towards a phylogeny for astragalus section caprini ... · pdf fileoriginal article towards a...

ORIGINAL ARTICLE

Towards a phylogeny for Astragalus section Caprini (Fabaceae)and its allies based on nuclear and plastid DNA sequences

Mehrshid Riahi • Shahin Zarre • Ali Aasghar Maassoumi •

Shahrokh Kazempour Osaloo • Martin F. Wojciechowski

Received: 7 August 2010 / Accepted: 28 January 2011 / Published online: 15 March 2011

� Springer-Verlag 2011

Abstract We conducted phylogenetic analyses of the

sect. Caprini and its closely related sections within

Astragalus. Analyses of a combined dataset including

nrDNA ETS and three cpDNA markers using maximum

parsimony and Bayesian inference from 44 species of sect.

Caprini and its allied taxa yielded congruent relationships

among several major lineages. These results largely dis-

agree with previously recognized taxonomic groups, most

notably in the following ways: (1) subsects. Caprini and

Purpurascentes of sect. Caprini are not natural groups; (2)

sects. Alopecuroidei and Laxiflori are nested within sect.

Astragalus; and (3) subsect. Chronopus constitutes a sep-

arate phylogenetic lineage. Representatives of sects.

Astragalus, Alopecuroidei, and Laxiflori share a common

ancestor with that of sect. Caprini. Our studies indicate that

Astragalus annularis is an outlier species for the genus

Astragalus and sect. Caraganella is the first-diverging

clade within the genus Astragalus. Results of these analy-

ses are supported by morphology and suggest the need for

new taxonomic delimitations, which are forthcoming. Key

morphological characters were mapped onto the phyloge-

netic tree and discussed.

Keywords Astragalus � sect. Alopecuroidei � sect.

Caprini � sect. Laxiflori � cpDNA � ETS rDNA

Introduction

Astragalus L. (Fabaceae), with over 2,500 species world-

wide, is the largest genus of flowering plants (Mabberley

2008) and phylogenetically belongs to the IRLC (inverted

repeat-lacking clade) of Fabaceae (Wojciechowski et al.

1999, 2000; Wojciechowski 2005; Kazempour Osaloo

2007). The species of the genus are distributed almost

throughout the world except for Australia (Lewis et al. 2005).

Section Caprini DC., with about 280 species, is the largest

of 150 accepted sections that comprise Old World Astraga-

lus (Podlech 1986, 1988; Maassoumi 1998). The majority of

species of sect. Caprini occur in subalpine and alpine areas of

northern Eurasia, from Western Europe and North Africa to

Central Asia where the highest diversity occurs in Afghan-

istan. Iran could be considered as a secondary center of

species diversity (Podlech 1986) of the section. These spe-

cies form important elements of mountain steppe vegetation

in these regions and include a number of important forage

plants (Maassoumi 1989). Section Caprini is morphologi-

cally unique in the genus in having basifixed hairs; thickly

textured unilocular, bilocular, or semi-bilocular legumes; as

well as relatively large yellow flowers arranged in rather

few-flowered short inflorescences.

Section Caprini was established by De Candolle (1825),

but on the basis of morphological characters, the section

has been subdivided into informal groups by different

M. Riahi � S. Zarre (&)

Department of Plant Sciences, School of Biology,

College of Science, University of Tehran,

P.O. Box 14155-6455, Tehran, Iran

e-mail: [email protected]

A. A. Maassoumi

Department of Botany, Research Institute of Forests

and Rangelands, P.O. Box 13185-116, Tehran, Iran

S. Kazempour Osaloo

Department of Plant Biology, Faculty of Biological Sciences,

Tarbiat Modares University, P.O. Box 14115-175, Tehran, Iran

M. F. Wojciechowski

School of Life Sciences, Arizona State University, Tempe,

AZ 85287, USA

123

Plant Syst Evol (2011) 293:119–133

DOI 10.1007/s00606-011-0417-3

authors (Bunge 1869; Goncharov et al. 1965). A compre-

hensive taxonomic treatment covering all species in the

section was performed by Podlech (1988), who recognized

the following subsections, each organized further into

informal groups: (1) Caprini, with morphologically heter-

ogeneous species (ca. 180 spp.); (2) Goncharovaliella

(Kamelin) Podlech, with three to eight series of verticillate

leaflets (ca. 16 spp.); (3) Erionotus (Bunge) Podlech, with a

cotton-like indumentum on the upper surface of leaflets (ca.

15 spp.); and (4) Purpurascentes Podlech, with the floral

keel petal very finely toothed on its upper margins (ca. 70

spp.). The delimitations of these informal groups were

mainly based on combinations of vegetative and repro-

ductive character states, such as the presence of a legume

stipe, indumentum of the inflorescence, and presence of a

septum in the fruit. Although taxonomic treatments of the

Iranian species were published by Maassoumi (1989,

2003), in the absence of an infrasectional classification of

sect. Caprini, the debate about group delimitation and

phylogeny of sect. Caprini remains unresolved.

The only molecular systematic analyses of Old World

Astragalus using DNA sequences of the nuclear internal

transcribed spacer (ITS) and plastid gene ndhF sequences

indicated eight monophyletic large groups (named ‘‘A’’ to

‘‘H’’; Kazempour Osaloo et al. 2003, 2005), which do not

overlap with the previous subgeneric classification of the

genus (Bunge 1868; Podlech 1982). Among these eight

clades, clade ‘‘A’’ is the most basal and includes repre-

sentatives of 13 sections with Caprini as the largest one.

These earlier molecular studies included only a few taxa of

sect. Caprini (9 out of 280 spp.) and provided only limited

insight into phylogenetic relationships of sect. Caprini. A

close relationship between the species of sect. Caprini and

other sections of clade A (Kazempour Osaloo et al. 2003,

2005), i.e., sects. Laxiflori Kirchhoff, Alopecuroidei DC.,

Astragalus, Aegacantha Bunge, as well as Eremophysa

Bunge, has been suggested in previous monographs of

these sections (Deml 1972; Agerer-Kirchhoff 1976; Ager-

er-Kirchhoff and Agerer 1977; Ott 1978; Podlech 1986).

Sect. Caraganella (Bunge) represents a very ancient paleo-

xeromorphic taxon of the genus with no close relative

within Astragalus (Podlech 1975, 1998). However, based

on molecular studies (Kazempour Osaloo et al. 2003,

2005), the phylogenetic relationships between these sec-

tions remained largely unclear due to large polytomies and

low support of the groups. The most important conclusions

drawn from these results are that sect. Caprini is (1) not

monophyletic and (2) forms a weakly supported group with

one representative each of sect. Pendulina Gontsch. and

sect. Aegacantha. In addition, subsect. Erionotus is

monophyletic, and all representatives of sects. Astragalus,

Eremophysa, Alopecuroidei, and Laxiflori constitute a

single clade with low internal resolution.

Hitherto no molecular phylogenetic study has focused

on the species-rich section Caprini. This paper reports

phylogenetic analyses of the nuclear ribosomal external

transcribed spacer (ETS) and the three plastid markers, the

trnY (GUA)-trnT (GGU) (trnY/T) region, the trnS (GCU)-

trnG (UCC) (trnS/G) region, and the psbA-trnH spacer for

44 species of sect. Caprini and its allies. ETS and two

plastid spacers (trnS/G and psbA-trnH) have not been used

previously for phylogenetic analysis in Astragalus. The

main purposes of the study are (1) to examine the evolu-

tionary relationships within sect. Caprini and among sect.

