JOURNAL OF VIROLOGY, Aug. 1988, p. 2896-29020022-538X/88/082896-07$02.00/0Copyright © 1988, American Society for Microbiology

Unique Requirement for the PyF441 Mutation for PolyomavirusInfection of F9 Embryonal Carcinoma Cells

RICHARD W. TSENG,lt TREVOR WILLIAMS,2 AND FRANK K. FUJIMURAlt*

Cancer Research Center, La Jolla Cancer Research Foundation, La Jolla, California 92037,1 and Howard HughesMedical Institute, Department ofBiochemistry, University of California, Berkeley, California 947202

Received 15 January 1988/Accepted 25 April 1988

A point mutation at nucleotide 5258 in the enhancer of the polyomavirus host range mutant F441 permitsproductive infection of F9 embryonal carcinoma cells, which, when undifferentiated, are refractory to infectionby wild-type polyomavirus. Synthetic oligonucleotides were used to construct viral genomes containing all fourpossible nucleotide pairs at nucleotide 5258. While all four of the viruses infected 3T6 cells efficiently, onlyF441, which has a guanosine in place of the wild-type adenosine in the early strand of DNA at position 5258,was able to infect F9 cells. Transfection assays with enhancer-dependent plasmid constructs expressing thechloramphenicol acetyltransferase gene under the control of the polyomavirus early promoter verified that onlythe F441 enhancer had any significant activity in F9 cells. DNase I footprinting showed that the F441 mutationcreates a strong binding site for purified CCAAT box transcription factor, which is identical to nuclear factor1. The three other mutations at nucleotide 5258 alter the affinity and the quality of factor binding at this site.

The polyomavirus enhancer offers a unique means ofanalyzing cell-specific gene expression. Mouse embryonalcarcinoma (EC) cells, the stem cells of teratocarcinomas, arerefractory to infection by wild-type polyomavirus (41). How-ever, several different mutations within the viral enhancerregion enable polyomavirus to grow on a variety of EC celllines (13, 24, 25, 38). These mutations (deletions, insertions,and point mutations) are highly specific for particular celllines. For example, an A. T to G C transition at nucleotide(nt) 5258 in the polyomavirus A3 strain genome (6) issufficient for productive infection of F9, but not PCC4, ECcells (13). This point mutation, found in the genome of thepolyomavirus host range mutant F441, appears to be criticalfor infection of F9 cells, as it has been observed in virtuallyevery polomavirus host range mutant selected for growth onthis EC cell line (13, 24, 38). Some of these mutants havetandem duplications of viral DNA sequences encompassingnt 5258, so that their DNAs contain two copies of the F441mutation. These mutants infect F9 cells more efficiently thanF441 does. It has been postulated that the A to G transitionin the F441 enhancer may either create a new binding site fora positive regulatory factor (19, 26) or destroy the site ofinteraction of a negative factor present in F9 cells (37).Indeed, these two possibilities are not necessarily mutuallyexclusive, and it is possible that both mechanisms occur. Toanalyze further how sequence alterations at nt 5258 affectpolyomavirus expression in F9 cells, we have constructedthe two other possible point mutations by site-directedmutagenesis. The biological effects of these two mutationswere compared to those of wild-type and F441 sequences,

with respect both to the enhancement of transient expressionof the bacterial chloramphenicol acetyltransferase (cat) genein recombinant constructs and to the infection of F9 and 3T6cells by complete viral genomes constructed with thesemutations. By these criteria, the F441 mutation alone, andnot the three other possible mutations at nt 5258, is func-

* Corresponding author.t Present address: SIBIA, San Diego, CA 92138.t Present address: Nichols Institute, 26441 Via De Anza, San

Juan Capistrano, CA 92675.

tional in F9 cells. Furthermore, we show by DNase Ifootprinting analyses that purified human CCAAT box tran-scription factor (CTF) (22) is capable of distinguishing be-tween the active F441 template and the three other se-

quences.

MATERIALS AND METHODS

Cell cultures and virus infections. Methods for culturingand virus infection of F9 and 3T6 cells have been describedpreviously (13). All cell cultures were grown in Dulbeccomodified minimal essential medium containing 4.5 mg ofglucose per ml and 10% fetal bovine (F9) or calf (3T6) serum.Infected cultures of 3T6 cells were maintained in the above-described medium with 5% calf serum. For blot analyses, F9(multiplicity of infection, 50) or 3T6 (multiplicity of infec-tion, 1) cells were infected, and viral DNA was isolated bypreviously described methods (13) at 72 (F9) or 48 (3T6) hafter infection. DNA samples were digested with BamHI tolinearize polyomavirus DNA, fractionated on 1% agarosegels, blotted onto nitrocellulose filters, and assayed byhybridization by standard methods (31). The probe forhybridizations was prepared by randomly primed synthesisof wild-type polyomavirus DNA with [a-32P]dCTP (2,000Ci/mmol; New England Nuclear Corp.), Klenow enzyme(Promega Biotec), and mixed-oligonucleotide primers (Phar-macia Molecular Biologicals) by the method of Feinberg andVogelstein (11).

