a gene-targeting system for pleurotus ostreatus : demonstrating the predominance of versatile

1

Applied and Environmental Microbiology (17-May-12) 1

Manuscript for review (Original paper) 2

3

A Gene-Targeting System for Pleurotus ostreatus: Demonstrating the 4

Predominance of Versatile-Peroxidase (mnp4) by Gene Replacement 5

6

Tomer M. Salame, Doriv Knop, Dana Tal, Dana Levinson, Oded Yarden, and 7

Yitzhak Hadar* 8

9

Department of Plant Pathology and Microbiology, The Robert H. Smith Faculty of 10

Agriculture, Food and Environment, The Hebrew University of Jerusalem, Rehovot 11

76100, Israel 12

13

*For correspondence: E-mail:[email protected]; 14

Tel. (+972) 8 948 9935; Fax (+972) 8 946 8785. 15

16

Running title: KU IN PLEUROTUS: INACTIVATION OF VERSATILE-17

PEROXIDASE 18

19

20

21

22

23

Copyright © 2012, American Society for Microbiology. All Rights Reserved.Appl. Environ. Microbiol. doi:10.1128/AEM.01234-12 AEM Accepts, published online ahead of print on 25 May 2012

on April 13, 2019 by guest

http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

2

ABSTRACT 24

Pleurotus ostreatus (the oyster mushroom) and other white-rot filamentous 25

basidiomycetes are key players in the global carbon cycle. P. ostreatus is also a 26

commercially important edible fungus with medicinal properties, and important for 27

biotechnological and environmental applications. Efficient gene targeting via 28

homologous recombination (HR) is a fundamental tool for facilitating 29

comprehensive gene function studies. Since the natural HR frequency in Pleurotus 30

transformations is low (2.3%), transformed DNA is predominantly integrated 31

ectopically. To overcome this limitation, a general gene-targeting system was 32

developed by producing a P. ostreatus PC9 homokaryon Δku80 strain, using 33

carboxin resistance complemented by the development of a protocol for hygromycin 34

B resistance protoplast-based DNA transformation and homokaryon isolation. The 35

Δku80 strain exhibited exclusive (100%) HR in the integration of transforming 36

DNA, providing high efficiency of gene targeting. Furthermore, the Δku80 strains 37

produced showed a phenotype similar to the wild-type PC9 strain, with similar 38

growth fitness, ligninolytic functionality and capability of mating with the 39

incompatible strain PC15 to produce a dikaryon which retained its resistance to the 40

corresponding selection and was capable of producing typical fruiting bodies. The 41

applicability of this system is demonstrated by inactivation of the versatile-42

peroxidase (VP) encoded by mnp4. This enzyme is part of the ligninolytic system of 43

P. ostreatus, being one of the nine members of manganese-peroxidase (MnP) gene 44

family, and is the predominantly expressed VP in Mn2+-deficient media. mnp4 45

inactivation provided a direct proof that it encodes a key VP responsible for the 46


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

3

Mn2+-dependent and Mn2+-independent peroxidase activity under Mn2+-deficient 47

culture conditions. 48

49

Keywords 50

Homologous recombination; Gene replacement; Knockout; Transformation; Ku; 51

Nonhomologous end joining (NHEJ); Hygromycin B resistance; Carboxin resistance; 52

Manganese-Peroxidase (MnP); Versatile-Peroxidase (VP); Lignin 53

54

INTRODUCTION 55

The genus Pleurotus comprises a group of edible ligninolytic mushrooms with 56

medicinal properties and important biotechnological and environmental applications (2). 57

The cultivation of Pleurotus spp., which has expanded in the past few years, is gaining 58

worldwide economic importance for the food industry. Pleurotus ostreatus (the oyster 59

mushroom) ranks second in the world market of industrially produced mushrooms. 60