Caprini and other closely related sects. Astragalus,

Alopecuroidei, Laxiflori, and Caraganella; (2) to determine

if sect. Caprini is monophyletic and to identify mono-

phyletic units within this section; (3) to determine whether

the phylogeny based on molecular data is congruent with

the current classification and the evolutionary sequence

proposed (Podlech 1982, 1999); and (4) to trace the evo-

lution of some taxonomically important morphological

features in order to assess their value in revealing phylo-

genetic relationships. While the main focus of this study is

on sect. Caprini, we have included A. annularis Forssk. to

examine the position of this species as a potential outlier

for the genus Astragalus and to evaluate the previous

studies on the position of this species (Kazempour Osaloo

et al. 2005; Wojciechowski 2005).

Materials and methods

Taxon sampling

A total of 44 taxa were included in this study (Appendix).

Sectional information and total species numbers are based

on Podlech (1986, 1988). Our sampling strategy focused on

sect. Caprini and included a set of 30 species belonging to

three out of four subsections of sect. Caprini. Our sampling

included representatives from 13 of 52 informal groups.

We emphasized taxon sampling in large species groups in

order to examine the monophyly of these groups. Species

were selected to give more complete representation of the

morphological range of the section. Multiple accessions

were sampled for A. pinetorum subsp. pinetorum to assess

possible intraspecific variation in this widespread species.

A second focus was on the closely related sects.

Astragalus, Alopecuroidei, Laxiflori, and Caraganella.

However, we did not sample from sects. Aegacantha and

Pendulina (endemic to Afghanistan), for which material

was not available. The sampling in sect. Alopecuroidei

aimed to encompass almost all species groups (three out of

four species groups) (Ranjbar et al. 2002) and included 4

out of 33 species belonging to sect. Alopecuroidei. We

sampled 1 of 3 species of sect. Caraganella, 1 of 7 species

120 M. Riahi et al.

123

of sect. Laxiflori, 2 of 16 species of subsect. Chronopus,

and 1 of 40 species of subsect. Astragalus. Species were

intended to represent the whole morphological range of the

sections. It was felt that the final sample size (except in

subsect. Astragalus) was sufficient to test the monophyly of

each section and to clarify the phylogenetic relationships

between them.

According to previous phylogenetic studies on the genus

Astragalus, one species of each of the following genera,

Colutea (C. buhsei [Boiss.] Shap.), Oxytropis (O. aucheri

Boiss.), Halimodendron (H. halodendron [Pall.] Voss.),

and Chesneya (C. astragalina Jaub. & Spach) was selected

as a member of the outgroup (Sanderson and Wojcie-

chowski 1996; Kazempour Osaloo et al. 2005).

Character-state optimization

Based on principal morphological criteria for delimitation

of sections and subsections, six morphological characters

were selected for optimization on the combined molecular

phylogeny by using Mesquite version 1.12 (Maddison and

Maddison 2006) to allow for discussion of the evolution of

these characters in a phylogenetic context. Morphological

features (listed below in Fig. 4) were scored from speci-

mens in the collection of the Central Herbarium of Uni-

versity of Tehran (TUH). Three of these characters have

two states and others are multistate.

Molecular methods

Total genomic DNA was extracted from specimens fol-

lowing the CTAB extraction protocol (Murray and

Thompson 1980) with modifications in which a lower

EDTA concentration (20 mM instead of 50 mM) and a

higher b-mercaptoethanol concentration (1% instead of

0.4%) in the extraction buffer was used (Riahi et al. 2010).

Sequences of the PCR primers, with corresponding refer-

ences, are listed in Table 1. The four plastid regions were

amplified in three fragments. The trnY-T spacer and trnY

intron were amplified together as the trnY/T fragment

using primers of trnT and trnY. The trnS/G spacer was

amplified using primers of trn S and trn G. The psbA-trnH

spacer was amplified using psbA and trnH primers.

The PCR reaction was performed in a 40 ll volume for

cp DNA products and in a 25 ll volume for nr DNA ETS

products containing 19 PCR buffer, 1.5 mM MgCl2,

0.1 mM of each dNTP, and 1 unit of Taq DNA polymerase

(Fermentas, Thermo Fisher Scientific). PCR procedures for

the three cpDNA regions were as follows: 3 min at 94�C,

35 cycles of 1 min at 94�C, 1 min at 53–61�C, 2 min at

72�C, and terminal elongation of 7 min at 72�C. For the

ETS region, PCR cycling parameters were 2 min at 94�C,

35 cycles of 1 min at 94�C, 1 min at 60�C, 2 min at 72�C,

and 5 min terminal elongation. For some taxa, a touch-

down PCR profile was used to eliminate nonspecific

product. The profile was set as follows: 94�C for 2 min; 2

cycles of 94�C 1 min, 60�C for 1 min and 72�C for 2 min,

followed by 12 cycles at decreasing annealing temperature

in decrements of 1�C per 2 cycles, then 1 min at 94�C, 20

cycles of 1 min at 54�C, 2 min at 72�C, and final extension

at 72�C for 5 min. Amplified PCR products were purified

using QIAquick PCR Purification kits (QIAGEN, Hilden,

Germany) and sequenced using the ABI Big-Dye Ready

Reaction kit with an ABI 3730xl DNA Analyzer 96 cap-

illary automated sequencer (Applied Biosystems, USA).

The resulting chromatograms were analyzed using the

program ChromasPro 1.41 (Technelysium).

Sequence alignment and indel coding

Each DNA region was aligned using MUSCLE under

default parameters (Edgar 2004). Obvious alignment errors

were edited manually using Mesquite version 1.12

(Maddison and Maddison 2006). A few sequences were not

obtained due to difficulties with the PCR, in which not all

DNA fragments for the particular species were sequenced.

These sequences were treated as missing data. Of the

75,856 cells in the aligned combined data matrix, 4,982

Table 1 Primers used for PCR and sequencing

Region Name F/R Sequence (50–30) Mode Reference

ETS 18S-ETS R ACTTACCACTGCATGGCTTAATCT P Baldwin and Markos (1998)

ETS-cic2F F GGATTTAATTTGTCATGCT P, S Javadi et al. (2007)

trnY/T trnT (GGU) F CTACCACTGAGTTAAAAGGG P Shaw et al. (2005)

trn Y (GUA) R CCGAGCTGGATTTGAACCA P, S Shaw et al. (2005)

trnS/G trnS F GATTAGCAATCCGCCGCTTT P Xu et al. (2000)

trnG R TTACCACTAAACTATACCCGC P, S Xu et al. (2000)

psbA-trnH psbA F ACTGCCTTGATCCACTTGGC P Hamilton (1999)

trnH R CGAAGCTCCATCTACAATGG P, S Hamilton (1999)

F Forward, R reverse, P PCR amplification, S sequencing

Phylogeny of Astragalus sect. Caprini (Fabaceae) 121

123

(6.5%) cells were scored as missing. Gaps within the

sequence data were treated as missing. However where

indels were shared by two or more ingroup taxa and could

be aligned unequivocally, they were treated as phyloge-

netically informative. Gaps of 2 base pairs (bp) or less were

removed because previous analyses of these regions dem-

onstrated that indels longer than 2 bp are not very prone to

parallelism. Indels of 3 bp and longer were coded as

independent, single, binary characters following Simmons

and Ochoterena (2000) and appended to the sequence

datasets for phylogenetic analyses. Corrected pairwise

sequence divergence per site for each nrDNA and plastid

marker was calculated for the dataset based on the best-fit

model of nucleotide sequence substitution as determined

by Akaike information criterion (AIC) method in Model-

test v. 3.06 (Posada and Crandall 1998).