Recombinants. The substrate for site-directed mutagenesiswas the 1.2-kilobase BamHI (nt 4658)-SacI (nt 589) fragmentof wild-type polyomavirus DNA cloned into the correspond-ing sites in the polylinker of M13mpl9. The cat expressionvectors pXOPCATT and pAOPCATT (see Fig. 3) are de-scribed elsewhere (44). Briefly, these vectors are derivativesof pUC18 containing the replication origin and early pro-moter region of polyomavirus (nts 5293 to 183), the HindIII-BamHI fragment containing the cat gene and the simianvirus 40 (SV40) splice sites from pSVO-cat (16), and thepolyadenylation signal (nts 2784 to 2986) of polyomavirus. Inaddition, pAOPCATT contains the A enhancer (BclI-PvuIIfragment; nts 5047 to 5155) in the natural orientation withrespect to the other polyomavirus sequences. Both cat

2896

Vol. 62, No. 8

on February 4, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

NUCLEOTIDE 5258 OF POLYOMAVIRUS DNA 2897

TABLE 1. Transfection assays

CAT activityb in:

Inserta F9 cells with: 3T6 cells with:

pX plasmid pA plasmid pX plasmid pA plasmid

None 0.33 (1.0) 0.86 (1.0) 0.75 (1.0) 15.46 (1.0)A enhancer' 0.69 (2.1 + 0.6) NA 25.63 (34.2 ± 12.1) NAWild type 0.44 (1.3 + 0.4) 9.74 (11.3 ± 8.0) 3.74 (5.0 ± 2.3) 19.17 (1.2 ± 0.1)F441 2.62 (7.9 + 2.7) 21.81 (25.4 ± 16.7) 15.68 (20.9 ± 7.2) 23.81 (1.5 ± 0.1)Gl 0.36 (1.1 ± 0.3) 1.44 (1.7 ± 1.3) 2.59 (3.5 ± 1.7) 6.65 (0.4 ± 0.1)J2 0.23 (0.7 ± 0.2) 1.81 (2.1 ± 1.2) 2.03 (2.7 ± 1.7) 7.42 (0.5 ± 0.1)

a All PvuII4 inserts are single copies in the natural orientation with respect to the other polyomavirus sequences in these constructs.b The CAT activities are expressed as the percent transfer of radioactivity from labeled acetyl coenzyme A to chloramphenicol after 2 h at 37°C as assayed by

the method of Sleigh (39). The numbers in parentheses represent activities + standard deviations normalized for each series of experiments to the activity of thevector without a B enhancer (PvuII-4 fragment) insert. All transfections within one series of experiments were performed concurrently, and the data shown foreach series of experiments represent the average of at least two separate transfections. Experiments in separate series were not performed concurrently, so thatvalues in different columns are not strictly comparable.

c Values are for pAOPCATT run in parallel with the pX series of plasmids. NA, Not applicable.

vectors contain an SmaI linker to allow insertion of the Benhancer by blunt-end ligation of the appropriate PvuII-4fragment of polyomavirus DNA.

Site-directed mutagenesis. Mutants were constructed bythe two-primer method of Zoller and Smith (50) with appro-priate mutagenic oligomers corresponding to nts 5246 to 5267and a protecting primer corresponding to nts 62 to 80 ofpolyomavirus DNA. Oligomers were synthesized to have thesame sequence as the late sense strand of polyomavirusDNA and were used with the M13mpl9 recombinant de-scribed above to construct the Gl and J2 mutants (see Fig.1). Potential mutants were identified by plaque hybridizationto the appropriate kinase-labeled mutagenic oligonucleotide,replaqued twice, and verified by DNA sequencing by thedideoxy method (36).

Reconstruction of viral genomes. The mutated polyoma-virus BamHI (nt 4658)-BglI (nt 109) fragments from thereplicative-form DNA of appropriate M13 constructs werepurified and ligated to the purified 4.5-kilobase BglI-BamHIfragment of wild-type polyomavirus DNA. Previous obser-vations have indicated that mutation within the B enhancerdoes not significantly affect the viability of polyomavirus infibroblasts if the A enhancer is not modified (30, 34, 45, 46).Because only the B enhancer was mutated in the presentconstructs, these mutants could, in fact, be isolated byplaque purification on 3T6 cells after DNA transfection withDEAE-dextran (32) as described previously (13). After asecond round of plaque purification on 3T6 cells, resultingviruses were amplified by low-multiplicity infection of 3T6cells. The presence of the appropriate mutation in recon-structed viral genomes was verified by the rapid sequencingprocedure of Chen and Seeburg (5).

