATM directly phosphorylates p53 on Ser15 (71). This leads to the accumulation and
22
stabilization of p53 in the nucleus where it transcriptionally induces p21WAF1/CIP1, an
inhibitor of the cyclin-dependent kinase, Cdk2, and ultimately results in inhibition of the
cyclin-E/cdk2 complex, blocking progression from G1 to S phase (72, 73). ATM also
phosphorylates Mdm2 on Ser365 and this decreases Mdm2s ability to negatively
regulate p53 by binding to its N-terminus and mediating transport from the nucleus to
the cytoplasm (74). Alternatively, IR also induces ATM-dependent phosphorylation of
p53 on Ser20 via Chk2 (checkpoint kinase 2) (75), a downstream effector of ATM (76).
Due to the RDS phenomenon seen in A-T cells and the fact that p53 is not
required for the intra S-phase checkpoint after IR, it was clear that ATM has additional
downstream targets. The intra S-phase checkpoint stems from two parallel pathways.
One such target is NBS1 protein, part of the MRN complex that forms recognition foci
on DNA double stranded breaks (77, 78). Mutations in NBS1 cause Nijmegen
Breakage Syndrome (NBS), a genetic disorder that shares a variety of phenotypic
abnormalities with A-T, including immunodeficiency, radiosensitiviy and genomic
instability (77, 79). ATM phosphorylates NBS1 on Ser343 in response to IR, both in
vivo and in vitro (80-82). Phosphorylated NBS1 acts as an adaptor protein for the ATM-
dependent phosphorylation of SMC1 (structural maintance of chromosomes 1), which
links DNA damage to DNA repair and the S-phase cell cycle checkpoint (81, 83). Also,
BRCA1 may be required for proper IR-induced S-phase arrest; ATM was found to
phosphorylate BRCA1 on Ser1387 and Ser1423, with Ser1387 required for ATM-
dependent S-phase arrest (84). Another pathway involves a functional link between
ATM, Chk2, and Cdc25a, a phosphatase that activates cyclin-dependent kinase 2
(Cdk2) to promote the progression through S-phase (85). ATM phosphorylates Chk2 on
23
threonine (T) 68 after IR, this activates Chk2 which subsequently phosphorylates
Cdc25a and marks it for proteasomal degradation (85).
In addition, A-T cells do not slow progression through the G2/M checkpoint in
response to IR (84). In response to DNA damage, Chk1 and/or Chk2 are
phosphorylated by ATM and these two protein kinases can both phosphorylate CDC25c
causing it to bind to 14-3-3 and be sequestered out of the nucleus and into the
cytoplasm (86). This prevents Cdc25c from activating the cyclin dependent kinase
Cdc2 and the subsequent formation of the Cdc2/cyclin B complex that is responsible for
the G2 to M transition (87). Also, the ATM-dependent phosphorylation of BRCA1 on
Ser1423 has been shown to be necessary for ATM-mediated G2/M arrest (88) and
BRCA1 is essential for activating Chk1, therefore directly regulating the DNA damage-
induced G2/M arrest (89).
ATM and oxidative stress. The most striking phenotype observed in A-T patients
is the progressive neurodegeneration caused by gradual Purkinje cell loss in the
cerebellum of the brain (1). Attempts to delineate ATMs role in neurodegeneration was
hampered by the fact that ATM was found in the cytoplasm of neuronal cells (90) and
rules out involvement in DNA damage response and cell cycle progression in this cell
type (56). This detached ATM’s well-known function from A-Ts most striking symptom.
Rotman and Shiloh et al. were the first to hypothesize that the neurological phenotype
seen in A-T patients could be a result of increased levels of oxidative stress (56). The
redox-state of the cerebella of Atm-/- mice was analyzed and found alterations in
markers of oxidative stress including, thioredoxin, catalase, and manganese superoxide
dismutase (91). These results were suggestive of increased levels of reactive oxygen
24
species, and was further supported by Chen et al., who showed the antioxidant,
isoindoline nitroxide (CTMIO), protected cultured A-T Purkinje cells from death and
enhanced differentiation (92). Taken further, antioxidant treatment was shown to correct
the neurobehavioral phenotype of Atm-/- mice (93, 94). Until recently the link between
ATM, oxidative stress and the neurological phenotype observed in A-T patients
remained elusive.
Astrocytes have been implicated in protecting neurons from oxidative stress and
the loss of astrocyte integrity may contribute to neuronal cell death (95, 96). Therefore,
Atm -/- astrocytes may be unable to protect Purkinje cells against oxidative stress
leading to their degeneration and the nuerodegeneration phenotype (92). In vitro, Atm -
/- astrocytes have a growth defect and eventually undergo senescence compared to
wild type cells (97, 98). Additionally, markers of oxidative stress such as
malondialdehyde (MDA), a byproduct of lipid peroxidation, and the endoplasmic
reticulium (ER) stress markers GRP78 and cleavage of procaspase-12 was increased in
Atm -/- astrocytes (98). ER stress has also been documented in Atm-deficient
thymocytes, and treatment with hydrogen peroxide (H2O2) exacerbates the stress
response (99). Treatment of Atm -/- astrocytes with the antioxidant, N-acetyl-l-cysteine
(NAC), restored proliferation rates comparable to Atm +/+ counterparts, linking the
growth defect directly to elevated oxidative stress levels (97). In addition, it was found
that Atm-/- astrocytes upregulate the cyclin-dependent kinase inhibitors (Cdks), p16Inka
and p21WAF1/CIP1 after H2O2 treatment and persist for 16 hours, while Atm +/+ astrocytes
are down to basal levels at this time point (97). This indicates that prolonged oxidative
stress conditions will result in cell cycle arrest and thus, a dramatic reduction of cell
25
proliferation in astrocytes lacking ATM, limiting the protection mechanism of neurons
normally in place in this cell type (97).
ATM activation by oxidative stress. Previously, it has been documented that
ATM is activated in response to changes in cellular redox status (100-103), however, it
remained unclear whether the activating event is a consequence of DNA damage. ATM
is autophosphorylated on Ser1981 and downstream effector proteins such as p53 and
Chk2 are also phosphorylated in an ATM dependent manner in response to H2O2
treatment and oxidative stress (104, 105). ATM activation was found to occur in the
cytoplasm in response to H2O2 (100) and in the absence of DNA DSBs (104). Also,
treatment of cells with the ATM inhibitor, KU-55933, blocked phosphorylation of ATM,
p53 and Chk2 after H2O2 treatment (104), supporting these events as ATM-dependent
in response to oxidative stress. Futhermore, these downstream targets are
phosphorylated in Ataxia-telangiectasia-like (ATLD) cells, which are deficient in Mre11,
when exposed to H2O2, indicating the MRN complex is not necessary for activation of
ATM by oxidative stress (104). Alexander et al. (100) hypothesized that reactive
oxygen species (ROS) may induce conformational changes in ATM via oxidation of
sulfhydryl groups forming intra- or intermolecular disulfide bonds, and this hypothesis
was proven later correct by Guo et al (104).
Once activated, ATMs affinity towards its substrates is dramatically increased
(106). Therefore, to determine the mechanistic activation of ATM after treatment with
H2O2, Guo et al. investigated substrate binding efficiencies by purifying recombinant
dimeric ATM and immobilizing it on magnetic beads (104). The beads were then
incubated with GST-tagged p53 in the presence or absence of H2O2 and the amount of
26
substrate bound was determined by western blot. Treatement with H2O2 increased the
affinity for GST-p53 compared to untreated, suggesting an oxidation dependent
conformational change in ATM (104).
Next, to determine if ATM converts to the active monomeric state in the presence
of ROS, purified dimeric ATM was treated with H2O2, ran on a denaturing SDS-
polyacrylamide gel and blotted with antibodies against ATM or phospho-ATM. Results
indicated that autophosphorylated ATM was only in the dimeric form and did not
undergo a dimer-monomer transition (104). This evidence supported the hypothesis
presented by Alexander et al. that disulfide bond formation may be the causative event
for ATM activation upon oxidation (100).
To further test this hypothesis, mutations were made in conserved cysteine
residues within the ATM protein (104). Most of the mutated residues did not alter the
activation of ATM after H2O2 treatment. Cysteine 2991 was the only residue shown to
be important in activation of ATM by oxidative stress; Cysteine 2991 is located in the C-
terminal FATC domain and is in close proximity to the kinase domain. As previously
mentioned, the FATC domain helps stabilize the catalytic domain of ATM (48). By
preparing heterodimers composed of wild type and mutated Cysteine 2991, it was
concluded that Cysteine 2991 forms an intermolecular disulfide bond under oxidative
stress conditions (104). After exposure to H2O2, the wild type-mutant heterodimer was
not active, assuming intermolecular disulfide bond formation was necessary for ATM
activation in response to oxidation. This study clearly identified a new activation
pathway of ATM independent of the well-known pathway involving DNA DSBs and the
27
MRN complex (61). This discovery opens a new door of ATM-dependent oxidative
stress response pathways not previously known.
Atm-Deficient Mice
Over 400 distinct DNA mutations have been identified in A-T patients that reside
across the entire length of the ATM gene (107) and most result in a truncated, unstable
protein (108). Regardless of the specific gene mutation, A-T patients often display
phenotypes suggesting almost all mutations are functionally equivalent and are null
alleles (109). Atm, the murine homolog, was identified by probing a mouse brain cDNA
library with a probe corresponding to nucleotides 1-2456 of the 5’ region of the human
transcript (110). Pecker et al. mapped Atm to mouse chromosome 9C, which contains
syntenic regions to chromosome 11q, specifically 11q22-q23, the locus of the human
ATM gene (38). The open reading frame encodes a protein of 3066 amino acids with a
molecular mass of 349.5 kDa and when comparing mouse and human orthologs, Atm
has 85% nucleotide identity and 91% similarity at the amino acid level (110). The most
conserved region is the PI3K catalytic domain, with 94% identity and 97% similarity
(110).
The first mouse models of A-T (111-113) were developed by disrupting the Atm
locus using gene targeting to introduce a truncation mutation into the Atm gene at
positions equivalent to the location of common frame-shift mutations found in A-T
patients (111, 114). All of the Atm-deficient mouse models (Atm-/-) exhibit phenotypes
consistent with A-T patients such as retarded growth, disrupted spermatogenesis and
oogenesis, immunologic abnormalities, increased radiosensitivity and a high penetrance
of thymic lymphomas (111-113). Neurologic degeneration was not observed in initial
analysis of Atm -/- mice. Histologic evaluation of brains from Atm -/- mice revealed
28
normal architecture, and analysis of the cerebellum revealed healthy Purkinje cells with
thick layers granular cells (111, 113). Partly controversial, electron micrographs of 2-
month old Atm -/- mice revealed markers of Purkinje cell degeneration including a
crenated surface profile and a dense cytoplasm (115).
Atm was found to be essential for germ cell development and fertility even though
mutant mice showed grossly normal reproductive organs (111-113). However, the
gonads of both sexes of mice were undersized, and histological examination revealed
the total absence of mature gametes (50). The seminiferous tubules of a 2-month-old
male Atm -/- mice lacked spermatids and spermatozoa, and had evidence of cellular
degeneration (50). Specifically, spermatogenesis is arrested at the zygotene/pachytene
stage of meiosis (113). The ovaries of Atm -/- female mice had immature primordial
follicles and oocytes in addition to lack of estrous cycling (50). Due to gonadal
dysregulation in Atm -/- mice, both sexes are unable to successfully reproduce.
Atm -/- mice have a substantial propensity to develop thymic lymphomas early in
life. Tumors develop between 2-4 months of age (111) and have been observed in 1
month old mice (113). Lymphomas have a high mitotic index and were aggressive.
Atm -/- mice succumbed by 4.5 months of age due to the lymphomas filling the chest
cavity and compressing the lungs or heart (111, 113). Barlow et al. reported the tumor
metastasized into the bone marrow and filled the subperiosteal space, located near the
orbital cavity (111). Although tumor cells circulated in the blood, Xu et al. failed to report
tumor cells metastasizing to distant tissues (113). Flow cytometry revealed the tumor
cells were CD3-, CD4+, and CD8+, indicative of immature T-lymphocytes (111, 113).
29
In addition to Atm-/- mice, another Atm-deficient mouse model was developed in
hope to recapitulate the neuronal degeneration phenotype. The mouse model termed,
Atm-SRI, was generated to express mutant Atm protein corresponding to a mutant
form of ATM documented in A-T patients that is not a kinase dead, non-functional form
of this protein (116). This mouse harbors a homozygous, nine-nucleotide in-frame
deletion (766del9) of exon 4 that results in a three amino acid deletion of serine,
arginine, and isoleucine (54) at amino acid positions 2556-2558 (116). This mutation
has been identified multiple times in A-T patients and is also found in the homozygous
state (114).
Characterization of Atm-SRI mice revealed features similar to Atm -/- mice
including growth retardation, sensitivity to ionizing radiation, gonadal defects,
immunological abnormalities and a high penetrance of thymic lymphomas (116).
Nevertheless, Atm-SRI mice had a longer life span than Atm -/- mice, 30% of Atm-
SRI survived to 16 months whereas 100% of Atm -/- perished by 40 weeks. Also, the
mice that did not succomb to thymic lymphomas, displayed a variety of tumor types in
including ovarian granulosa cell tumors, epithelial carcinomas, histiocytic/reticulum
tumors, and stromal cell tumors (116). Additionally, Atm-SRI showed no signs of
nuerological degeneration.
The Atm-SRI mouse model was the first to demonstrate an increased
susceptibility to developing tumors other than thymic lymphomas, in agreement with
epidemiological data supporting and increase risk of cancer development in
heterozygous carriers of ATM (117). To further support the initial increase of tumor
burden in Atm-SRI mice, tumor formation in heterozygous Atm-SRI mice was
30
monitored and compared to tumor incidence is Atm +/- and wild type mice (118).
Tumors were found in 29 out of 326 heterozygous Atm-SRI mice and 5/177 WT mice
(p=0.004), while no Atm +/- mice developed any tumors (118). The mean age of tumor
onset was 18.6 months and 22 months, respectively. 17 different tumor types arose in
heterozygous Atm-SRI mice that included sarcomas, lymphomas, leukemias,
adenomas and dermoid cysts. Majority of the sarcomas developed (9/12) were located
in the mammary gland and also two ductal adenomas of the mammary gland were
recorded (118). The tumor spectrum observed in heterozygous Atm-SRI mice was in
contrast to homozygous Atm-SRI mice (116). Together, this mouse model was the
first to demonstrate an increased risk of cancer and mammary tumor development in
Atm heterozygous mice.
Breast Cancer Risk Factors
The etiology of breast cancer is derived from both non-genetic and genetic factors.
According to the American Cancer Society, non-genetic factors are lifestyle-related and
include menstrual and reproductive history, overweight or obesity, alcohol use, post-
menopausal hormone therapy, and lack of physical exercise.
The genetic component tends to cluster in families and is termed hereditary or
familial cancer. Hereditary cancer is identified when cancer in families follows a
Mendelian pattern of inheritance and familial cancer is defined when family history is
indicative of a hereditary cancer, but the distribution is not conclusive (119). Hereditary
breast cancer only accounts for 5% of all breast cancer cases (120, 121) and additional
breast cancer susceptibility genes and syndromes likely only represent 10-15% of all
breast cancer cases (121). The remaining breast cancer cases not caused by
31
hereditary factors are termed sporadic, in which mutations arise after conception and
can be greatly influenced by lifestyle and environmental factors.
Breast Cancer-related Predisposition Syndromes
Li-Fraumeni syndrome. Li-Fraumeni syndrome (LFS) is rare autosomal dominant
syndrome that is associated with an increased risk for developing several types of
cancers (122). Breast cancer is just one of the many cancers reported in LFS patients;
other neoplasias include childhood soft tissue sarcomas, brain tumors, osteosarcomas,
leukemias and adrenocortical tumors (123). LFS is caused by germ-line mutations in
the tumor suppressor protein p53 (124). LFS patients have an almost 100% lifetime risk
of developing cancer, and roughly 50% of patients will develop a tumor by the age of 30
(125). Pre-menopausal breast cancer is highly associated with LFS, with an average
age of diagnosis of 36 years old (124). However, LFS breast cancer cases only make
up less than 1% of all cases (126).
Cowden’s syndrome. Cowden’s syndrome (CS) is a rare, autosomal dominant
cancer predisposition syndrome caused by mutations in the phosphatase and tensin
homolog (PTEN) (127). PTEN dephosphorylates phosphatidylinositol (3,4,5)-
triphosphate (PtdIns-(3,4,5)-P3), thus antagonizing oncogenic signaling through the
PI3K/AKT pathway, a critical regulator of many cell functions including glucose
metabolism, cell proliferation and survival (128, 129). PTEN is a tumor suppressor
gene, and is mutated at high frequency in a variety of somatic cancers (130). Cowden’s
syndrome is clinically characterized by the development of benign hamartomas of the
skin, breast, endometrial, brain and gastrointestinal tract (131). Women with CS have a
lifetime risk of developing invasive breast cancer around 25-50%, and an average age
of diagnosis between 38 and 46 years old (132, 133).
32
Peutz-Jeghers syndrome. Peutz-Jeghers Syndrome (PJS) is caused by
mutations in the STK/LKB1 gene (134). LKB1 protein is a serine/threonine kinase and
is known to associate with p53 and be involved in cell cycle arrest and epithelial cell
apoptosis (134). PJS is a rare autosomal dominant syndrome highly associated with
the development of hamaromatous polyps of the gastrointestinal tract (135). Patients
have a lifetime risk of malignant tumors of 37-93% by the average age of 47 (135) and
also may develop a variety of cancers including, breast, thyroid, colon, stomach,
pancreatic, lung, endometrial and benign ovarian tumors (136). Women with PJS have
an increased incidence rate of breast cancer that is between 29-50% by 65 years of age
(135).
Nijmegen breakage syndrome. Nijmegen breakage syndrome (NBS) is a rare
autosomal recessive chromosomal instability syndrome caused by mutations in NBS1, a
component of the MRN complex that is responsible for repairing DNA double-strand
breaks (62). If DNA DSBs are not repaired correctly genomic instability will result and
can lead to gene rearragements, chromosome translocations and eventually neoplasia.
NBS is clinically characterized by microcephaly, short stature, immunodeficiency and
predisposition to cancers, manly leukemias and lymphomas, and have a 40-50%
chance of developing a malignancy by 20 years old (137). The most common mutation
,657del5, is associated with a three-fold increased risk for breast cancer and a founder
effect has been identified in the Czech Republic, Poland, and Ukraine with a prevalence
of 1 in 177 (79).
Breast Cancer Susceptibility Genes
BRCA1 and BRCA2. Early epidemiological evidence indicated an acculumation
of families with multiple cases of breast and ovarian cancer (138, 139). This discovery
33
provided the driving force for the identification of the first breast cancer susceptibility
genes. In 1994, the first breast cancer associated gene (BRCA1) was cloned and
BRCA2 was quickly found a year later (140, 141). Different population carrier
frequencies of BRCA germ-line mutations have been reported to occur from 1 in 250-
860 women and founder mutations have been observed in different populations (142,
143). Specifically, BRCA mutations are present in 2% of Ashkenazi Jews and thus, this
group has been comprehensively studied (144). The penetrance of BRCA1 and BRCA2
mutations have been calculated to be 57% (95% CI, 47% to 66%) and 49% (95% CI,
40% to 57%) for breast cancer and 40% (95% CI, 35% to 46%) and 18% (95% CI, 13%
to 23%) for ovarian cancer (145).
Breast cancer has been divided into 5 subtypes based on microarray gene
expression profiles: normal-like, luminal A, luminal B, erbB2, and basal-like (146). Of
these subtypes, the basal-like breast tumors are associated with an earlier age at
diagnosis, high grade and overall poor prognosis (147). In addition, basal-like tumors
are largely triple negative for estrogen receptor (ER), progesterone receptor (PR) and
human epidermal growth factor receptor 2 (HER2), although the overlap is not uniform
(146-148). Because of the lack of targeted therapies, triple negative breast cancers are
difficult to treat. BRCA1 breast tumors display features consistent with the basal-like
phenotype and triple negative tumors, such as high proliferative capacity, metastasis,
poor prognosis, and expression profile (148, 149). It is believed that BRCA1
downregulation may be a fundamental step for establishing basal-like cancers, but
somatic mutations in sporadic basal-like cancers are rare (150, 151). LOH and
34
promoter hypermethylation leading to diminished BRCA1 expression occurs frequently
in sporadic breast cancers (150, 152).
BRCA1 has been implicated in many cellular processes such as cell cycle
checkpoint control, apoptosis, chromatin remodeling, protein ubiquitination, DNA
replication and DNA repair (153). Like ATM, BRCA1 protects genome integrity by
responding to DNA damage and stimulating DNA repair. Upon DNA DSBs, ATM
directly phosphorylates BRCA1 on serines 1423, 1457, and to a lesser extent 1387
(154). These phosphorylation events trigger different effects on cell cycle progression
and checkpoint control (84, 155). In a model proposed by Yang and Xia et al., BRCA1
plays a fundemental role in repairing DNA damage, however if unsuccessful, BRCA1 is
shuttled to other compartments of the cell where it initiates apoptosis. Contrary, if cells
survive with persistant DNA damage this will result in genomic instability and perhaps
cancer initiation (153).
Chek2 (1100delC). In 2007, cell cycle checkpoint kinase 2 (Chk2) was confirmed
as a breast cancer susceptibility gene by a large prospective research study that
included over 9,000 people and 1,101 women with breast cancer (156). The mutation
found to associate with an increased breast cancer risk was 1100delC, which results in
the introduction of a pre-mature stop codon and total loss of function of kinase activity
(157). Chk2 is a downstream effector protein of ATM that mediates responses to DNA
damage, such as cell cycle arrest or apoptosis (85). Female heterozygous carriers
have a 2-3 fold increase in breast cancer risk, but carrier frequencies are relatively low
in Western countries (158).
35
BRIP1 and PALB2. Mutation in either, BRIP1 or PALB2 are known to cause
Fanconi anemia, a rare (incidence 1 in 350,000) autosomal recessive disorder in which
the most common defect is bone marrow failure and congenital abnormalities (159).
BRIP1 and PALB2 are involved in DNA DSB and associate with BRCA1 and BRCA2,
respectively (160, 161). Mutations in BRIP1 are estimated to increase breast cancer
risk by 2-fold, (162) whereas there is debate if PALB2 mutations are clearly associated
with an increased risk due to incomplete segregation in breast cancer families (163).
ATM and Breast Cancer Susceptibility
Epidemiological Evidence
Nearly 40% of ataxia-telangiectasia patients will develop a malignancy during their
lifetime, although leukemias and lymphomas primarily of T-cell origin dominate during
childhood, other cancer types such as ovarian, gastric, brain and liver have been
documented (9, 164, 165). The initial interest in studying cancer risk in A-T families first
began in 1966 when Reed et al. recognized and documented the occurrence of
malignant neoplasms in the family histories of 15 A-T patients [161]. Later in 1976,
Swift et al. thoroughly analyzed 27 families (1,639 individuals) of patients with A-T
(166). The patients resided in the United States, were not related to each other,
represented ancestry from Europe, Russia, Canada and the United States, and had
diverse socioeconomic backgrounds. The results indicated an increase in the number
of deaths from carcinomas and hematological malignancies among A-T relatives
providing evidence that ATM heterozygotes have an increased risk for cancer
development (166). This conclusion was further supported by the fact that in both living
and dead blood relatives of A-T patients, the presence of malignant neoplasms
increased with heightened probability of ATM heterozygosity. ATM heterozygotosity
36
was linked to leukemias and lymphomas, ovarian, biliary and gastric cancer and breast
cancer predisposition (166).
To further test a potential link between Atm heterozygosity and breast cancer,
Swift et al. performed a retrospective study on cancer incidence rates in direct relatives
of A-T patients in 110 white non-Amish A-T families (117). Completion of the study
indicated cancer incidence rates in these family members were significantly higher than
spouse controls and found the relative risk (RR) of cancer for ATM heterozygotes to be
2.3 for men and 3.1 for women (117). An increase in breast cancer was shown to be
clearly and significantly associated with ATM heterozygosity with a relative risk of 6.8
(p=0.006) (117). In these studies, relative risk is defined as the probablitity of an ATM
heterozygote developing breast cancer relative to the probability of developing breast
cancer in the general population.
Following this initial study, multiple epidemiological reports (167-172) have
confirmed the increased risk of breast cancer with RR values ranging from 1.8 to 6.4. A
meta-analysis of four previously published epidemiological studies was performed by
Easton et al. and estimated the overall RR to be 3.9 (173). A more modest increase in
overall RR of 2.23 (95% CI 1.16-4.28) was recently found in a large study of 1160
relatives of 169 A-T patients and 139 families in the UK (174). This study’s objective
was to provide more accurate estimates of cancer incidence in ATM heterozygous
mutation carriers. Included in this study were the majority of A-T patients diagnosed in
the UK, which represented the largest group of A-T families studied outside of the
United States (174).
37
The increased relative risk associated with breast cancer development in obligate
ATM heterozygotes is of considerable importance to health care given that roughly 1%
of the general population carries an ataxia-telangiectasia predisposing mutation (166).
This equates to an estimate of 8% of all breast cancer cases are attributable to ATM
mutations (117, 175). This estimation is higher than the two major breast cancer
susceptibility alleles, BRCA1 and BRCA2, each of which are linked to ~5% of breast
cancer cases (176).
Molecular Evidence
Once the ATM gene was identified as the mutated allele in ataxia-telangiectasia
(37, 38), focus shifted to screening breast cancer patients. ATM heterozygous
mutations should have an increased rate of occurrence in breast cancer patients
compared to controls, if the hypothesis concluded from the epidemiological evidence is
correct. Many case-control studies have provided inconclusive evidence concerning the
role ATM plays in breast cancer susceptibility. The first studies that screened ATM
mutations in breast cancer patients found no contribution associated with mutations in
the ATM gene (177-180). For example, in a study performed by Fitzgerald et al., germ-
line mutational analysis of ATM was screened in 401 early-onset breast cancer patients
and 202 controls, regardless of a family history of breast cancer (179). As the majority
of ATM mutations (90%) that result in ataxia-telangiectasia are premature protein
truncation mutations (109), the authors screened a large number of patients utilizing a
cDNA protein truncation test (PTT). Results of this study found chain-terminating
mutations in 2/401 (0.5%) breast cancer patients and 2/202 (1%) mutations in the
controls. Three ATM nonsense mutations and one 2-nucleotide deletion leading to a
frameshift mutation and no premature truncation mutations were detected. This study
38
concluded no correlation between ATM heterozygosity and sporadic breast cancer
occurrence (179).
The discrepancy between the early molecular and epidemiological results raised
new hypotheses to explain this contradiction. The most supported model states that
phenotypic differences or penetrance of different classes of ATM mutations account for
the failure to detect an increased frequency of ATM mutations in breast cancer cases
(181). Hence, ATM mutations that cause A-T (mostly protein truncations) are in
contrast to those mutations that predispose to breast cancer. Missense ATM mutations
might act in a dominant negative fashion, and result in more profound reduction of
protein activity compared to a single ATM protein truncation, which is assumed to retain
50% of wild-type ATM activity and have no phenotypic abnormalities (181). The method
of mutational screening chosen by Fitzgerald et al. did not detect missense or short in-
frame deletions or insertions that do not cause a frameshift mutation (170). Frequency
of missense mutations between the breast cancer cases and controls would be missed.
This explanation sheds light on the absence of ATM truncating mutations in breast
cancer cases, but does not reconcile the increased rate of breast cancer in obligate
female ATM heterozygotes (170).
Different degrees of clinical features, such as levels of neurodegeneration,
immunodeficiency, radiosensitivity and tumor development have been reported in A-T
patients (23, 182). In an attempt to determine that this may be due to the existence of
distinct mutations in the ATM gene, Stankovic et al. analyzed lymphoblastoid cell lines
derived from 78 A-T patients by RT-PCR using three different methods including
restriction-endonuclease fingerprinting (REF), heteroduplex analysis and PTT (183).
39
Fifty-nine different ATM mutations were identified, specifically 43 (71%) were thought to
result in protein truncation, 8 were in-frame deletions and 9 were missense mutations.
Of the missense mutations identified, a particular variant (7271T>G) was found in two
A-T families. This transversion mutation was predicted to produce a change from amino
acid valine to glycine in codon 2424. It segregated with A-T in both families and was
linked with a moderate clinical A-T phenotype and decreased radiosensitivity. Both
families with this mutation had a familial history of breast cancer and the calculated
relative risk associated with 7271T>G was 12.7 fold (95% CI 4-46) (183).
In addition, the variant IVS10-6T was found in 3 patients in a study of 82 Dutch
early onset breast cases that were exposed to low doses of ionizing radiation and it was
estimated to have a 9-fold increase in RR (184). Following the identification of
7271T>G and IVS10-6T, multiple studies have attempted to validate the increased risk
of breast cancer development. An Australian study screened 76 non-BRCA1/2 breast
cancer families and identified one family with the ATM 727T1>G variant and two
families with the IVS10-6T variant with estimated penetrance values of 55% (95% CI
26-88%) and 78% (95% CI=36-99%), respectively (185). However, other studies in
Holland, Germany and the Czech Republic have observed carrier frequencies of 0.6-
1.1% of IVS10-6T in controls with uncertain breast cancer family history, suggesting the
IVS10-6T variant is not a breast cancer predisposition variant (174, 186). Recently, a
study performed by Berstein et al., evaluated the associations of 7271T>G and IVS10-
6T gene variants in a large population based case control study of 3,743 cases and
1,268 controls (187). The 7271T>G variant was found in 7/3,743 cases and calculated
overall risk (OR) was determined to be 8.6 fold (95% CI 3.9-18.9) over the general
40
population which equals a lifetime penetrance of 52% (187). However, the frequency of
carrying this variant is very small for the general population, but may have a founder
effect in the United Kingdom and Scotland based upon the identification in carriers of
this origin. Despite some evidence linking the ATM IVS10-6T variant to breast cancer, it
was found in 13/3,757 cases and 10/1,268 controls (OR 0.44; 95% CI 0.19-1.00) and
was not associated with breast cancer development (187). Although this variant was
thought to produce abnormally spliced ATM transcripts with reduced kinase activity
(185), differences in splicing efficiency or stability of the mutant protein could affect
variability of protein function resulting in incomplete penetrance (187).
Additional ATM missense variants have been identified in breast cancer cases,
however, they have not been vigourously studied. For example, Thorstenson et al.
published the identification of the missense variant 1420L>F within 13 of 270 Austrian
hereditary breast and ovarian cancer families that was not detected in any of the
matched 421 controls (188). In seven of the families with 1420L>F, the lifetime relative
risk of developing breast cancer was almost completely penetrant (99%), despite an
extremely wide confidence interval (95% CI 25-100) (189). However, five of the families
that carried the 1420L>F variant also carried a BRCA1 mutation and the presence of the
1420L>F variant did not increase the overall risk attributable to BRCA1 (cumulative risk
to age 70 years, 59%; 95% CI, 5–100%) (189). ATM 1420L>F variant was previously
found in a moderate number of controls in three different studies (186, 190) with a
calculated average allele frequency to be 3.1%.
Clearly, there is contradicting data in regards to ATM missense variants and their
role in breast cancer development. The majority of the studies have been indeterminate
41
by two restrictions (170). First, the studies are usually limited by the number of cases
and second, most studies do not screen the full ATM gene. Screening the entire ATM
gene is essential in regards to missense variants because they are common to the
genome. The frequency of common variants found can be fairly compared in both
cases and controls, however, the absence of rare missense variants in controls
validates that it is rare, but does not unequivocally explain its role in cancer. Moreover,
variants may be linked to a particular phenotype rather than a breast cancer
susceptibility allele (170).