Nutritionally, it has a unique flavor and aromatic properties and it is considered to be rich 61

in protein, fiber, carbohydrates, vitamins and minerals. Pleurotus spp. produce various 62

bioactive secondary metabolites which are of medical interest, exhibiting hematological, 63

antiviral, antitumor, antibiotic, antibacterial, hypocholesterolemic and 64

immunomodulatory activities (34). Pleurotus is a saprophyte in the wild, where it grows 65

readily on a variety of organic substrates as a decomposer, playing a key role in the 66

global carbon cycle. As a white-rot basidiomycete, one of the most important applied 67

aspects of Pleurotus spp. is related to the use of their ligninolytic system for the 68

bioconversion of woody materials and agricultural wastes into valuable products for 69


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

4

animal feed and other food products, as well as for the biodegradation of 70

organopollutants, xenobiotics and industrial contaminants (2, 34, 37). 71

Until recently, genetic manipulation and breeding of this organism was restricted 72

by a lack of knowledge about its genomic structure. In 2009, the complete genome 73

sequence of P. ostreatus was released by JGI (United States Department of Energy, 74

Office of Science, Joint Genome Institute; http://genome.jgi-psf.org (8)), providing a 75

comprehensive map for the design of gene function analyses. Identification of the genetic 76

basis of Pleurotus substrate colonization and fruiting induction would help expand the 77

range of agricultural wastes amenable to conversion using this fungus and might also 78

help improve the production of bioactive compounds. In addition, a number of 79

quantitative trait loci controlling growth rate (22), industrial quality and productivity have 80

been identified, and genomic studies would enable analysis of these genes' structures and 81

mechanisms of function. 82

The ability to manipulate P. ostreatus gene expression is an invaluable tool for the 83

dissection of gene functionality in this fungus. Honda and co-workers (13, 14) developed 84

a protoplast-based polyethylene glycol and calcium salt (PEG-CaCl2)-mediated method 85

for transformation and recombinant gene expression in P. ostreatus, based on the 86

homologous drug-resistant marker cassette Cbxr, which confers dominant resistance to 87

the systemic fungicide carboxin. This system has since been used for the homologous 88

expression of recombinant Mn2+-dependent peroxidase (mnp3) and versatile-peroxidase 89

(mnp2) genes (15, 39). However, homologous recombination (HR) has been shown to 90

occur only rarely, making gene-knockout studies difficult (13–16, 31). 91


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

5

Considering this limitation, we implemented a reverse-genetics strategy based on 92

gene silencing by RNA interference (RNAi). Knockdown of mnp3, one of the nine genes 93

comprising the mnp gene family, provided direct evidence for this family's relevance to 94

the functionality of the P. ostreatus ligninolytic system. Nevertheless, silencing via this 95

approach also resulted in ‘off-target’ effects on the expression of other mnp genes, which 96

limited the ability to pinpoint the relevance of a single gene (31, 32). Addressing this 97

question directly would require the production of specific homokaryon mnp-knockout 98

strains. 99

The availability of the genome sequence and the fact that the fungus is amenable 100

to genetic modifications make P. ostreatus accessible for comprehensive functional 101

genomics studies. To do so in a specific manner, HR of the transforming DNA is required 102

for gene-targeted procedures such as gene disruption and gene replacement. However, 103

DNA integration in filamentous fungi in general, and in Pleurotus in particular, is mainly 104

driven by nonhomologous end joining (NHEJ), resulting in ectopic integration of the 105

transformed DNA, and only a low frequency (0.1-5%) of site-specific recombination 106

(13–16, 20, 26, 31). Furthermore, the current Pleurotus protoplast-based DNA 107

transformation protocols are cumbersome, and at best produce only a few dozen 108

transformants per transformation (13–16, 31). To overcome this limitation, a general 109

gene-targeting system, with high rates of HR, is necessary to allow effective analysis of 110

gene function. 111

The most common approach to creating an efficient gene-targeting system in 112

filamentous fungi is to generate mutant strains impaired in their NHEJ mechanism. 113