Transfections. F9 or 3T6 cells were plated at a density of 5x 105 cells per 100-mm dish 16 to 24 h before transfection.F9 cells were plated on dishes that had previously beentreated with gelatin (28). The cultures were treated with 1 mlof calcium phosphate transfection solution containing 20 p.gof the appropriate plasmid DNA. The transfection solutionwas that described by Chen and Okayama (4) exceptthat N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid(HEPES) was substituted for BES. Cultures were main-tained in the presence of the DNA-calcium phosphate pre-cipitates for 16 h. After aspiration of the medium, cells werewashed with Tris-saline (10) containing 2 mM EGTA and fedwith fresh growth medium. All transfected cell cultures weremaintained at 37°C in 4% CO2.CAT assays. The medium was aspirated from transfected

cultures, which were then placed on ice and washed twicewith ice-cold Tris-saline. Each plate of cells was scrapedwith a rubber policeman in 5 ml of Tris-saline. Cells fromtwo or three replicate plates were combined and pelleted bycentrifugation at 150 x g at 4°C. Each 100-mm plate-equivalent of cells was suspended in 0.2 ml of 0.25 M Trishydrochloride (pH 7.8). The cells were disrupted by threecycles of freezing-thawing, and lysates were treated at 650Cfor 10 min (39). After removal of debris by centrifugation,extracts were assayed for CAT enzyme activity by thenonchromatographic method of Sleigh (39) with 0.06 ml ofcell extract in a 0.1-ml reaction. Aliquots were assayed after1 and 2 h of incubation to ensure that CAT enzyme activitymeasurements were linear. Although the. absolute CATactivities fluctuated from experiment to experiment, therelative activities within one transfection experiment werereproducible. Thus, all comparisons ofCAT activities are fortransfections performed concurrently and repeated at leasttwo times. Each column of data in Table 1 represents resultsfrom concurrent transfections, so that relative values can becompared within one column of Table 1 but not necessarilybetween different columns.DNase I footprinting. Supercoiled viral DNAs were puri-

fied from infected cultures of 3T6 cells as described previ-ously (13). End-labeled probes for footprinting were pre-pared with polynucleotide kinase and [y-32P]ATP (31). Forthese experiments, 5' end labeling of the polyomavirus earlysense strand was done at a Hinfl site at nt 5099, and labelingof the late sense strand was done at a DdeI site at nt 203.DNase I footprinting (15) was performed as described byLee et al. (27) with approximately 5 ng of labeled probe and10 to 60 ng of CTF-nuclear factor 1 (NF-1) (CTF/NF-1)purified by DNA affinity chromatography (22, 23).

RESULTS

Figure 1 shows the DNA sequence of the region around nt5258 in the B enhancer of wild-type polyomavirus. MutantF441 has an A to G transition at nt 5258. The two mutantsconstructed here have an A to C (Gl) or an A to T (J2)transversion at nt 5258. These mutations were introducedinto the entire viral genome to yield mutants G1 and J2. Thereplication of G1 and J2 was compared with the replicationof the wild type and F441 in F9 and 3T6 cells. As would beexpected, all four viral genomes replicated efficiently in 3T6cells (Fig. 2B). In contrast, only F441 replicated to anysignificant level in F9 cells (Fig. 2A). The levels of viral DNA

VOL. 62, 1988

on February 4, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

2898 TSENG ET AL.

Bcl IA enhancer

PvuIIB enhancer

PvUII

ElA SV40 BPV BPV

wild-type CAAAAAGCCTCTCCACCCAGGCCTAGAATGTTTCCACCCAATCATTACTATGACAACA

F441 G

Gl

J2

C

T

NF-1 Consensus

SV40 GT-II (A) Motif

SV40 GT-I (C) Motif

TGGANNNNNGCCAMC

GTGGMTGTGTGT

GTGGAAAGTCCCCAFIG. 1. DNA sequences of polyomavirus enhancer mutants. The 245-base-pair enhancer of polyomavirus DNA is shown with the BcIl and

PvuII restriction sites. These restriction sites define two fragments designated the A and B enhancers (7). The locations of sequences in thepolyomavirus enhancer that are similar to potentially important sequences present in the enhancers of the adenovirus ElA gene (18) and theSV40 (47) and bovine papillomavirus (BPV) (29) genomes are shown. The nucleotide sequence shown is that of the early strand of wild-typepolyomavirus DNA from nts 5324 to 5292. The point mutations at nt 5258 for F441, G1, and J2 DNAs are shown below the wild-type sequence.Also shown are the consensus sequence reported for NF-1-binding sites (3, 17) and the sequences of the SV40 enhancer motifs designatedGT-I and GT-II by Zenke et al. (49) or as A and C by Herr and Clarke (20).

in F9 cells infected with Gl and J2 were similar to thoseobtained with the wild type and were approximately 50- to100-fold lower than that in F441-infected F9 cells (Fig. 2). Bycomparison with known amounts ofDNA run in parallel, weestimated that F9 cells infected with F441 at a multiplicity ofinfection of 50 PFU per cell contained approximately 104copies of viral DNA per cell after 72 h of infection at 37°C.To determine the direct effects of these mutations on B

enhancer activity, we cloned the PvuII-4 fragments of thesemutants along with those of the wild type and F441 into catvectors pXOPCATT and pAOPCATT (Fig. 3). The pX andpA series of plasmids allow analyses of the different Benhancers in either the absence or the presence, respec-tively, of the A enhancer. The levels ofCAT enzyme activityin cell extracts after transfection of F9 and 3T6 cells with

A. B.F9 3T6

1......

F- :t-r- CNl

M .,LL -)

0 4H3 'O'

-

L (5 -.