Finally, a comprehensive case-control study was performed that accounts for
difficulties suggested by Ahmed and Rahman et al. (191). Renwick et al. analyzed only
familial breast cancer cases that were negative for BRCA1 and BRCA2 mutations rather
than sporadic breast cancer, therefore enhancing the cases for other breast cancer
susceptibility alleles. Second, the authors fully screened all 62 exons and splice
junctions of the ATM gene allowing for direct comparison of mutation frequency
between cases and controls. Nine (2.04%) ATM mutations that cause premature
protein truncation or exon skipping were identified in 443 familial breast cancer cases.
All nine are predicted to cause ataxia-telangiectasia in the homozygous state and 7 of
them are reported in A-T patients. Two truncating mutations (0.4%) were identified in
controls, which is consistent with the population frequency estimation of heterozygous
carriers in the UK (174). Thirty-seven different missense variants were identified
including 7271T>G, otherwise 12 variants were found in controls and cases, 13 solely in
cases and 10 only in controls (191). Of these variants (S49C, F858L, P1054R, L1420F,
D1853N) there was no significant difference between frequencies of cases versus
42
controls. Combining ATM truncating, splicing, and missense mutations identified, and
integrating information from both cases and control pedigrees, the authors were able to
conclude the relative risk of breast cancer associated with ATM mutations to be 2.37
(95% CI 1.51-3.78, p=0.0003) (191). Surprisingly, ATM mutations were only slightly
higher in cases with a family history of breast cancer.
This data is consistent with previously documented epidemiological evidence in A-
T families, suggesting a relatively modest increase risk associated with mutations in the
ATM allele (171, 174, 192), specifically ATM mutations that are known to cause ataxia-
telangiectasia, moreover establishing ATM as an intermediate breast cancer
susceptibility gene.
ATM expression in sporadic breast cancer. Normal breast tissue is largely
composed of two epithelial cell types, the milk-producing cuboidal epithelium that lines
the alveoli, and the contractile myoepithelial cells that surround them (52, 193-195). By
immunohistochemical analysis, multiple studies have documented ATM protein
expression in both the cytoplasm and nucleus of the inner luminal epithelium and
relatively low levels of expression in the relatively quiescent myoepithelial cells (52, 194,
195). In contrast, ATM is expressed in both the epithelium and myoepithelim in benign
breast lesion in which extra tissue such as nodules or small cysts develop within the
lobules, termed sclerosing adenosis (52). This increase in expression of ATM is
thought to be a result of heightened proliferation of the myoepithelial cells (52).
The expression pattern of ATM in sporadic breast carcinomas has been
investigated using a variety of molecular techniques. Cytogenetic and molecular
genetic analyses of breast cancer cells have provided evidence for the accumulation of
43
increased genomic instability in the onset and progression of breast cancer (196).
According to the classical Knudson’s two-hit hypothesis, there are limited phenotypic
consequences in regards to cancer development until two alleles of a single tumor
suppressor gene are inactivated (197). One of the “hits” that often occurs in cancers
are frequent deletions in the genome that cause loss of heterozygosity (LOH) of a
specific tumor suppressor gene residing in that region. LOH ocurrs when there is
inactivation at a particular locus where a heterozygote mutation previously exists, and
thus causing a homozygote deletrious allele (197). In particular, it is estimated that
LOH occurs in breast cancer at a frequency between 20-60%, compared to a 5%
background level (198).
Cytogenetic studies have provided contradicting evidence for the loss of 11q in
breast cancer. In one study, cytogenetic analysis of a panel of 34 metastatic breast
tumors showed the most common chromosomal losses were 1p, 6q, 7 and 11q (199),
while another study that analyzed 28 primary breast tumor samples, alterations in 11q
were not common (200). To clarify this discrepancy, Hampton et al. analyzed 47
matched normal and tumor samples, of the tumors, 44 were invasive disease and 3
were benign (201). By analyzing 11q specific microsatellelite loci that covered from
11q14-qter, LOH was found in 19/44 (43%) of the malignant tumors and none of the
three benign tumors, suggesting loss of chromosome 11q is quite common in the late
stages of breast cancer progression. Also, 58% of the tumors had LOH specific to the
long arm of 11q and five of them indicated a potential map of putative tumor suppressor
genes residing between 11q22 and 11q23.3. This is in agreement with studies that
44
have also found a high frequency of LOH at 11q22-qter in ovarian cancer (202),
colorectal (203) and malignant melanoma (204).
Since this initial report documenting LOH in the region of 11q22 to 11q23.3,
Negrini et al. refined this region at 11q23 between microsatellite markers D11S2000
and D11S897 and D11S528 and D11S990 (205) and later Laake et al. suggested ATM
as a target for LOH in this region (206). Numerous studies have since reported LOH in
the region of ATM on chromosome 11q22-23, with an estimation of ~40% of sporadic
breast tumors with LOH (207-209). Also, LOH of ATM has been described to occur at
an early stage in breast cancer progression (210) and in lower grade tumors (207).
ATM protein synthesis patterns have been examined by immunohistochemical
analysis by a number of groups and all revealed reduced ATM protein expression in
sporadic breast carcinomas (194, 195, 207, 211, 212). The initial study conducted by
Kairouz et al. estimated diminished ATM protein expression in 24% and 33% of DCIS
and invasive breast cancer (IBC) lesions, respectively (195). Also, when compared to
primary carcinomas, a significant trend of reduced ATM expression was found in more
invasive disease, particularly 71% of cases with lymph node metastases (195). A high
percentage of IBCs (9/16) examined in another study (194) also showed reduced ATM
staining compared to normal breast epithelium, verifying weaker ATM expression in
more invasive cancer. But in this same study, 7/17 tumors exhibited moderate to high
levels of ATM protein and these seven tumors were considered high grade (194).
Clearly, there is some discrepancy in relation to aberrant ATM protein expression and
tumor grade in the latter study. Nonetheless, in a recent publication, Ding et al.
analyzed 74 sporadic early onset breast tumors for ATM, BRCA1 and p53 protein
45
expression by immunohistochemistry (207). Results indicated all three proteins had a
decrease in protein expression with increasing pathological grade (207). ATM protein
expression was reduced in approximately 30% of high-grade tumors while 25% and
15% for moderate and low grade, respectively (207).
To further understand the biological role of the DNA damage machinery in breast
tumors, Tommiska et al. compared the frequency of aberrant ATM protein expression in
BRCA1/2 and non-BRCA1/2 tumors (212). And secondly, the authors hypothesized
that abnormal ATM status may contribute to the responses of DNA-damaging adjuvant
therapies in the hard to treat ER/PR/ERBB2 triple-negative breast tumors (212). In the
first aim, 740 familial, 76 BRCA1/2 and 366 non-BRCA1/2 sporadic breast tumors were
analyzed for ATM protein expression. No difference in ATM expression was seen
between the familial and sporadic breast tumors; however, there was a clear
association (3 fold increase) of ATM aberrant cases among the BRCA1/2 cases
compared to the non-BRCA1 tumors (212). This is consistent with the concept of the
DNA damage response (DDR) acting as an antagonist to breast cancer development
(213). The second goal correlated ATM expression with ER/PR and ERBB2 status in
1106 non-BRCA1/2 tumors and found reduced ATM expression was significantly more
associated with ER negative (p= 0.0002), PR negative (p= 0.004), triple-negative (p=
0.0006) and of higher grade (p= 0.0004) tumors (212). p53 over-expression was also
extremely prevalent in the triple-negative tumors analyzed (212). This breakdown in the
DDR response, particularly in BRCA1/2 and triple-negative breast tumors, certainly
highlights a potential tumor suppressive role for the DDR response in breast cancer
(213). These alterations may rescue cell senescence or cell death and prepare the
46
nascent cancer cells for tumor progression at the expense of increased genomic
instability (213).
In addition to reduced ATM protein expression, diminished mRNA expression has
also been reported in sporadic breast carcinomas (214, 215). Waha et al. was the first
to analyze ATM mRNA expression in a panel of 39 breast carcinomas, 14 benign
lesions and 4 normal breast tissue samples (215). Among the 39 carcinomas, ATM
expression was found at normal levels in only 3 and was statistically significant
compared to the normal control samples (p= 0.0003) (215). Less than half (6/14) of the
benign lesions had low ATM mRNA expression (p=0.04) and highest ATM mRNA
transcript was found in the normal breast samples (215). Our group also confirmed
reduced ATM transcript in sporadic, locally advanced breast adenocarcinomas by
quantitative real-time analysis in 15 out of 23 tumors compared to cultured normal
mammary epithelium cells (HMECs) (214).
The precise cellular mechanisms that trigger altered ATM expression are poorly
understood. LOH accounts for a percentage of tumors with depleted ATM protein
expression, but LOH on chromosome 11q has been described in tumors with high levels
of ATM mRNA expression (215, 216) suggesting the possibility of an alternative
explanation for reduced ATM expression. To examine if somatic mutations in ATM
contribute to breast cancer tumorigenesis, Vorechovsky et al. analyzed the entire
coding region of the ATM gene in the tumor and blood of 38 patients with primary breast
cancer by single-strand conformation polymorphism (SSCP) (190). No somatic ATM
mutations were found in these patients (190). Later, these results were confirmed by
another study by analyzing 58 patients with primary breast ductal and lobular
47
carcinomas by DOVAM-S (Detection of virtually all mutations-SSCP) (217). Another
mechanism for reduced ATM protein expression could be epigenetic silencing due to
methylation of ATMs bidirectional promoter (218). However, this hypothesis was
discarded by multiple studies (219, 220). Both of the studies analyzed methylated
cytosines referred to as CpG dinucleotides by methylation-specific PCR (MSP) in 174
breast carcinomas that included IBC, BRCA1/2 positive and sporadic tumors. None of
the tumors displayed any ATM promoter hypermethylation indicating epigenetic
silencing is not an underlying mechanism for aberrant ATM protein expression in breast
tumors (219, 220).
Mus Musculus Mammary Gland Development
Female animals of the Class Mammalia are characterized by the presence of
specialized sweat glands to produce milk and these distinctive features of mammals are
termed mammary glands. Organogenesis of the mammary gland begins during
embryogenesis however; its development is unique because it occurs predominately
after birth in defined stages that are directly linked to sexual development and
reproduction (221). These stages are embryonic, postnatal (prepubertal and pubertal),
pregnancy, lactation and involution. Beginning in the early 1950s, brief descriptions of
mammary gland development were obtained from morphological studies in the mouse
and rat (222) and only after the development of genetically engineered mouse models
was the field able to understand spatial gene patterns and their precise regulation in
mammary gland development.
Embryonic
Mammary gland development during embryogenesis relies on crosstalk between
the epithelium and mesenchyme rather than systemic and hormonal cues (223). In the
48
mouse, five pairs of mammary glands are derived from the ventral surface and span the
region from the axilla (underarm) to the groin (193). Development begins approximately
on embryonic day 10 (E10) and is marked by two stripes of lateral surface ectoderm
termed the milk or mammary lines, that become multilayered and columnar compared to
the single layer of the surrounding epidermis (224, 225). Within 48 hrs, the mammary
line separates by ectodermal cell migration into distinct individual lens-shaped
thickenings or placodes, and marks the future site of gland development (226).
Continuing through embryogenesis, the mesenchymal cells surrounding the placodes
thicken and condense to form a dense mammary mesenchyme (227). Meanwhile, the
placodes invaginate the underlying dermis to form small mammary buds, which are
complete by E14 (224). The mature mammary bud is composed of epithelial cells
positioned radially and connected to the overlying epidermis by a stalk of epidermal-like
cells (228). The epithelial cells at the end of the bud proliferate and by E16.5 a primary
sprout is formed and grows downward through the dermal mesenchyme and towards
the underlying fat pad (224). The mammary fat pad arises from subcutaneous
mesenchymal cells on E14 and is primarily composed of adipocytes and interspersed
fibroblasts (229). Once the primary sprout reaches and penetrates the mammary fat
pad, it branches into an extremely rudimentary ductal tree with 10-15 initial branches
(230). This structure is present in the neonate and is connected to the nipple sheath by
the elongating duct (230).
Postnatal
At birth, the mammary gland consists of a primary ductal tree composed of
epithelial cells surrounded by a dense stroma of connective tissue, fibroblasts, and
adipose cells (193). During the prepubertal period, the primary ducts elongate into the
49
mammary fat pad at a rate corresponding to body growth (193). At this early stage of
development, the mammary fat pad is primarily composed of adipocytes, both
multilocular (brown, immature fat cells) and unilocular (mature, white fat cells) (231). At
the onset of puberty (3-6 weeks of age in the mouse) and guided by ovarian hormones
(ie estrogen), the mammary epithelial cells that make up the ducts begin to rapidily
proliferate and move deeper into the surrounding fat pad (193). Ductal enlongation is
driven by “bulbous” structures located at the end of the ducts termed, terminal end buds
(TEBs) (232). The TEBs are composed of multiple layers of epithelial cells termed cap
cells and body cells. Cap cells are pluripotent stem cells and compose the single outer
layer of the TEB, and the body cells reside in layers beneath the cap cells (233). As the
duct grows through the fat pad, the trailing cap cells differentiate into specialized
contractile epithelial cells termed myoepithelial cells (233). The myoepithelial cells
deposit the basement membrane composed of organized proteins, such as fibronectin,
laminin, type IV collagen and proteoglycans (234). The basement membrane not only
provides a barrier between the stroma and the epithelial cells but is also required to
provide maintence, support and polarity of the ducts (234). The underlying body cells
differentiate into the luminal mammary epithelial cells that line the duct (233). The body
cells furthest away from the tip of the growing duct undergo apoptosis to assist in the
formation of the hollow lumen (235). The TEBs bifurcate or split, to create secondary
and tertiary-branched epithelium that eventually reach the edge of the fat pad at which
point they regress and form terminal ducts (233). This process of TEB bifurcation is
complete by 10-12 weeks of age in the mouse.
50
In response to continued cyclic ovarian hormone secretion with each estrous
cycle, the ductal system becomes more complex with lateral branches forming off of the
secondary and tertiary ducts in a process distinct from TEB bifurcation (236). Lateral
branches can “sprout” new epithelium into the fat pad and are referred to as alveolar
buds and divide to form underdeveloped alveolar structures that will mature and
become the future site of milk production (237). These structures are termed alveoli
and have the form of a hollow cavity (236). The complete differentiation of alveolar
buds to alveoli occurs during pregnancy-induced growth of the mammary gland in a
process termed alveologenesis (237).
Pregnancy and Lactation
Mammary gland development during the initial stages of pregnancy is
characterized by a vast increase in ductal sidebranching and alveolar bud formation
(193). Alveologenesis begins during mid pregnancy when the alveolar buds begin to
differentiate into milk-producing lobules and resemble clusters of grapes when viewed
histologically (193). The majority of mammary gland differentiation occurs during days
18-21 of pregnancy and is referred to as the lobulo-alveolar phase of mammary growth
(238). The functional differentiation of the alveoli to milk producing lobules is termed
lactogenesis, and goes hand in hand with alveologenesis (238). The alveoli fill a
significant portion of the fat pad and begin to dilate by the increase in pressure
produced by the newly synthesized milk proteins and lipids (238). At this stage, the
stroma decreases and the myoepithelial cells no longer completely surround the alveoli,
but rather are arranged in a discontinuous fashion allowing the alveoli to come in
contact with adipose cells and the basement membrane (239). The contact with the
51
basement membrane is thought to be required for full differentiation and milk production
(239).
By partuition day 1, the expression of milk proteins increase, tight juctions between
the alveolar cells close and the gland begins to secrete milk and lipids. The luminal
epithelial cells undertake a variety of cell shapes that range from flat, pyramidal or
cuboidal. The milk and milk fat globules can easily be seen residing in the lumens, and
is pink/purple in H and E stained sections. However, the fat pad still is composed of
about 30% of adipocytes. As lactation continues, the stored trigylercides (one glycerol
molecule bonded to 3 fatty acids) residing in the adipocytes are quickly metabolized due
to the increase in metabolic demand of milk production. Lactation will continue for 21
days or until the pups are weaned.
Involution
After weaning the mammary gland undergoes extensive remodeling to return it to
its pre-pregnant non-lactating state, in a process termed involution. Involution is
characterized by massive apoptotic epithelial cell death that can be distinctly identified
by condensed chromatin and DNA fragmentation (240). Involution is initiated by milk
stasis due to the reduced demand for milk as the pups begin to wean (241). Involution
has mostly been studied after the forced weaning of pups (193), this allows the
remodeling process to occur in a more tightly regulated and measurable level compared
to natural weaning, which occurs more slowly. The pups are first standardized to an
appropriate number that allows for considerable milk demand and this number depends
on the litter size of the inbred mouse strain under investigation. The pups are allowed
to suckle for 8 full days, then are removed from the dam, and the mothers are sacrificed
on various days after pup removal (193).
52
Involution is reversible upon increased suckling within the first 24 hours after pup
removal and does not undergo any identifiable morphologic changes during this time
(242). However, if suckling is not reinitiated within 48hrs, the gland will begin to
irreversibly involute (242). Secretory epithelial cells begin to undergo cell-mediated
death and are shed into the alveolar lumens where they are cleared by neighboring
phagocytic epithelial cells and infiltrating macrophages (243). During days 2-3 of
involution, the alveolar epithelium begins to collapse into unorganized groups of
epithelial cells, while the multilocular adipocytes reappear into the mammary fat pad due
the decrease in metabolic activity and thus, the increase in triglyercide storage (193).
The ducts remain unaffected during reorganization, besides the increase thickening of
the surrounding stroma (193). The myoepithelium also seems to remain refractent to
apoptosis and remains well organized as a thin sheath over the involuting alveoli (244).
By day 6, nearly all the alveoli have collapsed and removed from the involuting gland
(244).
During this first phase, a number of pro-apoptotic genes are up-regulated while
pro-survival genes are down-regulated (245). Pro-apoptotic genes including p53 (246),
Tgfβ-3 (247), Igfbp-5, and transcription factors Stat3 (248), C/ebp (249) and Vitamin
D3 receptor (Vdr) (250) have all been implemented during the first phase. Transgenic
mouse models of these genes have lead to a delay of involution.
The basement membrane begins to remodel on day 3 of involution and is
characterized by the rapid increase in expression of proteases and the downregulation
of protease inhibitors (TIMPs) (251). The matrix metalloproteinases, stromelysin-1
(MMP3) and gelatinase-A (MMP2) (251) and carboxypeptidases E, XI and A3 (252) are
53
all expressed at this time and demonstrate the increase in tissue remodeling. The
balance between protease inhibitors and MMPs is critical for the initiation of mammary
gland involution (251). For example, TIMP-3 knockout and overexpression of MMP-3
transgenic mice induces premature involution (253, 254). Interleukin-1 beta converting
enzyme (Ice) (255) and urokinase-type plasminogen activator (Plat) (256) are also
necessary to this phase. By day 21, the mammary gland morphologically resembles a
more differentiated gland than a nulliparous mouse due to the continued presence of a
small number of disorganized alveoli (193).
Hormonal Regulation
Estrogen. Regarding the mouse mammary gland, puberty is evident by the quick
outgrowth of the ductal tree into the surrounding mammary fat pad. Puberty
commences in response to the increase in gonadotrophins secreted by the pituitary
gland, which causes secretion of the ovarian hormones, estrogen and progesterone
(257). Estrogen is the first mammogen to trigger pubertal related growth in the
mammary gland and is mediated by two receptors, termed ER and ER, both
expressed in the mammary gland (258). The binding of estrogen to its receptor causes
ER to translocate into the nucleus where it can bind to estrogen response elements
(EREs) in the promoter of estrogen responsive genes (259). Ovariectomies performed
in mice first documented the role of estrogen in mammary gland development, resulting
in ablation of ductal development (260), but which estrogen receptor subtype played a
role remained unknown until the develoment of ER knockout mice (ERKO) (67).
ERKO mice display runted ductal outgrowth (232, 261) while ERKO mice show no
signs of ductal dysregulation (262). ER double knockout mice display the same extent
54
of ductal dysregulation as ERKO mice (263). Specifically, ER expressed in epithelial
cells is essential for ductal outgrowth (232).
Progesterone. Progesterone acts by two isoforms of the progesterone receptor
(PR), PR-A and PR-B that are translated from one gene by two separate and distinct
initiation codons (264). PR-A is expressed 2:1 to PR-B (265), however PR-B is the
longer isoform having 128-165 additional amino acids at the N-terminus and possesses
transactivation function (266) To understand the specific role of the PRs in mammary
gland development, PR-A and PR-B knockout mice were generated and revealed that
the PR-B isoform was necessary for ductal sidebranching and alveolar development,
whereas deletion of PR-A did not effect mammary gland development (267).
Furthermore, to determine whether the stromal or epithelial localized PR was necessary
for development, Brisken et al. transplanted fat pads lacking the stromal PR into WT
recipients and these gave rise to normal alveolar structures, whereas transplants
lacking epithelial PR showed abnormal alveolar structures (266). Taken together, PR-B
acts in a paracrine fashion in mammary epithelial cells to induce ductal side branching
and alveolar bud formation.
Paracrine Signaling. Other signaling pathways have been discovered that
connect hormonal stimuli with locally produced molecules and play a functional role
during puberty to promote ductal morphogenesis and TEB formation. During puberty,
the surge of ER is also partly responsible for synergizing with growth hormone (GH) to
stimulate the mammary stroma to produce insulin-like growth factor-1 (IGF-1) (268,
269). In support of this, IGF-1 -/- mice and growth hormone receptor (GHR) -/- mice
have impaired ductal development during puberty. Treatment of IGF-1 -/- mice with
55
exogenous estrogen and GH did not restore ductal outgrowth; however, this phenotype
was rescued with the addition of IGF-1 and estrogen (268), demonstrating IGF-1 action
is downstream of GH. Also, administration of IGF-1 to these animals did not stimulate
development, thus, the requirement for synergistic actions between ER, GH and IGF-1
(268, 269). Richards et al. confirmed the local production of IGF-1 is necessary for
ductal outgrowth by utilizing mice with a liver-specific deletion of the IGF-1 gene. This
caused a reduction in overall IGF-1 serum levels, but IGF-1 transcript levels were
normal in the mammary gland and normal mammary gland development ensued (270).
Consistent with IGF-1 being a mediator of ductal morphogenesis, the IGF-1
receptor (IGF-1R) is also imperative to normal pubertal development (271). IGF-1R is a
receptor tyrosine kinase and is predominantly expressed in the TEBs during puberty
and ductal epithelium during pregnancy (272). Binding of IGF-1 to IGF1-R activates
PI3K signaling and phosphorylation of Akt (273), a potent oncogene involved in cell
growth and survival. Constitutive activation of IGF1-R in the mammary epithelium leads
to tumor development in the mouse (274) and human (275), making IGF1-R an
attractive therapuetic target (276).
In breast cancer, IGF1-R expression is highly correlated with ER+ breast tumors,
and studies using anti-estrogen therapies have suppressed IGF mediated growth and
proliferation. Furthermore, ER can upregulate IGF1-R expression providing stimulation
of IGF signaling. In vitro and in the absence of estrogen, IGF-1 can increase the
transcriptional activity of ER, therefore highlighting that the synergy between ER, IGF1
and IGF1-R is highly complex.
56
Epidermal growth factor receptor (EGFR) also is essential for pubertal mouse
mammary gland development. Amphiregulin, the major EGFR ligand, is regulated by
estrogen and is localized to the TEBs and ductal epithelium (277). Loss of amphiregulin
limits ductal outgrowth and implantation of amphiregulin pellets restores this pheotype
(277). Mammary fat pad transplantation experiments of EGFR -/- mice into wild type
stroma, and vice versa, demonstrated epithelial EGFR was not necessary for ductal
outgrowth, whereas stromal EGFR was required (278) .
Prolactin. The ovarian hormones, estrogen and progesterone, and other factors
set the stage for proper alveologenesis, however, it is the pituitary luteotropic hormone,
prolactin (Prl) that is the principal director of alveolar and lactogenic differentiation (279).
Prl -/- and Prl receptor (PrlR) -/- mice display retarded ductal sidebranching with
quiescent TEBs that contain fewer body cell layers compared to controls and a
complete lack of alveolar structures (280). Contrary, in mammary fat pad
transplantation experiments, epithelium lacking PrlR transplanted into cleared fat pads
of wild type mice, revealed a ductal tree capable of tertiary budding but was entirely
devoid of alveoli (281). This result is likely due to the lack of progesterone, whose
secretion is regulated by Prl (282). Furthermore, PrlR -/- mammary glands were
completely devoid of lipid droplets and secretions in the alveolar lumens, this was also
accompanied by lack of the milk protein -casein, an indicator of failed secretory
activation (281). Consistent with PrlR-/- glands, PrlR heterozygous mice show
restricted alveolar development and are unable to support their first litter (281). Prl and
PrlR mouse models clearly demonstrate the action of prolactin directly targets the
mammary epithelium for it to evolve into a well-differentiated full lactating gland.
57
How prolactin controls alveolar development is through a canonical signaling
mechanism involving Janus-kinase 2 (JAK2) (283) and Signal Transducers and
Activators of Transcription 5 (STAT5) (284) and is known as the JAK2/STAT5 pathway.
Secretion of prolactin is under the control of a negative feedback loop administered by a
dopamine response process that is induced by nervous stimulations during lactation,
such as suckling and the demand for milk (285). In response to these demands, Prl
binds to the PrlR thereby activating the PrlR and inducing its dimerization. The
activation of PrlR causes the tyrosine phosphorylation of Jak2 that is closely associated
with the cytoplasmic portion of the PrlR (286). Its activation quickly leads to the
reciprocal phosphorylation of tyrosine residues of the PrlR (287). Stat5 is recruited to
the PrlR and is also phosphorylated by Jak2 (288), this causes Stat5 to dimerize and
translocate into the nucleus where it leads to the transcription of genes involved in
alveologenesis and specifically the milk proteins, -casein and whey acidic protein
(289). Jak2 -/- and Stat5 -/- mice recapitulate the defects seen in PrlR -/- mammary
glands, again revealing that Prl signaling through this canonical pathway is essential for
alveolar morphogenesis and milk secretion (290, 291).
The PrlR/Jak2/Stat5 pathway is both positively and negatively regulated to keep
Prl signaling tightly controlled. Positive regulators include 1-integrin and the receptor
tyrosine kinase and epidermal growth factor, Erbb4 (Her4) (292, 293). Signaling from
the extracellular matrix (ECM) through 1-integrin was shown to be important in
maintaining Prl signaling by sustaining Stat5 activation (293). This was determined
after -lactoglobulin (BLG) and WAP-Cre mediated deletion of 1-integrin in mouse
mammary glands failed to lactate due to lack of lobulo-alveolar development and Stat5
58
phosphorylation (pStat5) (293). In Erbb4 -/- mice, pStat5 is diminished even though Prl
signaling remains intact, however in PrlR -/- mice, prolonged progesterone treatment
increased pStat5 but was unable to do so in Erbb4 -/- mice suggesting Erbb4 is
necessary for maintaining pStat5 during late pregnancy (292). The Erbb4
phosphorylation site on Stat5 (Ser-779) is separate from the regulatory phosphorylation
site by Prl (Tyr-694), and was shown to stabilize Erbb4/Stat5a interaction and
subsequently regulate gene expression by adding to Prl signaling (294).
Negative regulators of Prl signaling include members of the suppressors of
cytokine signaling family of proteins (SOCs) and the scaffold protein Caveolin-1 (295).
Socs1 and Socs2 attenuate Prl signaling by interfering with activation of Stat5 while
Socs3 binds to the transmembrane glycoprotein, gp130, a cytokine receptor that signals
through the Jak/Stat pathway (296). Stat3, a pro-apoptotic transcription factor, is a
downstream target of gp130 mediated signaling and critically mediates epithelial cell
apoptosis after weaning (297) during involution. However, activation of Stat5 is a
dominant survival signal and overrides pStat3 to protect against epithelial cell death
(248). Together, the Socs proteins function as key regulatory molecules controlling Prl
signaling and also play a key role during involution.
Caveolin-1 is a member of the Caveolin family of scaffolding proteins that is
downregulated during pregnancy and lactation and is hormonely regulated by Prl
signaling (298). Caveolin-1 over-expression in the mouse mammary cell line, HC11,
dramatically reduced Prl mediated -casein expression (298). Furthermore, Caveolin-1
deficient mice show accelerated mammary gland development beginning during
59
pregnancy as a result of constituitive activation of Jak/Stat pathway (295). Caveolin-1 is
thought to negatively regulate Prl signaling by binding and sequestering Jak2 (295).
Oxidative Stress
One of the physiological consequences of reproduction is the heightened rate of
metabolism during the peri-natal and post-natal periods, particulary through lactation
(299, 300). Lactating female mice increase food intake by 109%-133% (301). The
increase in energy demand during pregnancy and lactation has the potential to result in
and increase of oxidative metabolic intermediates and result in oxidative stress (302).
Oxygen consumption measured at the onset of lactation in rat mammary gland tissue
increases 4-10 fold (303). In lactating mice, developmental changes of the
mitochondria such as the density of the inner membrane and cytochrome c oxidase
activity increase during the transition from pregnancy to early lactation (304, 305).
These observations confirm higher rates of metabolism and the potential that the
mammary gland is exposed to increasing amounts of free radicals during lactation. An
increase in oxidative stress during pregnancy and lactation has been documented in the
liver and kidneys of rats (306) and in the plasma of cows (299). However, there has
been limited evaluation of whether the increased metabolic demand during pregnancy
and lactation heightens the levels of ROS and oxidative damage in the mammary
glands of mammals (302).
Hadsell et al. performed one of the limited studies of oxidative damage in the
mouse mammary gland, here the authors specifically examined oxidative damage in
mammary tissue during a prolonged lactation cycle (307). Their hypothesis stated that
the secretory alveolar epithelial cells were being exposed to free radicals resulting in
progressive oxidative damage that may lead to increased cellular aging and apoptosis.
60
Lactation was prolonged by introducing new seven-day old pups onto experimental
dams every 7 days starting on lactation day 14. Lactating mammary tissue was
resected at specific time points and mitochondria were isolated to test for mitochondrial
protein and DNA oxidation. First, mammary mitochondrial protein carbonyl content was
analyzed using an ELISA based assay on days 2, 8, 14, 21, 28 and 35 of lactation.
Results showed mitochondrial protein carbonyl content was relatively high during early
lactation (days 2, 8 and 14), but decreased to a low on day 21, only to increase to
higher levels on days 28 and 35. Overall there was a 5-fold change over the course of
prolonged lactation suggesting oxidative damage plays a role during lactation.
Furthermore, terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL)
assay, a method used to determine apoptotic cells, revealed a similar pattern
suggesting these two mechanisms are linked. In fact, mitochondrial oxidative damage
combined with decreased ATP levels have been proposed to initiate apoptosis (308,
309).
Changes in mitochondrial DNA oxidation were analyzed using competitive ELISA
for 8-hydroxy-2-deoxyguanine (8-oxodGuo), a product of oxidative damaged DNA by
the hydroxy radical, across the same series of lactation time points (307). The assay
revealed relatively low levels of 8-oxodGuo on lactation day 2 (1 M/g mtDNA), and
significantly increased throughout lactation, peaking at lactation day 14 (3.25 M/g
mtDNA) equating to roughly a three-fold increase. Analysis of days 21, 28 and 35
revealed a slight decrease in mitochondrial oxidation, but remained steady at two-fold
above lactation day 2. This data is in accord with the fact that mammary gland
proliferation and secretory activity dramatically increases during the first 14 days of
61
lactation and previous data stating developmental changes of the mitochondria occur
during the course of lactation (304, 305, 310). Furthermore, this is the first study to
directly reveal an increase in oxidative damage in the mouse mammary gland during
lactation.