Ku70/Ku80 is a DNA-binding heterodimer that forms a multiprotein complex with the 114


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

6

DNA-dependent protein kinase (DNA-PKcs), the DNA ligase IV-XRCC4 complex and 115

the exonuclease Artemis, thereby activating the NHEJ pathway. The NHEJ pathway has 116

been successfully impaired in a large number of filamentous fungi via disruption of either 117

ku70 or ku80 homologs. To date, ku-disruption strains from more than 20 different 118

species (a majority of which are Ascomycetes) have been generated, showing 119

significantly increased homologous recombination frequency (between 50% and 100%) 120

(4, 20, 24–26, 38). 121

This report describes the production and characterization of a P. ostreatus PC9 122

homokaryon Δku80 strain, using carboxin-resistance and hygromycin B-resistance as 123

dominant selectable markers. This strain exclusively exhibits HR during the integration 124

of transforming DNA, thus providing high-efficiency gene targeting when used as a 125

background strain for transformation. The applicability of this system is demonstrated by 126

inactivation of the versatile-peroxidase (VP) encoding gene mnp4. 127

128

MATERIALS AND METHODS 129

Fungal and bacterial strains and growth conditions. Pleurotus ostreatus 130

monokaryon strain PC9 (Spanish Type Culture Collection accession number 131

CECT20311), which is a protoclone derived by dedikaryotization of the commercial 132

dikaryon strain N001 (Spanish Type Culture Collection accession number CECT20600), 133

was used throughout this study (23). In addition, the corresponding incompatible 134

monokaryon strain PC15 (Spanish Type Culture Collection accession number 135

CECT20312) was used in mating trials. Fungal strains were grown and maintained in 136

YMG medium [1% w/v glucose, 1% w/v malt extract (Difco), 0.4% w/v yeast extract 137


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

7

(Difco)] (14) or GP medium [2% w/v glucose, 0.5% w/v peptone (Difco), 0.2% yeast 138

extract (Difco), 0.1% w/v K2HPO4, 0.05% w/v MgSO4·7H2O]; Mn2+ was added as 139

MnSO4 as specified (15, 31). When required, 1.5% (w/v) agar was added to the 140

appropriate medium. Liquid cultures were maintained in stationary 100-ml Erlenmeyer 141

flasks containing 10 ml media. Cultures were incubated at 28°C in the dark. The 142

inoculum for all growth conditions was one disk (5 mm diameter) of mycelium obtained 143

from the edge of a freshly grown colony in solid culture and positioned at the center of 144

the Petri dish or flask. The azo dye Orange II [4-(2-hydroxy-1-145

naphthylazo)benzenesulfonic acid sodium salt], fungicide carboxin (Sigma-Aldrich) and 146

antibiotic hygromycin B (Alexis Biochemicals) were added to a final concentration of 147

100 mg/l, 2 mg/l (LD50 = 0.16 mg/l) and 100 mg/l (LD50 = 7 mg/l), respectively, as 148

specified. The selective compounds nourseothricin (Werner BioAgents), 149

phosphinothricin, neomycin (Sigma-Aldrich), phleomycin and zeocin (InvivoGen) were 150

added as specified. Escherichia coli JM109 cells (Promega) were used for standard 151

cloning procedures according to the manufacturer's protocol. 152

Nucleic acid manipulation and analyses. Molecular manipulations were carried 153

out on the basis of standard protocols as described by Sambrook et al. (33). Genomic 154

DNA was extracted from culture biomass first ground with dry ice in a Cryogenic Tissue 155

Grinder (BioSpec Products), and with the DNeasy Plant Mini Kit (Qiagen). PCR was 156

performed in an Eppendorf Mastercycler Gradient Thermocycler using Phusion High-157

Fidelity PCR Master Mix (Finnzymes), with the primers detailed in Table 1. Isolation and 158

purification of DNA fragments from agarose gel or PCR amplification was performed 159

using the Wizard SV Gel and PCR Clean-Up System (Promega). Cloning into plasmids 160