4-

FIG. 2. Replication of wild-type and mutant polyomavirusDNAs in infected F9 and 3T6 cells. Appropriate cell lines were

infected, and DNAs were isolated and analyzed by blot hybridiza-tion as described in Materials and Methods. WT, Wild type.

these plasmids are shown in Table 1. The transfection assayswith the pX series of plasmids indicated that the A enhancerwas more active than the B enhancer in 3T6 cells and thatneither the A enhancer nor the wild-type B enhancer hadsignificant activity in F9 cells. Furthermore, results with thepX series of plasmids clearly showed that the F441 mutationactivated the B enhancer for cat expression in both F9 and3T6 cells. The level of this activation was approximatelysixfold in F9 cells and fourfold in 3T6 cells. The Gl and J2mutations both reduced B enhancer activity down to, if notless than, wild-type levels for the pX series of plasmids in F9and 3T6 cells.The pA series of constructs yielded results that were

qualitatively similar to those yielded by the pX series ofconstructs. The F441 B enhancer again was clearly moreactive than the wild-type B enhancer when assayed in thepresence of the A enhancer, but the difference was lesspronounced than when activity was measured in the absenceof the A enhancer in the pX constructs. In the case of 3T6cells, this result was probably due to the high activity of theA enhancer in these cells. However, in F9 cells, even thoughthe A enhancer and the wild-type B enhancer individuallywere not active for cat expression, the pA construct with thewild-type B enhancer had about 40% the activity of theanalogous F441 construct. Although it is possible that thisresult was due to some peculiar features of these plasmidconstructs, it is also possible that elements of the A and Benhancers interact synergistically with each other. The pos-sibility of combined effects of elements in the A and Benhancers on activity was supported by the effects of the G1and J2 mutations in the pA series. These two mutations hadquite different effects from either the wild type or F441 inboth F9 and 3T6 cells. For pA constructs in F9 cells, the Gland J2 mutations virtually eliminated the activity of the Benhancer, while in 3T6 cells, these two mutations not only

J. VIROL.

on February 4, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

NUCLEOTIDE 5258 OF POLYOMAVIRUS DNA 2899

SmaI HindlIl

I P I

SmaI HindIl

I A I OP I

pAOPCATTFIG. 3. Structures of cat vectors. The broken lines represent pUC18 sequences. Both plasmids contain the replication origin (0) and early

promoter (P) of polyomavirus linked to the bacterial cat gene (CAT) and flanked by the polyadenylation signals (T) of polyomavirus. Inaddition, pAOPCATT contains the polyomavirus A enhancer (A). PvuII-4 fragments of polyomavirus were blunt-end ligated to the SmaI sitesin these plasmids, giving rise to the pX (pXOPCATT) and pA (pAOPCATT) series of constructs.

eliminated the activity of the B enhancer but also seemed toinhibit part of the activity of the A enhancer.Because the F441 mutation introduces a potential binding

site for the well-characterized DNA-binding factor NF-1 (17,35), which has recently been shown to be identical to CTF(22), we were curious whether this mutation did, in fact, leadto the binding of CTF/NF-1 to this region of the polyoma-virus enhancer. The binding of purified CTFINF-1 to theregulatory region of wild-type, F441, Gl, and J2 DNAs, asdetermined by DNase I footprinting with viral DNAs labeledin the early sense strand, is shown in Fig. 4. The one featuredistinguishing these DNAs was the protection of nts 5250 to5275 in F441 DNA. This region was not very stronglyprotected in the three other DNAs. Thus, the F441 mutationdid introduce a strong CTFINF-1-binding site into the poly-omavirus B enhancer. In addition, there were several re-gions common to all four DNAs that were protected byCTF/NF-1. These included nts 5157 to 5172, which arelocated in the late proximal side of the B enhancer, and nts69 to 93, which correspond to the CCAAT box in thepolyomavirus early promoter. Figure 5 shows the DNase Ifootprint patterns of CTF/NF-1 on the late sense strands ofwild-type and F441 DNAs. These patterns were consistentwith the footprint pattern of CTF/NF-1 on the early sensestrand, with unique protection of sequences specific tomutant F441 DNA.Although there was a clear difference in affinity between

F441 DNA and the three other DNAs for CTF/NF-1 bindingaround nt 5258, there was some indication of binding at thissite in the three other DNAs, particularly with higher con-centrations of CTF/NF-1. The binding of CTF/NF-1 to thissite in wild-type, Gl, and J2 DNAs was significantly weakerthan that to this site in F441 DNA. Titration with lowerconcentrations of CTF/NF-1 (data not shown) indicated thatthe binding affinity for this site in F441 DNA was at least20-fold greater than that in wild-type DNA. In addition to thedifference in binding affinity, the footprint patterns of thethree other DNAs around nt 5258 showed qualitative differ-ences from the F441 DNA footprint pattern. The CTFINF-1consensus binding sequence consists of two complementaryhalf sites, of which only one was mutated in these con-structs. While CTF/NF-1 strongly protected both half sitesin F441 DNA, it weakly protected only the unaltered halfsites in the three other DNAs.