In conclusion, ATM is a high-molecular weight protein kinase activated in response
to DNA damage and oxidative stress. ATM phosphorylates numerous substrates
fundamental in orchestrating proper response to genotoxic stress and maintaining
genomic stability. In both humans and mice, germline loss of ATM leads to a strong
predisposition to cancer development, specifically lymphoid tumors.
The first evidence that ATM may function in the suppression of breast cancer
came from epidemiologic studies on obligate heterozygotes and, to date, numerous
population-based studies have documented a higher risk of breast cancer development
in carriers of ATM mutations. While sporadic mutations in ATM are not common,
several labs, including ours, have documented reduced ATM expression in breast
tumors. These findings led many to propose ATM as a breast cancer risk factor;
however, this supposition has not been rigorously tested.
Furthermore, ATM and its role in mammary gland homeostasis has not been
directly examined. During mammary gland development, the growth of the mammary
gland is highly influenced by hormonal factors that also promote breast cancer.
Therefore, to better examine the role of ATM in mammary tumor suppression that would
avoid the shortcomings of current models, and determine the function of ATM in
mammary gland development, I have proposed to develop a mouse model that harbors
a conditional deletion of Atm within the mouse mammary epithelium.
62
CHAPTER 2 METHODS
Construction of the Mouse Line Containing a Floxed Atm Allele
Dr. Peter McKinnon (St. Jude Children’s Research Hospital, Memphis,
Tennessee) used standard gene targeting technology to develop a mouse line
harboring a “floxed” copy of the Atm allele. An Atm targeting construct consisting of a
HSV neomyocin resistant selection cassette flanked by loxP (locus of X-over P1)
(floxed) sites were transfected into C129 embryonic stem (ES) cells. Positive clones
that underwent homologous recombination were selected with G418 and recombinants
were screened by Southern blot. To induce partial Cre-mediated recombination,
positive ES cell clones were transiently transfected with the Cre-recombinase
expression vector, pMC-Cre, and clones were negatively selected with FIAU (1-(-2-
deoxy-2-fluoro-1-furanosyl)-5-iodouracil). Positive ES cells harboring the correct
orientation of the floxed Atm allele were microinjected into C57Bl/6 host blastocytes.
Chimeras were selected based on the agouti coat color and test bred to identify
germline transmission.
Generation of the Conditional Atm Mouse Line
A mating pair of heterozygous floxed Atm (Atmflox/+) mice in a mixed genetic
background [129SvEv X C57Bl/6] were sent to the University of Florida via Dr. Peter
McKinnon and maintained in a specific pathogen free environment in abidance of
University of Florida’s IACUC protocol. All pups were weaned at 21 days, genotyped
and segregated accordingly. The mice were crossed to generate homozygous floxed
Atm (Atmflox/flox) mice and F1 Atmflox/flox mice were repeatedly inbred to generate a
moderate cohort of female Atmflox/flox mice.
63
Transgenic mice harboring Cre recombinase under control of the whey-acidic
protein (WAP) promoter [B6.Cg-Tg(WAP-Cre)11738Mam strain#01XA8] were obtained
from the Mouse Models Human Cancer Consortium (MMHCC) (mouse.ncifcrf.gov). To
generate the Atm conditional knock out mouse line (Atm cKO), WAP-Cre mice were
bred with Atmflox/flox mice to transmit the WAP-Cre transgene. Atmflox/+ mice positive for
WAP-Cre (Atmflox/+;WAP-Cre) were backcrossed to obtain the genotype,
Atmflox/flox;WAP-Cre (Atm cKO).
Introducing a Floxed p53 Allele into the Atm cKO Mouse Line
To introduce a heterozygous floxed p53 allele in the Atm cKO background, p53
floxed mice were purchased from MMHCC [FVB.129-Trp53tm1Brn strain# 0X1C2] and
contained loxP sites inserted into intron 1 and 10 of the p53 gene (311). The mice were
crossed once to a C57Bl/6 mouse and the F1 generation were then mated to the Atm
cKO mouse line to generate the Atmflox/+;p53flox/+;WAP-Cre line. This line was
backcrossed to the Atm cKO mouse line to obtain mice harboring the homozygous
floxed Atm allele, a heterozygous floxed p53 allele, and the WAP-Cre transgene
(Atmflox/flox;p53flox/+;WAP-Cre). Mice with the genotype Atmflox/flox;p53+/+;WAP-Cre and
Atm+/+;p53flox/+;WAP-Cre were also generated.
Genotyping
Genotyping DNA was isolated from tail snips (0.5-1.0 cm) taken from 3-week old
pups and placed in tubes with buffer containing 100 mM NaCl, 20 mM Tris (pH 8.0), 25
mM EDTA (pH 8.0), 0.5% SDS, and 100 μg/mL of freshly added proteinase K (Sigma
Aldrich, St. Louis, MO). Tubes were incubated for 4 hrs or overnight at 50ºC. 0.5mL of
phenol-chloroform pH 7.6 (Fisher Scientific, Pittsburgh, PA) was added to each tube,
mixed, and centrifuged for 10 min at top speed. The clear aqueous phase was
64
transferred to new tubes supplemented with 100% ethanol, inverted a few times and
centrifuged for 5 min at top speed. The ethanol was removed from the tubes and 70%
ethanol was added, vortexed gently and centrifuged for a final time. The 70% ethanol
was removed and the DNA pellet was allowed to air dry. 50-200µL of dH2O or TE was
added to each tube and incubated at 50ºC until resuspended. Before PCR, the DNA
was vortexed and centrifuged for 5 min at top speed to pellet any insoluble material and
was diluted to a final concentration of 100 ng/µL.
A genomic PCR assay was developed by McKinnon to distinguish Atm
heterozygotes and Atm homozygous mice using primers P1 and P2 in Table 2-1 (also
see Figure 3-4). Mice heterozygous or homozygous were distinguished by the
difference in size of the PCR product.
RNA Isolation and Purification
RNA used for reverse-transcription (RT-PCR) and real-time PCR (Q-PCR) was
isolated from mammary tissue or NMuMG cells using TRI Reagent® (Ambion, Austin,
TX) with modifications. For mammary tissue, freshly dissected tissue was placed in
RNAlater® (Ambion, Austin, TX) storage stabilization solution and placed at -20ºC until
further use. The mammary tissue was removed and 1 mL of TRI Reagent® was added
to 5 mL falcon tubes for homogenization with Tissue Tearor (Biospec Products,
Bartlesville, OK) at 20,000 rpm. Lysates were stored at room temperature (RT) for up
15 min and were centrifuged at 12,000g for 10 min at 4ºC. The clear supernatant was
transferred to a new tube and supplemented with 0.2 mL of chloroform (Sigma Aldrich,
St. Louis, MO) and was vortexed for 15 sec. The mixture was stored at RT for 10-15
min and centrifuged at 12,000g for 15 min at 4ºC. The aqueous phase was transferred
to a fresh tube and 0.25 mL of isopropanol followed by 0.25 mL of high salt precipitation
65
solution (0.8M sodium citrate and 1.2M NaCl) was added and mixed. The resulting
mixture was stored at RT for 10 min and centrifuged at 12,000g for 8 min at 4ºC. The
supernatant was removed and the RNA pellet was washed with 75% ethanol and
centrifuged at 7,500g for 5 min at 25ºC. The ethanol was removed, the pellet allowed to
air dry and then resuspended in the appropriate amount of DEPC-treated water and
incubated at 50ºC. RNA concentrations were determined by NanoDrop
spectrophotometer (Thermo Scientific, Waltham, MA) at absorbance of 260 nm. Total
cell RNA from cell culture studies was isolated in a similar manner by omitting the first
centrifugation step.
Reverse-Transcription PCR
For RT-PCR and Q-PCR, 2 µg of total RNA was used to synthesize first strand
cDNA using the Go Script™ Revere Transcription System for RT-PCR (Promega,
Madison, WI) and the final product was diluted to 50 µL. For RT-PCR 1 µL of newly
synthesized cDNA was added to the following: 2.5 µL of 5x GoTaq® PCR buffer
(Promega, Madison, WI), 0.5 µL of 25 mM MgCl2, 0.5 µL of 10 mM dNTPs, 0.5 µL of
100 µM primers, 0.1 µL of GoTaq® (Promega, Madison, WI) and 7.9 µL dH2O to a total
of 20 µL. Thermocycling conditions for Atm and Gapdh were 95º 3’, (94º 45”: 60º 45”
72º 1’) for 34 and 30 cycles, respectively. The RT-PCR reactions were carried out in a
PTC-200 Peltier Thermal cycler (Bio Rad, Hercules, CA). RT-PCR products were ran
on 2% agarose gel supplemented with ethidum bromide and were photographed on a
GE Healthcare Image Quant 400 (Waukesha, WI).
Quantitative Real-Time Reverse-Transcription PCR
1 µL of the newly synthesized cDNA were added to the following in triplicate in a
48 or 96-well tray: 1.0 µL of 5 mM stocks of each forward and reverse gene specific
66
primer, 7.5 µL of SYBR Green master mix (Applied Biosytems, Norwalk, CT), and 6.5
µL water for a total volume of 15 µL. Primers for Keratin 18, a luminal epithelium
specific gene, and Gapdh were used as loading controls and the subsequent real-time
PCR was carried out in an Applied Biosystems StepOne and StepOnePlus Real-Time
PCR System (Applied Biosytems, Norwalk, CT). Crossing threshold (CT) values were
calculated with Step One™ software (Applied Biosystems, Norwalk, CT), defined as the
cycle number at which amplification crossed a designated threshold level within the
exponential amplification range of the samples. Normalized CT values (ΔCT) were
obtained by subtracting Keratin 18 or Gapdh CT values from the CT values of the
indicated genes. ΔΔCT values were obtained by subtracting the ΔCT value of the
control sample from the ΔCT value of the target sample for the indicated experiment.
Finally, fold induction values were defined as 2-ΔΔCT as per the ΔΔCT method (312).
Cloning of Atm Exon 58
Primers residing in Atm exon 57 and exon 59 were used to amplify Atm exon 58
(AtmRT3 Table 2-2) from cDNA from L1 Atmflox/flox and Atm cKO mice. The PCR
products were gel purified and cloned into pGem-T Easy Vector (Promega, Madison,
WI) using the suggested protocol. The plasmid was then sequenced using primers T7
and Sp6 at the University of Florida’s sequencing core located in the ICBR. The DNA
sequences were aligned and converted to amino acid sequence in Sequencer®
software (Gene Codes Corporation, Ann Arbor, MI).
Isolation and Preparation of Mammary Glands
At specific time points during mouse mammary gland development, Atmflox/flox and
Atm cKO females were euthanized with CO2 gas and subsequent cervical dislocation.
The inguinal mammary glands, located in the thoracic region of the mouse, were
67
surgically removed and fixed in freshly prepared 4% paraformaldehyde or 10% buffered
formalin (Fisher Scientific, Pittsburgh, PA) overnight. Tissues were then placed in 70%
ethanol, processed by a Milestone Histos 5 microwave histoprocessor (Thermo
Scientific, Waltham, MA), paraffin embedded using a Thermo Shandon Histocentre 3,
and sectioned onto Superfrost slides (Fisherbrand Pittsburgh, PA) by a Thermo Microm
HM325 (Waltham, MA). All sample processing was completed at the Cell and Tissue
Analysis Core (CTAC) at the University of Florida.
Immunohistochemical (IHC) Analysis
Mammary tissue was resected and fixed in 4% paraformaldehyde overnight. The
next day, tissue was placed in 70% ethanol, processed and sectioned. Sectioned
tissues were then deparaffinized in xylene (5 min x 2), 100% ethanol (2 min x 2), 95%
ethanol (3 min), 70% ethanol (1 min) and H2O (1 min x 2) and for anti-Atm (Millipore,
Billerica, MA) antigen retrieval was performed by treating the sections with proteinase K
(20 µg/mL) for 2 min at RT. Antigen retrieval for p-Stat5a (Tyr-694) and p-Stat3 (Tyr-
705) (Cell Signaling, Beverly, MA) and Igf1-R (Cell Signaling, Beverly, MA) was
performed in MCitra pH 6.0 in a steaming water bath (90º-100º). Slides were rinsed
with 1x Tris-Buffered Saline Tween-20 (TBST) and tissue staining was performed by
using VECTASTAIN® Elite ABC system (Vector Labs, Burlingame, CA). Briefly, to
quench endogenous peroxidase activity, slides were incubated for 30 min in 0.3% H2O2
in methanol, washed and incubated for 20 min with diluted normal blocking serum
prepared from the species in which the secondary antibody was made. After blocking,
slides were washed and incubated with primary antibody diluted in 1X TBST buffer at
4ºC overnight. The next day slides were washed and biotinylated secondary antibody
was added and incubated for 30 min at RT. After incubation, the slides were washed,
68
ABC reagent added, and incubated for 30 min at RT. The slides were then washed and
incubated with 3,3'-Diaminobenzidine (313) (Vector Labs, Burlingame, CA) until desired
staining intensity.
Histology and Whole Mount Analysis
Hematoxylin and eosin staining was performed in the CTAC on an automated slide
stainer (TissueTek). Slides were deparaffinized, rehydrated, and then placed in
hematoxylin for 4 min, washed with H2O, differentiated in 1% acidic alcohol for 30 sec,
washed, and dipped in bluing reagent (saturated lithium carbonate) for 30 sec. Slides
were then dipped in 95% ethanol, counterstained in eosin for 30 sec and dehydrated
through a series of ethanols, cleared in xylene, and cover slipped with a xylene based
mounting medium. H and E stained sections were imaged on a Leica DM6000B
microscope (Leica Microsystems, Buffalo Grove, IL).
For mammary whole mount analysis, thoracic mammary glands were resected,
spread thin onto nitrocellulose membrane, put into a labeled cassette and fixed in 10%
buffered formalin. The next day, cassettes were incubated in 3 changes of acetone
(Fisher Scientific Pittsburgh, PA) for 1 hr, and then the cassettes were immersed in
100% ethanol for 30 min, 95% ethanol for 30 min and stained using Mayer’s
Hematoxylin (Lillie’s Modification) (ScyTek Laboratories, Logan, Utah) overnight. The
cassettes were then rinsed with tap water until clear and destained in acidic 50%
ethanol (0.416 mL of 12N HCl per every 200 mL of 50% ethanol) for 3 changes at 1 hr
each. Subsequently, the cassettes were placed into 70%, 95% and 100% ethanol for
30 min each then placed in xylene overnight. Mammary whole mounts were removed
from the cassettes and stored in glass vials with methyl salicylate (Fisher Scientific
Pittsburgh, PA).
69
Pup Growth Curves
Average pup growth rates were determined by first standardizing both Atmflox/flox
and Atm cKO litter sizes to 6 pups per dam. This is necessary since alveolar
development and milk production is proportional to litter size. 6 pups were chosen due
to the small litter size of the C57Bl/6 inbred mouse strain. To determine starting weight,
pups were weighed on the day of birth (lactation day 0), culled to 6, and were weighed
daily until weaned or until specific lactation time points of mammary gland development.
Average pup weights were determined by dividing aggregate pup weights divided by the
number of pups.
Terminal Deoxynucleotidyl Transferase dUTP Nick End Labeling (TUNEL) Assay
To quantify apoptotic cells, TUNEL assay was performed according to the
manufacturers’ guidelines (Roche, Indianapolis, IN). Sectioned tissues were
deparaffinized (Xylene 5’ x 2, 100% 2’ x 2, 95% 3’, 70% 1’ and H2O 1’ x 2) and antigen
retrieval was performed by incubating slides in MCitra pH 6.0 in a 90°-100°C steaming
water bath. Slides were rinsed twice with 1x PBS and incubated with terminal
transferase for 60’ at 37º. After incubation, slides were rinsed twice with 1x PBS and
counterstained with DAPI (Vector Labs, Burlingame, CA). Slides were imaged on a
Leica DM6000B microscope (Leica Microsystems, Buffalo Grove, IL) with Openlab
software (Agilent Technologies, Santa Clara, CA). DAPI and TUNEL positive cells were
counted using ImageJ software (U.S. National Institute of Health). For each mammary
section micrographs of 6-8 randomly choosen fields were counted for both the number
of TUNEL positive cells and DAPI positive cells. A total of 4,000-5,000 DAPI postive
cells were counted and % of TUNEL positive cells were calculated by # TUNEL positive
cells divided by the number of DAPI positive cells.
70
GTC-phenol-chloroform Total RNA/DNA Isolation Method
RNA/DNA was isolated using the GTC-phenol chloroform method (314).
Mammary tissue was homogenized in 1 mL of 10 mM Deferoxamine Mesylate (DFOM)
(Sigma Aldrich, St. Louis, MO) in Chelex-treated 3 M GTC buffer (pH 7.5) containing
0.2% N-lauroylsarconsinate (Sigma Aldrich, St. Louis, MO), and 20 mM Tris (Fisher
Scientific, Pittsburgh, PA). The homogenate was transferred to 4x2 2.0 mL heavy PLG
tubes and centrifuged at 14,000g for 10 min. Then 1 mL of phenol chloroform:isoamyl
alcohol (25:24:1) pH 6.7 (Fisher Scientific, Pittsburgh, PA) was added to each tube and
vortexed immediately for 20 sec to avoid protein aggregation. During a period of 10 min
the samples were vortexed repeatedly to release nucleic acids and kept on ice. PLG
tubes were then centrifuged at 14,000g for 10 min at 4ºC to remove proteins and lipids.
The upper aqueous layer was transferred to a new clean PLG tube and an equal
amount of chloroform/isoamyl alcohol (24:1) (Fisher Scientific, Pittsburgh, PA) was
added. Tubes were hand-shaken multiple times and centrifuged again at 14,000g for 5
min at 4ºC. The upper phase was transferred to a new, eppendorf tube and an equal
amount of isopropanol was added, mixed and the samples were incubated overnight at
-80ºC. The next day samples were thawed on ice and centrigfuged at 10,000g for 10
min at 4ºC. The RNA/DNA pellet was washed by vortexing in 1 mL of 70% ethanol then
centrifuged at 5,000g for 5 min at 4ºC. The supernatant was discarded and the pellet
was dried at room temperature. For hydrolysis, DNase and RNase-free water
containing 30 µM DFOM was added to each tube and 10 µL of nuclease P1 (stock of
0.4U/µL in 300 mM sodium acetate, 0.2 mM ZnCl2, pH 5.3, frozen at -20ºC) was added
to each tube followed by the addition of 5 µL of alkaline phosphatase (1 U/µL, diluted
from 10 U/mL with 30 µM DFOM in water). The samples were then incubated in a water
71
bath at 50ºC for 1 hr. After hydrolysis, samples were filtered with Micropure-EZ filters
(Millipore, Billerica, MA) for 10-20 min at 14,000g at 0ºC and injected into the HPLC.
High Performance Liquid Chromatography-Electro Chemical Detection (HPLC-ECD)
HPLC-ECD analysis of 8-oxoGuo was carried out under a previous established
protocol provided by Dr. Christian Leeuwenburgh at the University of Florida,
Department of Aging (314). The HPLC-ECD system was composed of a Teflon mobile-
phase filter, ESA Model 582 pump (ESA Inc., Chelmsford, MA) set at 0.5mL/min, a
PEEK pulse damper (Scientific Instruments, State College, PA), a graphite filter (ESA),
a 48ºC model 542 autosampler (ESA) with a 100 mL PEEK loop and a thermostated
(358C) column over holding a C-18 guard column (Phenomenex, Torrance, CA), and
two Delta-Pak (150=3.9 mm i.d., 5 mm) C-18 reversed-phase columns (Water, Milford,
MA). Samples (G85 ml) were placed into snap-cap vials (SUN-Sri, Duluth, GA, USA),
from which 50 ml was injected (30-ml flush). 8-OxoGuo was detected with an
electrochemical detector (Coulochem III, ESA) with a PEEK filter-protected 5011A
analytical cell (ESA, 5 nA; screenelectrode, q205 mV; analytical electrode, q275 mV),
and Guo/dGuo were measured with a SpectraSYSTEM UV1000 detector (Thermo
Electron Corp., San Jose, CA, USA) set at 290 nm. Chromatograms were recorded
using EZChrome Elite (Scientific Software Inc., Pleasanton, CA, USA). The HPLC
buffer consisted of 9% v/v methanol and 50 mM sodium acetate set to pH 5.3 with
acetic acid filtered through a CN 0.2 mm filter (Nalgene Nunc, Rochchester, NY). The
analysis time was 30 min.
72
Ionizing Irradiation
Atmflox/flox;p53flox/+WAP-Cre, Atmflox/flox;p53+/+;WAP-Cre and Atm+/+;p53flox/+;WAP-
Cre mice were subjected to 5 Gy (500 Rad) of whole body irradiation from a CS137
source (GammaCell 40 Extractor, Ottawa, ON, Canada). Before irradiation, female
mice went through a round of pregnancy and pups were allowed to suckle for 4-6 days.
Pups were then removed and the dam was subjected to IR. Water was supplemented
with the antibiotic Baytril® (active ingredient enrofloxacin) (Bayer, Pittsburgh, PA), moist
food was provided ad libitum and cages were kept sanitary. Mice were examined daily
for the first 14 days after irradiation, then 3x a week for two months.
Cell Culture and Chemicals
MDA-MB-231 cells were purchased from ATCC (Manassas, VA) and NMuMG
mouse mammary epithelial cells (a kind gift from Dr. Brian Law, University of Florida)
were cultured with 1X Dulbecco’s Modified Essential Media with 4.5g/L glucose, L-
glutamine and sodium pyruvate, 10% Fetal Bovine Serum (Atlanta Biologicals,
Lawrencevill, Ga) and 1% penicillin-streptomycin (Mediatech, Inc., Manassas, VA).
H2O2 was purchased from Fisher Scientific and stock solution was prepared with H2O
and final concentrations used where indicated. ATM kinase inhibitor KU-55933 was
purchased from Chemdea (Ridgewood, NJ) and stock solutions were prepared with
DMSO and final concentration used was 20 µM.
RNA Interference (RNAi)
For RNAi mediated knockdown of mouse and human ATM, shRNA sequences
cloned into the lentiviral vector pGIPz were obtained from Open Biosystems (Huntsville,
AL. Clone V2LHS_89366 and clone V2LHS_192880 was used to target the mouse and
human ATM gene, respecitively. Lentivirus encoding shRNAs were packaged in HEK-
73
293FT cells (ATCC, Manassas, VA) following co-transfection with the packaging
plasmids psPAX2 and pMD2.G. Lentivirus containing medium and polybrene (10
µg/mL) were added to the cultures of NMuMG and MDA-MB-231 human breast cancer
cells, and selection with 2 µg/mL puromycin was conducted for approximately 2 weeks
prior to analysis.
Immunoblot
SDS-PAGE and immunoblotting was performed using established protocols (315).
Protein concentrations were then determined with a bicinchoninic acid (BCA) assay.
20-50 µg of total cellular protein were separated on a 10% SDS/polyacrylamide gel and
transferred to nitrocellulose membrane (GE Healthcare). The membrane was then
blocked for 1 hour with 5% Carnation instant non-fat dry milk powder dissolved in Tris-
Buffered Saline Tween-20 (TBST) at room temperature. The membrane was then
probed overnight with ATM (Millipore, Billerica, MA), Sod2 (Santa Cruz Biotechnology,
Santa Cruz, CA) or anti-tubulin (DM1A) antibody, which was the generous gift of Dr.
D.W. Cleveland (UCSD). Membranes were then washed three times with TBST,
incubated with a goat anti-rabbit horseradish peroxidase conjugated antibody for 1 h,
washed again, subjected to enzymatic chemiluminescence (GE Healthcare) developed
using chemiluminescence and exposed on autoradiographic film.
Cell Viability Assay
105 MDA-MB-231 cells and 105 NMuMG cells were plated in triplicate into 24-well
plates and allowed to adhere to the plate overnight. The next day, media was removed,
cells were rinsed with 1X PBS and new media was added and supplemented with the
indicated concentrations of H2O2 and 2 µg/mL puromycin (Fisher Scientific, Pittsburgh,
PA). After 24 or 48 hours, media was removed, rinsed with 1X PBS and new media
74
was added along with 1/10 volume of alamarBlue® reagent (AbDSerotec, Raleigh, NC).
Cells were incubated at 37ºC for 3-4 hours. For analysis, 100 µl of media was removed,
placed in triplicate into 96-well plates and fluorescence activity (excitation 560nm and
emission 580nm) was measured using a BMG Labtech FLUOstar Omega (Offenburg,
Germany).
Statistical Analysis
All graphs are plotted as the mean with error bars representing +/- SEM. A “*” is
used to denote p ≤ .05 as determined by a Student’s t-test. For Q-PCR analysis of
Atmflox/flox and Atm cKO mice, Atm cKO mice were compared to an Atmflox/flox mouse that
displayed the greatest deviation in expression compared to littermates.
75
Primers Sequence
P1 CCCAGTGTATATGCCACCGACTGAGTTACATCC P2 ACCACTCGAAGAACAACCGCTTCGC P3 GCCTGGTCTACATCCTGAGCTCCAGGACAGCC Atm exon 4 AGGAGCACCCAGGCTAAAAT CCTAGCCACTGTTGCTGAGAT WAP-Cre ACCAGCCAGCTATCAACTCGTTACA TTGGTCCAGCCACC p53 flox CACAAAAACAGGTTAAACCCAG AGCACATAGGAGGCAGAGAC
Table 2-1. List of genotyping primers
All sequences are listed in the 5’-> 3’ direction for each primer with the forward strand primer listed first followed by the reverse strand primer.
76
Table 2-2. List of mus musculus RT and Q-PCR primers
All sequences are listed in the 5’-> 3’ direction for each primer with the forward strand primer listed first followed by the reverse strand primer
Gene Sequence Product size (bp)
AtmRT1 GTCCATCGTCCACTGGTCTT AAAGGACTCATGGCACCAAC
103
AtmRT2 AGGCCAAATGATTTCAGTGC 190 TGCGTGTATATGCCAATCGT AtmRT3 ATGCAGCAGGTCTTCCAGAT 200 AACAGCTGGGTCCAAGAATTT Gapdh AACGACCCCTTCATTGAC 191 GTGCTGAGTATGTCGTGGA Krt18 GCTGGAGGATGGAGAAGATTT 158 CCTCCTTCTCTGCCTCAGTG Lalba CTTGAATGGGCCTGTGTTTT 167 GTCACAGGAGATGCCACAGA Csn2 CTACATTTACTGTATCCTCTGAGACTG 100 TGTCCCATGAGATTCACCTT Wap AACATTGGTGTTCCGAAAGC 178 AGGGTTATCACTGGCACTGG Bcl212 GGCGGAGYYCACAGCTCTAT 140 AAAAGGCCCCTACAGTTACCA
Cebp AAGCTGGTGGAGTTGTCGG 239
GTCCCAAAGAAACTAGCGATTC Mmp2 GGGAGCATGGAGATGGATAC 110 CAGCTCATCATCATCAAAGTGA Mmp3 GGACAAATACTGGAGGTTTGATG 158 TGCGAAGATCCACTGAAGAA
Tgf-3 GCACGGTGCTTGGACTATAC 112
GGGGTTCTGCCCACATAGTA Plin1 TGTCCACCCAGTTCACAGC 104 CAGAGGCGATCTTTTCTGGA Cat GGAGCAGGTGCTTTTGGATA 138 AGCTGAGCCTGACTCTCCAG Sod2 AACCCAAAGGAGCGTTGCTG 100 GAACCTTGGACTCCCACAGA Igf1-R ACAGCACCCAGAGCATGTA 122 GCATCCTTGGAGCATTTGAG
77
CHAPTER 3 ATM FUNCTION IN MAMMARY GLAND HOMEOSTASIS
Mammary Gland Development in Atm Mutant Mouse Models
A few studies suggest a potential role for Atm in mouse mammary gland
development (316, 317). Atm heterozygous, Brca1-deficient (Atm +/-;Brca1-MG-
ex11) mammary glands exhibit reduced ductal sidebraching at 7-weeks and had a
tendency for reduced alveolar development during late pregnancy (316). No defects
were observed during early pregnancy; however, during late pregnancy Atm +/-;Brca1-
MG-ex11 glands tended to have less dense alveolar structures. TUNEL assays
performed on 7-week old mice from all groups revealed no differences in apoptosis
(p=0.463), and immunohistochemical analysis of Ki-67, a nuclear protein bound to
condensed chromatin during mitosis and thus a cell proliferation marker, also showed
similar rates of proliferation (p=0.671) (316). Similarily, 20-30% of mice carrying a
mutation of an unique Atm phosphorylation site of Brca1 (S1152A) displayed a delay in
ductal and lobular formation in 2-month old virgin mice (317). However, by 4 months of
age no differences could be observed between S1152A and control mammary glands.
Cre-Mediated Recombination
Mouse models with tissue specific deletion of a target gene have been generated
in the past to overcome hurdles, such as the embryonic lethality seen in Brca1-/- mice
(318). To study the function of Brca1 in the mouse mammary development and
tumorigenesis, it was necessary to engineer mice that carry a conditional allele of Brca1
by using the Cre-loxP system (319). The Cre-loxP system is a powerful tool that
catalyzes site-specific DNA recombination in vivo to “knock-out” a gene of interest. Cre-
recombinase is a 38 kDa protein encoded by the bacteriophage P1, and catalyzes site-
78
specific DNA recombination between two repeats of a 34bp sequence termed loxP
(locus of X-over P1) sites (320, 321). The loxP site is composed of two 13bp inverted
repeats that flank an 8bp nonpalindromic sequence that gives the loxP its directionality
(321). When loxP sites are placed unidirectionally, Cre-recombinase excises the
intervening DNA into a covalently closed circle. If the loxP sites are placed in opposite
orientation, Cre-recombination will result in an inversion, rather than excision of the
DNA (321).
Cre-Mediated Gene Deletion in the Mammary Gland
Tissue specific deletion is achieved by crossing mice that contain loxP sites
unidirectionally flanking the target gene (termed floxed allele) to mice expressing Cre-
recombinase in the tissue of interest. There are two commonly used transgenic mouse
models carrying Cre-recombinase under the control of mammary tissue specific
promoters: The Mouse Mammary Tumor Virus Long Terminal Repeat (MMTV-LTR) and
Whey Acidic Protein (WAP) gene promoters (322). Functional analysis of the MMTV-
LTR mouse lines by using a ROSA26 LacZ reporter mouse revealed Cre expression
occurred in the ductal and alveolar cells of the mammary gland, albeit with some
variation (322). Consequently, Cre was also expressed in other secretory cell types
including skin, salivary gland, seminal vesicles and lymphoid cells (322, 323). This off-
site expression limits the use of the MMTV-Cre mouse line for conditional deletion of
Atm for two reasons. First, ATM is a prominent tumor suppressor in B and T cells
demonstrated by A-T patients and Atm-deficient mice. Secondly, deletion of Atm in
germ cells results in sterility (111). These shortcomings require for the use of an
alternative promoter driving Cre expression such as WAP. The WAP-Cre transgenic
mouse line is a milk protein, thus, is highly specific to the luminal epithelial cells of the
79
mammary gland. Limited Cre expression has been observed in the brain, but is not
detectable in B or T cells, or the germ-line of male and female mice (322). WAP-Cre
expression in the mammary gland is restricted to late pregnant and lactating dams (322,
323). Transgenic WAP-Cre expression is thought to precede the endogenous gene,
with expression beginning on pregnancy day 13 (P13), and increasing throughout
lactation and subsequent pregnancies (322, 324). This suggests WAP-Cre is also
expressed in mammary stem cells or lobulo-alveolar progenitor cells.