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

8

was performed using the pGEM-T Vector System II (Promega). Plasmid DNA was 161

purified using the QIAprep Spin Miniprep Kit (Qiagen). DNA endonuclease restriction 162

was performed with restriction enzymes from Fermentas. DIG-labeled DNA probes were 163

used for Southern blotting (Fig. 1, Table 1) according to the DIG system procedures 164

(Roche Applied Science). Total RNA was extracted from culture biomass first ground 165

with dry ice in a Cryogenic Tissue Grinder, then homogenized with QIA shredder spin 166

columns (Qiagen) and RNA was purified from the lysate using the RNeasy Plus Mini Kit 167

(Qiagen). cDNA was synthesized using SuperScript III First-Strand Synthesis System for 168

RT-PCR (Invitrogen). Comparative gene expression was evaluated by semi-quantitative 169

reverse transcription PCR (RT-PCR) with the primers detailed in Table 1. DNA 170

fragments, plasmid inserts and RT-PCR amplicons were fully sequenced at the Center for 171

Genomic Technologies of the Hebrew University of Jerusalem. 172

Construction of transforming DNA: ku80-replacement cassettes. The flanking 173

DNA (2 kb 5' and 3') of ku80 was amplified from genomic DNA, and the carboxin-174

resistance cassette (Cbxr) from plasmid pTM1 (13), using primers ku80PF and cbxF-175

ku80PR, cbxR-ku80TF and ku80TR, and ku80PR-cbxF and ku80TF-cbxR, for the 5' 176

flank, 3' flank and Cbxr cassette, respectively (Table 1). The resulting amplicons were 177

fused together using the double-joint (fusion) PCR technique (26, 42) to produce a ku80-178

replacement cassette (TMS6), which was cloned to produce plasmid pTMS6 (Fig. 1A). 179

The flanking DNA (2 kb 5' and 3') of ku80 and a 1.7-kb fragment comprising the 180

promoter region of the β-tubulin gene (3, 31) were amplified from genomic DNA, and the 181

hygromycin B-resistance gene (hph) coding sequence (CDS) from plasmid pCSN44 (36), 182

using primers ku80PF and btubPF-ku80PR, hygR-ku80TF and ku80TR, ku80PR-btubPF 183


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

9

and hygF-btubPR, and btubPR-hygF and ku80TF-hygR for the 5' flank, 3' flank, β-184

tubulin promoter and hph CDS, respectively (Table 1). The resulting amplicons were 185

fused together using the double-joint PCR technique to produce a ku80-replacement 186

cassette (TMS14), which was cloned to produce plasmid pTMS14 (Fig. 2A). The fusion 187

between the β-tubulin promoter and the hph CDS was designated hygromycin B-188

resistance cassette (Hygr) (Fig. 2A). The flanking DNA (2 kb 5' and 3') of mnp4 (3, 30, 189

31) were amplified from genomic DNA, and the Hygr cassette from plasmid pTMS14, 190

using primers mnp4PF and hygF-mnp4PR, hygR-mnp4TF and mnp4TR, mnp4PR-hygF 191

and mnp4TF-hygR for the 5' flank, 3' flank and Hygr, respectively (Table 1). The 192

resulting amplicons were fused together using the double-joint PCR technique to produce 193

a mnp4-replacement cassette (TMS10), which was cloned to produce plasmid pTMS10 194

(Fig. 3A). 195

Fungal transformation. Transformation was performed based on the PEG-CaCl2 196

protocol previously adapted for P. ostreatus (13, 14, 31). Either carboxin or hygromycin 197

B were used as selection markers, and resistance was conferred via introduction of the 198

carboxin-resistance cassette (Cbxr) (Fig. 1A) or the hygromycin B-resistance cassette 199