DISCUSSION

The common feature of polyomavirus host range mutantsinfecting F9 cells is the F441 mutation at nt 5258. This

mutation appears to be critical for infection of F9 cells as,save for one exception (24), it has been present in everymutant infecting F9 cells described to date (13, 24, 38).Interestingly, this mutation was selected in one other in-stance. Tang et al. (43) introduced multiple point mutationswithin the polyomavirus enhancer, virtually inactivating thevirus. Revertants of the mutants, selected for growth onwhole mouse embryo cells, fell into three classes. In oneclass, some of the original nucleotides in putatively impor-tant enhancer motifs were restored, while a second class had

G-1 J-2

CTF - 1 36 - - 1 3 6 -

wt 441

1 36- 1 3 6 -

5275

5250

5172

5157

FIG. 4. DNase I footprints of CTFINF-1 on the early strands ofpolyomavirus DNAs. Wild-type (wt) and mutant DNAs were 5' endlabeled in the early sense strand at the Hinfl site at nt 5099, andDNase I footprinting was performed as described in Materials andMethods. The location of nt 5258 is indicated by the arrow, andbrackets indicate sites of protection by CTF/NF-1. Units ofCTF/NF-1 are represented by the numbers above the lanes; one unitof CTF/NF-1 corresponds to 10 ng of CTF/NF-1; -, no CTF/NF-1.

rAT

BamH I

I T -1

pXOPCATT

CAT

BamnHI

I T l

VOL. 62, 1988

nt 5258 _so

on February 4, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

2900 TSENG ET AL.

wt 441

r1 ---I -CTF - 1 3 6 - - t 3 6 -.. ..e '' IIJI XW SE* z : e _E*-- s @$\ \# x,9. w Ss *g*. S ijF Ss ] t .4 ..r s i'S<W _ _ Bo *nt 5258_ --tS _ ''

r _*

t':§F:* *.F# Z :<:: tbilssPF - wR-- .F-Um....m m:-ks -- ^

sS: x - -:eZ : -- - w - -

.: :::.... suS

esse

....I s-.

5250

5275

_ 69

93

FIG. 5. DNase I footprints of CTF/NF-1 on

polyomavirus DNAs. Wild-type (wt) and F441 5'

labeled in the late sense strand at the DdeI site

and symbols are as described in the legend

tandem duplications of the mutated enhancer

prisingly, in the third class of revertant, all of

mutations were retained, and the F441 mutation

duced at nt 5258. This revertant (Bl-5258),plaques on primary mouse embryo cells, was

infect 3T6 cells (43). Furthermore, polyomavirus

mutants isolated by several laboratories

mouse cell lines other than F9 do not have the

(1, 25, 33, 42). Thus, it appears that there

specificity of the F441 mutation for infection

possibly some early embryonic mouse cells.

results support this idea by showing that

sequence, and not the three other possible

5258 can permit polyomavirus infection

Although both the transfection and infection

clearly indicated the superiority of the F441

the three other possible sequences for enhancer

F9 cells, the difference between wild-type

ers for activation of cat expression from

transfections (Table 1) was considerably

difference between wild-type and F441

measured in vivo during infection of F9

factor contributing to this difference probably

ment of the polyomavirus enhancer for

and viral DNA replication (8, 14, 30, 34).

mutation is necessary for both early transcription and repli-cation in F9 cells (14), enhancer effects will tend to beamplified during infection, whereas transfection experimentswith the constructs used here presumably reflect enhancereffects on just transcription.Our transfection experiments suggest that the F441 muta-

tion activates the B enhancer in both F9 and 3T6 cells. Thissuggestion is consistent with the results of Herbomel et al.(19) but not with those of Linney and Donerly (28), whofound that the F441 mutation, while activating the B en-hancer more than the wild type did in F9 cells, did notincrease the activity of the B enhancer in 3T3 or mousemyoblast cells. The reason for this discrepancy is notknown, but differences in plasmid constructs with differentpromoters, in transfection methods, and in the cell lines used(3T6 versus 3T3) are among the possibilities. Our transfec-tion results support the idea suggested by Herbomel et al.(19) that the F441 mutation creates an enhancer motif thatactivates the B enhancer in both F9 and 3T6 cells. Thus, theF441 mutation is not strictly cell specific. The activation ofthe B enhancer by the F441 mutation within the context ofthe entire viral genome may be masked in 3T6 cells by thehigh activity of the A enhancer in these cells. Note that theF441 mutation does exhibit some level of cell specificity, asit cannot activate the polyomavirus enhancer in PCC4 ECcells (24, 38), indicating that whatever mechanism is used bypolyomavirus host range mutants in overcoming the block toenhancer activity in F9 cells differs from that in PCC4 cells.As has been reported by Herbomel et al. (19) and Bohnlein