Here I outline the development of a mouse line with a conditional deletion of Atm
in the mouse mammary gland. A tissue-specific deletion of Atm has not been reported,
and this model is a novel tool to study a hypothesized role for Atm in mammary tumor
suppression and mammary gland development.
Results
Atm -/- Mammary Glands Have Developmental Defects
Atm -/- mice are viable and display high incidence rates of lymphoma (111).
Developmental defects have also been reported in Atm -/- mice and include, growth
retardation, immature B and T cells and abolished germ cell development, however,
mammary gland development has not been reported (9, 19, 111). To first address this,
ductal and alveolar bud development was examined by mammary gland whole mount
and histological analysis on mammary glands resected from 12-week old Atm -/- mice
and wild type littermates. Atm -/- mice are profoundly sterile (50), which limits their use
to study later stages of mammary gland development. Consistent with pubertal
mammary gland development, wildtype littermates displayed normal ductal
morphogenesis as demonstrated by secondary and tertiary ductal sidebranching (Figure
3-1A) and distinct alveolar bud formation (325) (Figure 3-1A inset). In contrast, Atm -/-
80
mammary glands exhibited severely blunted mammary gland development (Figure 3-
1B). Notably, there was a dramatic reduction in ductal sidebranching and complete lack
of alveolar bud formation (Figure 3-1B inset). Histological analysis also supported these
striking differences. Wild type littermates (Figure 3-2A) dysplayed more ductal
development (asterik) and alveolar buds (arrows) compared to Atm -/- mice (Figure 3-
2B). To examine whether there were structural abnormalities in ductal development, H
and E stained sections were analyzed at a higher magnification (Figure 3-2 C and D).
No differences were noted between genotypes, both had a layer of luminal epithelium
lining the ducts and a thick layer of dense stroma surrounding them. Although untested,
the incomplete development seen in 12-week virgin Atm -/- mice may be directly linked
to the lack of estrous cycling and ovarian dysregulation (50, 111). Nevertheless, these
abnormalities dismiss the use of Atm -/- mice for mammary gland developmental
studies.
Generation of the Atm cKO Mouse Line
In order to study a role for Atm in mammary gland function, in collaboration with
Dr. Peter McKInnon (St. Jude’s Research Hospital, Memphis, Tennessee), a mouse line
with a conditional deletion of the Atm gene (Atm cKO) in the mammary epithelium was
developed. A standard gene targeting approach was used to introduce loxP sites
flanking exon 58 of the Atm allele (Figure 3-3). After identifying founder mice and
verifying germline transmission, mice heterozygous for the floxed allele (Atmflox/+) were
mated to generate homozygous floxed mice (Atmflox/flox) using genotyping primers
designed to distinguish between wild type and floxed Atm alleles (Figure 3-4). Atmflox/flox
mice were subsequently bred with a transgenic line harboring Cre-recombinase under
the control of the whey-acidic protein (WAP) promoter generating the genotype,
81
Atmflox/+;Wap-Cre. These mice were then mated to each other to generate the genotype
Atmflox/flox;Wap-Cre and is termed the Atm cKO mouse line. Atmflox/flox and Atm cKO
mice were maintained in a mixed genetic background [C57Bl/6 X 129SvEv] and
Atmflox/flox mice were used as controls. Examples of genotyping Atmflox/flox and Atm cKO
mice can be found in Figure 3-5.
Characterization of WAP-Cre Mediated Deletion of Atm Exon 58
Transcription from the WAP promoter does not occur until pregnancy day 13,
persists through lactation and ceases as the mammary gland undergoes involution
(322). Therefore, to determine if WAP-Cre recombination results in excision of exon 58
in the mammary glands of uniparous Atm cKO mice, Atmflox/flox and Atm cKO mammary
glands were resected at lactation day 1 (L1) and 10-week old (virgin) mice. Genomic
DNA was isolated from mammary glands and PCR was conducted with PCR primers P1
and P3 that flank Atm exon 58 (Figure 3-3 and primers Table 2-1). Excision of Atm
exon 58 was only seen in Atm cKO L1 females and was almost at near completion
(Figure 3-6A). The residual full length Atm PCR product observed at L1 most likely
results from the existence of other cell types in the mammary gland, such as
myoepithelium, fibroblasts and lymphocytes or incomplete excision within the mammary
epithelium. No excision of Atm exon 58 was observed in uniparous Atmflox/flox mice and
in virgin Atm cKO mammary glands, consistent with WAP-Cre expression during mid-
pregnancy. Parallel assays were conducted on various tissue types to confirm
mammary gland specificity of the WAP-Cre promoter (Figure 3-6B). No excision of Atm
exon 58 was observed in the kidneys, lung, spleen or ovary of Atm cKO mice. Excision
of Atm exon 58 was observed in the brain of Atm cKO mice, albeit at very low levels
similar to what has been previously reported (322).
82
Next, to determine if loss of Atm exon 58 results in diminished Atm mRNA
expression, total RNA was harvested from the virgin and L1 Atmflox/flox and Atm cKO
mammary glands and was used in RT-PCR and Q-PCR reactions. To characterize
steady-state Atm mRNA expression, RT-PCR primers were designed (AtmRT1 Table 2-
1) to amplifly an exon residing upstream (exon 16) of Atm exon 58. No difference in
steady-state Atm mRNA transcript abundance was found at L1 in Atmflox/flox and Atm
cKO mice (Figure 3-7A). This data was also confirmed by Q-PCR as shown in Figure 3-
7B with both Gapdh and the luminal epithelial cell specilfic gene, Krt18, as internal
controls.
Next, in order to specifically determine if Atm exon58 transcript is expressed, RT-
PCR primer set was designed in which one primer resided in the exon-exon juction
between Atm exon 58 and Atm exon 59 (AtmRT2 Table 2-1). Q-PCR was conducted
on the same RNA used in Figure 3-7B and results are shown in Figure 3-8. Expression
levels of Atm exon58 in Atm cKO mammary glands were significantly reduced
compared to Atmflox/flox mice and results were consistent when both Gapdh and Krt18
were used as internal controls. This data combined with the results shown in Figure 3-7
suggest that there is diminished expression of Atm transcript that includes Atm exon 58,
but does not affect total Atm transcript expression. These findings indicate that mutant
Atm transcript is also expressed at normal levels.
Although Atm protein expression has been characterized in human breast
epithelium it has not been reported in the mouse. Therefore, to investigate the
localization of Atm protein expression, IHC was performed on a virgin Atmflox/flox mouse.
Mammary fat pads were resected, fixed, processed, sectioned and immunostained with
83
anti-Atm antibody and non-specfic rabbit IgG was used as a non-specific binding
control. Postitive Atm staining was found mostly in the nucleus of the ductal epithelium
and surrounding stroma and sparingly in the cytoplasm (Figure 3-9). This is consistent
with published reports of Atm staining in human mammary epithelium (53, 194, 195).
Next, to examine whether there is a reduction of Atm protein expression in Atm cKO
mice, mammary fat pads of Atmflox/flox and Atm cKO at L1 were resected and
immunostained. Figure 3-10 shows positive immunostaining in both the nucleus and
cytoplasm of Atmflox/flox mammary gland and a clear reduction of staining in the Atm cKO
mammary gland.
Previous reports have indicated truncated ATM protein is readily degraded (40,
49). To determine if excision of Atm exon 58 resulted in a frame-shift mutation within
the Atm transcript, RT-PCR primers (AtmRT3 Table 2-1) were designed within exons 57
and 59 and flanked Atm exon 58. RNA was extracted from the mammary glands of
Atmflox/flox and Atm cKO mice at L1 and cDNA was subsequently synthesized. cDNA
was then amplified using the AtmRT3 primer set and the PCR products were cloned
and sequenced. Aligning the sequences from both genotypes unexpectingly revealed
excision of Atm exon 58 does not result in a frame-shift mutation in the open reading
frame of the Atm protein (data not shown). However, further analysis determined
excision of Atm exon 58 deletes a highly conserved region of the PIKK catalytic domain
commonly deleted in A-T patients (326) and would thus be catalytically dead. The
previous Atm -/- mouse model generated by Dr. Peter McKinnon’s group used the neo
gene to interrupt exon 57 and replace exon 58 of Atm resulting in a similar deletion of
the catalytic domain (326).
84
Taken together, these experiments indicate that during their first pregnancy, Atm
cKO mice display WAP-Cre mediated recombination at Atm exon 58 and concomitantly
lose Atm expression.
Reduced Litter Weight of Atm cKO Dams
Following development of the Atm cKO mouse line, anecdotal evidence suggested
the litters of Atm cKO dams initially grew slower than litters of Atmflox/flox dams. To
examine this in greater detail, 5 mating pairs of Atm cKO and Atmflox/flox mice were
arranged and consistent with similar studies (327), average pup weights were recorded
daily to determine pup growth during the entire lactation period and up until weaning.
After birth litter weights were recorded and then culled to 6 pups per dam. Analysis of
growth curves revealed the majority (3/5) of Atm cKO litters had reduced average pup
weight (Figure 3-11) compared to Atmflox/flox litters. Between genotypes, pups were of
similar size at birth, however, differences in average pup weight were evident by L10
and low average pup weight of Atm cKO dams persisted through the later stages of
lactation. Total average daily weight gain was 0.423g and 0.341g for Atmflox/flox and Atm
cKO litters, respectively, and was not statistically significant. However, average daily
weight gain of affected Atm cKO litters (3/5 litters) revealed a reduction in pup weight
that was found to be significant (0.423g and 0.299g, p=0.013). Pup weights of Atm cKO
dams began to increase as pups neared weaning age. This may be due to the ability of
the pups to reach the chow in the cage and becoming less relient on the Atm cKO dam.
Figure 3-11B shows a larger panel of average pup weights from Atm cKO dams
compared to average pup weights from ten Atmflox/flox mice (red bar +/- SD). Combining
both data sets an estimated 10/22 (~45%) Atm cKO litters show a reduction in pup
weight.
85
Histological Analysis of Atm cKO Mammary Glands
In order to examine if reduced pup weight was attributable to a defect in the
mammary glands of Atm cKO dams, mammary glands of Atmflox/flox and Atm cKO mice
were resected at various timepoints during development. H and E staining was
performed on tissue sections from virgin, P16.5, L1, L5 and L10 mice and was analyzed
by Dr. Mary Reinhard, a lab animal pathologist at The University of Florida. Analysis of
H and E stained sections of virgin and P10 mammary glands of both genotypes
revealed normal mammary gland development consistent in young dams, such as an
abundance of adipose tissue and ducts (Figure 3-12 A and D). Alveoli are sparsely
distributed but quiescent. No changes in the mammary glands at P16.5 were found and
similar to virgin mammary glands, adipose tissue is abundant and alveoli are small and
non-reactive but more plentiful (Figure 3-12 B and E). At L1, adipose tissue is less
adundant than P16.5 due to the increase in alveolar cell proliferation at parturition.
Alveoli have become moderately distributed, dialated, increased in size and are
arranged in clusters. By L5, adipose tissue is very minimal and alveoli are dense, large
in size, extremely dialated and discrete lobules can be seen (Figure 3-12 C and F). Milk
secretions are clearly observed in the lumens. Clear histological differences are
observed at L10 between Atmflox/flox and Atm cKO mammary glands, specifically Atm
cKO glands 145 and 150 (Figure 3-13 D and E). Atmflox/flox mammary glands had
moderate to large alveoli and were dense and abundant, reactive and milk secretions
were seen in majority of alveolar and ductal lumens (Figure 3-13 A-C). Cells lining
alveoli were generally uniform high cuboidal to columnar with occasional multiple layers
that were actively proliferating. Contrastingly, Atm cKO dam 145 had small alveoli that
were unreactive and scattered throughout the mammary fat pad; no distinctive lobules
86
were observed (Figure 3-13D). No milk secretions are observed residing in the alveolar
lumens and the luminal epithelium also lacked the characteristic of blebbing, an
indicator of active lipid secretion (327). Instead, apoptotic cells are observed shedding
into the alveolar lumens, along with the infiltration of adipocytes in the fat pad. The
disruption of the epithelial cell integrity in Atm cKO dams 150 and 147 mammary glands
was less severe (Figure 3-13 E and F). Overall, alveoli were moderate in size and more
abundant, however, Atm dam 150 was unreactive with no active blebbing or milk
secretions, yet patchy activity of milk secretion, lipid synthesis and adipocyte infiltration
were observed in Atm cKO dam 147. Histological analysis of Atm cKO mammary glands
158 and 161 revealed normal tissue integrity compared to controls (Figure 3-13 G and
H). The luminal epithelial cells lining the alveoli of all Atmflox/flox and Atm cKO mice were
low to high cuboidal and generally in a single layer, signifying Atm-deficiency does not
interfere with cell-cell contact. Additionally, mammary gland whole-mount analysis was
performed on opposite abdominal mammary glands and revealed equivalent results
(data not shown).
Atm mRNA Expression in L10 Atm cKO Mammary Epithelium
In order to determine the cause of the incomplete penetrance seen in L10 Atm
cKO dams, Atm expression was analyzed by Q-PCR using the AtmRT2 primer set
(Table 2-2) in our panel of L10 Atmflox/flox and Atm cKO mammary glands. Atm
expression in Atmflox/flox mammary glands was consistent between mice (Figure 3-14
left) however; Atm cKO mammary glands displayed varying degrees of Atm mRNA
expression. Atm cKO dams 145 and 150 displayed the greatest diminishment (97%
and 90%, respectively), whereas, Atm cKO dams 158 and 161 showed only modest
reduction (45% and 38%, respectively) (Figure 3-14 right), although significant. Atm
87
cKO dam 147 exhibited similar Atm mRNA expression levels to Atmflox/flox mammary
glands. Atm expression levels correlate with the severity of mammary gland
dysregulation observed in Atm cKO mice and implicates the incomplete penetrance
phenotype is likely caused by deviant WAP-Cre mediated Atm excision.
Relative mRNA Expression Levels of Milk Proteins
Having established a reduction in pup litter weight and histologically abnormal
mammary gland structure in Atm cKO dams, we hypothesized this will directly cause a
defect in lactation. To address this, and the fact that the absence of milk could be a
consequence of tissue processing, milk production was examined by quantifying milk
protein gene expression by Q-PCR. The milk proteins α-lactoalbumin (Lalba), β-casein
(Csn2) and Whey-acidic protein (Wap) were analyzed in our panel of Atmflox/flox and Atm
cKO dams at L5 and L10. Results indicated there was no quantitative difference in milk
protein gene expression between Atmflox/flox and Atm cKO dams at L5 (Figure 3-15 (left)
and primers in Table 2-2). However, there was a clear decrease in relative milk protein
gene expression observed at L10 in 2/5 Atm cKO dams (Figure 3-15 (right) primers
Table 2-2), similar to the reduced litter weights of Atm cKO dams in Figure 3-11.
Specifically, Atm cKO dam 145 displayed neglible expression of all milk proteins
analyzed compared to Atmflox/flox mice at L10. Atm cKO dam 150 displayed an
approximate 3-fold reduction in Lalba gene expression when compared to Atmflox/flox
dams at L10 and neglible expression of the milk protein genes, Csn2 and Wap. Atm
cKO dam 147 displayed a statistically significant reduction in expression of Lalba, but
had normal expression levels of Csn2 and Wap. These results corroborate the partial
88
penetrance phenotype initially observed and suggest a defect in the secretory
maintenance of the mammary epithelium in affected Atm cKO dams.
Immunohistochemical Analysis of p-Stat5a
Stat5a is a downstream transcriptional regulator of prolactin signaling and is
essential for alveologenesis and milk secretion (284). Stat5a activation occurs through
phosphorylation of Tyr-694 by Jak2 causing it to dimerize and translocate to the nucleus
where it binds to GAS (gamma interferon activation site) elements in DNA. p-Stat5a is
known to directly regulate the expression of milk genes Csn2 and Wap. Therefore, it
was necessary to test p-Stat5a expression and localization by immunohistochemical
analysis. IHC was performed on tissue sections from Atmflox/flox and Atm cKO mammary
glands at L10. p-Stat5 expression was abundant in both Atmflox/flox and Atm cKO luminal
mammary epithelium, therefore, no changes in active Stat5a were found between
Atmflox/flox and Atm cKO mammary glands (Figure 3-16). This result indicates the
reduction of milk protein gene expression seen in Atm cKO mice is independent of
Prl/Jak/Stat signaling.
Quantifying Apoptosis via TUNEL Staining
Histological examination of Atm cKO mammary glands revealed an increase
infiltration of adipocytes and condensed alveoli remenisent of histological characteristics
observed during mammary gland involution (252). A hallmark of mammary gland
involution is epithelial cell apoptosis. Apoptosis occurs at extremely low levels
throughout lactation and day 1 of involution to a considerable level at day 2 of involution
and reaching a peak at day 3 of involution (242-244). Thus, it was necessary to test
whether lactating Atm cKO mammary epithelium have increased rates of epithelial cell
apoptosis. TUNEL staining was performed on histological sections of Atmflox/flox and Atm
89
cKO mammary glands at L5 and L10 and on an Atmflox/flox mammary gland at day 3 of
involution (Inv D3) as a positive control. TUNEL-postitive cells were calculated as a
percentage of total cells (minimum of 4000 secretory epithelial cells) in 6-8 randomly
chosen fields. As expected, TUNEL-positive cells were absent in mammary glands of
postpartum L5 and L10 Atmflox/flox mice and overall Atm cKO mammary glands at L5 did
not have increased rates of apoptosis (Figure 3-17 left). In contrast, Atm cKO
mammary glands at L10 had a marked increase in TUNEL-positive cells (Figure 3-17
right). The apoptotic rate was 0.54%, 0.55% and 0.74% in Atm cKO dams 145, 150,
and 147, respectively. Apoptotic rates of Atm cKO 158 and 161 were comparable to
Atmflox/flox controls at L10. To better comprehend the apoptosis rates found in Atm cKO
mammary glands, only 1.5% of TUNEL-positive epithelial cells were scored on day 3 of
involution and represented the maximum level of apoptosis during involution in an
Atmflox/flox mammary gland. These data confirm that Atm cKO luminal epithelium
undergoes increased rates of apoptosis during lactation, suggesting a premature
activation of mammary gland involution.
Expression of Involution Markers in Atm cKO Mice
The mammary epithelium is maintained by pro-survival signals during lactation but
undergoes apoptosis during involution due to a decrease in cell survival signals and
increase in pro-apoptotic genes (241, 252). In order to determine if Atm cKO mammary
glands are undergoing precocious activation of involution, the relative expression levels
of genes that define the two distinct stages of mammary gland involution were
investigated. Involution-associated genes that define the first phase include Bcl212,
Cebpδ, and Tgfβ-3. Bcl212 is an antiapoptotic regulator in the Bcl2 family known to
90
regulate apoptosis via mitochrondrial membrane permeabilization (328) and is
downregulated by day 1 of involution (328). Cebpδ is a transcription factor upregulated
by day 1 of involution and induces expression of Igfbp5 (IGF-binding protein 5), a
protein that inhibits IGF-1 signaling, and inhibits expression of Cyclin D1 (327). Tgfβ-3
is a multifunctional cytokine known to play a role in many biological processes. In
mammary gland involution, Tgfβ-3 induces epithelial cell apoptosis and also plays a role
in immune cell infiltration (247). Tgfβ-3 expression peaks at day 2 of involution (328)
and is a downstream target of p-Stat3 (329). Relative expression of these genes was
examined in RNA extracted from our panel of Atmflox/flox and Atm cKO mammary glands
at L10. Figure 3-18A-C illustrate the relative expression levels of Bcl212, Cebpδ, and
Tgfβ-3, respectively. Consistent with the involution process, Bcl212 expression was
greatly downregulated in Atm cKO dams 145 and 150, whereas, Atm cKO dams 147
and 158 showed an approximate 2-fold reduction (Figure 3-18A). Atm cKO dams 145,
150 and 158 had upregulated expression of Cebpδ, while expression in Atm cKO dams
147 and 161 was comparable to controls (Figure 3-18B). Although not dramatic, Atm
cKO dams 145 and 158 showed significant differences in Tgfβ-3 expression (Figure 3-
18C). It was clear that changes in gene expression were highest in the Atm cKO mice
that displayed histological characteristics resembling involuting glands and had low Atm
expression. From these data we conclude that a process similar to the first phase of
involution is occurring in the lactating mammary glands of Atm cKO mice, albeit in a less
regulated manner.
Extracellular matrix remodeling and the reinfiltration of adipocytes into the
mammary fat pad characterize the second phase of involution (241, 252). Involution-
91
associated genes that define the second phase were analyzed in the same panel of
Atmflox/flox and Atm cKO dams. Genes examined were matrix metalloproteinase-2
(Mmp2) and 3 (Mmp3) also known as, gelatinase A and stromelysin-1, respectively, and
perilipin (Plin1). Matrix metalloproteinases break down the extracellular matrix to allow
stromal remodeling to occur (251). Perilipin acts as a protective coating on adipocytes
from lipases that breakdown triglycerides into glycerol and free fatty acids for
metabolism (330). Q-PCR results show Atm cKO dam 145 displayed aberrant induction
of all late involution genes (Figure 3-19A-C). Atm cKO dam 147 displayed modest
upregulation of Plin1 as compared to controls (Figure 3-19C). Although Atm cKO dam
150 displayed induction of many first phase involution genes, no second phase genes
were dysregulated (Figure 3-19A-C). Combined with the gene expression data for the
first phase of involution, the data suggests Atm cKO mammary glands undergo an
aberrant activation of involution during lactation, however the stage of involution varies
between Atm cKO mice.
Immunohistochemical Analysis of p-Stat3
During involution, induction of Stat3 phosphorylation occurs via interleukin-6 and
LIF (Luekemia inhibitory factor) through gp130, a cytokine receptor that signals through
the Jak/Stat pathway (297). p-Stat3 crictically mediates epithelial cell death and tissue
remodeling during mammary gland involution (297). To examine whether there is a
dysregulation of Stat3 activation, IHC was performed on tissue sections from Atmflox/flox
and Atm cKO mammary glands at L10. Figure 3-20 shows p-Stat3 immunostaining and
like p-Stat5a, no difference in staining was observed between between Atmflox/flox and
Atm cKO mammary glands. Figure 3-20 A and B show an absence of p-Stat3 staining
in Atmflox/flox and Atm cKO mammary glands although small ares of positive staining
92
could be found regardless of genotype (Figure 3-20 C and D). This data confirms the
involution process seen in lactating glands is independent of p-Stat3 and when
combined with p-Stat5a IHC, is not caused by a disruption in the balance of p-Stat5a
and p-Stat3.
Oxidative Stress in Atm cKO Mammary Glands
ATM plays a critical role in activating cellular responses to oxidative stress
stemming from ROS (97, 99, 102) and recently it has been clearly documented that
ATM is activated by increased levels of oxidative stress (104). Initial studies in the
mouse mammary gland have indicated that lactating epithelium has heightened levels
of oxidative stress, therefore, it was hypothesized that the Atm cKO lactation defect
emanates from dysregulation of Atm-dependent protective mechanism to oxidative
stress. To test this hypothesis, the presence of oxidized guanine residues (8-oxoGuo)
was measured in RNA harvested from Atmflox/flox and Atm cKO mammary glands at L10
by electrochemical coupled-HPLC (314). Statistically significant increases in 8-oxoGuo
levels were detected in the mammary epithelium of Atm cKO dams 145 and 150
compared to controls and Atm high expressing Atm cKO glands (Atm cKO dams 147
and 158) (Figure 3-21). Atm cKO dam 145 showed a 5-fold increase in 8-oxoGuo
content compared to controls, while Atm cKO dam displayed a 1.5-fold increase. This
data indicates there is buildup of 8-oxoGuo within the lactating epithelium of Atm cKO
dams compared to control mice and Atm high expressing Atm cKO mice and supports a
role for an Atm dependent response to oxidative stress.
Sensitivity to Oxidative Stress in Atm Knockdown Mammary Epithelial Cells
Progessive nuerodegeneration is the most prominent clinical phenotype attributed
to A-T and it is widely believed this pathology stems from dysregulation of responses to
93
oxidative stress. However, a requirement for Atm in response to oxidative stress within
the mammary epithelium is unknown. Thus to test Atm in this regard, Atm expression
was knocked down by RNAi (shRNA lentiviral transduction) in cultured normal murine
mammary epithelium cells (NMuMG) (Figure 3-22A) and MDA-MB-231 human breast
tumor cells (Figure 3-23A). Both cell lines and vector control (VC) cells were treated
with the indicated doses of H2O2 and cell viability was determined after 24 and 48 hours
by alamar® blue assay. Atm knockdown NMuMG cells were rendered sensitive after
24hr treatment with 1.2mM of H2O2 (Figure 3-22B) and no sensitivity was found at lower
doses (1mM). However, enhanced sensitivity to 0.8 mM and 1.0 mM of H2O2 was found
after 48hrs (Figure 3-22C). Consistent results were observed with Atm knockdown
MDA-MB-231 cells. Increased sensitivity was distinguished after 24 hr treatment with 1
mM and 1.2 mM H2O2 (Figure 3-23B) and after 48 hr treatment with 0.6 mM and 0.8 mM
H2O2 (Figure 3-23C). These results coupled with increased levels of 8-oxoGuo in the
mammary epithelium suggest a buildup of oxidative stress within the mammary gland of
lactating Atm cKO dams resulting in a loss of viability within the mammary epithelium.
Antioxidant Gene Expression in Atm-knockdown NMuMG and Atm cKO Mammary Glands
Next, we sought to determine the reason for the sensitivity of Atm-deficient
mammary epithelium to oxidative stress. Antioxidants are the first line of defense
against reactive oxygen species. Mn-superoxide dismutase (Sod2) reduces superoxide
ion (-O2) to form hydrogen peroxide and is a nuclear encoded protein active within the
mitochondrial matrix (331). Catalase (Cat) is localized to peroxisomes and scavenges
hydrogen peroxide to form water and oxygen, and is extremely efficient due to its high
enzymatic activity (332). Therefore, gene expressions of the mouse orthologs were
94
assayed by Q-PCR in both Atm knockdown NMuMG cells and Atm cKO mice. Analysis
of Atm knockdown NMuMG cells indicated a drastic reduction in both catalase and
Sod2 expression as compared to vector control cells (Figure 3-24A). Immunoblot
confirmed reduced Sod2 expression in Atm knockdown NMuMG cells (Figure 3-24B).
Furthermore, analysis of Atm cKO mice revealed catalase and Sod2 expression was
significantly reduced in Atm cKO dam 145, whereas, Atm cKO dam 150 displayed only
a significant reduction in Sod2 (Figures 3-24 C and D). These preliminary findings
suggest an Atm-dependent mechanism for Sod2 expression and perhaps shed light on
the mechanism leading up to the build up of ROS in Atm cKO mammary glands.
Discussion
The goal of this study was to examine Atm function in the mouse mammary gland.
Histological analysis revealed a striking lack of structural mammary gland development
in 12-week Atm-/- female mice. Specifically, we noted a prominent reduction in ductal
tree and alveolar bud formation. This phenotype is likely attributable, at least in part, to
ovarian hormone hormonal dysregulation (eg, lack of estrogen and progesterone)
secondary to the defects in ovary development previously described in Atm-/- mice (50,
111). In support of this, ERKO mice display similar disruption of postnatal mammary
gland development and PR-B knockout mice exhibit dysregulated ductal sidebranching
and alveolar bud fomation (232, 267). Ductal outgrowth seen in Atm-/- mice is likely
attributable to the presence of growth hormone, a pituitary peptide hormone, during
postnatal development (269). In light of the lack of mammary gland development in
Atm-/- mice, it was necessary to develop a novel mouse model with conditional deletion
95
of Atm in the mammary epithelium (termed Atm cKO) to study a potential the role of this
protein in mammary gland function.
Atm deletion in the luminal epithelial cells was achieved by driving Cre expression
under the control of the WAP promoter and resulted in reduced Atm transcript and
protein expression, although quantitative reduction in Atm expression was measured in
only ~50% of the mice. Early in our work with this line, we observed that pups born of
Atm cKO dams often showed reduced rates of post parturition growth. As pup growth is
a sensitive marker for lactational performance (327), we consequently investigated
mammary gland function and structure in Atm cKO dams. We measured statistically
significant reduction in pup weight in 10/22 Atm cKO dams compared to Atmflox/flox
controls. This finding strongly suggests that Atm cKO dams possess a lactation defect,
albeit with a less than 100% incidence rate. The incomplete penetrance of this
phenotype appears to be reflective, at least in part, of heterogenous reduction in Atm
expression in the mammary glands of Atm cKO dams since mice that display sharper
reductions in Atm expression also show the most striking reduction in pup weight. This
inconsistency may be attributable to mosaic activation of WAP transgene expression
within individual mammary glands as well as between individual transgenic mice.
Patchy transgene expression has been documented in MMTV-Cre mice (322), and may
be a characteristic of the normal lactating mammary gland perhaps stemming from
variable milk consumption by the pups or local tissue regeneration (333). Furthermore,
WAP-Cre activity is more extensive during subsequent pregnancies and suggests
expression is possibly linked to mammary stem cells or lobulo-alveolar progenitor cells
(322). Although our data concerning potential lactation defects during subsequent
96
pregnancies is anecdotal in nature, we have observed that Atm cKO dams can display a
lactation defect during their second pregnancy and that this phenotype is likely
incompletely penetrant amongst multiparous females.
The lactation defect in Atm cKO dams is characterized by a reduction in litter
weight, reduced lobuloalveolar structure during lactation, and significantly diminished
expression of the milk protein genes -lactabumin, -casein, and whey acidic protein
(WAP). These data indicate no difference in litter weight between control and Atm cKO
dams up to lactation day 5. In agreement, mammary glands from pregnant and
immediately post-parturition Atm cKO females exhibit normal ductal tree branching,
alveolar development, and milk gene expression. However, the lactation defect was
evident in Atm cKO dams at lactation day 10 (L10), suggesting a progressive nature to
this phenotype. Although not as extensive, this phenotype is reminiscent of WAP-
deficient female mice (334). In this model beginning at lactation day 4, litters of these
dams survived poorly or had reduced body weight particularly during the second half of
lactation suggesting that the lactation phenotype in this model is progressive as well.
Histological examination of Atm cKO mammary glands at L10 revealed an overall
loss of structural integrity within the mammary gland. Consistent with reduced milk
protein gene expression, pink/purple staining indicative of milk protein and globule
secretion was conspicuously absent from the alveolar lumens of Atm cKO dams. The
luminal epithelium also lacked characteristic blebbing suggesting a lack of active lipid
secretion (327). Individual alveoli appeared irregular and fragile and showed signs of
regression, and a clear increase in the reinfiltration of adipocytes into the mammary fat
pad were evident. This structural dysregulation is suggestive of a premature activation
97
of involutive remodeling. In support of this, TUNEL analysis revealed increased
apoptosis within Atm cKO mammary glands compared to matched controls, and we
observed gene expression patterns consistent with premature entry into involution.
Similar phenotypes have been reported in a number of mouse models (253, 335-338).