(Hygr) (Fig. 2A, Fig. 3A). Competent protoplasts were produced by digestion of 200

vegetative mycelium of P. ostreatus from YMG liquid culture with lytic enzymes. The 201

lytic enzyme solution consisted of 2% (w/v) Lysing enzymes from Trichoderma 202

harzianum (Sigma-Aldrich, product number L1412) and 0.05% (w/v) Chitinase from 203

Trichoderma viride (Sigma-Aldrich, product number C8241) in 0.5 M sucrose as an 204

osmotic stabilizer. The protoplasts were washed (by centrifugation at 450g, 8 min, 4°C) 205

in STC solution (18.2% w/v sorbitol, 50 mM Tris-HCl pH 8.0, 50 mM CaCl2, 0.5 M 206


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

10

sucrose), and adjusted to a final concentration of 5 × 107 protoplasts/ml. Then, 2 ml 207

protoplasts was mixed with 100 µl transforming DNA (300 ng/µl), 150 µl heparin 208

solution (Sigma-Aldrich) (5 mg dissolved in 1 ml STC solution), and 300 µl single-strand 209

λ phage carrier DNA (Fermentas) (500 µg/ml, after denaturation at 95°C for 5 min and 210

immediate transfer to ice). After 40 min of incubation on ice, 10 ml PTC solution (40% 211

w/v PEG#4000, 50 mM Tris-HCl pH 8.0, 50 mM CaCl2, 0.5 M sucrose) was added, and 212

the mixture was incubated for 20 min at room temperature. For transformation performed 213

using carboxin selection, the mixture was then plated on selective solid YMG 214

regeneration medium, containing 0.5 M sucrose and carboxin at a final concentration of 2 215

mg/l. For transformation performed using hygromycin B selection, the mixture was 216

plated on solid YMG regeneration medium containing 0.5 M sucrose, and left to 217

regenerate overnight. Subsequently a medium overlay containing hygromycin B was 218

applied, obtaining a final concentration of 150 mg/l. Transformants were isolated after 10 219

days of incubation at 28°C. Transformant stability was verified by three successive 220

transfers (inoculated from the edge of a 10-day-old colony) to solid medium without the 221

selection drug, and then returning the transformant to solid culture conditions in which 222

the selective drug was present. 223

Phenotypic characterization. Culture biomass production was measured as dry 224

weight (oven-dried to constant weight at 65°C) in liquid YMG. Mycelial linear growth 225

rate was determined by measuring the position of the advancing mycelial front (leading 226

hyphae) in solid YMG culture. Laccase and Mn2+-peroxidase (MnP) activities were 227

measured in liquid GP culture amended with 27 µM of Mn2+, whereas versatile-228

peroxidase (VP) activity was measured in Mn2+-deficient culture, after filtration of the 229


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

11

culture fluids through GF/A glass microfiber filter paper (Whatman) and treatment with 230

cOmplete, EDTA-free Protease Inhibitor Cocktail Tablets (Roche) according to the 231

manufacturer's instructions. Enzyme assays were carried out according to Grinhut et al. 232

(9). Briefly, enzymatic activity assays were conducted in a 1-ml cuvette at 35°C, using a 233

BioMate 3 spectrophotometer (Thermo Spectronic). Laccase activity was determined 234

using 2,2′-azino-bis(3-ethylbenzthiazoline-6-sulphonic acid) (ABTS) (Sigma-Aldrich) as 235

the substrate. Oxidation of ABTS was measured by monitoring absorbance at 436 nm 236

(A436) (ε = 29.3 mM−1 cm−1). The reaction mixture contained 0.5 mM ABTS and 100 mM 237

citrate buffer (pH 3.0). MnP and VP activities were determined using phenol red (Sigma-238

Aldrich) as the substrate. Oxidation of phenol red was measured by monitoring the A610 (ε 239