et al. (2), we found that the A enhancer by itself has little, ifany, activity in F9 cells. Surprisingly, our results suggestthat the A enhancer may have a synergistic effect on theactivity of the B enhancer in F9 cells. One possibility is thatthis synergism is due to some peculiarity of our plasmidconstructs. Alternatively, it is possible that elements in theA and B enhancers do, in fact, cooperate with each other andthat the F441 B enhancer requires elements in the A en-hancer for full biological activity, at least in F9 cells. Itshould be noted that while polyomavirus host range mutantsoften have deletions of sequences in the B enhancer, nodeletions in the A enhancer have been observed. One reasonfor this is that essential sequences comprising the latepromoter and late leader sequences are located in the Aenhancer (12). A second possibility raised by the presentresults is that sequences necessary for the in vivo function-ing of the B enhancer are present in the A enhancer. Thelatter possibility is supported by the observation that the Gland J2 B enhancers are not activated in F9 cells by thepresence of the A enhancers (Table 1). Furthermore, the Gland J2 B enhancers apparently can inhibit part of the activityof the A enhancers in 3T6 cells.One explanation for the inability of wild-type polyoma-

virus to grow in F9 cells is that these cells contain negativelyacting factors that repress the viral enhancer, and the F441mutation could relieve this repression by abolishing thebinding site through which these factors act (37). Therefore,it might also be expected that other mutations at or near thissite would have an effect similar to that of F441. However,we find that the other two possible mutations at nt 5258actually seem to inhibit B enhancer function relative to thatin F441 in both F9 and 3T6 cells, suggesting that the F441mutation has some highly specific activating function for thepolyomavirus enhancer, perhaps by the creation of a new

binding site for a positively acting factor. This possibility isfurther supported by the general stimulation of B enhancerfunction by the F441 mutation in F9 and 3T6 cells, as well as

J. VIROL.

.---O-

,11;.4: ...w m

b. .-4mmdmmmbm-!._ _

on February 4, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

NUCLEOTIDE 5258 OF POLYOMAVIRUS DNA 2901

by the increase in enhancer activity resulting from tandemduplications of sequences encompassing the F441 mutation(13). Indeed, we do find that the F441 mutation creates a newhigh-affinity binding site for the human transcription andreplication factor CTF/NF-1. This strong binding site is notobserved in the three other templates. Whether a mouseanalog of CTF/NF-1 is responsible for the activation of theF441 mutant in F9 cells remains to be determined. Speck andBaltimore (40) reported that they were unable to detectCTF/NF-1 activity in crude nuclear extracts of EC cells by a

gel retardation assay with the relatively weak CTF/NF-1-binding site present in the Moloney murine leukemia virusenhancer. Their result may indicate that CTF/NF-1 is absentfrom F9 cells or that it is present in relatively low quantities.

In addition to CTF/NF-1, other factors that bind prefer-entially to the F441 sequence over the wild-type polyoma-virus sequence have been detected in crude nuclear extractsfrom F9 and other cell lines (26, 48). These factors may notbe identical to CTF/NF-1, although some or all may repre-sent related members of a possible family of CCAAT box-binding proteins (9). It should also be noted that the F441mutation creates a sequence motif resembling the putativecore sequences of the SV40 enhancer (47). These coresequences consist of two similar motifs designated GT-I or Cand GT-II or A (20, 49) (Fig. 2). Recently, it has been shownthat these two motifs bind distinct nuclear factors (48). Asequence (nts 5215 to 5221) corresponding to the GT-I motifis common to the wild-type and F441 polyomavirus Benhancers, and a purified nuclear factor from rat liver hasbeen shown to bind to this motif in both the SV40 andpolyomavirus enhancers (21). The F441 mutation creates a

binding site for a factor that also binds to the GT-II enhancermotif (48). This factor preferentially binds to the F441enhancer over the wild-type enhancer. It will be of interestto determine if the binding of this factor to the four possibletemplates at nt 5258 also correlates with the activities of therespective enhancer constructs. Finally, given the multitudeof interactions that can occur on the polyomavirus enhancer,it is possible that the stimulation of enhancer activity by theF441 mutation results from the altered binding of multiplefactors at separate domains within the polyomavirus en-

hancer and that the in vivo effect of the F441 mutation is dueto a combination of positive and negative regulatory mech-anisms.

ACKNOWLEDGMENTS

We thank C. Der and R. Maki for graciously providing plasmidDNAs and advice on site-directed mutagenesis, P. Hearing, E.Mather, N. Mermod, R. Oshima, and C. Santoro for helpfuldiscussions, and D. Lowe for help in the preparation of themanuscript.

This work was supported by Public Health Service grant R01 CA37689 from the National Institutes of Health and in part by CancerCenter core grant P30 CA 30199 from the National Cancer Institute.R.W.T. was supported by training grant T32 CA 09497 from theNational Institutes of Health. T. W. was supported by an ImperialCancer Research Fund Travelling Fellowship.

LITERATURE CITED

1. Amati, P. 1985. Polyoma regulatory region: a potential probe formouse cell differentiation. Cell 43:561-562.

2. Bohnlein, E., K. Chowdhury, and P. Gruss. 1985. Functional

analysis of the regulatory region of polyoma mutant F9-1 DNA.Nucleic Acids Res. 13:4789-4809.

3. Briggs, M. R., J. T. Kadonaga, S. P. Bell, and R. Tjian. 1986.Purification and biochemical characterization of the promoter-specific transcription factor, Spl. Science 234:47-52.