Phylogenetic analyses

The DNA sequences from each molecular marker were

analyzed separately and combined in a final analysis. The

incongruent length difference (ILD) test (Farris et al. 1994)

was performed to test the combinability of the four DNA

regions. Phylogenetic analyses were conducted using

PAUP*4.0b10 (Swofford 2002) for maximum parsimony

(MP) and maximum likelihood (ML) and MrBayes version

3.1.2 (Ronquist and Huelsenbeck 2003) for Bayesian infer-

ence (BI). MP and BI analyses were conducted on both

separate and combined (total evidence analysis) datasets. For

MP analyses, heuristic searches were performed with 1,000

replicates of random stepwise addition and tree bisection

reconnection (TBR) branch swapping with the MULTREES

option in effect. In order to prevent PAUP* from crashing,

the options CHUCK and CHUCKSCORE were used. Sup-

port for individual clades was determined by bootstrap

analyses (Felsenstein 1985) of 1,000 replicates, each with 10

random stepwise addition replicates and TBR branch

swapping with MULTREES on. All equally most parsimo-

nious trees were summarized into a strict consensus tree.

The ML analyses were conducted using a heuristic

search, invoking the as-is option in PAUP*. The substitu-

tion models for ML and Bayesian analyses were obtained

using Modeltest v. 3.06 applying the AIC method. TVM

with gamma distribution rates was identified as best fitting

the sequence data of ETS. For the trnS/G region, TVM?I

was identified as the best fitting model and K81uf?G as the

best model for the trnT/Y and the combined dataset. For

the combined plastid dataset (the three plastid markers), a

K81uf?I?G model was used and for the combined

molecular dataset (nuclear and plastid dataset together), a

K81uf?G model. The gaps recoded as binary data were

analyzed under the F81 evolutionary model (Felsenstein

1981), according to Ronquist et al. (2005).

The BI analyses were conducted using the selected

model of evolution (with uniform priors) and four chains

(one cool and three heated). Chains were allowed to run for

1.0 9 106 generations, and trees were sampled from the

cool chain every 100 generations. In all analyses average

standard deviation of split frequencies had dropped sig-

nificantly below 0.01 (about 0.006) after completion of the

generations. After discarding trees yielded before likeli-

hood stationary (burn-in = 2,000), the remaining 8,000

trees were summarized in a 50% majority rule consensus

tree, using posterior probabilities (PP) as a measure of

clade support.

Test of hypothesis and alternative topology

We used the SH test (Shimodaira and Hasegawa 1999)

to compare the best ML trees recovered from analyses of

the combined molecular data with the constraint topol-

ogies based on existing hypotheses of the monophyly for

each of the two sections Astragalus and Alopecuroidei

constructed in Treeview version 1.6.6 (Page 1996). The

trees were loaded as a backbone into PAUP*. Heuristic

searches were conducted using the ML parameters out-

lined above to find the shortest trees compatible with

constraint. The likelihood score of the best ML tree was

then compared with the score of the best ML tree using

the one-tailed nonparametric SH tests. As a result, the

nuclear gene tree indicates Astragalus is not monophy-

letic, in conflict with the cpDNA tree and morphological

evidence (see the ‘‘Discussion’’ section). The SH test

was performed on the nrDNA ETS dataset to test whe-

ther anomalous placement of A. annularis is significantly

favored over the phylogenetic hypothesis that other evi-

dence suggests.

Results

Aligned DNA sequences

The length and composition of each DNA region

sequenced, as well as the tree statistics from separate and

combined analyses of the four regions, are summarized in

Table 2. Sequence identity for amplified ETS was con-

firmed by comparison with the sequences obtained from

Medicago rigidula (L.) All. and Vicia sativa L. available in

GenBank. No evidence of paralogous sequences was found

for ETS sequences because all PCR products were resolved

as a single band and no polymorphisms due to SNPs pro-

cesses could be identified in sequencing (Brumfield et al.

2003). After introducing gaps and eliminating ambiguous

characters, a 543 bp matrix was generated. Gaps were not

included in the analyses as binary characters.

122 M. Riahi et al.

123

For plastid regions, sequence identity was confirmed

by comparison with the corresponding loci in A. canad-

ensis L., A. coluteocarpus Boiss., and Medicago trunca-

tula Gaertn. available in GenBank. In trnS/G, there was a

section between 320 and 620 bp that could not be

sequenced due to presence of a large poly A/T region. A

poly-A/T tail of 80–100 bp was also detected in all out-

group species and one Astragalus species (A. reshadensis

Podlech). For these, raw forward and reverse sequences

were assembled. The cpDNA regions were aligned with

low ambiguity, although numerous gaps were introduced.

A number of large indels were observed in the psbA-trnH

intergeneric spacer (IGS). There was a large deletion of

115 bp in all Astragalus species except in A. reshadensis.

In trnS/G alignment, A. pseudobrachystachys Sirj. &

Rech. f., A. mozaffarianii Maassoumi, A. kashmarensis

Maassoumi & Podlech, A. nephtonensis Freyn, and A.

macropelmatus Podlech shared an identical insertion of

14 bp. Topologies were unaffected when these indels

were excluded from analyses (data not shown). Following

exclusion of all ambiguous sites, the final aligned length

of the cpDNA data was 1,112 bp, and 11 gaps were

included in the analyses as binary characters. The

matrices are available as NEXUS files upon an email

request to the first author.

Multiple accessions were sampled for A. pinetorum

subsp. pinetorum to assess possible intraspecific variation

in this widespread species. In this case sequences were

identical and only one of them was used for the phyloge-

netic reconstruction.

Individual DNA analyses

For each of the four datasets analysed in this study, MP and

ML ingroup topologies were identical to those obtained

under Bayesian analyses.

The nrDNA ETS dataset placed A. annularis as the

sister taxon (BS = 70%, PP = 1.00) to a clade composed

of Colutea buhsei and Oxytropis aucheri. Relationships

between remaining clades were largely unresolved and

unsupported with regard to the ingroup topology (Fig. 1).

In general, topology of all three plastid datasets as well as

the combined plastid dataset was congruent (Fig. 2).

In the combined plastid dataset analyses, Astragalus

formed a monophyletic group with high support. Within

the Astragalus clade, two species of subsect. Chronopus

Table 2 Data set and tree statistics from separate and combined analyses of the nuclear and three chloroplast regions

Nuclear (NR) sequences Plastid (CP) sequences NR ? CP

ETS trnT/Y trnS/G psbA-trnH Combined

CP

Sequences (n) 43 43 43 35 44 44

Length range (bp) 530–565 598–650 330–670 129–402 NA NA

Aligned length (including informative indels) (bp) 543 549 370 193 1,112 1,655

GC content mean, ingroup (%) 50 31.6 29.1 24.0 29.8 35.9

GC content mean, outgroup included (%) 49.7 31.7 66.9 24.3 29.8 35.9

Sequence divergence, ingroup (%) 0.00–17.5 0.00–4.57 0.00–7.73 0.00–6.24 0.00–5.19 0.00–8.70

Sequence divergence, outgroup included (%) 7.06–36.54 1.69–78.99 4.76–32.12 5.79–52.55 5.06–68.98 5.40–40.39

Average sequence divergence, ingroup (%) 8.75 2.28 3.86 3.12 2.59 4.35

Average sequence divergence, outgroup included (%) 14.28 38.65 13.68 23.38 31.96 19.32

Variable sites, ingroup (n) 122 59 54 20 133 262

Variable sites, outgroup included (n) 238 186 111 97 394 639

Potentially informative characters, ingroup (%) 31 24 28 9 61 99

Potentially informative characters, outgroup (%) 108 50 48 40 138 235

Unambiguously coded indels (n) NA 8 2 1 11 11

Coded indel size range (bp) NA 1–8 1–3 3 1–8 1–8

Ratio of coded indels to potentially informative sites NA 1:6 1:24 1:40 1:12 1:21

CI of MPTs 0.83 0.88 0.84 0.89 0.82 0.81

CI of MPTs (excluding uninformative characters) 0.72 0.71 0.71 0.79 0.64 0.65

RI of MPTs 0.78 0.84 0.85 0.83 0.76 0.74

Number of MPTs 1,110 363 8,500 6 92,900 98,200

Length of MPTs 337 233 157 128 552 917

CI Consistency index, RI retention index, MPTs most parsimonious trees, NA not applicable


123

included in our analysis were resolved together in a sup-

ported group, while all members of sect. Astragalus sub-

sect. Astragalus as well as sects. Laxiflori and

Alopecuroidei formed a well resolved clade. Furthermore,

A. citrinus Bunge was the first-diverging clade within sect.

Caprini (Fig. 2, PP = 0.58) along with A. rufescens Freyn

(Fig. 2, PP = 0.65). These two species formed the sister

group to all species of sect. Caprini.