For example, targeted disruption of the Prl/Jak/Stat5a signaling pathway (282, 291, 336,
338), which is fundamental for promoting mammary epithelial cell lactogenic
differentiation and survival, results in an accelerated onset of mammary gland involution
(282, 291, 336, 338). Similarly, conditional deletion of Socs-3, a negative regulator of
Stat3 phosphorylation/activation, results in premature Stat3 phosphorylation and
accelerated entry into involution (336). Of note, immunohistochemical analysis revealed
that the mammary epithelium of Atm cKO mice do not show dysregulated
phosphorylation of either phospho-Stat5a or Stat3. This indicates that the premature
activation of involution observed in Atm cKO mice occurs independently of the
Prl/Jak/Stat signaling axis. While the mechanism guiding precocious involution in Atm
cKO mice is currently undetermined, the triggering of the involution response in Atm
cKO may be in response to the reduced viability of the mammary epithelium within the
mammary gland of lactating females.
Similar to the phenotype observed in Atm cKO mice, conditional knockout of
Ephrin-B2 (339), E-cadherin (340) and α-catenin (341) within the mammary epithelium
resulted in severe impairment of milk protein gene expression and precocious activation
of apotosis during lactation. Each of these molecules are critical for the maintenance of
the integrity of the mammary epithelium by promoting cell-cell contact, cell polarity, and
the formation and integrity of adherens junctions (342). Moreover, the lactation
98
phenotype observed in these mice underscores the importance of maintaining structural
integrity within the epithelium for proper milk production. While disruption in mammary
gland structure is observed in Atm cKO mice, Atm has not been implicated as important
in epithelial cell or tissue structure; rather, it is well characterized as an upstream
activator of numerous signaling cascades during response to DNA damage (343).
Thus, we propose that within the lactating mammary gland, Atm is activating survival
signaling, required for homeostasis, stemming from stress occuring during lactation.
A prominent role for ATM in the activation of survival signaling was first
documented by the heightened radiosensitivity of A-T patients and A-T cells (23, 30,
344). Additionally, ATM has been implicated in protecting neurons from the
degenerative response that is activated in reaction to oxidative stress (92, 97, 98). As
several reports document oxidative stress within the mammary gland during both
pregnancy and lactation (299, 300, 306, 307), we hypothesized Atm could be required
to activate critical pro-survival signaling cascades in response to oxidative stress within
lactating mammary epithelium. In support of this notion, we measured high levels of
oxidized guanine residues (8-oxoG) within RNA harvested from L10 Atm cKO mammary
glands relative to controls. The observation that 8-oxoG levels were significantly lower
in controls clearly suggests that one of the functions of Atm within the mammary
epithelium is the activation of mechanism(s) that neutralize ROS in this cell type.
Overall, these results are consistent with a buildup of oxidative stress within the
mammary gland of lactating Atm cKO dams and that this insult results in a loss of
cellular viability within Atm-deficient mammary epithelium.
99
We observed that shRNA-mediated knockdown of ATM in either human breast
cancer cells (MDA-MB-231) or normal mouse mammary epithelial cells (NMuMG)
increase sensitivity to H2O2. These findings are consistent with the work of others
documenting that Atm -/- mice display bone marrow failure caused by elevated levels of
ROS affecting hemtopoietic stem cell viability (345). Moreover, supplementation of
these animals with antioxidants corrected this phenotype and others such as the tumor
latency (346), neurobehavioral effects and the constitutively active stress response
observed in A-T Purkinje cells and fibroblasts (94, 347). The nature of the ATM-
dependent mechanism(s) that promote cell survival in response to oxidative stress
remains unknown; however, in this study, we found expression of the antioxidant
enzymes Sod2 and catalase are significantly reduced in Atm-deficient mouse mammary
epithelial cells and mammary tissues from Atm cKO mice. These results clearly indicate
that both Sod2 and catalase are expressed in mammary epithelium through an Atm-
dependent mechanism. While this mechanism remains undetermined, loss of Sod2 and
catalase expression in Atm-deficient mammary epithelium likely contributes to the
sensitivity of this cell type to oxidative stress.
In sum, our work leads us to conclude that conditional deletion of Atm within the
mammary gland results in insufficient milk production. This phenotype is progressive
and is associated with decreased expression of several genes whose products are key
milk components. Analysis of lactating mammary glands indicates a general loss of
structural integrity and increased levels of apoptosis occurs within the lactating
epithelium of Atm cKO dams. Furthermore, we observe gene expression patterns
consistent with the premature activation of involution in Atm cKO glands; however, this
100
response is independent of the Prl/Jak/Stat signaling axis that normally controls entry
into involution. The loss of gland integrity and heightened apoptosis documented in the
lactating mammary gland of Atm cKO mice stems, at least in part, from supra-
physiological buildup of ROS within the lactating epithelium. Knockdown of Atm in
human or mouse mammary cell lines results in heightened sensitivity to H2O2,
supporting the notion that Atm functions in mammary epithelium by activating pro-
survival signaling. This pro-survival signaling activated by Atm promotes expression of
critical endogenous antioxidants required to maintain the viability of the mammary
epithelium and sustain lactation.
101
Figure 3-1. Whole mount analysis of mammary gland structure in Atm -/- mice.
Mammary fat pads were resected from 12-week old virgin wildtype (A) and Atm -/- mice (B). Shown are ductal tree sidebranching and alveolar bud development in the wild type gland. The Atm -/- gland shows a reduction in both primary and secondary ductal structure. Also shown is the centrally-located mammary lymph node. The inset is a higher power magnification, alveolar buds are plentiful in the wild type gland but the Atm -/- is largely devoid of alveolar buds.
102
Figure 3-2. Histological analysis of H and E stained mammary sections. Mammary fat
pads were resected from 12-week old virgin wildtype (A and C) and Atm -/- mice (B and D) and processed for H and E staining. Shown are low powered micrographs (A) depicting the presence of ducts (asterik) and alveolar buds (arrows) in the wildtype mammary gland. The Atm -/- gland (B) shows little ductal structure and a dramatic reduction in alveolar buds. Also seen are adipocytes occupying the mammary fat pads of both mice. Panels C and D are high power micrographs of wildtype and Atm -/- ducts. No structural differences are observed.
103
Figure 3-3. Gene targeting scheme used to introduce loxP sites flanking Atm exon 58.
A targeting construct consisting of a HSV-neo cassette flanked by two loxP sites and a third loxP site located downstream, was introduced into ES cells. ES cells were selected and recombinates were identified by Southern blot. Positive ES clones were then transfected with pMC-Cre and negatively selected with FIAU, clones containing the correct loxP orientation were microinjected into host blastocysts and chimeras were generated.
104
Figure 3-4. Location of loxP sites and genotyping primers within the Atm allele. LoxP
sites unidirectionally lie in the introns flanking Atm exon 58. Genotyping primers P1 and P2 were used to detect the floxed Atm allele. Genotyping primers P1 and P3 were used to to determine Cre-mediated recombination of Atm exon 58.
105
Figure 3-5. Genotyping of the Atm cKO mouse line. Genotyping PCR primers P1 and
P2 were used to distinguish between the floxed Atm allele and wildtype allele. The floxed Atm allele is a larger PCR product and thus retards in the gel. The WAP-Cre transgene was detected by WAP-Cre specific primers. Primer sequences are located in Table 2-1. PCR was conducted on genomic DNA harvested from tail snips and PCR products were run on 2% agarose electrophoresis gel
.
106
Figure 3-6. WAP-Cre mediated recombination results in Atm exon 58 excision. A)
Genomic DNA was harvested from mammary glands resected from virgin and L1 Atmflox/flox and Atm cKO mice. PCR was conducted with P1 and P3 primers that flank exon 58 of the Atm gene (top). Amplification of the recombined Atm allele can only be seen in the L1 Atm cKO gland. Amplification of Atm exon 4 was conducted as a control (bottom). B) Genomic DNA was harvested from respected organs of Atm cKO mice. PCR was conducted to verify WAP-cre specificity.
107
Figure 3-7. Total Atm mRNA expression in Atm cKO mice. A) RT-PCR with AtmRT1
primers (Table 2-2) was conducted on RNA extracted from Atmflox/flox and Atm cKO mice at virgin and L1 timepoints. No difference in Atm expression levels could be detected at either timepoint. Gapdh was used as an internal control. B) Q-PCR was conducted on Atmflox/flox and Atm cKO at L1 with the same primer set. Gapdh (left) and the luminal epithelial cell specific gene, Krt18, were used as internal controls.
108
Figure 3-8. Quantification of Atm exon 58 mRNA expression in Atm cKO mice. Q-
PCR was conducted on Atmflox/flox and Atm cKO at L1 with the AtmRT3 primer set (Table 2-2). Atm transcript expression that included exon 58 was greatly diminished. Gapdh (left) and the luminal epithelial cell specific gene, Krt18, were used as internal controls.
109
Figure 3-9. Immunohistochemical characterization of Atm protein expression in
Atmflox/flox mammary glands. Mammary fat pads were resected from 10-week Atmflox/flox mice. Mammary glands were fixed, processed, sectioned and stained with anti-Atm (Millipore) and non-specific IgG control. Following this, sections were incubabted with a biotinylated seconday antibody and developed with VECTASTAIN® Elite ABC system and DAB. Positive Atm immunostaining is detected notably in the nucleus of the ductal epithelium and stroma.
110
Figure 3-10. Immunohistochemical analysis of Atm protein expression in Atm cKO mammary glands. Mammary fat pads were resected from Atmflox/flox and Atm cKO mice at L1. Mammary glands were fixed, processed, sectioned and stained with anti-Atm (Millipore) and non-specific IgG control. Following this, sections were incubabted with a biotinylated seconday antibody and developed with VECTASTAIN® Elite ABC system and DAB. Positive Atm immunostaining is detected notably in the cytoplasm and nucleus of the alveolar epithelium in Atmflox/flox mammary gland, note the reduction of staining in Atm cKO mammary gland.
111
Figure 3-11. Reduced pup weight of Atm cKO dams. A) Average pup weight was
determined in 5 litters of Atmflox/flox and Atm cKO dams. 3/5 Atm cKO dams showed reduced average pup weight by L15. Red line represents the average of all five Atmflox/flox +/- SD. B) A larger panel of pup weights from Atm cKO dams were analyzed and showed reduced pup weights compared to 10 litters of Atmflox/flox dams (red line +/- SD)
112
Figure 3-12. Histological analysis of Atmflox/flox and Atm cKO mammary glands throughout mammary gland development. Mammary fat pads were resected from Atmflox/flox and Atm cKO mice at 10-week, P10, P16.5, L1, L5, and L10 and processed for H and E staining. There are no serious differences in mammary gland development between Atmflox/flox and Atm cKO mammary glands.
113
Figure 3-13. Histological analysis of Atmflox/flox and Atm cKO mammary glands at L10.
Mammary fat pads were resected from Atmflox/flox and Atm cKO mice and processed for H and E staining. Drastic differences in mammary gland structure are observed between Atmflox/flox mice and Atm cKO dams 145, 150 and 147. Atm cKO dam 145 shows dramatic dysregulation whereas Atm cKO dam 150 and 147 show loss of integrity but are less severe.
114
Figure 3-14. Relative Atm expression in Atm cKO dams at L10. Gene specific Q-PCR analysis was performed on RNA extracted from Atmflox/flox and Atm cKO mammary glands. Graph shows severly diminished Atm expression in 2/5 Atm cKO mammary glands at L10. Krt18 used as an internal control. Data points represent the RQ value (relative quantities) and RQ max and RQ min. *,** and *** indicate p≤0.05, p≤0.001 and p≤0.0001 respectively.
115
Figure 3-15. Relative milk protein gene expression in Atm cKO dams. Gene specific Q-
PCR analysis was performed on RNA extracted from Atmflox/flox and Atm cKO mammary glands at L10. Graphs represent mRNA levels of A) Lalba B) Csn2 and C) Wap milk proteins with Krt18 used as an internal control. Data points represent the RQ value (relative quantities) and RQ max and RQ min. ** and *** indicate p≤0.001and p≤0.0001 respectively.
116
Figure 3-15. Continued
117
Figure 3-15. Continued
118
Figure 3-16. Immunohistochemical analysis of p-Stat5 in Atmflox/flox and Atm cKO
mammary glands. Mammary fat pads were resected from Atmflox/flox and Atm cKO mice at L10. Mammary glands were fixed, processed, sectioned and stained with anti-p-Stat5 (Tyr-694). Following this, sections were incubated with a biotinylated seconday antibody and developed with VECTASTAIN® Elite ABC system and DAB. Positive p-Stat5 immunostaining is detected notably in the cytoplasm and nucleus of the alveolar epithelium in both Atmflox/flox and Atm cKO mammary gland. .
119
Figure 3-17. TUNEL analysis of Atmflox/flox and Atm cKO mammary glands. Atmflox/flox
and Atm cKO mammary glands were resected at L5 and L10, paraffin embedded, sectioned, incubated with terminal transferase and counterstained with DAPI. TUNEL positive cells were counted and are presented as percentage of cells/DAPI. *** indicates p≤0.0001 as compared to Atmflox/flox mouse that shows the highest TUNEL positive cells. Atmflox/flox mammary gland at involution day 3 was assayed as a positive control.
120
Figure 3-18. Relative expression of first-phase involution-associated genes in Atm cKO
dams. Gene specific Q-PCR analysis was performed on RNA extracted from Atmflox/flox and Atm cKO mammary glands at L10. Graphs represent mRNA
levels of A) Bcl212, B) Cebp, and C) Tgf-3 with Gapdh used as an internal control. Data points represent the RQ value (relative quantities) and RQ max and RQ min. * ,** and*** indicate p≤0.05, p≤0.001and p≤0.0001 respectively as compared to Atmflox/flox mouse that shows the highest gene expression.
121
Figure 3-19. Relative expression of second-phase involution-associated genes in Atm
cKO dams. Gene specific Q-PCR analysis was performed on RNA extracted from Atmflox/flox and Atm cKO mammary gland at L10. Graphs represent mRNA levels of A) Mmp2, B) Mmp3, and C) Plin1 with Gapdh used as an internal control. Data points represent the RQ value (relative quantities) and RQ max and RQ min. * ,** and*** indicate p≤0.05, p≤0.001and p≤0.0001 respectively as compared to an Atmflox/flox mouse that showed the highest gene expression.
122
Figure 3-20. Immunohistochemical analysis of p-Stat3 expression in Atmflox/flox and Atm cKO mammary glands. Mammary fat pads were resected from Atmflox/flox and Atm cKO mice at L10. Mammary glands were fixed, processed, sectioned and stained with anti-p-Stat3 (Tyr-705). Following this, sections were incubated with a biotinylated seconday antibody and developed with VECTASTAIN® Elite ABC system and DAB. A and B) Shown are micrographs indicating negative staining of p-Stat3 status in Atmflox/flox and Atm cKO mammary glands. C and D) Shown are micrographs depicting slight cytoplasmic staining in mammary sections regardless of the genotype.
123
Figure 3-21. Quantification of 8-oxoGuo in total RNA harvested from Atmflox/flox and Atm
cKO mammary glands. RNA was extracted from Atmflox/flox and Atm cKO mammary glands using the GTC-phenol chloroform method, hydrolyzed and injected into the HPLC. Graphed is the number of 8-oxoGuo per 106 Guo. *** indicates p≤0.0001.
124
Figure 3-22. Loss and inhibition of Atm in NMuMG cells results in increased sensitivity
to oxidative stress. A) Atm expression was analyzed by Q-PCR analysis in shRNA-mediated knockdown of NMuMG cells. B) NMuMG vector control and Atm knockdown cells were treated for 24hrs and C) 48hrs with the indicated doses of H2O2. D) H2O2 sensitiviy of NMuMG cells treated with +/- 20μM of the Atm inhibitor, KU55993. Sensitivity was quantified by alamarBlue® reagent. ** and *** indicate p≤0.001 and p≤0.0001.
125
Figure 3-22. Continued
126
Figure 3-23. Loss and inhibition of Atm in MDA-MB-231 cells results in increased
sensitivity to oxidative stress. A) Atm expression was analyzed by western blot in shRNA-mediated knockdown of MDA-MB-231 cells. B) MDA-MB-231 vector control and Atm knockdown cells were treated for 24hrs and C) 48hrs with the indicated doses of H2O2. Sensitivity was quantified by alamarBlue® reagent. ** and *** indicate p≤0.001 and p≤0.0001.
127
Figure 3-23. Continued
128
Figure 3-24. Atm is required for Catalase and Sod2 expression. A) Catalase and Sod2
expression were measured by Q-PCR in Atm knockdown NMuMG cells and vector controls. B) Immunoblot of Sod2 expression. C) Catalase and D) Sod2 expression assayed by Q-PCR in Atmflox/flox and Atm cKO mice at L10 with Krt18 used as an internal control. * and *** indicate p≤0.05 and p≤0.0001, respectively.
129
Figure 3-24. Continued
130
CHAPTER 4 ATM AND MAMMARY TUMOR SUPPRESSION
Mammary Tumor Development in Atm Heterozygous Mouse Models
Many epidemiological reports have suggested that ATM heterozygosity may
predispose individuals to breast cancer (117, 167, 170, 191). Low protein and mRNA
expression of ATM in breast carcinomas are also highly correlated with breast
tumorigenesis; however, missense mutations in ATM in sporadic breast cancer remains
controversial (217, 348). The Atm ΔSRI mouse model was the first to demonstrate a
role for ATM in the initiation of mammary tumor development in vivo, but the frequency
of mammary tumors arising in these mice was low (118). Since this initial study, various
mouse models have been developed to test Atm’s role in the development and severity
of mammary tumors.
In a study by Bowen et al., Atm heterozygosity did not affect mammary tumor
latency but increased the invasiveness and differentiation status in Brca1 conditional
knock-out mice under the MMTV-Cre promoter (Brca1-MG-ex11) (316). These mice
termed Atm +/-;Brca1-MG-ex11, were mated continuously and monitored for
mammary tumor development. Mammary tumor latency was between 9 and 26 months
in Atm +/-;Brca1-MG-ex11 and Atm+/+; Brca1-MG-ex11 mice (p>0.56). By the end
of 26 months, 43% (20/46) of Atm+/-; Brca1-MG-ex11 and 56% (28/50) Atm
+/+;Brca1-MG-ex11 developed mammary tumors.
Although Atm heterozygosity did not decrease latency or increase tumor burden of
Brca1-MG-ex11 mice, histological analysis of mammary tumors revealed a difference
in severity between Atm +/-;Brca1-MG-ex11 and Atm+/+; Brca1-MG-ex11 mice.
Tumors of Atm+/+; Brca1-MG-ex11 mice had variable differentiation states and tumor
131
types that included, but not limited to, adenocarcinomas, fibroadenomas, ductal
carcinomas, papillary carcinomas and anaplastic carcinomas (316). However, tumors
arising in Atm +/-;Brca1-MG-ex11 mice were all undifferentiated invasive anaplastic
carcinomas. LOH analysis of tumor DNA revealed that tumors arising in Atm +/-;Brca1-
MG-ex11 mice retained the Atm allele and phenotypic differences could be attributed
to Atm haploinsufficiency. Furthermore, western blot analysis revealed loss of ERα in
all tumors arising from Atm +/-;Brca1-MG-ex11 and 13/15 of Atm +/+; Brca1-MG-
ex11, similar to ERα expression status in Brca1-deficient mice (148). Together this
data supports a role for Atm in mammary tumorigenesis, perhaps by influencing the
severity of tumors.
In an attempt to distinguish if environmental factors, such as carcinogens
contribute to the increased risk of breast cancer seen in ATM heterozygous carriers,
Atm +/- and WT mice of FVBN/J genetic background were treated with the mammary
carcinogen, DMBA (7, 12-dimethylbenz()anthracene), and mammary tumor
development was analyzed (349). DMBA treatment began at 6 weeks of age by
delivering a dose of 1 mg once a week for five consecutive weeks. Mammary tumor
development was monitored by weekly palpation. Mammary tumor development in
DMBA-treated Atm +/- mice occurred almost twice as often compared to wild type mice
(65% vs. 38%) and had a significantly shorter latency period, specifically, 189 days
compared to 229 days (349). Relative risk for DMBA-induced mammary tumorigenesis
for Atm +/- mice was calculated to be 1.7.
ATM heterozygotes are reported to be at an increased risk of radiation-induced
breast cancer, however, this remains controversial (175, 350, 351). In an effort to clarify
132
the role of ATM in radiation-induced breast cancer, a murine model harboring one
defective copy of Atm was subjected to 1 Gy of irradiation and ductal dysplasia was
examined by a transplanting outgrowth assay (344). The outgrowth assay was
completed by transplanting post-irradiated (6 weeks) Atm +/- mammary fatpads into the
cleared fat pads of 3-week-old wild type recipients. After 10 weeks, the transplanted
mammary outgrowths were examined for ductal dysplasia. Dysplasia was found in
~10% of irradiated Atm +/- ductal outgrowths, whereas irradiated wild type glands did
not develop ductal dysplasia (344). This suggests Atm heterozygosity could be a
confounding variable contributing to irradiation-induced breast cancer, at least in a
murine model.
Increasing Mammary Tumorigenesis in the Mouse Mammary Gland
Mammary tumor development in mice is a relatively uncommon event. The
C57Bl/6 mouse strain has an estimated 1% lifetime risk of developing mammary tumors
(352). Due to the modest risk associated with Atm heterozygosity in the general
population and inconclusive results in previous Atm mammary tumor models, it is
necessary to raise mammary tumor development to observable levels in order to
effectively quantify the impact of Atm deficiency on mammary tumorigenesis. Similar to
previous studies, this can first be achieved by mating mice to a mammary tumor prone
mouse line (316, 353), and second, by increasing DNA damage by agents such as
ionizing radiation or carcinogens (349, 354, 355).
p53. The tumor suppressor protein, p53, is the most commonly mutated protein in
human cancer with mutations in approximately 50% of all cancers (57). In sporadic
breast cancer, the rate is also similar at 40-60% (356). Brca1 conditional knockout mice
develop mammary tumors at low penetrance and long latency (~20%) (319) compared
133
to women with a BRCA1 mutation (35-85%) (357). It was hypothesized that further
genetic changes may be necessary to drive mammary tumor formation in this mouse
model (319). Fluorescence in situ hybridization (FISH) and PCR suggested
rearrangement or loss of p53 played a role in Brca1 tumorigenesis, similar to BRCA1
familial breast cancer (358). To test this, a loss of function p53 allele was introduced
into Brca1 conditional knockout mice and mammary tumor development was monitored
over time (319). Mammary tumors were discovered in 8/11 mice (72%) and the
introduction of the mutant p53 allele caused a large reduction in tumor latency from 10-
13 months to 6-8 months. Analysis of these tumors also showed the loss of the wild-
type p53 allele in 4/5 mice. This data clearly demonstrates mutation of p53 influences
tumor latency and increases tumor development in mammary tumor prone mice.
Ionizing Radiation. Exposure to ionizing radiation (IR) has been shown by
numerous studies to increase the penetrance and decrease the latency of tumors in
mice (359, 360). DNA is the primary target for cellular damage from IR, in both an
indirect and direct fashion. IR directly damages DNA when alpha and beta particles or
x-rays create ions that physically break the sugar phosphate backbone or hydrogen
bonds (361). Indirect action occurs when x-rays create free radicals that can damage
DNA, leading to mutation, chromosome breakage, and cell death (361). The
tumorigenetic effects of IR can be clearly seen in mice carrying mutations in known
tumor suppressor or DNA damage and repair genes, such as p53 (354, 355).
In a study performed by Backlund et al, the influence of IR was examined on the
development of mammary tumors and genetic background in p53 heterozygous mice
(354). The genetic background of mice is also known to impact the spectrum of tumors
134
developed (362). For example, p53 -/- on a mixed (75% C57Bl/6 and 25% 129/Sv)
background were highly susceptible to spontaneous malignant thymic lymphomas,
whereas p53 -/- mice on a pure 129/Sv background developed a variety of tumors
including lymphoma, teratocarcinomas, adenocarcinoma and osteosarcoma (362). p53
+/- of BALB/c and DBA/2 genetic backgrounds were exposed to a single dose of 5 Gy
ionizing radiation and tumor development was monitored biweekly. Compared to the
unirradiated mice (363), morbidity and the median age of tumor latency decreased
considerably from 500 days to 207 days in BALB/c mice and 184 days in DBA/2 Mice
(354).
Umesako et al. also employed a tumor prone background and irradiation to
determine the effect of Atm heterozygosity on tumor development. A series of Atm +/-
and p53 +/- BALB/c x MSM/Ms mice were generated from crossing the mouse lines,
BALB/cHeA-p53 +/- and MSM/Ms-Atm +/- (355). Prior to this study, it was determined
that 55% of p53 heterozygous mice on a BALB/c genetic background developed
spontaneous mammary tumors in a mouse model of Li-Fraumeni syndrome (364). The
MSM/Ms inbred strain was derived in Japan from Mus musculus molossinus mice (365)
and has been reported to be resistant to the development of lymphoma (366).
Two cohorts of doubly heterozygous mice and controls (p53 +/- Atm +/-, p53 +/-
Atm +/+, p53 +/+ Atm +/- and p53 +/+ Atm +/+) were either subjected to 5 Gy of IR at 5
weeks of age or received no irradiation. The non-irradiated cohort was aged to 26
months, in which 50% (14/28) p53 +/- Atm +/- and 32% (7/22) p53 +/- Atm +/+ mice
spontaneously developed mammary tumors. Latency was similar for both genotypes,
most tumors developed between 41-77 weeks. Lymphomas and other tumor types
135
including ovarian carcinoma, hepatoma and osteosarcoma developed, although at low
frequency.
The irradiated cohort included 55 p53 +/- Atm +/-, 61 p53 +/- Atm +/+, 47 p53 +/+
Atm +/- and 53 p53 +/+ Atm +/+ mice for a total of 216 mice. 58% (32/55) of the p53 +/-
Atm +/- mice and 31% (19/61) of the p53 +/- Atm +/+ mice developed mammary
carcinomas after irradiation. In contrast, only one p53 +/+ Atm +/+ mice and none of the
p53 +/+ Atm +/- mice developed mammary tumors after irradiation, clearly
demonstrating p53 haploinsufficiency was necessary for mammary tumor development
in irradiated Atm +/- mice. Overall, mammary tumor latency was decreased from 41-77
weeks and 23-43 weeks for the non-irradiated group and irradiated group, respectively.
Also, mammary tumor incidence was similar between each genotype regardless of
irradiation status; however, mice heterozygous for Atm had a tendency to develop more
mammary tumors than p53 +/- alone.
In sum, this study shows that loss of p53 is a critical component of mammary
tumorigenesis in Atm heterozygous mice and Atm functions in mammary tumor
suppression in response to IR. Therefore, we initiated a similar approach to
accelerating tumor development in the Atm cKO mouse line by introducing a
heterozygous floxed p53 allele and subjecting them to 5 Gy of whole body irradiation.
Results
Mammary Tumor Development in Aged Atm cKO Mice
To determine the effect of Atm loss on mammary tumor incidence, a small colony
(7 mice each) of Atm cKO mice and Atmflox/flox were continually mated (5x) and were
monitored bimonthly for the development of papable mammary tumors. Reoccurrent
pregnancies are thought to increase WAP-Cre transgene expression in the mammary
136
gland (322). After aging multiparous Atmflox/flox and Atm cKO mice for 1.5-2 years, no
papable mammary tumors developed. One Atm cKO mouse was sacrificied due a
lymphoid tumor within a mammary lymph node. Although no papable mammary tumors
had developed, it was still probable that Atm cKO mice could display signs of epithelial
cell dysplasia within the mammary fat pad. Therefore, mammary fat pads of both
Atmflox/flox and Atm cKO mice were resected and processed for histological analysis.
Representative H and E stained sections of multiparous Atm cKO and Atmflox/flox
mammary glands are seen in Figure 4-1. No hyperplasia within the mammary ducts or
residual alveolar buds was found in both cohorts of multiparous aged mice. Figure 4-1
shows scant ductal and alveolar structures surrounded by a sea of adipocytes in the
mammary glands of aged Atmflox/flox and Atm cKO mice. Although disappointing, it is not
surprising that an absence of mammary tumor development or hyperplasia occurred in
the Atm cKO mouse line. Two possible explanations could account for the absence of
mammary tumors, first, mammary tumor development in the background mouse strain,
C57Bl/6, is very low at 1% (352). Second, and according to Renwick et al., the risk of
breast tumor development associated with the loss of Atm is relatively modest (191).
Therefore we chose to overcome this hurdle by introducing a floxed copy of the p53
allele into the Atm cKO background and subject them to 5 Gy of whole body irradiation.
We predict that each of these approaches will raise mammary tumor incidence to a level
where the effects of Atm loss can be quantified.
Generation of the Atmflox/flox;p53flox/+;WAP-Cre Mouse Line
Mice harboring a floxed copy of the p53 allele on the FVBN/J background were
ordered from MMHCC as a heterozygous breeding pair. These mice carry loxP sites
placed at intron 1 and intron 10 of the p53 locus (p53flox) (311). By crossing these mice
137
to a mouse line expressing Cre recombinase under the control of the WAP promoter
this will result in excision of exons 2-10 of the p53 locus within the mammary epithelium.
This mouse strain has been used to promote mammary tumor formation in Brca2
conditional knockout mice (311). Female p53flox/+ mice were mated to male Atm cKO
mice to obtain mice with the genotype Atmflox/+;p53flox/+;WAP-Cre. These mice were then
inbred to generate all of the experimental mouse lines, Atmflox/flox;p53flox/+;WAP-Cre,
Atmflox/flox;p53+/+WAP-Cre, and Atm control mice Atm+/+;p53flox/+:WAP-Cre (Figure 4-2).
A total of 15 mice were generated per cohort and were maintained in a mixed
[C57Bl/6;c129;FVBN/J] background.
Mammary Tumor Development in Irradiated Atmflox/flox;p53flox/+;WAP-Cre Mice
In an effort to raise mammary tumor incidence in Atm cKO mice to a measurable
level, Atmflox/flox;p53flox/+;WAP-Cre, Atmflox/flox;p53+/+WAP-Cre and Atm+/+;p53flox/+:WAP-
Cre mice were subjected to 5 Gy of whole body irradiation. The dams were mated and
allowed to give birth to one litter and pups were allowed to suckle for 4-6 days before
being removed from the cage. After pup removal, the dams were irradiated and placed
back in their cages and monitored biweekly for tumor development. Based on the study
by Umesako et al. the irradiatied p53 +/- Atm +/- cohort developed tumors between 23-
43 weeks, therefore we expected comparable mammary tumor latencies to occur in our
cohorts. However, only one papable mammary tumor was observed after 36 weeks,
and as a result, we began to sacrifice mice to examine for histological signs of
precancerous lesions within the mammary fat pad. After mammary fat pad resection, it
was evident that some mice developed IR-induced lymphomas. Specifically, lymphoma
development was observed in 2/15 Atmflox/flox;p53flox/+;WAP-Cre, 2/15
Atmflox/flox;p53+/+;WAP-Cre, and 1/15 Atm+/+;p53flox/+;WAP-Cre dams and was confirmed
138
via H and E staining and microscopic examination. These lymphomas were found in
the lymph nodes of the neck and mammary gland and were not believed to metastasize
to other tissues.
However, after microscopically analyzing mammary sections from all irradiated
cohorts, no additional mammary tumors and no signs of ductal hyperplasia were
detected (Figure 4-3). Rather, minimal ductal and residual alveolar structures were
observed, and adipocytes filled the majority of the mammary fat pad. Aged matched
unirradiated controls were not part of the experimental plan and, thus, it is unclear
whether this phenotype is attributable to irradiation, age or a combination of both.