4. Chen, C., and H. Okayama. 1987. High-efficiency transforma-tion of mammalian cells by plasmid DNA. Mol. Cell. Biol.7:2745-2752.

5. Chen, E. Y., and P. H. Seeburg. 1985. Supercoil sequencing: a

fast and simple method for sequencing plasmid DNA. DNA(New York) 4:165-170.

6. Deininger, P. L., A. Esty, P. LaPorte, H. Hsu, and T. Fried-mann. 1980. The nucleotide sequence and restriction enzymesites of the polyoma genome. Nucleic Acids Res. 8:855-860.

7. De Villiers, J., and W. Schaffner. 1981. A small segment ofpolyoma virus DNA enhances the expression of a clonedbeta-globin gene over a distance of 1400 base pairs. NucleicAcids Res. 9:6251-6264.

8. De Villers, J., W. Schaffner, C. Tyndall, S. Lupton, and R.Kamen. 1984. Polyoma virus DNA replication requires an

enhancer. Nature (London) 312:242-246.9. Dorn, A., J. Bollekens, A. Staub, C. Benoist, and D. Mathis.

1987. A multiplicity of CCAAT box-binding proteins. Cell50:863-872.

10. Favaloro, J., R. Treisman, and R. Kamen. 1980. Transcriptionmaps of polyoma virus-specific RNA: analysis by two-dimen-sional nuclease Si-gel mapping. Methods Enzymol. 65:718-749.

11. Feinberg, A. P., and B. Vogelstein. 1983. A technique forradiolabeling DNA restriction endonuclease fragments to highspecific activity. Anal. Biochem. 132:6-13.

12. Flavell, A. J., A. Cowie, J. R. Arrand, and R. Kamen. 1980.Localization of the major capped 5' ends of polyomavirus latemRNAs within a single tetranucleotide sequence in the viralgenome. J. Virol. 33:902-908.

13. Fujimura, F. K., P. L. Deininger, T. Friedmann, and E. Linney.1981. Mutation near the polyoma DNA replication origin per-mits productive infection of F9 embryonal carcinoma cells. Cell23:809-814.

14. Fujimura, F. K., and E. Linney. 1982. Polyoma mutants thatproductively infect F9 embryonal carcinoma cells do not rescue

wild-type polyoma in F9 cells. Proc. Natl. Acad. Sci. USA79:1479-1483.

15. Galas, D. J., and A. Schmitz. 1978. DNAase footprinting: a

simple method for the detection of protein-DNA binding spec-ificity. Nucleic Acids Res. 5:3157-3170.

16. Gorman, C. M., L. F. Moffat, and B. H. Howard. 1982.Recombinant genomes which express chloramphenicol acetyl-transferase in mammalian cells. Mol. Cell. Biol. 2:1044-1051.

17. Gronostajski, R. M., S. Adhya, K. Nagata, R. A. Guggenheimer,and J. Hurwitz. 1985. Site-specific DNA binding of nuclearfactor I: analysis of cellular binding sites. Mol. Cell. Biol.5:964-971.

18. Hearing, P., and T. Shenk. 1983. The adenovirus type 5 ElAtranscriptional control region contains a duplicated enhancerelement. Cell 33:695-703.

19. Herbomel, P., B. Bourachot, and M. Yaniv. 1984. Two distinctenhancers with different cell specificities coexist in the regula-tory region of polyoma. Cell 39:653-662.

20. Herr, W., and J. Clarke. 1986. The SV40 enhancer is composedof multiple functional elements that can compensate for one

another. Cell 45:461-470.21. Johnson, P. F., W. H. Landschulz, B. J. Graves, and S. L.

McKnight. 1987. Identification of a rat liver nuclear protein thatbinds to the enhancer core element of three animal viruses.Genes Dev. 1:133-146.

22. Jones, K. A., J. T. Kadonaga, P. J. Rosenfeld, T. J. Kelly, and R.Tjian. 1987. A cellular DNA-binding protein that activateseukaryotic transcription and DNA replication. Cell. 48:79-89.

23. Kadonaga, J. T., and R. Tjian. 1986. Affinity purification ofsequence-specific DNA binding proteins. Proc. Natl. Acad. Sci.USA 83:5889-5893.

24. Katinka, M., M. Vasseur, N. Montreau, M. Yaniv, and D.Blangy. 1981. Polyoma DNA sequences involved in control ofviral gene expression in murine embryonal carcinoma cells.Nature (London) 290:720-722.

25. Katinka, M., M. Yaniv, M. Vasseur, and D. Blangy. 1980.Expression of polyoma early functions in mouse embryonalcarcinoma cells depends on sequence rearrangements in the

VOL. 62, 1988

on February 4, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

2902 TSENG ET AL.

beginning of the late region. Cell 20:393-399.26. Kosvedi, I., M. Satake, K. Furukawa, R. Reichel, Y. Ito, and

J. R. Nevins. 1987. A factor discriminating between the wild-type and a mutant polyomavirus enhancer. Nature (London)328:87-89.

27. Lee, W., P. Mitchell, and R. Tjian. 1987. Purified transcriptionfactor AP-1 interacts with TPA-inducible enhancer elements.Cell 49:741-752.