Fig. 1 Strict consensus tree

obtained from analysis of

nrDNA ETS sequences of

Astragalus sect. Caprini and its

allies. Nonparametric bootstrap

values of [50% from 1,000

replicates and Bayesian

posterior probabilities are

indicated above and below thebranches, respectively

124 M. Riahi et al.

123

Combined DNA analyses

Trees derived from separate analyses of each of the plastid

and nuclear DNA regions were shown to be significantly

incongruent according to the ILD test (P = 0.01). How-

ever, the topologies obtained were congruent at a confi-

dence limit of 70% BS, exemplifying the difference

between characters and topological incongruences (Allard

and Carpenter 1996). Because no hard incongruence was

found, the inclusion of all DNA regions into a single

analysis should maximize the explanatory power regardless

of the level of character incongruence between datasets

detected with the ILD (Yoder et al. 2001; Darlu and Le-

cointre 2002; Hipp et al. 2004).

Parsimony analysis and Bayesian inference gave very

similar results. The strict consensus tree is shown in Fig. 3.

Fig. 2 Fifty percent majority

rule consensus tree derived from

analysis of the combined plastid

trnY/T, trnS/G, and psbA-trnH

sequences of Astragalus sect.

Caprini and its allies.

Nonparametric bootstrap values

of [50% from 1,000 replicates

and Bayesian posterior

probabilities are indicated aboveand below the branches,

respectively


123

Fig. 3 Strict consensus tree

resulting from phylogenetic

analysis [tree length, 917 steps;

consistency index (CI), 0.81;

retention index (RI), 0.74] of

combined cpDNA and nrDNA

ETS sequences of Astragalussect. Caprini and its allies.

Nonparametric bootstrap values

of [50% from 1,000 replicates

and Bayesian posterior

probabilities are indicated aboveand below the branches,

respectively. Informal groups of

sect. Caprini are indicated

before the species name with asymbol

126 M. Riahi et al.

123

Coding of indels as binary characters generally increased

the statistical support for the clades, both in the MP and

Bayesian analyses.

A. annularis is the first-diverging lineage (Fig. 3,

BS = 97%, PP = 1.00), followed by A. reshadensis

(Fig. 3, BS = 100%, PP = 1.00). A. reshadensis formed

the sister clade to sects. Astragalus, Alopecuroidei, and

Laxiflori, which received weak support (Fig. 3, BS = 62%,

PP = 0.54). Phylogenetic relationships among species of

the sects. Astragalus, Alopecuroidei, and Laxiflori were

fully resolved and comprised two subclades. One of them

was formed by members of sect. Astragalus subsect.

Chronopus with high support (Fig. 3, BS = 100%,

PP = 1.00), the other, also with high support (Fig. 3,

BS = 92%, PP = 1.00), included all representatives of

sect. Astragalus subsect. Astragalus, as well as sects.

Alopecuroidei and Laxiflori.

The species of Caprini analyzed here constitute a single

clade (clade Caprini) (Fig. 3, BS = 72%, PP = 1.00),

indicating that this section is monophyletic. The two sub-

sects. Caprini and Purpurascentes were not monophyletic;

the species of subsect. Purpurascentes, i.e., A. rufescens, A.

macroplematus, A. kashmarensis, and A. nephtonensis,

were placed among the species of subsect. Caprini. Infor-

mal groups were also not monophyletic, as some members

of a certain informal group nested within a clade including

the majority of species belonging to other groups (Fig. 3).

In clade Caprini, A. citrinus, A. rufescens, the group

formed by A. antalyensis A. Duran & Podlech and A.

pellitus Bunge, and the group that included the remaining

species from sect. Caprini constitute a polytomy. In this

clade, A. pseudoibicinus Maassoumi & Podlech, A. ker-

manschahensis Bornm., and A. gypsicolus Maassoumi &

Mozaffarian formed a weakly supported group (Fig. 3,

PP = 0.86) that is sister to another weakly supported group

(Fig. 3, PP = 0.61) comprising the other 23 analyzed taxa

of sect. Caprini. Although relationships within the Caprini

clade were largely unresolved and unsupported, some

species of sect. Caprini formed seven well to moderately

supported groups (A1–A7) (Fig. 3).

Discussion

The present study represents the most comprehensive

phylogenetic analysis of Astragalus sect. Caprini based on

three plastid markers as well as nrDNA ETS sequences.

Although taxon sampling was limited, the three subsections

found in Iran, the presumed secondary center of diversity

of sect. Caprini (Podlech 1986), and representatives of

other sections that have been considered to be closely

related, are represented. The results of the phylogenetic

reconstruction performed here are significant at various

levels, despite incomplete resolution in sect. Caprini, and

are discussed below.

Relationships among sects. Caraganella, Astragalus,

Alopecuroidei, and Laxiflori

In agreement with previous phylogenetic studies in

Astragalus based on combined analysis of plastid trnL-F

and ndhF as well as nrDNA ITS sequences (Kazemi et al.

2009), the results presented here show A. reshadensis, a

representative of sect. Caraganella, as the first-diverging

lineage within clade ‘‘A’’ sensu Kazempour Osaloo et al.

(2003, 2005) (Fig. 3). Section Caraganella as defined by

Podlech (1975) includes only three species. This spiny

subshrubby section has both basifixed and medifixed hairs.

Podlech (1998) regarded sect. Caraganella as ‘‘phyloge-

netically isolated’’ and morphologically anomalous within

the genus.

In accordance with Kazempour Osaloo et al. (2003,

2005), our results suggest the monophyly of sect. Astrag-

alus subsect. Chronopus (Fig. 3). The members of this

section are characterized by indurated or spiny leaf rachis,

free stipules, and completely bilocular and cylindrical pods

with hard leathery valves that might be in turn falcate and

striate on the surface (Fig. 4, characters 1 and 2). This

subsection has been widely recognized as section Chron-

opus (Bunge 1869; Goncharov et al. 1965; Maassoumi

2003), but recently Podlech (1999) reduced it to subsection

rank. Our present data suggest this subsection as sister to a

group consisting of sect. Astragalus subsect Astragalus,

sect. Alopecuroidei, and sect. Laxiflori (Fig. 3). The spe-

cies of this group share a unique and unambiguous 5 bp

deletion in trnT/Y. This group, which is monophyletic, can

be recognized by fruit synapomorphies: smaller pods

compared with the members of subsect. Chronopus cov-

ered by a mixture of long and short hairs. A distinctive

character for Astragalus subsect. Astragalus is the presence

of white or brown hairs, but this trait is also found in some

members of sect. Alopecuroidei. Zarre (2003) suggested

that the character ‘‘hair color’’ seems to be a reliable one

for assessing phylogenetic relationships at species level.