However, similarities in ductal structure are observed when compared to aged
multiparous Atm cKO mice (Figure 4-1). The mammary tumor that developed initiated
in an Atm+/+;p53flox/+;WAP-Cre dam and pathological examination of this tumor is
currently underway by lab animal pathologist, Dr. Mary Reinhard at the University of
Florida. As a result, no association between Atm and mammary tumor development
could be calculated.
Discussion
Previous human epidemiological evidence has provided contradictory evidence for
the role of Atm in breast tumor development (179, 216, 367-369). Many studies have
reported heterozygous ATM mutations in obligate females have increased susceptibility
to breast cancer (117, 167, 168, 173, 184, 191). Additional studies analyzing ATM
germ-line mutation in panels of breast tumor samples have not supported this
hypothesis (179, 190, 369). Therefore, the objective of this study was to directly test
whether Atm-deficiency plays a role in mammary tumorigenesis and development by
using a novel Atm conditional knockout mouse line. Based on published accounts, we
139
expected to observe mammary tumor development in Atm cKO mice (118, 316, 355).
However, in our mouse line, no association was found between Atm-deficiency and
mammary tumorigenesis due to inadequate tumor development. No mammary tumors
developed in multiparous aged Atm cKO mice or controls and similar results were
observed in our tumor-prone Atmflox/flox;p53flox/+;WAP-Cre mice. Histological examination
of multiparous aged Atm cKO mammary glands revealed an absence of hyperplasia
and precancerous lesions. In the large cohort of irradiated mice, 0/15
Atmflox/flox;p53flox/+;WAP-Cre, 0/15 Atmflox/flox;p53+/+;WAP-Cre and 1/15
Atm+/+;p53flox/+;WAP-Cre mice developed a mammary tumor. These results do not
support a previous study (355), where irradiation and introduction of Atm
heterozygousity into the background of p53 +/- mice significantly increased the
incidence of mammary carcinomas.
It was not surprising that our small cohort of aged multiparous Atm cKO mice did
not develop mammary tumors. First, mammary tumorigenesis associated with Atm-
deficiency is modest (191), second, spontaneous mammary tumor development in mice
is a relatively uncommon event (~1%) (352) and lastly, a large population of mice is
needed to effectively calculate increased Relative Risk of mammary tumor development
of Atm cKO mice compared to controls. Therefore we chose to increase mammary
tumor incidence in the Atm cKO mouse line by introducing a floxed p53 allele and
subjecting them to 5 Gy of whole body irradiation. However, the exact reason(s) for the
absence of mammary tumor development in these mice is unclear. We believe the
most probable cause for the lack of tumor development is attributable to genetic strain
differences.
140
The three cohorts of irradiated mice were maintained on a mixed
C57Bl/6;129SvEv;FVBN/J genetic background. Although C57Bl/6 mice are the most
widely used inbred strain for transgenic studies, they are resistant to the development of
many tumors including, mammary, leukemia, and lung cancer (352). It is possible this
cancer resistant phenotype may have hampered the effects of radiation-induced
mammary tumors in our mouse line. Furthermore, C57Bl/6 mice are refractory to the
effects of irradiation as compared to other inbred strains such as BALB/c (370-372).
Ponnaiya et al. compared post-irradiated chromosomal aberrations of C57Bl/6 and
BALB/c primary mammary epithelial cells in culture (370). After the initial clearance of
chromosomal instabilities, chromosomal aberrations in C57Bl/6 epithelial cells were
similar to unirradiated controls, wheras aberrations in BALB/c mammary cells remained
elevated. Futhermore, the quantity of chromosomal aberrations observed in BALB/c
epithelial cells correlates with the human breast cell line MCF10A (373). This study
demonstrates there are clear genetic differences in radiation-induced chromosomal
instability between inbred strains of mice and perhaps corroborrates the lack of
mammary tumor development in our mouse line.
Recenlty, we began backcrossing our Atm cKO mouse line into the FVBN/J
genetic background. FVBN/J inbred mice are the primary mouse line used to study
mammary gland biology (193) and have been used in mammary tumor mouse models
(349, 374). FVBN/J mice were used to determine that Atm heterozygosity promotes
DMBA-induced mammary tumors (349) and the coordinated loss of Brca1 and p53
induce mammary tumors with features similar to human BRCA1 breast cancer (374).
Our Atm cKO mouse line will be backcrossed to FVBN/J mice for a total of 10
141
generations (99.9% pure). Atm cKO mice will later be crossed to FVBN/J p53flox/+ mice
from MMHCC to regenerate the Atmflox/flox;p53flox/+;WAP-Cre genotype.
In sum, this study could not determine an increase in Relative Risk in Atm-
deficient mammary epithelium. One papable mammary tumor developed in an
irradiated Atm +/+;p53flox/+;WAP-Cre mouse and no hyperplasia was found in any of the
cohorts regardless of genotype. Although our initial efforts failed to clarify Atms role in
mammary tumorigenesis, this continues to be a valuable question to elucidate. ATM
heterozygote mutations are found in 1% of the general population, and thus can
account for a large percentage of breast cancer cases. As the health care industry
establishes personalized medicine, it will be extremely important to identify individuals
at risk for the development of breast cancer given these patients will benefit the most
from risk reduction measures.
142
Figure 4-1. Histological analysis of mammary gland sections from aged multiparous Atmflox/flox and Atm cKO mice. Mammary fat pads were resected from aged Atmflox/flox (A and C) and Atm cKO (B and D) mice and processed for H and E staining. Shown are high-powered micrographs depicting the presence of ducts, remaining alveolar buds and adipocytes in Atmflox/flox and Atm cKO mammary glands. No mammary tumors or hyperplasia were found in either genotype.
143
Figure 4-2. Genotypes of irradiated mice. Atm cKO mice were mated to p53flox/+ mice
to generate experimental genotypes Atmflox/flox;p53flox/+;WAP-Cre, Atmflox/flox;p53+/+;WAP-Cre and the control genotype Atm+/+;p53flox/+;WAP-Cre. PCR was conducted on genomic DNA harvested from tail snips and PCR products were run on 2% agarose electrophoresis gel.
144
Figure 4-3. Histological analysis of mammary gland sections from irradiated mice. Mammary fat pads were resected from aged Atmflox/flox;p53flox/+;WAP-Cre (A and B), Atmflox/flox;p53+/+;WAP-Cre (C and D) and Atm+/+;p53flox/+;WAP-Cre (E and F) mice mice and processed for H and E staining. Shown are micrographs depicting the presence of ducts, remaining alveolar buds and adipocytes. No irradiation-induced hyperplasia is present.
145
CHAPTER 5 FUTURE DIRECTIONS
ATM is a non-essential gene, ATM homozygous deletion in humans and mice are
viable and development and homeostasis of most differentiated tissues is complete.
However, A-T patients and Atm -/- mice display immature development of T-
lymphocytes, thymus, gonads, and suffer from a premature aging phenotype (21, 111).
Previous studies have suggested a potential role for Atm in mouse mammary gland
ductal morphogenesis and alveolar bud formation (316, 317). Also, evidence gathered
in this study indicates Atm -/- mice show severely blunted pubertal mammary gland
development. Therefore, we studied the role of Atm during the various developmental
stages of this organ in a mouse line with a conditional deletion of Atm in the mammary
epithelium (termed Atm cKO). Using this novel mouse line, a progressive lactation
defect associated with severe disruption of mammary gland integrity at mid-lactation
was observed. This is significant because these observations are the first to recognize
a role for ATM in development and secretory maintanence of the mammary epithelium.
At the molecular level, this study documented that 8-oxoGuo levels are
significantly higher in affected Atm cKO mammary glands, an indication of accumulation
of reactive oxygen species (ROS), and suggest Atm is responsible for neutralizing
physiological levels of ROS is this cell type. In both cultured normal murine mammary
epithelum and Atm-deficient glands, this study documented that Atm is required for
steady-state expression of manganese superoxide dismutase (MnSOD; Sod2). These
studies are novel as they have addressed an unrecognized role for ATM in mammary
gland homeostasis and warrant the proper response to oxidative stress within the
lactating gland. Furthermore, oxidative stress is widely believed to be a contributing
146
factor to breast cancer development, and this study provides a clear link between
reduced Atm function and in the initiation of carcinogenesis of the breast.
The Glazer group reported Atm-dependent expression of Igf-1R in A-T fibroblasts
and found Igf-1R expression could be complimented by recombinant Atm expression
(375). Given that Igf-1R is critical for ductal morphogenesis and terminal end bud
formation within the mammary epithelium, it was necessary to determine if Atm
expression influences expression of Igf-1R in mouse mammary tissue (Appendix B).
Results indicate a clear reduction of Igf-1R baseline expression in Atm-deficient
mammary epithelial cells and Atm -/- mammary epithelium suggesting Atm-dependent
of Igf-1R expression in this cell type. These results are novel because this study was
the first to show that Atm is required for basal expression of Igf-1R in another cell type
besides fibroblasts. Furthermore, this data implicates a new biological role for Atm in
pubertal mammary gland development and suggests an alternative explanation for the
lack of ductal and alveolar development observed in Atm -/- mammary glands.
Hormonal Supplementation of Atm -/- Mice
In this study it was shown that loss of Atm leads to a disruption in mammary gland
ductal sidebranching and alveolar development, however, it is not clear whether this
phenotype is intrinsic to the mammary gland or due to disruption of ovarian hormones,
estrogen and progesterone. Ovarian development in Atm -/- mice has been described
as “highly degenerate” with no visible follicles or primary oocytes (50) and marked
decreases of serum and urine levels of estrogen were measured in Atm -/- mice (376).
Estrogen and progesterone are essential for ductal outgrowth and alveolar bud
formation (232, 281). To determine if Atm plays a systemic role in mammary gland
development Atm -/- mice will be hormonally supplemented with estrogen and
147
progesterone pellets. First, it will be essential to assay the level of progesterone in Atm
-/- mice to assure its absence. Once determined, female Atm -/- mice will be
anaesthetized and implanted subcutaneously with sterilized estrogen and progesterone
timed-release pellets. 60 days after surgery mice will be sacrificed, mammary glands
removed and processed for histological and molecular analyses. As controls, parallel
experiments can be conducted on Atm -/- females implanted with placebo pellets and
wild type littermates will be ovariectomized and estrogen/progesterone or sham pellets
implanted.
If mammary gland development is not fully restored by ovarian hormone
supplementation, then it can be concluded that estrogen/progesterone deficiencies are
not the only factors contributing to the lack of development in Atm-deficient mammary
glands.
Mammary Gland Development and Signaling in MMTV-Cre Atm cKO Mice
Our current Atm cKO line displays a partial-penetrant lactation defect. However,
Atm may also play an intrinsic role for pre-pregnancy mammary gland development. To
study development prior to pregnancy, a new conditional mouse line can be created that
will utilize MMTV-Cre to drive Atm deletion in the mouse mammary gland. MMTV-Cre
allows Atm-dependent mammary gland development to be examined prior to and
through puberty. Specifically, the D-line generated by the Henninghausen lab, express
Cre-recombinase within the mammary epithelium ~22 days post-partum (322). The
MMTV-Cre expression in this line occurs in salivary glands, lymphocytes and the
gonads of both sexes of mice, thus there may be off-site effects associated with Atm
loss.
148
Exongenous Antioxidant Administration to Atm cKO Mice
ATM plays a critical role in activating cellular response to oxidative stress
stemming from reactive oxygen species (ROS). We posit that the lactation defect
documented in Atm cKO mice stems from supra-physiological buildup of ROS that
ultimately triggers apoptosis in lactating mammary epithelium resulting in insufficient
milk production. To test the role that ROS plays in inducing this lactation defect,
antioxidants can be administerd to the Atm cKO mouse line during pregnancy and
lactation to determine if the phenotype is reversed. The antioxidant, TEMPOL, has
been administered to Atm -/- mice and was proved to increase both the lymphoma
latency and life span.
Atm-dependent Sod2 Expression in Mammary Epithelial Cells
In this study we observed both Atm knockdown mammary cells and Atm-deficient
mammary epithelium show significant diminishment in basal levels of Sod2 expression.
Previous studies in our lab have documented that Atm is required for basal expression
of NFκB and stress-associated upregulation of Sod2 is linked to NFκB. Therefore,
diminished expression of Sod2 in mammary epithelium could be attributable to to lost
activation of the Atm>NFκB signaling axis. To determine if Atm promotes NFκB activity,
NFκB transcriptional activity can be conducted in Atm +/+ and Atm-deficient mammary
cell lines by using transcriptional reporter assays and Sod2 expression can also be
analyzed by Q-PCR. Chromatin immunoprecipitation assays (ChIP) can also be
performed in human mammary/breast cancer cell lines to determine occupancy of RelA,
a key component of NFκB, on the Sod2 promoter.
149
New Strategy for Driving Mammary Tumorigenesis in the Atm cKO Mouse Line
In this study, no mammary tumors developed in either the aged multiparous or the
irradiated Atm cKO cohorts. This result could be caused by the mammary tumor
resistant phenotype of the C57Bl/6 mouse strain. Therefore, a new stragety must be
developed to drive mammary tumorigenesis in the Atm cKO mouse line. Currently, the
lab is backcrossing the Atm cKO mouse line into a new strain, termed FVBN/J.
Introducing a gain of function mutation or loss of a tumor suppressor gene known to
predispose to mammary tumors can also be implemented to increase the penetrance of
mammary tumors. For example, 50% of transgenic mice harboring activated rat Erbb2
oncogene under control of the mouse mammary tumor virus promoter (MMTV-Errb2)
mice develop multifocal mammary tumors between 6-12 months of age (377).
However, consideration needs to be considered when introducing strong oncogenic
gain of function mutations because the strong effects have the potential to conceal the
contributing effects of Atm.
150
APPENDIX A RADIATION EFFECTS
There are numerous studies reporting differences in sensitivity to whole body
irradiation in different strains of mice (378, 379). Effects of whole body irradiation in
mice include, graying of the hair, body weight loss, intestinal bleeding, infection and
lethality (380, 381). For example, C57Bl/6 mice are more resistant to irradiation,
whereas BABL/c mice are more sensitive (379). In this appendix, a pilot study was
conducted to determine if the planed IR dose (5 Gy) causes radiosensitivity in the
Atmflox/flox;p53flox/+;WAP-Cre mouse line.
Ten 10-week old mice that did not match our genotype of interest were subjected
to 5 Gy of whole body irradiation and were monitored daily for 14-days and then 3x a
week for two months. Access to water and moist food were provided ad libitum, cages
were kept sanitary and the antibiotic, Baytril®, was added to water bottles to prevent
bacterial infection. Body weights were measured before and every 3 days after
irradiation during the 2-month period. No irradiation-induced lethality was observed
during the study in agreement with previous studies that have indicated the C57Bl/6
mouse strain can tolerate up to 11 Gy of irradiation (381). Mice may lose up to 25% of
their body weight due to irradiation sickness (381), yet the body weights increased daily
after irradiation (Figure A-1).
As part of the experimental plan to determine the role of Atm in mammary tumor
suppression, Atmflox/flox;p53flox/+;WAP-Cre, Atmflox/flox;p53+/+:WAP-Cre and
Atm+/+;p53flox/+;WAP-Cre dams were allowed to give birth. Pups were culled to 6
pups/dam and suckled for 4-6 days before being removed and the dam irradiated. The
same precautionary measures used in the pilot study were applied to this study. The
151
body weights of these mice, regardless of genotype, dropped dramatically for the first 3
days then gradually increased back to a healthy weight (Figure A-2). We believe this
dramatic decrease in body weight is a combined effect of irradiation and the cessation
of lactation. Graying of the hair was observed but did not adversely affect the health of
the mice.
152
Figure A-1. Body weight after 5 Gy of whole body irradiation in 10-week old mice. Body
weight was measure before and after irradiation for 2 months. Graphed is one month.
153
Figure A-2. Body weight of experimental and control mice after 5 Gy of whole body
irradiation. Body weight was measured daily both before and after irradiation.
154
APPENDIX B ATM AND IGF-1R IN MAMMARY GLAND DEVELOPMENT
Mammary gland development is guided by both ovarian steroid (ie, estrogen and
progesterone) and pituitary peptide (growth hormone (GH), prolactin) hormones. At the
onset of puberty, estrogen induces ductal morphogenesis by, in part, synergizing with
GH to stimulate the mammary stroma to produce insulin-like growth factor-1 (IGF-1).
This provides paracrine signaling to the mammary epithelial precursor cells to initiate
ductal morphogenesis/TEB formation. In support of this view, mice lacking Igf-1 or
estrogen receptor alpha (ERα) fail postnatal ductal/TEB morphogenesis, indicating that
both estrogen and IGF-1 are critical in mammary gland development occurring prior to
pregnancy.
Several groups have studied modulators of radiosensitivity and the role that ATM
plays in this response. One molecule that has received attention is IGF-1R and is
known to influence radiosensitivity (382). Work from the Glazer group showed that IGF-
1R expression was suppressed in fibroblasts from A-T patients and that this could be
complemented by expression of recombinant ATM (375). Given the essential nature of
IGF-1 and IGF-1R in mammary gland development (268-272), we sought to determine if
Atm expression influences expression of Igf-1R in mouse mammary tissue.
The first experiment conducted was to score Igf-1R expression by Q-PCR in the
normal mouse mammary line NMuMG with shRNA-mediated knockdown of Atm
expression. A ~4-fold decrease in Igf-1R expression was observed in the Atm
knockdown NMuMG cells (Figure B-1A). Similarly, we observed significantly reduced
expression of Igf-1R in lactating (L10) Atm cKO glands with low Atm expression
compared to control and Atm cKO glands with high Atm expression (Figure B-1B).
155
Next, immunohistochemical analysis was conducted to determine Igf-1R status in Atm -
/- and wildtype littermates. Igf-1R expression was prominent in the luminal epithelium of
Atm wild type mice but absent from mice with germline deletion of Atm (Figure B-1C),
indicating Atm is required for Igf-1R expression.
156
Figure B-1. Atm is required for Igf1-R expression. A) Igf-1R expression was analyzed
by Q-PCR analysis in Atm knockdown NMuMG cells and B) Atmflox/flox and Atm cKO mammary glands at L10. C) Immunohistochemical analysis of 10-week Atm wild type and Atm -/- mammary glands. Note the total absence of Igf-1R expression in Atm -/- mammary glands.
157
FIgure B-1. Continued
158
LIST OF REFERENCES
1. Boder E. Ataxia-telangiectasia: an overview. Kroc Found Ser 1985;19:1-63.
2. Boder E, Sedgwick RP. Ataxia-telangiectasia; a familial syndrome of progressive cerebellar ataxia, oculocutaneous telangiectasia and frequent pulmonary infection. Pediatrics 1958;21:526-54.
3. Harnden DG. The nature of ataxia-telangiectasia: problems and perspectives. Int J Radiat Biol 1994;66:S13-9.
4. Chun HH, Gatti RA. Ataxia-telangiectasia, an evolving phenotype. DNA Repair (Amst) 2004;3:1187-96.
5. Farr AK, Shalev B, Crawford TO, Lederman HM, Winkelstein JA, Repka MX. Ocular manifestations of ataxia-telangiectasia. Am J Ophthalmol 2002;134:891-6.
6. Lewis RF, Lederman HM, Crawford TO. Ocular motor abnormalities in ataxia telangiectasia. Ann Neurol 1999;46:287-95.
7. Gatti RA, Vinters HV. Cerebellar pathology in ataxia-telangiectasia: the significance of basket cells. Kroc Found Ser 1985;19:225-32.
8. Ersoy F, Berkel AI, Sanal O, Oktay H. Twenty-year follow-up of 160 patients with ataxia-telangiectasia. Turk J Pediatr 1991;33:205-15.
9. Morrell D, Cromartie E, Swift M. Mortality and cancer incidence in 263 patients with ataxia-telangiectasia. J Natl Cancer Inst 1986;77:89-92.
10. Levis WR, Dattner AM, Shaw JS. Selective defects in T cell function in ataxia-telangiectasia. Clin Exp Immunol 1979;37:44-9.
11. Rigas DA, Tisdale VV, Hecht F. Transformation of blood lymphocytes in ataxia telangiectasia. Dose and time response to phytohemagglutinin. Int Arch Allergy Appl Immunol 1970;39:221-33.
12. Vacchio MS, Olaru A, Livak F, Hodes RJ. ATM deficiency impairs thymocyte maturation because of defective resolution of T cell receptor alpha locus coding end breaks. Proc Natl Acad Sci U S A 2007;104:6323-8.
13. Nowak-Wegrzyn A, Crawford TO, Winkelstein JA, Carson KA, Lederman HM. Immunodeficiency and infections in ataxia-telangiectasia. J Pediatr 2004;144:505-11.
14. Sanal O, Ersoy F, Yel L, et al. Impaired IgG antibody production to pneumococcal polysaccharides in patients with ataxia-telangiectasia. J Clin Immunol 1999;19:326-34.
159
15. Ammann AJ, Cain WA, Ishizaka K, Hong R, Good RA. Immunoglobulin E deficiency in ataxia-telangiectasia. N Engl J Med 1969;281:469-72.
16. Oxelius VA, Berkel AI, Hanson LA. IgG2 deficiency in ataxia-telangiectasia. N Engl J Med 1982;306:515-7.
17. Stray-Pedersen A, Aaberge IS, Fruh A, Abrahamsen TG. Pneumococcal conjugate vaccine followed by pneumococcal polysaccharide vaccine; immunogenicity in patients with ataxia-telangiectasia. Clin Exp Immunol 2005;140:507-16.
18. McFarlin DE, Strober W, Waldmann TA. Ataxia-telangiectasia. Medicine (Baltimore) 1972;51:281-314.
19. Spector. Epidemiology of cancer in ataxia-telangiectasia. In: Bridges H, editor. Ataxia Telangiectasia: A Cellular and Molecular Link between Cancer, Neuropathy, and Immune Deficiency. New York: Wiley; 1982. p. 103-38.
20. Hecht F, Hecht BK. Cancer in ataxia-telangiectasia patients. Cancer Genet Cytogenet 1990;46:9-19.
21. Boder E. Ataxia-telangiectasia: some historic, clinical and pathologic observations. Birth Defects Orig Artic Ser 1975;11:255-70.
22. Kojis TL, Gatti RA, Sparkes RS. The cytogenetics of ataxia telangiectasia. Cancer Genet Cytogenet 1991;56:143-56.
23. Taylor AM, Metcalfe JA, McConville C. Increased radiosensitivity and the basic defect in ataxia telangiectasia. Int J Radiat Biol 1989;56:677-84.
24. Narducci MG, Virgilio L, Isobe M, et al. TCL1 oncogene activation in preleukemic T cells from a case of ataxia-telangiectasia. Blood 1995;86:2358-64.
25. Sherrington PD, Fisch P, Taylor AM, Rabbitts TH. Clonal evolution of malignant and non-malignant T cells carrying t(14;14) and t(X;14) in patients with ataxia telangiectasia. Oncogene 1994;9:2377-81.
26. Metcalfe JA, Parkhill J, Campbell L, et al. Accelerated telomere shortening in ataxia telangiectasia. Nat Genet 1996;13:350-3.
27. Xia SJ, Shammas MA, Shmookler Reis RJ. Reduced telomere length in ataxia-telangiectasia fibroblasts. Mutat Res 1996;364:1-11.
28. Pandita TK, Pathak S, Geard CR. Chromosome end associations, telomeres and telomerase activity in ataxia telangiectasia cells. Cytogenet Cell Genet 1995;71:86-93.
160
29. Shiloh Y, Tabor E, Becker Y. In vitro phenotype of ataxia-telangiectasia (AT) fibroblast strains: clues to the nature of the "AT DNA lesion" and the molecular defect in AT. Kroc Found Ser 1985;19:111-21.
30. Thacker J. Cellular radiosensitivity in ataxia-telangiectasia. Int J Radiat Biol 1994;66:S87-96.
31. Painter RB. Radioresistant DNA synthesis: an intrinsic feature of ataxia telangiectasia. Mutat Res 1981;84:183-90.
32. Mann JR. Proceedings: A patient with ataxia-telangiectasia showing abnormal radiosensitivity to normal doses of irradiation. Br J Radiol 1976;49:560.
33. Beamish H, Williams R, Chen P, Lavin MF. Defect in multiple cell cycle checkpoints in ataxia-telangiectasia postirradiation. J Biol Chem 1996;271:20486-93.
34. Kastan MB, Zhan Q, el-Deiry WS, et al. A mammalian cell cycle checkpoint pathway utilizing p53 and GADD45 is defective in ataxia-telangiectasia. Cell 1992;71:587-97.
35. Paules RS, Levedakou EN, Wilson SJ, et al. Defective G2 checkpoint function in cells from individuals with familial cancer syndromes. Cancer Res 1995;55:1763-73.
36. Gatti RA, Berkel I, Boder E, et al. Localization of an ataxia-telangiectasia gene to chromosome 11q22-23. Nature 1988;336:577-80.
37. Lange E, Borresen AL, Chen X, et al. Localization of an ataxia-telangiectasia gene to an approximately 500-kb interval on chromosome 11q23.1: linkage analysis of 176 families by an international consortium. Am J Hum Genet 1995;57:112-9.
38. Savitsky K, Sfez S, Tagle DA, et al. The complete sequence of the coding region of the ATM gene reveals similarity to cell cycle regulators in different species. Hum Mol Genet 1995;4:2025-32.
39. Uziel T, Savitsky K, Platzer M, et al. Genomic Organization of the ATM gene. Genomics 1996;33:317-20.
40. Concannon P, Gatti RA. Diversity of ATM gene mutations detected in patients with ataxia-telangiectasia. Hum Mutat 1997;10:100-7.
41. Chen G, Lee E. The product of the ATM gene is a 370-kDa nuclear phosphoprotein. J Biol Chem 1996;271:33693-7.
42. Keith CT, Schreiber SL. PIK-related kinases: DNA repair, recombination, and cell cycle checkpoints. Science 1995;270:50-1.
161
43. Ma Y, Pannicke U, Schwarz K, Lieber MR. Hairpin opening and overhang processing by an Artemis/DNA-dependent protein kinase complex in nonhomologous end joining and V(D)J recombination. Cell 2002;108:781-94.
44. Cliby WA, Roberts CJ, Cimprich KA, et al. Overexpression of a kinase-inactive ATR protein causes sensitivity to DNA-damaging agents and defects in cell cycle checkpoints. EMBO J 1998;17:159-69.
45. Brown EJ, Albers MW, Shin TB, et al. A mammalian protein targeted by G1-arresting rapamycin-receptor complex. Nature 1994;369:756-8.
46. McMahon SB, Wood MA, Cole MD. The essential cofactor TRRAP recruits the histone acetyltransferase hGCN5 to c-Myc. Mol Cell Biol 2000;20:556-62.
47. Dames SA, Mulet JM, Rathgeb-Szabo K, Hall MN, Grzesiek S. The solution structure of the FATC domain of the protein kinase target of rapamycin suggests a role for redox-dependent structural and cellular stability. J Biol Chem 2005;280:20558-64.
48. You Z, Chahwan C, Bailis J, Hunter T, Russell P. ATM activation and its recruitment to damaged DNA require binding to the C terminus of Nbs1. Mol Cell Biol 2005;25:5363-79.
49. Brown KD, Ziv Y, Sadanandan SN, et al. The ataxia-telangiectasia gene product, a constitutively expressed nuclear protein that is not up-regulated following genome damage. Proc Natl Acad Sci U S A 1997;94:1840-5.
50. Barlow C, Liyanage M, Moens PB, et al. Atm deficiency results in severe meiotic disruption as early as leptonema of prophase I. Development 1998;125:4007-17.
51. Oka A, Takashima S. Expression of the ataxia-telangiectasia gene (ATM) product in human cerebellar neurons during development. Neurosci Lett 1998;252:195-8.
52. Clarke RA, Kairouz R, Watters D, Lavin MF, Kearsley JH, Lee CS. Upregulation of ATM in sclerosing adenosis of the breast. Mol Pathol 1998;51:224-6.
53. Watters D, Khanna KK, Beamish H, et al. Cellular localisation of the ataxia-telangiectasia (ATM) gene product and discrimination between mutated and normal forms. Oncogene 1997;14:1911-21.
54. Watters D, Kedar P, Spring K, et al. Localization of a portion of extranuclear ATM to peroxisomes. J Biol Chem 1999;274:34277-82.
55. Wanders RJ, Waterham HR. Biochemistry of mammalian peroxisomes revisited. Annu Rev Biochem 2006;75:295-332.
56. Rotman G, Shiloh Y. Ataxia-telangiectasia: is ATM a sensor of oxidative damage and stress? Bioessays 1997;19:911-7.
162
57. Morgan SE, Kastan MB. p53 and ATM: cell cycle, cell death, and cancer. Adv Cancer Res 1997;71:1-25.
58. Cornforth MN, Bedford JS. On the nature of a defect in cells from individuals with ataxia-telangiectasia. Science 1985;227:1589-91.
59. Bakkenist CJ, Kastan MB. DNA damage activates ATM through intermolecular autophosphorylation and dimer dissociation. Nature 2003;421:499-506.
60. Lukas C, Melander F, Stucki M, et al. Mdc1 couples DNA double-strand break recognition by Nbs1 with its H2AX-dependent chromatin retention. EMBO J 2004;23:2674-83.
61. Falck J, Coates J, Jackson SP. Conserved modes of recruitment of ATM, ATR and DNA-PKcs to sites of DNA damage. Nature 2005;434:605-11.
62. Uziel T, Lerenthal Y, Moyal L, Andegeko Y, Mittelman L, Shiloh Y. Requirement of the MRN complex for ATM activation by DNA damage. EMBO J 2003;22:5612-21.
63. Goodarzi AA, Jonnalagadda JC, Douglas P, et al. Autophosphorylation of ataxia-telangiectasia mutated is regulated by protein phosphatase 2A. EMBO J 2004;23:4451-61.
64. Shreeram S, Demidov ON, Hee WK, et al. Wip1 phosphatase modulates ATM-dependent signaling pathways. Mol Cell 2006;23:757-64.
65. Bassing CH, Suh H, Ferguson DO, et al. Histone H2AX: a dosage-dependent suppressor of oncogenic translocations and tumors. Cell 2003;114:359-70.
66. Banin S, Moyal L, Shieh S, et al. Enhanced phosphorylation of p53 by ATM in response to DNA damage. Science 1998;281:1674-7.
67. Doil C, Mailand N, Bekker-Jensen S, et al. RNF168 binds and amplifies ubiquitin conjugates on damaged chromosomes to allow accumulation of repair proteins. Cell 2009;136:435-46.
68. Huen MS, Grant R, Manke I, et al. RNF8 transduces the DNA-damage signal via histone ubiquitylation and checkpoint protein assembly. Cell 2007;131:901-14.
69. Kolas NK, Chapman JR, Nakada S, et al. Orchestration of the DNA-damage response by the RNF8 ubiquitin ligase. Science 2007;318:1637-40.
70. Hartwell LH, Culotti J, Reid B. Genetic control of the cell-division cycle in yeast. I. Detection of mutants. Proc Natl Acad Sci U S A 1970;66:352-9.
71. Canman CE, Lim DS, Cimprich KA, et al. Activation of the ATM kinase by ionizing radiation and phosphorylation of p53. Science 1998;281:1677-9.
163
72. el-Deiry WS, Tokino T, Velculescu VE, et al. WAF1, a potential mediator of p53 tumor suppression. Cell 1993;75:817-25.
73. Harper JW, Adami GR, Wei N, Keyomarsi K, Elledge SJ. The p21 Cdk-interacting protein Cip1 is a potent inhibitor of G1 cyclin-dependent kinases. Cell 1993;75:805-16.