28. Linney, E., and S. Donerly. 1983. DNA fragments from F9 PyECmutants increase expression of heterologous genes in transfec-ted F9 cells. Cell 35:693-699.

29. Lusky, M., L. Berg, H. Weiher, and M. Botchan. 1983. Bovinepapillomavirus contains an activator of gene expression at thedistal end of the early transcription unit. Mol. Cell. Biol.3:1108-1122.

30. Luthman, H., M. G. Nilsson, and G. Magnusson. 1982. Non-contiguous segments of the polyoma genome required in cis forDNA replication. J. Mol. Biol. 161:533-550.

31. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecularcloning: a laboratory manual. Cold Spring Harbor Laboratory,Cold Spring Harbor, N.Y.

32. McCutchan, J. H., and J. S. Pagano. 1968. Enhancement of theinfectivity of simian virus 40 deoxyribonucleic acid with diethy-laminoethyl-dextran. J. Natl. Cancer Inst. 41:351-357.

33. Melin, F., H. Pinon, C. Kress, and D. Blangy. 1985. Isolation ofpolyomavirus mutants multiadapted to murine embryonal car-cinoma cells. J. Virol. 53:862-866.

34. Muller, W. J., C. R. Mueller, A. M. Mes, and J. A. Hassell. 1983.Polyomavirus origin for DNA replication comprises multiplegenetic elements. J. Virol. 47:586-599.

35. Rosenfeld, P. J., and T. J. Kelly. 1986. Purification of nuclearfactor I by DNA recognition site affinity chromatography. J.Biol. Chem. 261:1398-1408.

36. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequenc-ing with chain-terminating inhibitors. Proc. Natl. Acad. Sci.USA 74:5463-5467.

37. Sassone-Corsi, P., C. Fromental, and P. Chambon. 1987. Atrans-acting factor represses the activity of the polyoma virusenhancer in undifferentiated embryonal carcinoma cells. Onco-gene Res. 1:113-119.

38. Sekikawa, K., and A. J. Levine. 1981. Isolation and characteri-zation of polyoma host range mutants that replicate in nullipo-tential embryonal carcinoma cells. Proc. NatI. Acad. Sci. USA78:1100-1104.

39. Sleigh, M. J. 1986. A nonchromatographic assay for expression

of the chloramphenicol acetyltransferase gene in eucaryoticcells. Anal. Biochem. 156:251-256.

40. Speck, N. A., and D. Baltimore. 1987. Six distinct nuclearfactors interact with the 75-base-pair repeat of the Moloneymurine leukemia virus enhancer. Mol. Cell. Biol. 7:1101-1110.

41. Swartzendruber, D. E., and J. M. Lehman. 1975. Neoplasticdifferentiation: interaction of simian virus 40 and polyoma viruswith murine teratocarcinoma cells in vitro. J. Cell. Physiol.85:179-188.

42. Tanaka, K., K. Chowdhury, K. S. S. Chang, M. Israel, and Y.Ito. 1982. Isolation and characterization of polyoma virus mu-tants which grow in murine embryonal carcinoma and tropho-blast cells. EMBO J. 1:1521-1527.

43. Tang, W. J., S. L. Berger, S. J. Triezenberg, and W. R. Folk.1987. Nucleotides in the polyomavirus enhancer that controlviral transcription and DNA replication. Mol. Cell. Biol.7:1681-1690.

44. Tseng, R. W., and F. K. Fujimura. 1988. Multiple domains in thepolyomavirus B enhancer are required for productive infectionof F9 embryonal carcinoma cells. J. Virol. 62:2890-2895.

45. Tyndall, C., G. La Mantia, C. M. Thacker, J. Favaloro, and R.Kamen. 1981. A region of the polyoma genome between thereplication origin and late protein coding sequences is requiredin cis for both early gene expression and viral DNA replication.Nucleic Acids Res. 9:6231-6250.

46. Veldman, G. M., S. Lupton, and R. Kamen. 1985. Polyomavirusenhancer contains multiple redundant sequence elements thatactivate both DNA replication and gene expression. Mol. Cell.Biol. 5:649-658.

47. Weiher, H., M. Konig, and P. Gruss. 1983. Multiple pointmutations affecting the simian virus 40 enhancer. Science219:626-631.

48. Xiao, J. H., I. Davidson, D. Ferrandon, R. Rosales, M. Vigneron,M. Macchi, F. Ruffenach, and P. Chambon. 1987. One cell-specific and three ubiquitous nuclear proteins bind in vitro tooverlapping motifs in the domain Bi of the SV40 enhancer.EMBO J. 6:3005-3013.

49. Zenke, M., T. Grundstrom, H. Matthes, M. Wintzerith, C.Schatz, A. Wildeman, and P. Chambon. 1986. Multiple sequencemotifs are involved in SV40 enhancer function. EMBO J.5:387-397.

50. Zoller, M. J., and M. Smith. 1984. Oligonucleotide-directedmutagenesis: a simple method using two oligonucleotide prim-ers and a single-stranded DNA template. DNA (New York)3:479-488.

J. VIROL.

on February 4, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from