Consistent with previous studies (Kazempour Osaloo et al.

2003, 2005), our data clearly show that none of the sections

Astragalus, Alopecuroidei, and Laxiflori forms a natural

group as currently circumscribed by Podlech (1999).

Constraining sect. Astragalus to be monophyletic requires

eight more steps (parsimony analysis), and this topology

has a lower likelihood value (one-tailed SH test; significant

values P = 0.016).

Nested among sect. Astragalus species is the strongly

supported clade of sects. Alopecuroidei and Laxiflori, a find-

ing consistent with results of Kazempour Osaloo et al. (2003,

2005). Constraining Alopecuroidei to be monophyletic


123

(i.e., excluding sect. Laxiflori) would add 18 more steps to the

tree length, and this topology has a significantly lower like-

lihood value (SH test; significant values P = 0.002). Sect.

Laxiflori can be distinguished by the loose raceme from sect.

Alopecuroidei (Agerer-Kirchhoff and Agerer 1977; Podlech

1999). The monophyly of this group (subsect Astragalus, sect.

Alopecuroidei, and sect. Laxiflori) is not surprising because

these species share several morphological characters such as

caulescent, head-like inflorescence, yellow corolla, a more or

less inflated fruiting calyx, and bilocular fruit. Therefore, they

have been considered closely related (Agerer-Kirchhoff

1976). Subsection Astragalus is distributed mostly in dry

regions, from Western Europe and North Africa far into

central Asia, with its centers of diversity in Afghanistan and

the western Orient and Turkey (Podlech 1986). A similar

pattern of distribution is evident for sect. Alopecuroidei

(Becht 1978). In our phylogenetic hypothesis, representatives

of sects. Astragalus, Alopecuroidei, and Laxiflori are derived

from a common ancestor (Fig. 3).

Relationships within sect. Caprini

The monophyly of sect. Caprini (BS = 72, PP = 1.00), as

well as its close relationship to sects. Astragalus, Alopec-

uroidei, and Laxiflori, is supported in this study. Section

Caprini shares a common ancestor with sects. Astragalus,

Fig. 4 Optimization of six

morphological characters of

taxonomic importance in

Astragalus mapping on

dichotomous Bayesian

inference tree derived from

analyses of molecular data.

Numbers above branchesindicate the characters

according to the list, while the

trait states are indicated belowthe branches. Characters and

trait states: 1 stipules—all free

(0), basally connate (1), connate

for more than 2 mm (2); 2spines—rachis nonindurated

(0), rachis indurated (1); 3 stem

internodes—more than 4 cm

(0), less than 4 cm (1); 4 keel

teeth—absent (0), present (1); 5fruit septum—unilocular (0),

semibilocular (1), bilocular (2);

6 calyx shape—campanulate

(0), broadly tubular and inflated

(1), tubular and gibbous (2)

128 M. Riahi et al.

123

Alopecuroidei, and Laxiflori, a finding that is confirmed by

many morphological similarities. Agerer-Kirchhoff (1976)

suggested a close relationship among sects. Astragalus,

Alopecuroidei, Eremophysa, Laxiflori, and Caprini based

on similarities in morphological characters. Among their

shared features, we mapped fruit septum and calyx shape

traits. Both characters, however, show homoplastic nature

(Fig. 4, characters 5 and 6), indicating their low phyloge-

netic value.

Podlech (1999) believed that sect. Caprini is closely

related to the sect. Aegacantha mainly based on spiny taxa

presented in both sections. The recent analyses of nrDNA

ITS sequences also confirm a close relationship between

these two sections (Kazempour Osaloo et al. 2003, 2005),

but the trait ‘‘spiny leaf rachis’’ appears to be derived at

several positions inside sect. Caprini and outside it (Fig. 4,

character 2).

The only member of subsect. Erionotus, A. citrinus, is

nested within a basal-branching clade in sect. Caprini in

the combined analysis (Fig. 3). This subsection has a

restricted distribution in Iran, and is most widely

distributed in Afghanistan (Podlech 1986). Presence of

cotton-like indumentum on the upper surface of leaflets is a

synapomorphy not otherwise known in Old World

Astragalus. This subsection has been treated as sect.

Erionotus in the past (Bunge 1869; Goncharov et al. 1965),

but Podlech (1999) reduced this section to subsection rank

within sect. Caprini. Our data corroborate Podlech’s view

of the submersion of sect. Erionotus into sect. Caprini

(Podlech 1986).

The phylogenetic study presented here does not support

the monophyly of subsect. Purpurascentes, as this sub-

section is clearly nested within subsect. Caprini (Fig. 3).

Most species of this subsection are restricted to Afghani-

stan (Podlech 1986). The most important morphological

synapomorphy of Purpurascentes should be the unique

feature of finely toothed corolla keel. However, this trait is

derived at least five times in sect. Caprini (Fig. 4, character

4) and thus is considered to be of low importance.

Despite little resolution within sect. Caprini, the results

of analyses performed are in agreement with seven groups

(Fig. 3) within sect. Caprini (although sometimes with low

support). Group A1 includes A. pellitus (belonging to

informal A. pellitus group) and A. antalyensis (of uncertain

species group) with moderate support (BS = 68%,

PP = 0.95). A distinctive synapomorphy of this group is

the bilocular pod with a septum not reaching the top of the

fruit and with striate as well as papery valves. Furthermore,

the pods in this group of species are covered by long soft

hairs. A second well-supported clade (BS = 87%,

PP = 1.00), the A2, consists of A. pseudoibicinus

(belonging to A. angustiflorus group), A. kermanschahensis

(belonging to A. caprinus group), and A. gypsicolus

(uncertain species group). The synapomorphies for this

clade are the incompletely bilocular pods, with leathery

valves that are densely covered by curly hairs. Group A3

consists of A. impexus Podlech (belonging to the A. pine-

torum group), A. kirpicznikovii Grossh. (belonging to the A.

exscapus group), A. macropelmatus (belonging to the A.

macropelmatus group), A. pseudobrachystachys (belonging

to the A. flexus group), A. kashmarensis, and A. nephton-

ensis (belonging to the A. macronyx group). The group is

well resolved, and its monophyly is strongly supported

(BS = 91%, PP = 1.00). The morphological synapomor-

phies of this third group are the incompletely bilocular

pods with papery valves that are covered by long soft hairs.

This group is additionally supported by a unique insertion

(30 bp) in the trnS/G marker. Group A4 is represented by

A. johannis Boiss. (belonging to the A. pinetorum group),

and A. neo-podlechi Maassoumi (belonging to the A. in-

durescens group) but with low support (BS = 59%,

PP = 0.91). The morphological features supporting this

group are bilocular pods with papery valves that are cov-

ered with sparse, short, and soft hair. Group A5

(BS = 78%, PP = 1.00) includes A. multijugus DC.

(belonging to the A. pinetorum group), A. apricus Bunge

(belonging to the A. pinetorum group), and A. mozaffarianii

(belonging to the A. amygdalinus group). A. multijugus is

sister to other members of this clade (PP = 0.75). This

group can be distinguished by bilocular pods with papery

valves that are densely covered with long and soft hairs.

Two more clades were resolved in the obtained trees of

combined sequence analyses. The first one comprised A.

aegobromus Boiss & Hohen. (belonging to the A. ovinus

group) and A. gaubae Bornm. (belonging to the A. caprinus

group) (PP = 0. 95), which are characterized by a complete

bilocular pod possessing semi-leathery valves marked with

prominent striate venations and covered by long soft hairs.