74. Maya R, Balass M, Kim ST, et al. ATM-dependent phosphorylation of Mdm2 on serine 395: role in p53 activation by DNA damage. Genes Dev 2001;15:1067-77.
75. Shieh SY, Ahn J, Tamai K, Taya Y, Prives C. The human homologs of checkpoint kinases Chk1 and Cds1 (Chk2) phosphorylate p53 at multiple DNA damage-inducible sites. Genes Dev 2000;14:289-300.
76. Hirao A, Cheung A, Duncan G, et al. Chk2 is a tumor suppressor that regulates apoptosis in both an ataxia telangiectasia mutated (ATM)-dependent and an ATM-independent manner. Mol Cell Biol 2002;22:6521-32.
77. Carney JP, Maser RS, Olivares H, et al. The hMre11/hRad50 protein complex and Nijmegen breakage syndrome: linkage of double-strand break repair to the cellular DNA damage response. Cell 1998;93:477-86.
78. Dolganov GM, Maser RS, Novikov A, et al. Human Rad50 is physically associated with human Mre11: identification of a conserved multiprotein complex implicated in recombinational DNA repair. Mol Cell Biol 1996;16:4832-41.
79. Varon R, Seemanova E, Chrzanowska K, et al. Clinical ascertainment of Nijmegen breakage syndrome (NBS) and prevalence of the major mutation, 657del5, in three Slav populations. Eur J Hum Genet 2000;8:900-2.
80. Gatei M, Young D, Cerosaletti KM, et al. ATM-dependent phosphorylation of nibrin in response to radiation exposure. Nat Genet 2000;25:115-9.
81. Lim DS, Kim ST, Xu B, et al. ATM phosphorylates p95/nbs1 in an S-phase checkpoint pathway. Nature 2000;404:613-7.
82. Zhao S, Weng YC, Yuan SS, et al. Functional link between ataxia-telangiectasia and Nijmegen breakage syndrome gene products. Nature 2000;405:473-7.
83. Kitagawa R, Bakkenist CJ, McKinnon PJ, Kastan MB. Phosphorylation of SMC1 is a critical downstream event in the ATM-NBS1-BRCA1 pathway. Genes Dev 2004;18:1423-38.
84. Xu B, Kim ST, Lim DS, Kastan MB. Two molecularly distinct G(2)/M checkpoints are induced by ionizing irradiation. Mol Cell Biol 2002;22:1049-59.
164
85. Falck J, Mailand N, Syljuasen RG, Bartek J, Lukas J. The ATM-Chk2-Cdc25A checkpoint pathway guards against radioresistant DNA synthesis. Nature 2001;410:842-7.
86. Forrest A, Gabrielli B. Cdc25B activity is regulated by 14-3-3. Oncogene 2001;20:4393-401.
87. Peng CY, Graves PR, Thoma RS, Wu Z, Shaw AS, Piwnica-Worms H. Mitotic and G2 checkpoint control: regulation of 14-3-3 protein binding by phosphorylation of Cdc25C on serine-216. Science 1997;277:1501-5.
88. Xu B, Kim S, Kastan MB. Involvement of Brca1 in S-phase and G(2)-phase checkpoints after ionizing irradiation. Mol Cell Biol 2001;21:3445-50.
89. Yarden RI, Pardo-Reoyo S, Sgagias M, Cowan KH, Brody LC. BRCA1 regulates the G2/M checkpoint by activating Chk1 kinase upon DNA damage. Nat Genet 2002;30:285-9.
90. Barlow C, Ribaut-Barassin C, Zwingman TA, et al. ATM is a cytoplasmic protein in mouse brain required to prevent lysosomal accumulation. Proc Natl Acad Sci U S A 2000;97:871-6.
91. Kamsler A, Daily D, Hochman A, et al. Increased oxidative stress in ataxia telangiectasia evidenced by alterations in redox state of brains from Atm-deficient mice. Cancer Res 2001;61:1849-54.
92. Chen P, Peng C, Luff J, et al. Oxidative stress is responsible for deficient survival and dendritogenesis in purkinje neurons from ataxia-telangiectasia mutated mutant mice. J Neurosci 2003;23:11453-60.
93. Browne SE, Roberts LJ, 2nd, Dennery PA, et al. Treatment with a catalytic antioxidant corrects the neurobehavioral defect in ataxia-telangiectasia mice. Free Radic Biol Med 2004;36:938-42.
94. Gueven N, Luff J, Peng C, Hosokawa K, Bottle SE, Lavin MF. Dramatic extension of tumor latency and correction of neurobehavioral phenotype in Atm-mutant mice with a nitroxide antioxidant. Free Radic Biol Med 2006;41:992-1000.
95. Chen Y, Vartiainen NE, Ying W, Chan PH, Koistinaho J, Swanson RA. Astrocytes protect neurons from nitric oxide toxicity by a glutathione-dependent mechanism. J Neurochem 2001;77:1601-10.
96. Desagher S, Glowinski J, Premont J. Astrocytes protect neurons from hydrogen peroxide toxicity. J Neurosci 1996;16:2553-62.
97. Kim J, Wong PK. Oxidative stress is linked to ERK1/2-p16 signaling-mediated growth defect in ATM-deficient astrocytes. J Biol Chem 2009;284:14396-404.
165
98. Liu N, Stoica G, Yan M, et al. ATM deficiency induces oxidative stress and endoplasmic reticulum stress in astrocytes. Lab Invest 2005;85:1471-80.
99. Yan M, Shen J, Person MD, et al. Endoplasmic reticulum stress and unfolded protein response in Atm-deficient thymocytes and thymic lymphoma cells are attributable to oxidative stress. Neoplasia 2008;10:160-7.
100. Alexander A, Cai SL, Kim J, et al. ATM signals to TSC2 in the cytoplasm to regulate mTORC1 in response to ROS. Proc Natl Acad Sci U S A;107:4153-8.
101. Bencokova Z, Kaufmann MR, Pires IM, Lecane PS, Giaccia AJ, Hammond EM. ATM activation and signaling under hypoxic conditions. Mol Cell Biol 2009;29:526-37.
102. Sasaki M, Ikeda H, Nakanuma Y. Activation of ATM signaling pathway is involved in oxidative stress-induced expression of mito-inhibitory p21WAF1/Cip1 in chronic non-suppurative destructive cholangitis in primary biliary cirrhosis: an immunohistochemical study. J Autoimmun 2008;31:73-8.
103. Kurz EU, Douglas P, Lees-Miller SP. Doxorubicin activates ATM-dependent phosphorylation of multiple downstream targets in part through the generation of reactive oxygen species. J Biol Chem 2004;279:53272-81.
104. Guo Z, Kozlov S, Lavin MF, Person MD, Paull TT. ATM activation by oxidative stress. Science;330:517-21.
105. Zhao H, Traganos F, Albino AP, Darzynkiewicz Z. Oxidative stress induces cell cycle-dependent Mre11 recruitment, ATM and Chk2 activation and histone H2AX phosphorylation. Cell Cycle 2008;7:1490-5.
106. Lee KM, Choi JY, Park SK, et al. Genetic polymorphisms of ataxia telangiectasia mutated and breast cancer risk. Cancer Epidemiol Biomarkers Prev 2005;14:821-5.
107. Concannon P. Leiden Open Varition Database. 2011.
108. Byrd PJ, Cooper PR, Stankovic T, et al. A gene transcribed from the bidirectional ATM promoter coding for a serine rich protein: amino acid sequence, structure and expression studies. Hum Mol Genet 1996;5:1785-91.
109. Gilad S, Khosravi R, Harnik R, et al. Identification of ATM mutations using extended RT-PCR and restriction endonuclease fingerprinting, and elucidation of the repertoire of A-T mutations in Israel. Hum Mutat 1998;11:69-75.
110. Pecker I, Avraham KB, Gilbert DJ, et al. Identification and chromosomal localization of Atm, the mouse homolog of the ataxia-telangiectasia gene. Genomics 1996;35:39-45.
166
111. Barlow C, Hirotsune S, Paylor R, et al. Atm-deficient mice: a paradigm of ataxia telangiectasia. Cell 1996;86:159-71.
112. Elson A, Wang Y, Daugherty CJ, et al. Pleiotropic defects in ataxia-telangiectasia protein-deficient mice. Proc Natl Acad Sci U S A 1996;93:13084-9.
113. Xu Y, Ashley T, Brainerd EE, Bronson RT, Meyn MS, Baltimore D. Targeted disruption of ATM leads to growth retardation, chromosomal fragmentation during meiosis, immune defects, and thymic lymphoma. Genes Dev 1996;10:2411-22.
114. Savitsky K, Bar-Shira A, Gilad S, et al. A single ataxia telangiectasia gene with a product similar to PI-3 kinase. Science 1995;268:1749-53.
115. Kuljis RO, Xu Y, Aguila MC, Baltimore D. Degeneration of neurons, synapses, and neuropil and glial activation in a murine Atm knockout model of ataxia-telangiectasia. Proc Natl Acad Sci U S A 1997;94:12688-93.
116. Spring K, Cross S, Li C, et al. Atm knock-in mice harboring an in-frame deletion corresponding to the human ATM 7636del9 common mutation exhibit a variant phenotype. Cancer Res 2001;61:4561-8.
117. Swift M, Reitnauer PJ, Morrell D, Chase CL. Breast and other cancers in families with ataxia-telangiectasia. N Engl J Med 1987;316:1289-94.
118. Spring K, Ahangari F, Scott SP, et al. Mice heterozygous for mutation in Atm, the gene involved in ataxia-telangiectasia, have heightened susceptibility to cancer. Nat Genet 2002;32:185-90.
119. Bradbury AR, Olopade OI. Genetic susceptibility to breast cancer. Rev Endocr Metab Disord 2007;8:255-67.
120. Malone KE, Daling JR, Neal C, et al. Frequency of BRCA1/BRCA2 mutations in a population-based sample of young breast carcinoma cases. Cancer 2000;88:1393-402.
121. Serova OM, Mazoyer S, Puget N, et al. Mutations in BRCA1 and BRCA2 in breast cancer families: are there more breast cancer-susceptibility genes? Am J Hum Genet 1997;60:486-95.
122. Birch JM, Alston RD, McNally RJ, et al. Relative frequency and morphology of cancers in carriers of germline TP53 mutations. Oncogene 2001;20:4621-8.
123. Li FP, Fraumeni JF, Jr. Soft-tissue sarcomas, breast cancer, and other neoplasms. A familial syndrome? Ann Intern Med 1969;71:747-52.
124. Malkin D, Li FP, Strong LC, et al. Germ line p53 mutations in a familial syndrome of breast cancer, sarcomas, and other neoplasms. Science 1990;250:1233-8.
167
125. Lustbader ED, Williams WR, Bondy ML, Strom S, Strong LC. Segregation analysis of cancer in families of childhood soft-tissue-sarcoma patients. Am J Hum Genet 1992;51:344-56.
126. Sidransky D, Tokino T, Helzlsouer K, et al. Inherited p53 gene mutations in breast cancer. Cancer Res 1992;52:2984-6.
127. Guenard F, Labrie Y, Ouellette G, et al. Germline mutations in the breast cancer susceptibility gene PTEN are rare in high-risk non-BRCA1/2 French Canadian breast cancer families. Fam Cancer 2007;6:483-90.
128. Maehama T, Dixon JE. The tumor suppressor, PTEN/MMAC1, dephosphorylates the lipid second messenger, phosphatidylinositol 3,4,5-trisphosphate. J Biol Chem 1998;273:13375-8.
129. Paez J, Sellers WR. PI3K/PTEN/AKT pathway. A critical mediator of oncogenic signaling. Cancer Treat Res 2003;115:145-67.
130. Li J, Yen C, Liaw D, et al. PTEN, a putative protein tyrosine phosphatase gene mutated in human brain, breast, and prostate cancer. Science 1997;275:1943-7.
131. Liaw D, Marsh DJ, Li J, et al. Germline mutations of the PTEN gene in Cowden disease, an inherited breast and thyroid cancer syndrome. Nat Genet 1997;16:64-7.
132. Nusbaum R, Isaacs C. Management updates for women with a BRCA1 or BRCA2 mutation. Mol Diagn Ther 2007;11:133-44.
133. Starink TM, van der Veen JP, Arwert F, et al. The Cowden syndrome: a clinical and genetic study in 21 patients. Clin Genet 1986;29:222-33.
134. Boudeau J, Sapkota G, Alessi DR. LKB1, a protein kinase regulating cell proliferation and polarity. FEBS Lett 2003;546:159-65.
135. Giardiello FM, Brensinger JD, Tersmette AC, et al. Very high risk of cancer in familial Peutz-Jeghers syndrome. Gastroenterology 2000;119:1447-53.
136. Boardman LA, Thibodeau SN, Schaid DJ, et al. Increased risk for cancer in patients with the Peutz-Jeghers syndrome. Ann Intern Med 1998;128:896-9.
137. Gladkowska-Dura M, Dzierzanowska-Fangrat K, Dura WT, et al. Unique morphological spectrum of lymphomas in Nijmegen breakage syndrome (NBS) patients with high frequency of consecutive lymphoma formation. J Pathol 2008;216:337-44.
138. Anderson DE, Badzioch MD. Risk of familial breast cancer. Cancer 1985;56:383-7.
168
139. Ottman R, Pike MC, King MC, Casagrande JT, Henderson BE. Familial breast cancer in a population-based series. Am J Epidemiol 1986;123:15-21.
140. Miki Y, Swensen J, Shattuck-Eidens D, et al. A strong candidate for the breast and ovarian cancer susceptibility gene BRCA1. Science 1994;266:66-71.
141. Wooster R, Bignell G, Lancaster J, et al. Identification of the breast cancer susceptibility gene BRCA2. Nature 1995;378:789-92.
142. Risch HA, McLaughlin JR, Cole DE, et al. Prevalence and penetrance of germline BRCA1 and BRCA2 mutations in a population series of 649 women with ovarian cancer. Am J Hum Genet 2001;68:700-10.
143. Warner E, Foulkes W, Goodwin P, et al. Prevalence and penetrance of BRCA1 and BRCA2 gene mutations in unselected Ashkenazi Jewish women with breast cancer. J Natl Cancer Inst 1999;91:1241-7.
144. Kauff ND, Perez-Segura P, Robson ME, et al. Incidence of non-founder BRCA1 and BRCA2 mutations in high risk Ashkenazi breast and ovarian cancer families. J Med Genet 2002;39:611-4.
145. Chen S, Parmigiani G. Meta-analysis of BRCA1 and BRCA2 penetrance. J Clin Oncol 2007;25:1329-33.
146. Perou CM, Sorlie T, Eisen MB, et al. Molecular portraits of human breast tumours. Nature 2000;406:747-52.
147. Sorlie T, Perou CM, Tibshirani R, et al. Gene expression patterns of breast carcinomas distinguish tumor subclasses with clinical implications. Proc Natl Acad Sci U S A 2001;98:10869-74.
148. Sorlie T, Tibshirani R, Parker J, et al. Repeated observation of breast tumor subtypes in independent gene expression data sets. Proc Natl Acad Sci U S A 2003;100:8418-23.
149. Foulkes WD, Stefansson IM, Chappuis PO, et al. Germline BRCA1 mutations and a basal epithelial phenotype in breast cancer. J Natl Cancer Inst 2003;95:1482-5.
150. Janatova M, Zikan M, Dundr P, Matous B, Pohlreich P. Novel somatic mutations in the BRCA1 gene in sporadic breast tumors. Hum Mutat 2005;25:319.
151. Xu CF, Solomon E. Mutations of the BRCA1 gene in human cancer. Semin Cancer Biol 1996;7:33-40.
152. Catteau A, Harris WH, Xu CF, Solomon E. Methylation of the BRCA1 promoter region in sporadic breast and ovarian cancer: correlation with disease characteristics. Oncogene 1999;18:1957-65.
169
153. Yang ES, Xia F. BRCA1 16 years later: DNA damage-induced BRCA1 shuttling. FEBS J;277:3079-85.
154. Gatei M, Scott SP, Filippovitch I, et al. Role for ATM in DNA damage-induced phosphorylation of BRCA1. Cancer Res 2000;60:3299-304.
155. Xu B, O'Donnell AH, Kim ST, Kastan MB. Phosphorylation of serine 1387 in Brca1 is specifically required for the Atm-mediated S-phase checkpoint after ionizing irradiation. Cancer Res 2002;62:4588-91.
156. Weischer M, Bojesen SE, Tybjaerg-Hansen A, Axelsson CK, Nordestgaard BG. Increased risk of breast cancer associated with CHEK2*1100delC. J Clin Oncol 2007;25:57-63.
157. Bell DW, Varley JM, Szydlo TE, et al. Heterozygous germ line hCHK2 mutations in Li-Fraumeni syndrome. Science 1999;286:2528-31.
158. Nevanlinna H, Bartek J. The CHEK2 gene and inherited breast cancer susceptibility. Oncogene 2006;25:5912-9.
159. Auerbach AD, Rogatko A, Schroeder-Kurth TM. International Fanconi Anemia Registry: relation of clinical symptoms to diepoxybutane sensitivity. Blood 1989;73:391-6.
160. Cantor SB, Bell DW, Ganesan S, et al. BACH1, a novel helicase-like protein, interacts directly with BRCA1 and contributes to its DNA repair function. Cell 2001;105:149-60.
161. Xia B, Sheng Q, Nakanishi K, et al. Control of BRCA2 cellular and clinical functions by a nuclear partner, PALB2. Mol Cell 2006;22:719-29.
162. Seal S, Thompson D, Renwick A, et al. Truncating mutations in the Fanconi anemia J gene BRIP1 are low-penetrance breast cancer susceptibility alleles. Nat Genet 2006;38:1239-41.
163. Rahman N, Seal S, Thompson D, et al. PALB2, which encodes a BRCA2-interacting protein, is a breast cancer susceptibility gene. Nat Genet 2007;39:165-7.
164. Dunn HG, Meuwissen H, Livingstone CS, Pump KK. Ataxia-Telangiectasia. Can Med Assoc J 1964;91:1106-18.
165. Haerer AF, Jackson JF, Evers CG. Ataxia-telangiectasia with gastric adenocarcinoma. JAMA 1969;210:1884-7.
166. Swift M, Sholman L, Perry M, Chase C. Malignant neoplasms in the families of patients with ataxia-telangiectasia. Cancer Res 1976;36:209-15.
170
167. Athma P, Rappaport R, Swift M. Molecular genotyping shows that ataxia-telangiectasia heterozygotes are predisposed to breast cancer. Cancer Genet Cytogenet 1996;92:130-4.
168. Pippard EC, Hall AJ, Barker DJ, Bridges BA. Cancer in homozygotes and heterozygotes of ataxia-telangiectasia and xeroderma pigmentosum in Britain. Cancer Res 1988;48:2929-32.
169. Swift M, Chase CL, Morrell D. Cancer predisposition of ataxia-telangiectasia heterozygotes. Cancer Genet Cytogenet 1990;46:21-7.
170. Ahmed M, Rahman N. ATM and breast cancer susceptibility. Oncogene 2006;25:5906-11.
171. Inskip HM, Kinlen LJ, Taylor AM, Woods CG, Arlett CF. Risk of breast cancer and other cancers in heterozygotes for ataxia-telangiectasia. Br J Cancer 1999;79:1304-7.
172. Olsen JH, Hahnemann JM, Borresen-Dale AL, et al. Cancer in patients with ataxia-telangiectasia and in their relatives in the nordic countries. J Natl Cancer Inst 2001;93:121-7.
173. Easton DF. Cancer risks in A-T heterozygotes. Int J Radiat Biol 1994;66:S177-82.
174. Thompson D, Duedal S, Kirner J, et al. Cancer risks and mortality in heterozygous ATM mutation carriers. J Natl Cancer Inst 2005;97:813-22.
175. Swift M, Morrell D, Massey RB, Chase CL. Incidence of cancer in 161 families affected by ataxia-telangiectasia. N Engl J Med 1991;325:1831-6.
176. Campeau PM, Foulkes WD, Tischkowitz MD. Hereditary breast cancer: new genetic developments, new therapeutic avenues. Hum Genet 2008;124:31-42.
177. Bay JO, Grancho M, Pernin D, et al. No evidence for constitutional ATM mutation in breast/gastric cancer families. Int J Oncol 1998;12:1385-90.
178. Chen J, Birkholtz GG, Lindblom P, Rubio C, Lindblom A. The role of ataxia-telangiectasia heterozygotes in familial breast cancer. Cancer Res 1998;58:1376-9.
179. FitzGerald MG, Bean JM, Hegde SR, et al. Heterozygous ATM mutations do not contribute to early onset of breast cancer. Nat Genet 1997;15:307-10.
180. Izatt L, Greenman J, Hodgson S, et al. Identification of germline missense mutations and rare allelic variants in the ATM gene in early-onset breast cancer. Genes Chromosomes Cancer 1999;26:286-94.
171
181. Gatti RA, Tward A, Concannon P. Cancer risk in ATM heterozygotes: a model of phenotypic and mechanistic differences between missense and truncating mutations. Mol Genet Metab 1999;68:419-23.
182. Gatti RA, Boder E, Vinters HV, Sparkes RS, Norman A, Lange K. Ataxia-telangiectasia: an interdisciplinary approach to pathogenesis. Medicine (Baltimore) 1991;70:99-117.
183. Stankovic T, Kidd AM, Sutcliffe A, et al. ATM mutations and phenotypes in ataxia-telangiectasia families in the British Isles: expression of mutant ATM and the risk of leukemia, lymphoma, and breast cancer. Am J Hum Genet 1998;62:334-45.
184. Broeks A, Urbanus JH, Floore AN, et al. ATM-heterozygous germline mutations contribute to breast cancer-susceptibility. Am J Hum Genet 2000;66:494-500.
185. Chenevix-Trench G, Spurdle AB, Gatei M, et al. Dominant negative ATM mutations in breast cancer families. J Natl Cancer Inst 2002;94:205-15.
186. Dork T, Bendix R, Bremer M, et al. Spectrum of ATM gene mutations in a hospital-based series of unselected breast cancer patients. Cancer Res 2001;61:7608-15.
187. Bernstein JL, Bernstein L, Thompson WD, et al. ATM variants 7271T>G and IVS10-6T>G among women with unilateral and bilateral breast cancer. Br J Cancer 2003;89:1513-6.
188. Thorstenson YR, Shen P, Tusher VG, et al. Global analysis of ATM polymorphism reveals significant functional constraint. Am J Hum Genet 2001;69:396-412.
189. Thorstenson YR, Roxas A, Kroiss R, et al. Contributions of ATM mutations to familial breast and ovarian cancer. Cancer Res 2003;63:3325-33.
190. Vorechovsky I, Rasio D, Luo L, et al. The ATM gene and susceptibility to breast cancer: analysis of 38 breast tumors reveals no evidence for mutation. Cancer Res 1996;56:2726-32.
191. Renwick A, Thompson D, Seal S, et al. ATM mutations that cause ataxia-telangiectasia are breast cancer susceptibility alleles. Nat Genet 2006;38:873-5.
192. Janin N, Andrieu N, Ossian K, et al. Breast cancer risk in ataxia telangiectasia (AT) heterozygotes: haplotype study in French AT families. Br J Cancer 1999;80:1042-5.
193. Richert MM, Schwertfeger KL, Ryder JW, Anderson SM. An atlas of mouse mammary gland development. J Mammary Gland Biol Neoplasia 2000;5:227-41.
194. Angele S, Treilleux I, Taniere P, et al. Abnormal expression of the ATM and TP53 genes in sporadic breast carcinomas. Clin Cancer Res 2000;6:3536-44.
172
195. Kairouz R, Clarke RA, Marr PJ, et al. ATM protein synthesis patterns in sporadic breast cancer. Mol Pathol 1999;52:252-6.
196. van de Vijver M, van de Bersselaar R, Devilee P, Cornelisse C, Peterse J, Nusse R. Amplification of the neu (c-erbB-2) oncogene in human mammmary tumors is relatively frequent and is often accompanied by amplification of the linked c-erbA oncogene. Mol Cell Biol 1987;7:2019-23.
197. Knudson AG, Jr. Mutation and cancer: statistical study of retinoblastoma. Proc Natl Acad Sci U S A 1971;68:820-3.
198. Sato T, Tanigami A, Yamakawa K, et al. Allelotype of breast cancer: cumulative allele losses promote tumor progression in primary breast cancer. Cancer Res 1990;50:7184-9.
199. Trent J, Yang JM, Emerson J, et al. Clonal chromosome abnormalities in human breast carcinomas. II. Thirty-four cases with metastatic disease. Genes Chromosomes Cancer 1993;7:194-203.
200. Thompson F, Emerson J, Dalton W, et al. Clonal chromosome abnormalities in human breast carcinomas. I. Twenty-eight cases with primary disease. Genes Chromosomes Cancer 1993;7:185-93.
201. Hampton GM, Mannermaa A, Winqvist R, et al. Loss of heterozygosity in sporadic human breast carcinoma: a common region between 11q22 and 11q23.3. Cancer Res 1994;54:4586-9.
202. Foulkes WD, Black DM, Stamp GW, Solomon E, Trowsdale J. Very frequent loss of heterozygosity throughout chromosome 17 in sporadic ovarian carcinoma. Int J Cancer 1993;54:220-5.
203. Keldysh PL, Dragani TA, Fleischman EW, et al. 11q deletions in human colorectal carcinomas: cytogenetics and restriction fragment length polymorphism analysis. Genes Chromosomes Cancer 1993;6:45-50.
204. Tomlinson IP, Gammack AJ, Stickland JE, et al. Loss of heterozygosity in malignant melanoma at loci on chromosome 11 and 17 implicated in the pathogenesis of other cancers. Genes Chromosomes Cancer 1993;7:169-72.
205. Negrini M, Rasio D, Hampton GM, et al. Definition and refinement of chromosome 11 regions of loss of heterozygosity in breast cancer: identification of a new region at 11q23.3. Cancer Res 1995;55:3003-7.
206. Laake K, Odegard A, Andersen TI, et al. Loss of heterozygosity at 11q23.1 in breast carcinomas: indication for involvement of a gene distal and close to ATM. Genes Chromosomes Cancer 1997;18:175-80.
173
207. Ding SL, Sheu LF, Yu JC, et al. Abnormality of the DNA double-strand-break checkpoint/repair genes, ATM, BRCA1 and TP53, in breast cancer is related to tumour grade. Br J Cancer 2004;90:1995-2001.
208. Kerangueven F, Eisinger F, Noguchi T, et al. Loss of heterozygosity in human breast carcinomas in the ataxia telangiectasia, Cowden disease and BRCA1 gene regions. Oncogene 1997;14:339-47.
209. Rio PG, Pernin D, Bay JO, et al. Loss of heterozygosity of BRCA1, BRCA2 and ATM genes in sporadic invasive ductal breast carcinoma. Int J Oncol 1998;13:849-53.
210. Shen CY, Yu JC, Lo YL, et al. Genome-wide search for loss of heterozygosity using laser capture microdissected tissue of breast carcinoma: an implication for mutator phenotype and breast cancer pathogenesis. Cancer Res 2000;60:3884-92.
211. Angele S, Treilleux I, Bremond A, Taniere P, Hall J. Altered expression of DNA double-strand break detection and repair proteins in breast carcinomas. Histopathology 2003;43:347-53.
212. Tommiska J, Bartkova J, Heinonen M, et al. The DNA damage signalling kinase ATM is aberrantly reduced or lost in BRCA1/BRCA2-deficient and ER/PR/ERBB2-triple-negative breast cancer. Oncogene 2008;27:2501-6.
213. Bartek J, Bartkova J, Lukas J. DNA damage signalling guards against activated oncogenes and tumour progression. Oncogene 2007;26:7773-9.
214. Vo QN, Kim WJ, Cvitanovic L, Boudreau DA, Ginzinger DG, Brown KD. The ATM gene is a target for epigenetic silencing in locally advanced breast cancer. Oncogene 2004;23:9432-7.
215. Waha A, Sturne C, Kessler A, et al. Expression of the ATM gene is significantly reduced in sporadic breast carcinomas. Int J Cancer 1998;78:306-9.
216. Kovalev S, Mateen A, Zaika AI, O'Hea BJ, Moll UM. Lack of defective expression of the ATM gene in sporadic breast cancer tissues and cell lines. Int J Oncol 2000;16:825-31.
217. Feng J, Yan J, Chen J, et al. Absence of somatic ATM missense mutations in 58 mammary carcinomas. Cancer Genet Cytogenet 2003;145:179-82.
218. Luo L, Lu FM, Hart S, et al. Ataxia-telangiectasia and T-cell leukemias: no evidence for somatic ATM mutation in sporadic T-ALL or for hypermethylation of the ATM-NPAT/E14 bidirectional promoter in T-PLL. Cancer Res 1998;58:2293-7.
174
219. Kontorovich T, Cohen Y, Nir U, Friedman E. Promoter methylation patterns of ATM, ATR, BRCA1, BRCA2 and p53 as putative cancer risk modifiers in Jewish BRCA1/BRCA2 mutation carriers. Breast Cancer Res Treat 2009;116:195-200.
220. Treilleux I, Chapot B, Goddard S, Pisani P, Angele S, Hall J. The molecular causes of low ATM protein expression in breast carcinoma; promoter methylation and levels of the catalytic subunit of DNA-dependent protein kinase. Histopathology 2007;51:63-9.
221. Hennighausen L, Robinson GW. Signaling pathways in mammary gland development. Dev Cell 2001;1:467-75.
222. Balinsky BI. On the prenatal growth of the mammary gland rudiment in the mouse. J Anat 1950;84:227-35.
223. Sakakura T, Nishizuka Y, Dawe CJ. Mesenchyme-dependent morphogenesis and epithelium-specific cytodifferentiation in mouse mammary gland. Science 1976;194:1439-41.
224. Sakakura T, Kusano I, Kusakabe M, Inaguma Y, Nishizuka Y. Biology of mammary fat pad in fetal mouse: capacity to support development of various fetal epithelia in vivo. Development 1987;100:421-30.
225. Veltmaat JM, Van Veelen W, Thiery JP, Bellusci S. Identification of the mammary line in mouse by Wnt10b expression. Dev Dyn 2004;229:349-56.
226. Propper AY. Wandering epithelial cells in the rabbit embryo milk line. A preliminary scanning electron microscope study. Dev Biol 1978;67:225-31.
227. Sakakura T, Sakagami Y, Nishizuka Y. Dual origin of mesenchymal tissues participating in mouse mammary gland embryogenesis. Dev Biol 1982;91:202-7.
228. Hens JR, Wysolmerski JJ. Key stages of mammary gland development: molecular mechanisms involved in the formation of the embryonic mammary gland. Breast Cancer Res 2005;7:220-4.
229. Parmar H, Cunha GR. Epithelial-stromal interactions in the mouse and human mammary gland in vivo. Endocr Relat Cancer 2004;11:437-58.
230. Veltmaat JM, Mailleux AA, Thiery JP, Bellusci S. Mouse embryonic mammogenesis as a model for the molecular regulation of pattern formation. Differentiation 2003;71:1-17.
231. Neville MC, Medina D, Monks J, Hovey RC. The mammary fat pad. J Mammary Gland Biol Neoplasia 1998;3:109-16.
175
232. Mallepell S, Krust A, Chambon P, Brisken C. Paracrine signaling through the epithelial estrogen receptor alpha is required for proliferation and morphogenesis in the mammary gland. Proc Natl Acad Sci U S A 2006;103:2196-201.