= 22.0 mM−1 cm−1). The reaction mixture contained 0.1 mM MnSO4, 0.1 mM H2O2, 240

0.01% (w/v) phenol red, 25 mM lactate, 0.1% (w/v) bovine serum albumin, 20 mM 241

sodium succinate buffer (pH 4.5), and after incubation, 80 mM NaOH. Activity in the 242

absence of either MnSO4, H2O2 or both, was measured to establish specific peroxidase 243

activity. One unit (U) of enzymatic activity was defined as the amount of enzyme that 244

catalyzes the formation of 1.0 μmol of product per minute per milliliter of culture filtrate. 245

Enzyme activities are expressed as units per milligram of culture biomass. The assays 246

were performed in at least three technical replicates. Orange II decolorization capacity 247

was estimated in GP cultures amended with Orange II. In solid culture, this was based on 248

the visually decolorized area, as measured from the center of the inoculation point. In 249

liquid culture, 200 µl media were centrifuged (4720g, 10 min, room temperature) and 250

mixed with 800 µl phosphate buffer (0.1 M, pH 7.0), and the Orange II concentration in 251

the media was quantified according to the absorption reading of the solution at λmax 483 252


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

12

nm, using a BioMate 3 spectrophotometer according to a standard curve. Noninoculated 253

medium amended with Orange II was used as a control (31). Mating trials were 254

performed by inoculating the tested strain and PC15, placed 4 cm apart in a Petri dish 255

containing solid YMG medium. The plate was then incubated at 28°C in the dark for 256

approximately 14 days, until the two mycelia formed a large contact zone. A piece of 257

mycelium was cut from the contact zone, placed on a new culture plate, allowed to grow 258

for 7 days, and its morphology examined under the microscope for the presence or 259

absence of true clamp connections indicating dikaryons or monokaryons, respectively 260

(21, 23). In vitro production of fruiting bodies was evaluated by subjecting the cultures to 261

a photoperiod regime of 12 h light/12 h dark, and incubating at 28°C (1). Light and 262

fluorescence microscopy were performed with a Zeiss Axioscope microscope equipped 263

with a Nikon DXM1200F digital camera. For calcofluor white staining, samples were 264

treated with a solution of 10 µg/ml calcofluor (Sigma-Aldrich) prior to observation by 265

fluorescence microscopy using the appropriate filter (excitation, 395 to 440 nm, and 266

emission, 470 nm) (5). 267

268

RESULTS 269

Production and characterization of P. ostreatus PC9 homokaryon strain 270

Δku80. To create an efficient gene-targeting system in P. ostreatus, HR frequency in the 271

PC9 strain had to be enhanced (Table 2). The NHEJ pathway was therefore inactivated 272

by disrupting the P. ostreatus ku80 gene homolog. 273

The P. ostreatus PC9 genome database was searched to identify the Ku70 and 274

Ku80 homologs, using BLASTP analysis against Neurospora crassa Mus-51 and Mus-52 275


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

13

proteins, respectively (26). The candidate P. ostreatus genes encoding the predicted Ku70 276

and Ku80 homologs, JGI genome (PC9 v1.0) protein IDs 86980 and 85252, respectively, 277

were both determined as single hits against Mus-51 and Mus-52, respectively 278

(http://genome.jgi-psf.org/PleosPC9_1/PleosPC9_1.home.html). 279

A gene-replacement cassette targeted at HR with ku80 CDS, from its translation 280

start site (ATG) to stop site (TAG), was constructed by fusing the carboxin-resistance 281

cassette (Cbxr) (13) to 2 kb 5' and 3' DNA flanking ku80, to produce TMS6, which was 282

also cloned to produce plasmid pTMS6 (see Materials and Methods, Fig. 1A). Both the 283

plasmid (pTMS6) and the linear cassette (TMS6, PCR product) were used, separately, for 284

transformation of the wild-type PC9 strain (Fig. 1A), and carboxin-resistant colonies 285

were isolated. 286

About 1000 transformants (collected from four independent transformation 287

experiments) were subcultured, and genomic DNA was extracted from about 300 288

transformants to determine, by PCR, whether ku80 had been replaced by the Cbxr 289