The second clade is represented by A. leonardii Maassoumi

and A. remotijugus Boiss. & Hohen. (belonging to A. ovinus

group) (PP = 0.87), and characterized by completely

bilocular pods with leathery valves that are glabrous and

striate. Interspecific relationships of the other ten species

remain unclear as they are unresolved in a polytomy.

Phylogenetic position of A. annularis

In principal agreement with earlier studies (Kazempour

Osaloo et al. 2003, 2005; Kazemi et al. 2009), the results of

the nrDNA ETS sequence analyses presented here place A.

annularis as sister to a clade comprising Colutea and

Oxytropis (Fig. 1). In contrast, the plastid data place this

taxon as sister to all other Astragalus taxa (Fig. 2). Con-

straining Astragalus to be monophyletic based on nuclear

sequence data requires no additional step, and surprisingly

the likelihood of the constrained topologies is not


123

statistically lower (SH test; P value from 0.999 to 0.212).

There is no unique important synapomorphy that could

support the placement of A. annularis within Coluteineae

(Podlech 1999). Based on molecular evidence, Wojcie-

chowski (2005) concluded that A. pelecinus plus A. epi-

glottis, and most likely A. annularis, comprise the most

basal branching lineage within Astragalus. These species

differ from all other members of the genus by having very

short flowers (not exceeding 5 mm), five fertile stamens, as

well as densely papillose short hairs on pods and calyces

(Liston and Wheeler 1994; Wojciechowski et al. 1999;

Kazempour Osaloo et al. 2003; Taeb et al. 2007). This

analysis provides clear evidence that A. annularis is placed

in a well supported basal branching position in Astragalus.

Morphological characters

All characters that have been considered to be of major

taxonomic value in Astragalus were found to be subject to

homoplasy (Fig. 4). Nonetheless, considerable correlations

are distinguished between well to moderately supported

groups and features of fruits such as pod septum (uniloc-

ular, incompletely bilocular, nearly bilocular, bilocular),

valve texture (papery, semi-leathery, leathery), valve sur-

face (striate, smooth), and valve indumentum (hairless,

curly hair, long and soft hairy, short and soft hairy). No

other morphological character could be significantly cor-

related with these groupings. It seems, therefore, that pod

morphology may be a better indicator of phylogenetic

relationships within sect. Caprini and its allies than floral,

leaf, or stipule morphology.

Conclusion and future research perspectives

Our phylogenetic analyses strongly suggest that the current

classification (Podlech 1999) does not properly reflect the

phylogeny of sect. Caprini and allied sections. Apart from

pod characters, other morphological characters are not

helpful in shaping a new classification for sect. Caprini and

its closest relatives. Sanderson (1991) also observed an

evolutionary significance of pod structure within North

American Astragalus. Morphological features of the pod

have not historically been important characters in the

classification of Old World Astragalus, but in this study

they could provide a number of criteria that are still useful

in identifying monophyletic groups in sect. Caprini and

related sections.

Being mostly incongruent with Podlech’s (1999) sec-

tional and infrasectional circumscriptions, our results sug-

gest some taxonomic revisions may be necessary in

Astragalus; for example, sects. Astragalus, Laxiflori, and

Alopecuroidei should not be considered as separate

sections. In addition, all subsections and informal groups of

sect. Caprini investigated here were not reflected as

monophyletic. This degree of incongruence of phylogenies,

traditional classifications, and intrasectional delimitations

indicates that classifications based on single morphological

characters are problematic in genera such as Astragalus.

Poor resolution within sect. Caprini in our phylogenetic

analyses may be explained by rapid and/or very recent

diversification (Zhang et al. 2009; Scherson et al. 2008).

Therefore, different molecular techniques or markers such

as AFLPs or ISSRs, or more variable genomic regions, may

have to be applied in order to confidently resolve rela-

tionships at this level of relatedness.

The present work sheds new light on interpretations of

systematic relationships within sect. Caprini and its rela-

tives and the role that the fruit may play in driving the

evolution of these sections. Sampling of more individuals

is necessary to confirm the monophyletic groups presented

in this paper. Future research might reveal still more

complex patterns in the evolution of sect. Caprini and its

relatives.

Acknowledgments The authors are indebted in Prof. Dr. D. Podlech

(Munich) for his critical comments and suggestions. We thank the

following: Dr. F. Attar, Dr. H. Ebrahimzadeh, Dr. V. Niknam, and

M. Mirmasoumi (Department of Plant Sciences, University of Teh-

ran) for providing lab facilities. We are grateful to the curators of

Central Herbarium of University of Tehran (TUH) and the Herbarium

of Research Institute of Forests and Rangelands (TARI) for the loan

of materials and permission to extract DNA from selected specimens.

Grants from the Research Council, as well as Council of International

Office of the University of Tehran to S.Z. are gratefully acknowl-

edged. Alexander von Humboldt Stiftung (Germany) also supported

S.Z. through a generous scholarship.

Appendix

List of investigated specimens, with GenBank accession

numbers for the ETS, psbA-trnH, trnY/T, trnS/G region,

including voucher numbers. Sections and species of

Astragalus are in alphabetical order. All specimens are kept

in the Central Herbarium of Tehran University (TUH). All

sequences are new for this study.

Genbank accession number of taxa

For species whose markers were sequenced during this

study, complete voucher information as well as GenBank

accession numbers are given. All samples were collected

mostly in Iran and the vouchers are deposited in Tehran

University Herbarium (TUH). Where the country is not

indicated, the specimen was collected from Iran.

Astragalus section Alopecoroidei: A. alopecias Pall.,

Khorrassan, Mashahad, 21906, JF409729, JF409766,

130 M. Riahi et al.

123

JF409808, JF409852; A. jessenii Bunge, Tehran, Damav-

and, 7727, JF409742, JF409779, JF409822, JF409865; A.

ponticus Pall., Kordestan, Kamyaran, 9737, JF409752,

JF409790, JF409835, JF409878; A. echinops Boiss.,

Lorestan, Khorramabad, 23723, JF409737, JF409775,

JF409849, JF409860.

Astragalus section Annulares: A. annularis Forssk.,

Arak, 28828, JF409730, JF409768, JF409809, JF409850.

Astragalus section Astragalus: A. dacylocarpus Boiss.

subsp. dactylocarpus, Khuzestan, Masjed-Soleyman,

33598, JF409894, JF409773, JF409816, JF409858; A.

vanillae Boiss., Isfahan, Zarrin-Shahr, 54838; A. siversi-

anus Pall., Khorasan, Quchan, 27320, JF409758,

JF409798, JF409842, JF409886.

Astragalus section Caprini: A. aegobromus Boiss. &

Hohen., Tehran, Shemshak, 11617, JF409728, JF409767,

JF409807, JF409851; A. antalyensis A.Duran & Podlech,

Antalya, Akseki, Turkey, 2792 (GAZI), JF409731, -,

JF409810, JF409853; A. apricus Bunge, Azarbaiejan,

Marand, Mishou-Dagh, 55246, -, JF409896, JF409811,

JF409854; A. avicennicus Parsa, Hamadan, Avaj, 66443,

JF409732, JF409769, JF409812, JF409855; A. caprinus L.,

Turkey, Sanliorfa, Gurbaba merkii, 2319 (GAZI),

JF409733, JF409770, JF409813, JF409856; A. chrysan-

thus Boiss. & Hohen., Tehran, Damavand, 21283,

JF409734, JF409771, JF409814, JF409857; A. citrinus

Bunge, Gorgan, Mayamey to Golestan Forest, 27307,

JF409735, JF409772, JF409815, -; A. gaubae Bornm.,

Lorestan, Khorramabad, Veisslan, 23730, JF409738,

JF409776, JF409818, JF409861; A. gypsicola Maassoumi

& Mozaffarian, Khuzestan, Masjed Solyman, 70190,

JF409739, JF409777, JF409819, JF409862; A. impexus

Podlech, Hamadan, Kuh-e Alvand, 64925, JF409740, -,

JF409820, JF409863; A. ischredensis Bunge, Chaharma-

hal-e Bakhtiari, Broujen, 7750, JF409741, JF409778,

JF409821, JF409864; A. johannis Boiss., Shiraz, Dasht-

Arjan, 7751, JF409897, -, JF409823, JF409866; A. kash-

marensis Maassoumi & Podlech, Golestan, Golestan

National Park, 24404, JF409743, JF409780, JF409824,

JF409867; A. kermanschahensis Bornm., Lorestan, Esla-

mabad, 64383, JF409895, JF409781, JF409825, -; A. kir-

picznikovii Grossh., Azarbaijan, Ahar, 55358, JF409744,

JF409782, JF409826, JF409868; A. leonardii Maassoumi,

Lorestan, Khorramabad, 23734, JF409745, JF409783,

JF409827, JF409869; A. macropelmatus Bunge subsp.