233. Williams JM, Daniel CW. Mammary ductal elongation: differentiation of myoepithelium and basal lamina during branching morphogenesis. Dev Biol 1983;97:274-90.
234. Streuli CH, Bissell MJ. Expression of extracellular matrix components is regulated by substratum. J Cell Biol 1990;110:1405-15.
235. Humphreys RC, Krajewska M, Krnacik S, et al. Apoptosis in the terminal endbud of the murine mammary gland: a mechanism of ductal morphogenesis. Development 1996;122:4013-22.
236. Brisken C. Hormonal control of alveolar development and its implications for breast carcinogenesis. J Mammary Gland Biol Neoplasia 2002;7:39-48.
237. Robinson GW, McKnight RA, Smith GH, Hennighausen L. Mammary epithelial cells undergo secretory differentiation in cycling virgins but require pregnancy for the establishment of terminal differentiation. Development 1995;121:2079-90.
238. Neville MC, McFadden TB, Forsyth I. Hormonal regulation of mammary differentiation and milk secretion. J Mammary Gland Biol Neoplasia 2002;7:49-66.
239. Howlett AR, Bissell MJ. The influence of tissue microenvironment (stroma and extracellular matrix) on the development and function of mammary epithelium. Epithelial Cell Biol 1993;2:79-89.
240. Wyllie AH, Kerr JF, Currie AR. Cell death: the significance of apoptosis. Int Rev Cytol 1980;68:251-306.
241. Furth PA. Introduction: mammary gland involution and apoptosis of mammary epithelial cells. J Mammary Gland Biol Neoplasia 1999;4:123-7.
242. Li M, Liu X, Robinson G, et al. Mammary-derived signals activate programmed cell death during the first stage of mammary gland involution. Proc Natl Acad Sci U S A 1997;94:3425-30.
243. Quarrie LH, Addey CV, Wilde CJ. Programmed cell death during mammary tissue involution induced by weaning, litter removal, and milk stasis. J Cell Physiol 1996;168:559-69.
244. Strange R, Li F, Saurer S, Burkhardt A, Friis RR. Apoptotic cell death and tissue remodelling during mouse mammary gland involution. Development 1992;115:49-58.
176
245. Green KA, Streuli CH. Apoptosis regulation in the mammary gland. Cell Mol Life Sci 2004;61:1867-83.
246. Jerry DJ, Kuperwasser C, Downing SR, et al. Delayed involution of the mammary epithelium in BALB/c-p53null mice. Oncogene 1998;17:2305-12.
247. Flanders KC, Wakefield LM. Transforming growth factor-(beta)s and mammary gland involution; functional roles and implications for cancer progression. J Mammary Gland Biol Neoplasia 2009;14:131-44.
248. Clarkson RW, Boland MP, Kritikou EA, et al. The genes induced by signal transducer and activators of transcription (STAT)3 and STAT5 in mammary epithelial cells define the roles of these STATs in mammary development. Mol Endocrinol 2006;20:675-85.
249. Thangaraju M, Rudelius M, Bierie B, et al. C/EBPdelta is a crucial regulator of pro-apoptotic gene expression during mammary gland involution. Development 2005;132:4675-85.
250. Zinser GM, Welsh J. Accelerated mammary gland development during pregnancy and delayed postlactational involution in vitamin D3 receptor null mice. Mol Endocrinol 2004;18:2208-23.
251. Talhouk RS, Bissell MJ, Werb Z. Coordinated expression of extracellular matrix-degrading proteinases and their inhibitors regulates mammary epithelial function during involution. J Cell Biol 1992;118:1271-82.
252. Stein T, Salomonis N, Gusterson BA. Mammary gland involution as a multi-step process. J Mammary Gland Biol Neoplasia 2007;12:25-35.
253. Fata JE, Leco KJ, Voura EB, et al. Accelerated apoptosis in the Timp-3-deficient mammary gland. J Clin Invest 2001;108:831-41.
254. Alexander CM, Howard EW, Bissell MJ, Werb Z. Rescue of mammary epithelial cell apoptosis and entactin degradation by a tissue inhibitor of metalloproteinases-1 transgene. J Cell Biol 1996;135:1669-77.
255. Boudreau N, Sympson CJ, Werb Z, Bissell MJ. Suppression of ICE and apoptosis in mammary epithelial cells by extracellular matrix. Science 1995;267:891-3.
256. Lund LR, Bjorn SF, Sternlicht MD, et al. Lactational competence and involution of the mouse mammary gland require plasminogen. Development 2000;127:4481-92.
257. Daniel CW, Silberstein GB, Strickland P. Direct action of 17 beta-estradiol on mouse mammary ducts analyzed by sustained release implants and steroid autoradiography. Cancer Res 1987;47:6052-7.
177
258. Pelletier G, El-Alfy M. Immunocytochemical localization of estrogen receptors alpha and beta in the human reproductive organs. J Clin Endocrinol Metab 2000;85:4835-40.
259. Tsai SC, Heppner GH. Immunoendocrine mechanisms in mammary tumor progression: direct prolactin modulation of peripheral and preneoplastic hyperplastic-alveolar-nodule- infiltrating lymphocytes. Cancer Immunol Immunother 1994;39:291-8.
260. Haslam SZ. Local versus systemically mediated effects of estrogen on normal mammary epithelial cell deoxyribonucleic acid synthesis. Endocrinology 1988;122:860-7.
261. Saji S, Jensen EV, Nilsson S, Rylander T, Warner M, Gustafsson JA. Estrogen receptors alpha and beta in the rodent mammary gland. Proc Natl Acad Sci U S A 2000;97:337-42.
262. Forster C, Makela S, Warri A, et al. Involvement of estrogen receptor beta in terminal differentiation of mammary gland epithelium. Proc Natl Acad Sci U S A 2002;99:15578-83.
263. Cunha GR, Young P, Hom YK, Cooke PS, Taylor JA, Lubahn DB. Elucidation of a role for stromal steroid hormone receptors in mammary gland growth and development using tissue recombinants. J Mammary Gland Biol Neoplasia 1997;2:393-402.
264. Conneely OM, Kettelberger DM, Tsai MJ, Schrader WT, O'Malley BW. The chicken progesterone receptor A and B isoforms are products of an alternate translation initiation event. J Biol Chem 1989;264:14062-4.
265. Schneider W, Ramachandran C, Satyaswaroop PG, Shyamala G. Murine progesterone receptor exists predominantly as the 83-kilodalton 'A' form. J Steroid Biochem Mol Biol 1991;38:285-91.
266. Brisken C, Park S, Vass T, Lydon JP, O'Malley BW, Weinberg RA. A paracrine role for the epithelial progesterone receptor in mammary gland development. Proc Natl Acad Sci U S A 1998;95:5076-81.
267. Mulac-Jericevic B, Lydon JP, DeMayo FJ, Conneely OM. Defective mammary gland morphogenesis in mice lacking the progesterone receptor B isoform. Proc Natl Acad Sci U S A 2003;100:9744-9.
268. Ruan W, Kleinberg DL. Insulin-like growth factor I is essential for terminal end bud formation and ductal morphogenesis during mammary development. Endocrinology 1999;140:5075-81.
178
269. Ruan W, Catanese V, Wieczorek R, Feldman M, Kleinberg DL. Estradiol enhances the stimulatory effect of insulin-like growth factor-I (IGF-I) on mammary development and growth hormone-induced IGF-I messenger ribonucleic acid. Endocrinology 1995;136:1296-302.
270. Richards RG, Klotz DM, Walker MP, Diaugustine RP. Mammary gland branching morphogenesis is diminished in mice with a deficiency of insulin-like growth factor-I (IGF-I), but not in mice with a liver-specific deletion of IGF-I. Endocrinology 2004;145:3106-10.
271. Bonnette SG, Hadsell DL. Targeted disruption of the IGF-I receptor gene decreases cellular proliferation in mammary terminal end buds. Endocrinology 2001;142:4937-45.
272. Richert MM, Wood TL. The insulin-like growth factors (IGF) and IGF type I receptor during postnatal growth of the murine mammary gland: sites of messenger ribonucleic acid expression and potential functions. Endocrinology 1999;140:454-61.
273. Fagan DH, Yee D. Crosstalk between IGF1R and estrogen receptor signaling in breast cancer. J Mammary Gland Biol Neoplasia 2008;13:423-9.
274. Carboni JM, Lee AV, Hadsell DL, et al. Tumor development by transgenic expression of a constitutively active insulin-like growth factor I receptor. Cancer Res 2005;65:3781-7.
275. Surmacz E. Function of the IGF-I receptor in breast cancer. J Mammary Gland Biol Neoplasia 2000;5:95-105.
276. Cohen BD, Baker DA, Soderstrom C, et al. Combination therapy enhances the inhibition of tumor growth with the fully human anti-type 1 insulin-like growth factor receptor monoclonal antibody CP-751,871. Clin Cancer Res 2005;11:2063-73.
277. Luetteke NC, Qiu TH, Fenton SE, et al. Targeted inactivation of the EGF and amphiregulin genes reveals distinct roles for EGF receptor ligands in mouse mammary gland development. Development 1999;126:2739-50.
278. Wiesen JF, Young P, Werb Z, Cunha GR. Signaling through the stromal epidermal growth factor receptor is necessary for mammary ductal development. Development 1999;126:335-44.
279. Brisken C, Rajaram RD. Alveolar and lactogenic differentiation. J Mammary Gland Biol Neoplasia 2006;11:239-48.
280. Ormandy CJ, Camus A, Barra J, et al. Null mutation of the prolactin receptor gene produces multiple reproductive defects in the mouse. Genes Dev 1997;11:167-78.
179
281. Brisken C, Kaur S, Chavarria TE, et al. Prolactin controls mammary gland development via direct and indirect mechanisms. Dev Biol 1999;210:96-106.
282. Bole-Feysot C, Goffin V, Edery M, Binart N, Kelly PA. Prolactin (PRL) and its receptor: actions, signal transduction pathways and phenotypes observed in PRL receptor knockout mice. Endocr Rev 1998;19:225-68.
283. Shillingford JM, Miyoshi K, Robinson GW, et al. Jak2 is an essential tyrosine kinase involved in pregnancy-mediated development of mammary secretory epithelium. Mol Endocrinol 2002;16:563-70.
284. Liu X, Robinson GW, Wagner KU, Garrett L, Wynshaw-Boris A, Hennighausen L. Stat5a is mandatory for adult mammary gland development and lactogenesis. Genes Dev 1997;11:179-86.
285. Freeman ME, Kanyicska B, Lerant A, Nagy G. Prolactin: structure, function, and regulation of secretion. Physiol Rev 2000;80:1523-631.
286. Goupille O, Daniel N, Bignon C, Jolivet G, Djiane J. Prolactin signal transduction to milk protein genes: carboxy-terminal part of the prolactin receptor and its tyrosine phosphorylation are not obligatory for JAK2 and STAT5 activation. Mol Cell Endocrinol 1997;127:155-69.
287. Lebrun JJ, Ali S, Sofer L, Ullrich A, Kelly PA. Prolactin-induced proliferation of Nb2 cells involves tyrosine phosphorylation of the prolactin receptor and its associated tyrosine kinase JAK2. J Biol Chem 1994;269:14021-6.
288. DaSilva L, Rui H, Erwin RA, et al. Prolactin recruits STAT1, STAT3 and STAT5 independent of conserved receptor tyrosines TYR402, TYR479, TYR515 and TYR580. Mol Cell Endocrinol 1996;117:131-40.
289. Wartmann M, Cella N, Hofer P, et al. Lactogenic hormone activation of Stat5 and transcription of the beta-casein gene in mammary epithelial cells is independent of p42 ERK2 mitogen-activated protein kinase activity. J Biol Chem 1996;271:31863-8.
290. Chen WH, Chen Y, Cui GH, et al. [Effect of curcumin on STAT5 signaling pathway in primary CML cells]. Zhongguo Shi Yan Xue Ye Xue Za Zhi 2004;12:572-6.
291. Wagner KU, Krempler A, Triplett AA, et al. Impaired alveologenesis and maintenance of secretory mammary epithelial cells in Jak2 conditional knockout mice. Mol Cell Biol 2004;24:5510-20.
292. Long W, Wagner KU, Lloyd KC, et al. Impaired differentiation and lactational failure of Erbb4-deficient mammary glands identify ERBB4 as an obligate mediator of STAT5. Development 2003;130:5257-68.
180
293. Naylor MJ, Li N, Cheung J, et al. Ablation of beta1 integrin in mammary epithelium reveals a key role for integrin in glandular morphogenesis and differentiation. J Cell Biol 2005;171:717-28.
294. Clark DE, Williams CC, Duplessis TT, et al. ERBB4/HER4 potentiates STAT5A transcriptional activity by regulating novel STAT5A serine phosphorylation events. J Biol Chem 2005;280:24175-80.
295. Park DS, Lee H, Frank PG, et al. Caveolin-1-deficient mice show accelerated mammary gland development during pregnancy, premature lactation, and hyperactivation of the Jak-2/STAT5a signaling cascade. Mol Biol Cell 2002;13:3416-30.
296. Arzt E. gp130 cytokine signaling in the pituitary gland: a paradigm for cytokine-neuro-endocrine pathways. J Clin Invest 2001;108:1729-33.
297. Zhao L, Hart S, Cheng J, et al. Mammary gland remodeling depends on gp130 signaling through Stat3 and MAPK. J Biol Chem 2004;279:44093-100.
298. Park DS, Lee H, Riedel C, et al. Prolactin negatively regulates caveolin-1 gene expression in the mammary gland during lactation, via a Ras-dependent mechanism. J Biol Chem 2001;276:48389-97.
299. Castillo C, Hernandez J, Bravo A, Lopez-Alonso M, Pereira V, Benedito JL. Oxidative status during late pregnancy and early lactation in dairy cows. Vet J 2005;169:286-92.
300. Speakman JR. The physiological costs of reproduction in small mammals. Philos Trans R Soc Lond B Biol Sci 2008;363:375-98.
301. Hammond KA, Lloyd KC, Diamond J. Is mammary output capacity limiting to lactational performance in mice? J Exp Biol 1996;199:337-49.
302. Garratt M, Vasilaki A, Stockley P, McArdle F, Jackson M, Hurst JL. Is oxidative stress a physiological cost of reproduction? An experimental test in house mice. Proc Biol Sci 2010.
303. Williamson DH, Lund P, Evans RD. Substrate selection and oxygen uptake by the lactating mammary gland. Proc Nutr Soc 1995;54:165-75.
304. Rosano TG, Jones DH. Developmental changes in mitochondria during the transition into lactation in the mouse mammary gland. J Cell Biol 1976;69:573-80.
305. Rosano TG, Lee SK, Jones DH. Developmental changes in mitochondria during the transition into lactation in the mouse mammary gland. II. Membrane marker enzymes and membrane ultrastructure. J Cell Biol 1976;69:581-8.
181
306. Upreti K, Chaki, S.P & Misro, M.M. Evaluation of peroxidative stress and enzymatic antioxidant activity in liver and kidney during pregnancy and lactation in rats. Health Population Issues Perspective 2002;25:177-85.
307. Hadsell DL, Torres D, George J, Capuco AV, Ellis SE, Fiorotto ML. Changes in secretory cell turnover, and mitochondrial oxidative damage in the mouse mammary gland during a single prolonged lactation cycle suggest the possibility of accelerated cellular aging. Exp Gerontol 2006;41:271-81.
308. Izyumov DS, Avetisyan AV, Pletjushkina OY, et al. "Wages of fear": transient threefold decrease in intracellular ATP level imposes apoptosis. Biochim Biophys Acta 2004;1658:141-7.
309. Pollack M, Leeuwenburgh C. Apoptosis and aging: role of the mitochondria. J Gerontol A Biol Sci Med Sci 2001;56:B475-82.
310. Hollmann KH, Verley JM. [Mammotropic and somatotropic pituitary cells in spontaneous mammary tumor bearing C3H female mice. A quantitative electron microscope study]. Experientia 1978;34:98-100.
311. Jonkers J, Meuwissen R, van der Gulden H, Peterse H, van der Valk M, Berns A. Synergistic tumor suppressor activity of BRCA2 and p53 in a conditional mouse model for breast cancer. Nat Genet 2001;29:418-25.
312. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001;25:402-8.
313. Robson M, Dabney MK, Rosenthal G, et al. Prevalence of recurring BRCA mutations among Ashkenazi Jewish women with breast cancer. Genet Test 1997;1:47-51.
314. Hofer T, Seo AY, Prudencio M, Leeuwenburgh C. A method to determine RNA and DNA oxidation simultaneously by HPLC-ECD: greater RNA than DNA oxidation in rat liver after doxorubicin administration. Biol Chem 2006;387:103-11.
315. Ai L, Kim WJ, Demircan B, et al. The transglutaminase 2 gene (TGM2), a potential molecular marker for chemotherapeutic drug sensitivity, is epigenetically silenced in breast cancer. Carcinogenesis 2008;29:510-8.
316. Bowen TJ, Yakushiji H, Montagna C, Jain S, Ried T, Wynshaw-Boris A. Atm heterozygosity cooperates with loss of Brca1 to increase the severity of mammary gland cancer and reduce ductal branching. Cancer Res 2005;65:8736-46.
317. Kim SS, Cao L, Baek HJ, et al. Impaired skin and mammary gland development and increased gamma-irradiation-induced tumorigenesis in mice carrying a mutation of S1152-ATM phosphorylation site in Brca1. Cancer Res 2009;69:9291-300.
182
318. Gowen LC, Johnson BL, Latour AM, Sulik KK, Koller BH. Brca1 deficiency results in early embryonic lethality characterized by neuroepithelial abnormalities. Nat Genet 1996;12:191-4.
319. Xu X, Wagner KU, Larson D, et al. Conditional mutation of Brca1 in mammary epithelial cells results in blunted ductal morphogenesis and tumour formation. Nat Genet 1999;22:37-43.
320. Sternberg N, Hamilton D. Bacteriophage P1 site-specific recombination. I. Recombination between loxP sites. J Mol Biol 1981;150:467-86.
321. Sauer B. Inducible gene targeting in mice using the Cre/lox system. Methods 1998;14:381-92.
322. Wagner KU, Wall RJ, St-Onge L, et al. Cre-mediated gene deletion in the mammary gland. Nucleic Acids Res 1997;25:4323-30.
323. Sinn E, Muller W, Pattengale P, Tepler I, Wallace R, Leder P. Coexpression of MMTV/v-Ha-ras and MMTV/c-myc genes in transgenic mice: synergistic action of oncogenes in vivo. Cell 1987;49:465-75.
324. Pittius CW, Sankaran L, Topper YJ, Hennighausen L. Comparison of the regulation of the whey acidic protein gene with that of a hybrid gene containing the whey acidic protein gene promoter in transgenic mice. Mol Endocrinol 1988;2:1027-32.
325. Stebbins MA, Schar CR, Peterson CB, Sepaniak MJ. Temporal analysis of DNA restriction digests by capillary electrophoresis. J Chromatogr B Biomed Sci Appl 1997;697:181-8.
326. Herzog KH, Chong MJ, Kapsetaki M, Morgan JI, McKinnon PJ. Requirement for Atm in ionizing radiation-induced cell death in the developing central nervous system. Science 1998;280:1089-91.
327. Palmer CA, Neville MC, Anderson SM, McManaman JL. Analysis of lactation defects in transgenic mice. J Mammary Gland Biol Neoplasia 2006;11:269-82.
328. Thangaraju M, Sharan S, Sterneck E. Comparison of mammary gland involution between 129S1 and C57BL/6 inbred mouse strains: differential regulation of Bcl2a1, Trp53, Cebpb, and Cebpd expression. Oncogene 2004;23:2548-53.
329. Chapman RS, Lourenco PC, Tonner E, et al. Suppression of epithelial apoptosis and delayed mammary gland involution in mice with a conditional knockout of Stat3. Genes Dev 1999;13:2604-16.
183
330. Greenberg AS, Egan JJ, Wek SA, Garty NB, Blanchette-Mackie EJ, Londos C. Perilipin, a major hormonally regulated adipocyte-specific phosphoprotein associated with the periphery of lipid storage droplets. J Biol Chem 1991;266:11341-6.
331. Zelko IN, Mariani TJ, Folz RJ. Superoxide dismutase multigene family: a comparison of the CuZn-SOD (SOD1), Mn-SOD (SOD2), and EC-SOD (SOD3) gene structures, evolution, and expression. Free Radic Biol Med 2002;33:337-49.
332. Alfonso-Prieto M, Biarnes X, Vidossich P, Rovira C. The molecular mechanism of the catalase reaction. J Am Chem Soc 2009;131:11751-61.
333. Wilde CJ, Knight CH, Flint DJ. Control of milk secretion and apoptosis during mammary involution. J Mammary Gland Biol Neoplasia 1999;4:129-36.
334. Triplett AA, Sakamoto K, Matulka LA, Shen L, Smith GH, Wagner KU. Expression of the whey acidic protein (Wap) is necessary for adequate nourishment of the offspring but not functional differentiation of mammary epithelial cells. Genesis 2005;43:1-11.
335. Bagheri-Yarmand R, Vadlamudi RK, Kumar R. Activating transcription factor 4 overexpression inhibits proliferation and differentiation of mammary epithelium resulting in impaired lactation and accelerated involution. J Biol Chem 2003;278:17421-9.
336. Sutherland KD, Vaillant F, Alexander WS, et al. c-myc as a mediator of accelerated apoptosis and involution in mammary glands lacking Socs3. EMBO J 2006;25:5805-15.
337. Walton KD, Wagner KU, Rucker EB, 3rd, Shillingford JM, Miyoshi K, Hennighausen L. Conditional deletion of the bcl-x gene from mouse mammary epithelium results in accelerated apoptosis during involution but does not compromise cell function during lactation. Mech Dev 2001;109:281-93.
338. Cui Y, Riedlinger G, Miyoshi K, et al. Inactivation of Stat5 in mouse mammary epithelium during pregnancy reveals distinct functions in cell proliferation, survival, and differentiation. Mol Cell Biol 2004;24:8037-47.
339. Weiler S, Rohrbach V, Pulvirenti T, Adams R, Ziemiecki A, Andres AC. Mammary epithelial-specific knockout of the ephrin-B2 gene leads to precocious epithelial cell death at lactation. Dev Growth Differ 2009;51:809-19.
340. Boussadia O, Kutsch S, Hierholzer A, Delmas V, Kemler R. E-cadherin is a survival factor for the lactating mouse mammary gland. Mech Dev 2002;115:53-62.
184
341. Nemade RV, Bierie B, Nozawa M, et al. Biogenesis and function of mouse mammary epithelium depends on the presence of functional alpha-catenin. Mech Dev 2004;121:91-9.
342. Beavon IR. The E-cadherin-catenin complex in tumour metastasis: structure, function and regulation. Eur J Cancer 2000;36:1607-20.
343. Rotman G, Shiloh Y. ATM: from gene to function. Hum Mol Genet 1998;7:1555-63.
344. Weil MM, Kittrell FS, Yu Y, McCarthy M, Zabriskie RC, Ullrich RL. Radiation induces genomic instability and mammary ductal dysplasia in Atm heterozygous mice. Oncogene 2001;20:4409-11.
345. Ito K, Hirao A, Arai F, et al. Regulation of oxidative stress by ATM is required for self-renewal of haematopoietic stem cells. Nature 2004;431:997-1002.
346. Reliene R, Schiestl RH. Antioxidants suppress lymphoma and increase longevity in Atm-deficient mice. J Nutr 2007;137:229S-32S.
347. Takao N, Li Y, Yamamoto K. Protective roles for ATM in cellular response to oxidative stress. FEBS Lett 2000;472:133-6.
348. Bretsky P, Haiman CA, Gilad S, et al. The relationship between twenty missense ATM variants and breast cancer risk: the Multiethnic Cohort. Cancer Epidemiol Biomarkers Prev 2003;12:733-8.
349. Lu S, Shen K, Wang Y, et al. Atm-haploinsufficiency enhances susceptibility to carcinogen-induced mammary tumors. Carcinogenesis 2006;27:848-55.
350. Boice JD, Jr., Miller RW. Risk of breast cancer in ataxia-telangiectasia. N Engl J Med 1992;326:1357-8; author reply 60-1.
351. Kuller LH, Modan B. Risk of breast cancer in ataxia-telangiectasia. N Engl J Med 1992;326:1357; author reply 60-1.
352. Hoag WG. Spontaneous Cancer in Mice. Ann N Y Acad Sci 1963;108:805-31.
353. Cheung AM, Elia A, Tsao MS, et al. Brca2 deficiency does not impair mammary epithelium development but promotes mammary adenocarcinoma formation in p53(+/-) mutant mice. Cancer Res 2004;64:1959-65.
354. Backlund MG, Trasti SL, Backlund DC, Cressman VL, Godfrey V, Koller BH. Impact of ionizing radiation and genetic background on mammary tumorigenesis in p53-deficient mice. Cancer Res 2001;61:6577-82.
355. Umesako S, Fujisawa K, Iiga S, et al. Atm heterozygous deficiency enhances development of mammary carcinomas in p53 heterozygous knockout mice. Breast Cancer Res 2005;7:R164-70.
185
356. Greenblatt MS, Bennett WP, Hollstein M, Harris CC. Mutations in the p53 tumor suppressor gene: clues to cancer etiology and molecular pathogenesis. Cancer Res 1994;54:4855-78.
357. Antoniou A, Pharoah PD, Narod S, et al. Average risks of breast and ovarian cancer associated with BRCA1 or BRCA2 mutations detected in case Series unselected for family history: a combined analysis of 22 studies. Am J Hum Genet 2003;72:1117-30.
358. Crook T, Crossland S, Crompton MR, Osin P, Gusterson BA. p53 mutations in BRCA1-associated familial breast cancer. Lancet 1997;350:638-9.
359. Garte SJ, Burns FJ. Oncogenes and radiation carcinogenesis. Environ Health Perspect 1991;93:45-9.
360. Horn Y. The potential carcinogenic hazards of electromagnetic radiation: a review. Cancer Detect Prev 1995;19:244-9.
361. Martin LM, Marples B, Coffey M, et al. DNA mismatch repair and the DNA damage response to ionizing radiation: making sense of apparently conflicting data. Cancer Treat Rev 2010;36:518-27.
362. Harvey M, McArthur MJ, Montgomery CA, Jr., Bradley A, Donehower LA. Genetic background alters the spectrum of tumors that develop in p53-deficient mice. FASEB J 1993;7:938-43.
363. Cressman VL, Backlund DC, Hicks EM, Gowen LC, Godfrey V, Koller BH. Mammary tumor formation in p53- and BRCA1-deficient mice. Cell Growth Differ 1999;10:1-10.
364. Kuperwasser C, Hurlbut GD, Kittrell FS, et al. Development of spontaneous mammary tumors in BALB/c p53 heterozygous mice. A model for Li-Fraumeni syndrome. Am J Pathol 2000;157:2151-9.
365. Okumoto M, Mori N, Imai S, et al. Genetic control of the radiosensitivity of lymphoid cells for antibody formation ability in mice. J Radiat Res (Tokyo) 1994;35:179-85.
366. Pataer A, Kamoto T, Lu LM, Yamada Y, Hiai H. Two dominant host resistance genes to pre-B lymphoma in wild-derived inbred mouse strain MSM/Ms. Cancer Res 1996;56:3716-20.
367. Angele S, Hall J. The ATM gene and breast cancer: is it really a risk factor? Mutat Res 2000;462:167-78.
368. Baynes C, Healey CS, Pooley KA, et al. Common variants in the ATM, BRCA1, BRCA2, CHEK2 and TP53 cancer susceptibility genes are unlikely to increase breast cancer risk. Breast Cancer Res 2007;9:R27.
186
369. Bebb DG, Yu Z, Chen J, et al. Absence of mutations in the ATM gene in forty-seven cases of sporadic breast cancer. Br J Cancer 1999;80:1979-81.
370. Ponnaiya B, Cornforth MN, Ullrich RL. Radiation-induced chromosomal instability in BALB/c and C57BL/6 mice: the difference is as clear as black and white. Radiat Res 1997;147:121-5.
371. Storer JB, Mitchell TJ, Fry RJ. Extrapolation of the relative risk of radiogenic neoplasms across mouse strains and to man. Radiat Res 1988;114:331-53.
372. Ullrich RL, Bowles ND, Satterfield LC, Davis CM. Strain-dependent susceptibility to radiation-induced mammary cancer is a result of differences in epithelial cell sensitivity to transformation. Radiat Res 1996;146:353-5.
373. Ponnaiya B, Cornforth MN, Ullrich RL. Induction of chromosomal instability in human mammary cells by neutrons and gamma rays. Radiat Res 1997;147:288-94.
374. Liu X, Holstege H, van der Gulden H, et al. Somatic loss of BRCA1 and p53 in mice induces mammary tumors with features of human BRCA1-mutated basal-like breast cancer. Proc Natl Acad Sci U S A 2007;104:12111-6.
375. Peretz S, Jensen R, Baserga R, Glazer PM. ATM-dependent expression of the insulin-like growth factor-I receptor in a pathway regulating radiation response. Proc Natl Acad Sci U S A 2001;98:1676-81.
376. Rasheed N, Wang X, Niu QT, Yeh J, Li B. Atm-deficient mice: an osteoporosis model with defective osteoblast differentiation and increased osteoclastogenesis. Hum Mol Genet 2006;15:1938-48.
377. Muller WJ, Sinn E, Pattengale PK, Wallace R, Leder P. Single-step induction of mammary adenocarcinoma in transgenic mice bearing the activated c-neu oncogene. Cell 1988;54:105-15.
378. Reinhard MC, Mirand EA, Goltz HL, Hoffman JG. Mouse-strain differences in response to radiation. Proc Soc Exp Biol Med 1954;85:367-70.
379. Hanson WR, Fry RJ, Sallese AR, Frischer H, Ahmad T, Ainsworth EJ. Comparison of intestine and bone marrow radiosensitivity of the BALB/c and the C57BL/6 mouse strains and their B6CF1 offspring. Radiat Res 1987;110:340-52.
380. Duran-Struuck R, Dysko RC. Principles of bone marrow transplantation (BMT): providing optimal veterinary and husbandry care to irradiated mice in BMT studies. J Am Assoc Lab Anim Sci 2009;48:11-22.
187
381. Duran-Struuck R, Hartigan A, Clouthier SG, et al. Differential susceptibility of C57BL/6NCr and B6.Cg-Ptprca mice to commensal bacteria after whole body irradiation in translational bone marrow transplant studies. J Transl Med 2008;6:10.
382. Cosaceanu D, Budiu RA, Carapancea M, Castro J, Lewensohn R, Dricu A. Ionizing radiation activates IGF-1R triggering a cytoprotective signaling by interfering with Ku-DNA binding and by modulating Ku86 expression via a p38 kinase-dependent mechanism. Oncogene 2007;26:2423-34.
188
BIOGRAPHICAL SKETCH
Lisa was born to Fred and Nancy Dyer in Melbourne, Florida. During her
childhood Lisa frequented her father’s seafood business where she would hang out in
the lab and “help” test for seafood contamination. This led her to become interested in
science. In high school, she began taking her first elective science courses and upon
entering college at the University of Florida she majored in microbiology and cell
science. After graduating, her Aunt Marie died of breast cancer and this gave Lisa the
drive necessary to pursue a medical science graduate degree. After working as a
cytogenetic technologist for 2 years, Lisa was accepted to the University of Florida’s
interdisiplinary research program and began breast cancer research under her mentor,
Dr. Kevin Brown. Lisa plans on becoming a clinical cytogenetic laboratory director after
obtaining her PhD.