cassette. Primers in this PCR were designed to positions outside the targeted gene, ku80, 290

and inside the Cbxr cassette (see Recombination probe in Fig. 1A, representative PCR 291

results in Fig. 1B and primers in Table 1). Seven carboxin-resistant transformants 292

contained the Cbxr cassette replacing ku80 (Fig. 1B), equal to 2.3% HR frequency in the 293

wild-type PC9 strain background (Table 2). 294

Next, these seven transformants were screened for the presence of 295

nontransformed nuclei (indicative of being heterokaryons) by PCR with primers 296

amplifying a region within the ku80 CDS which was targeted for replacement by the Cbxr 297

cassette (see Homokaryon probe in Fig. 1A, representative PCR results in Fig. 1C and 298


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

14

primers in Table 1). Three of the seven transformants were found to be homokaryons in 299

which HR had occurred at the ku80 locus (Table 2). From this point on, these 300

transformants were grown without antibiotic selection. 301

After subculturing at least three times, DNA was extracted from the homokaryon 302

strains and screened by Southern blot hybridization analysis to confirm the absence of 303

ectopic integrations of the transformation cassette. Genomic DNA was digested with 304

either BglII, EcoNI or StyI and probed with a DIG-labeled DNA probe corresponding to 305

the Southern probe amplicon (see Southern probe in Fig. 1A and primers in Table 1). A 306

distinctive pattern of bands for either BglII, EcoNI or StyI, of 7195, 8118, 2537 and 4146, 307

2227, 3059 bp was produced from the wild-type PC9 strain and the Δku80 strains, 308

respectively. This analysis confirmed that ku80 replacement was the result of a single 309

integration event in all three transformants (Table 2). These analyses also confirmed that 310

both the plasmid (pTMS6) and the linear cassette (TMS6) used for transformation 311

produce Δku80 homokaryon strains without ectopic integrations. 312

One of these transformants, designated 20b (isolated from transformation with the 313

linear TMS6 cassette), was chosen for further work and designated P. ostreatus PC9 314

homokaryon Δku80 strain. Several phenotypic traits were analyzed. Strain 20b produced 315

a biomass similar to that of the wild-type PC9 strain, showed a comparable linear growth 316

rate and ligninolytic functionality (as evaluated by laccase activity, Mn2+-peroxidase 317

activity and Orange II decolorization capacity), and was capable of mating with the 318

incompatible strain PC15 to produce a dikaryon mycelium which was resistant to 319

carboxin and produced typical fruiting bodies (Table 3). 320


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

15

Screening for a second dominant selectable marker. To implement use of the 321

carboxin-resistant P. ostreatus PC9 homokaryon Δku80 strain 20b as the background 322

strain for a successive transformation step, a transformation procedure with a second 323

dominant selectable marker had to be developed. We tested P. ostreatus for sensitivity to 324

several common selectable agents by plating nontransformed protoplasts on solid YMG 325

medium containing 0.5 M sucrose as an osmotic stabilizer, which was then overlaid with 326

the same medium amended with the different drugs. The tested compounds were 327

nourseothricin, phosphinothricin, neomycin, phleomycin, zeocin and hygromycin B (40), 328

at final concentrations of 0 to 1000 mg/l. After 10 days of incubation, background 329

colonies emerged in all treatments, except when ≥100 mg/l hygromycin B was present in 330

the medium. Therefore, hygromycin B was chosen as a selection compound for further 331

testing. 332

Development of a hygromycin B dominant resistance selective marker 333

transformation system. To introduce hygromycin B resistance into P. ostreatus, the 334