macropelmatus, Esfahan, Abyane, 18213, JF409746,

JF409784, JF409848, JF409870; A. mozaffarianii Maas-

soumi, Azarbaijan, 64475, JF409747, JF409785, JF409828,

JF409871; A. multijugus DC., Azarbaiejan, Marand, Iran,

9752, JF409748, -, JF409829, JF409872; A. neopodlechi

Maassoumi, Yazd, Taft, 5972, JF409760, JF409829,

JF409873, -; A. nephtonensis Freyn, Golestan, Golestan


JF409874; A. ovinus Boiss., Chaharmahal-e Bakhtiari,

Brujen, 54905, JF409750, JF409787, JF409832, JF409875;

A. pellitus Bunge, Khorassan, Birjand, 22203, JF409765,

JF409788, JF409833, JF409876; A. pinetorum Boiss.

subsp. pinetorum Gilan, Deylaman, 18589, JF409751,

JF409789, JF409834, JF409877; A. pseudobrachystachys

Sirj. & Rech.f., Semnan, Firuzkuh, 5729, JF409753, -,

JF409837, JF409879; A. pseudoibicinus Maassoumi &

Podlech; Chaharmahal-e Backhtiari, Brujen, 57184,

JF409754, JF409791, JF409836, JF409880; A. remotijugus

Boiss. & Hohen., Mazanderan, Haraz, 6287, JF409755,

JF409792, JF409838, JF409881; A. rufescens Freyn, Shi-

raz 5541, -, JF409795, -, JF409883; A. touranicus Freitag

& Podlech, Balouchestan, Iranshahr, 9112, JF409757,

JF409797, JF409841, JF409885; A. vereskensis Maasso-

umi & Podlech, Semmnan, Damghan, 23711, JF409759,

JF409799, JF409843, JF409887.

Astragalus section Caraganella: A. reshadensis Pod-

lech, Farah, Afghanistan, 70152 (MSB), JF409756,

JF409793, JF409839, JF409882.

Astragalus section Laxiflori: A. dictyolobus Bunge,

Kordestan, Divan Darreh, 34594, JF409736, JF409774,

JF409817, JF409859.

Outgroups: Chesneya astragalina Jaub. & Spach,

Tehran, Eivanakey, 5551, JF409761, JF409800, JF409844,

JF409888; Colutea buhsei (Boiss.) Shap., Gorgan, Park-e

Golestan, 5865, JF409762, JF409802, JF409845,

JF409889; Halimodendrun halodendrun (Pall.) Voss.,

Tehran, Karaj, 28284, JF409763, JF409803, JF409846,

JF409891; Oxytropis aucheri Boiss., Golestan, Golestan


JF409890.

References

Agerer-Kirchhoff C (1976) Revision von Astragalus L. sect. Astra-

galus (Leguminosae). Boissiera 25:1–197

Agerer-Kirchhoff C, Agerer R (1977) Eine neue Sektion der Gattung

Astragalus L.: Laxiflori Agerer-Kirchhoff. Mitt Bot Staatssamml

Munchen 13:203–234

Allard MW, Carpenter JM (1996) On weighting and congruence.

Cladistics 12:183–198

Baldwin BG, Markos S (1998) Phylogenetic utility of the external

transcribed spacer (ETS) of 18S-26S rDNA: congruence of ETS

and ITS trees of Calycadenia (Compositae). Mol Phylogenet

Evo 10:449–463

Becht R (1978) Revision der Sektion Alopecuroidei DC. der Gattung

Astragalus. Phanerogamarum Monographiae X. Cramer, Vaduz

Brumfield RT, Beerli P, Nickerson DA, Edwards SV (2003) The

utility of single nucleotide polymorphisms in inferences of

population history. Trends Ecol Evol 18(5):249–256

Bunge A (1868) Generis Astragali species Gerontogeae. Mem Acad

Imp Sci Saint Petersburg 11:1–140

Bunge A (1869) Generis Astragali species Gerontogeae. Mem Acad

Imp Sci Saint Petersbug 15:1–254


123

Darlu P, Lecointre G (2002) When does the incongruence length

difference test fail? Mol Biol Evol 19:432–437

De Candolle AP (1825) Notice sur quelques genres et especes

nouvelles de legumineuses, extraite de divers Memoires

presentes a la Societe d’Histoire naturelle de Geneve, pendant

le cours des annees 1823 et 1824. Ann Sci Natur 4:90–103

Deml I (1972) Revision der Sektionen Acanthophace Bunge und

Aegacantha Bunge der Gattung Astragalus L. Boissiera

21:1–235

Edgar RC (2004) MUSCLE: multiple sequence alignment with high

accuracy and high throughput. Nucleic Acids Res

32(5):1792–1797

Farris JS, Kallersjo M, Kluge AG, Bult C (1994) Testing significance

if incongruence. Cladistics 10:315–319

Felsenstein J (1981) Evolutionary tree from DNA sequences: a

maximum likelihood approach. J Mol Evol 17:368–378

Felsenstein J (1985) Confidence limits on phylogenies: an approach

using the bootstrap. Evolution 38:783–791

Goncharov NF, Borisova AG, Gorshkova SG, Popov MG, Vas-

ilchenko IT (1965) Astragalus. In: Komarov VL, Shishkin BK

(eds) Flora of the USSR, vol 12. Israel Program for Scientific

Translations/Smithsonian Institution and the National Science

Foundation, Jerusalem/Washington, pp 1–918

Hamilton MB (1999) Four primer pairs for the amplification of

chloroplast intergenic regions with intraspecific variation. Mol

Ecol 8:521–523

Hipp AL, Hall JC, Sytsma KJ (2004) Phylogenetic accuracy,

congruence between data partitions, and performance of the

ILD. Syst Biol 53:81–89

Javadi F, Wojciechowski MF, Yamaguchi H (2007) Geographical

diversification of the genus Cicer (Leguminosae: Papilionoideae)

inferred from molecular phylogenetic analyses of chloroplast and

nuclear DNA sequences. Bot J Linn Soc 154(2):175–186

Kazemi M, Kazempour Osaloo S, Maassoumi AA, Rastegar Pouyani

E (2009) Molecular phylogeny of selected Old World Astragalus(Fabaceae): incongruence among chloroplast trnL-F, ndhF and

nuclear ribosomal DNA ITS sequences. Nord J Bot

27(12):425–436

Kazempour Osaloo S (2007) Phylogenetic relationships in the inverted

repeat lacking clade (IRLC) of papilionoid legumes based on

nrDNA ITS sequences. In: Abstract book. First National Plant

Taxonomy Conference of Iran, Tehran, pp 106–107

Kazempour Osaloo S, Maassoumi AA, Murakani N (2003) Molecular

systematics of the genus Astragalus L. (Fabaceae): phylogenetic

analysis of nuclear ribosomal DNA internal transcribed spacers

and chloroplast gene ndhF sequences. Pl Syst Evol 242:1–32

Kazempour Osaloo S, Maassoumi AA, Murakani N (2005) Molecular

systematics of the Old World Astragalus (Fabaceae) as inferred

from nrDNA ITS sequence data. Brittonia 57:367–381

Lewis GP, Schrire BD, Mackinder BA, Lock M (2005) Legumes of

the world. Royal Botanic Gardens, Kew, pp 475–481

Liston A, Wheeler JA (1994) The phylogenetic position of the genus

Astragalus (Fabaceae): evidence from the chloroplast genes

rpoC1 and rpoC2. Biochem Sys Ecol 22:377–388

Maassoumi AA (1989) The genus Astragalus in Iran, vol 2. Jahad-e

Sazandgi Research Institute of Forests and Rangelands, Tehran

Maassoumi AA (1998) Astragalus in the Old World check-list.

Research Institute of Forests and Rangeland, Tehran

Maassoumi AA (2003) Papilionaceae I (Astragalus), vol 43. Research

Institute of Forests and Rangelands, Tehran

Mabberley DJ (2008) Mabberley’s plant-book. A portable dictionary

of plants, their classification and uses, 3rd edn. Cambridge

University Press, Cambridge

Maddison DR, Maddison WP (2006) Mesquite, a modular system

for evolutionary analysis. http://mesqiteproject.org/mesquite/

mesquite.html

Murray MG, Thompson WF (1980) Rapid isolation of high molecular

weight plant DNA. Nucleic Acids Res 8:4321–4326

Ott E (1978) Revision der Sektion Chronopus Bge. der Gattung

Astragalus L. Phan Monogr, vol 9. Cramer, Vaduz

Page RDM (1996) TREEVIEW: an application to display phyloge-

netic trees on personal computers. Comp Appl Biosci

12:357–358

Podlech D (1975) Revision der Sektion Caraganella Bunge der

Gattung Astragalus L. Mitt Bot Staatssamml Munchen

12:153–166

Podlech D (1982) Neue Aspekte zur Evolution und Gliederung der

Gattung Astragalus L. Mitt Bot Staatssamml Munchen

18:359–378

Podlech D (1986) Taxonomic and phytogeographical problems in

Astragalus of the Old World and southwest Asia. Proc R Soc

Edinb 89:37–43

Podlech D (1988) Revision von Astragalus L. sect. Caprini DC.

(Leguminosae). Mitt Bot Staatssamml Munchen 25:1–924

Podlech D (1998) Phylogeny and progression of characters in Old

World Astragali (Leguminosae). In: Zhang A, Wu S (eds)

Floristic characteristics and diversity of East Asian plants. China

Higher Education Press, Beijing, pp 405–407

Podlech D (1999) Papilionaceae III: Astragalus I. In: Rechinger KH

(ed) Flora Iranica, vol 174. Akademische Druck-u. Verlagsan-

stalt, Graz, pp 1–350

Posada D, Crandall KA (1998) Model test: testing the model of DNA

substitution. Bioinformatics 14:817–818

Ranjbar M, Maassoumi AA, Podlech D (2002) Astragalus sect.

Alopecuroidei (Fabaceae) in Iran, complementary notes with a

key to the species. Willdenowia 32:85–91

Riahi M, Zarre S, Maassoumi AA, Attar F, Kazempour Osaloo S

(2010) An inexpensive and rapid method for extracting papilio-

noid genomic DNA. Genet Mol Res 9:1334–1342

Ronquist F, Huelsenbeck JP (2003) MrBayes 3: Bayesian phyloge-

netic inference under mixed models. Bioinformatics

19:1572–1574

Ronquist F, Huelsenbeck JP, Van der Mark P (2005) MrBayes 3.1

manual. http://mrbayes.csit.fsu.edu/mb3.1_manual.pdf

Sanderson MJ (1991) Phylogenetic relationships within North Amer-

ican Astragalus L. (Fabaceae). Syst Bot 16:414–430

Sanderson MJ, Wojciechowski MF (1996) Diversification rates in a

temperate legume clade: are there ‘‘so many species’’ of

Astragalus (Fabaceae)? Am J Bot 83:1488–1502

Scherson RA, Vidal R, Sanderson MJ (2008) Phylogeny, biogeogra-

phy, and rates of diversification of New World Astragalus(Leguminosae) with an emphasis on South American radiations.

Am J Bot 95:1030–1039

Shaw J, Lickey E, Beck JT, Farmer SB, Liu W, Miller J, Siripun KC,

Winder CT, Schilling EE, Small RL (2005) The tortoise and the

hare II: relative utility of 21 noncoding chloroplast DNA

sequences for phylogenetic analysis. Amer J Bot 92:142–166

Shimodaira H, Hasegawa M (1999) Multiple comparisons of log-

likelihoods with applications to phylogenetic inference. Mol Biol

Evol 16:1114–1116

Simmons MP, Ochoterena H (2000) Gaps as characters in sequence-

based phylogenetic analyses. Syst Biol 49:369–381

Swofford DL (2002) PAUP*. Phylogenetic analysis using parsi-

mony,* and other methods. 4.0b10. Sinauer Associates,

Massachusetts

Taeb F, Zarre S, Podlech D, Tillich HJ, Kazempour Osaloo S,

Maassoumi AA (2007) A contribution to the phylogeny of

annual species of Astragalus (Fabaceae) in the Old World using

hair micromorphology and other morphological characters.

Feddes Repert 118:206–225

Wojciechowski MF (2005) Astragalus (Fabaceae): a molecular

phylogenetic perspective. Brittonia 57:382–396

132 M. Riahi et al.

123

http://mesqiteproject.org/mesquite/mesquite.html

http://mesqiteproject.org/mesquite/mesquite.html

http://mrbayes.csit.fsu.edu/mb3.1_manual.pdf

Wojciechowski MF, Sanderson MJ, Hu JM (1999) Evidence on the

monophyly of Astragalus (Fabaceae) and its major subgroups

based on nuclear ribosomal DNA ITS and chloroplast DNA trnL

intron data. Syst Bot 24:409–437

Wojciechowski MF, Sanderson MJ, Steele KP, Liston A (2000)

Molecular phylogeny of the ‘‘temperate herbaceous tribes’’ of

papilionoid legumes: a super tree approach. In: Herendeen P,

Bruneau A (eds) Advances in legume systematics, part 9. Royal

Botanic Garden, Kew, pp 277–298

Xu DH, Sakai AJ, Kanazawa M, Shimamoto A, Shimamoto Y (2000)

Sequence variation of non-coding regions of chloroplast DNA of

soybean and related wild species and its implications for the

evolution of different chloroplast haplotypes. Theor Appl Genet

101:724–732

Yoder AD, Irwin JA, Payseur BA (2001) Failure of the ILD to

determine data combinability for slow loris phylogeny. Syst Biol

50:408–424

Zarre S (2003) Hair micromorphology and its phylogenetic applica-

tion in the phylogeny of Astragalus. Bot J Linn Soc 143:323–330

Zhang M, Kang Y, Zhou L, Podlech D (2009) Phylogenetic origin of

Phyllolobium with a further implication for diversification of

Astragalus in China. J Integr Plant Biol 51:889–899


123

towards a phylogeny for astragalus section caprini ... · pdf fileoriginal article towards a...

Documents