CDS of the hygromycin B-resistance gene hph from E. coli (10, 27) was cloned and fused 335

to the promoter and terminator regions of either the Lentinus edodes glyceraldehyde-3-336

phosphate dehydrogenase (gpd) (12, 16) or P. ostreatus iron-sulfur protein subunit of 337

succinate dehydrogenase (sdi1, which was also used to drive the Cbxr cassette; data not 338

shown) gene in a manner similar to the construction of the carboxin-resistance ku80-339

replacement cassette (TMS6, Fig. 1). None of these cassettes, following introduction into 340

the fungus, were successful in producing stable hygromycin B-resistant transformants. 341

To confer resistance to hygromycin B during the crucial phase of protoplast 342

regeneration, sufficient levels of hygromycin B phosphotransferase (HPH) must be 343


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

16

produced. We initially determined that expression of the P. ostreatus β-tubulin gene is 344

higher than that of gpd, sdi1 and cross-pathway control (cpc-1) (Fig. 4). Thus, the P. 345

ostreatus β-tubulin promoter was chosen to drive hph, producing the Hygr cassette (see 346

Materials and Methods, Fig. 2A). The Hygr cassette was fused to the flanking DNA (2 kb 347

5' and 3') of P. ostreatus ku80 to produce a fragment designated TMS14. TMS14 was 348

then cloned to produce plasmid pTMS14 (see Materials and Methods, Fig. 2A). Using 349

this design strategy, the targeted gene’s 3’ flank provides a versatile terminator signal for 350

the Hygr cassette, and is expected to reduce the chances of HR with the endogenous β-351

tubulin (which may reduce transformation efficiency). This also simplified construction 352

of the gene-replacement cassettes. In addition, to allow regenerating protoplasts to gain 353

enough resistance to hygromycin B via accumulation of HPH, they were regenerated 354

overnight prior to exposure to hygromycin B. Both the plasmid (pTMS14) and the linear 355

cassette (TMS14, purified restriction fragment of pTMS14 digested with SphI and NotI) 356

were used, separately, for transformation into either P. ostreatus wild-type PC9 strain or 357

the 20b strain (Fig. 2A). Only the treatment in which the protoplasts were allowed to 358

regenerate before exposure to selection was successful in producing stable and integrative 359

transformation of the tested P. ostreatus strains for hygromycin B resistance with the 360

recombinant hph under the control of P. ostreatus β-tubulin promoter (Fig. 2). The 361

number of transformants obtained from transformation of the wild-type and strain 20b 362

was similar, about 100 transformants per transformation experiment (an average of six 363

independent transformation experiments). 364

Evaluation of gene-targeting efficiency using the P. ostreatus 20b (Δku80) 365

strain. To evaluate the efficiency of the gene-targeting system based on using the P. 366


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

17

ostreatus carboxin-resistant Δku80 strain 20b as a background strain for transformation, a 367

Hygr cassette intended for replacement of the Cbxr cassette, located at the ku80 locus, 368

was constructed. Both the plasmid (pTMS14) and the linear cassette (TMS14) were used, 369

separately, for transformation into P. ostreatus strain 20b (Fig. 2A), and hygromycin B-370

resistant colonies were isolated. 371

About 100 transformants (collected from two independent transformation 372

experiments) were subcultured under hygromycin B selection. Subsequently, they were 373

transferred for three rounds of subculturing to medium without selection. Following the 374

subculturing process, all resulting transformants were found to be hygromycin B-375

resistant;carboxin-sensitive, also indicating that these transformants are, most probably, 376

homokaryons. 377

Genomic DNA was extracted from 10 randomly chosen transformants (designated 378

20bH1-10) to determine, by PCR, whether the Cbxr cassette, located at the ku80 locus of 379

strain 20b, had in fact been replaced by the Hygr cassette. Primers in this PCR were 380

designed such that one was outside the targeted gene, at the flanking ku80 5’ region, and 381

the other was inside the Hygr cassette (see Recombination probe in Fig. 2A, PCR results 382

in Fig. 2B and primers in Table 1). All 10 hygromycin B-resistant transformants 383

contained the Hygr cassette in place of the Cbxr cassette at the ku80 locus (Fig. 2B), 384

exhibiting 100% HR frequency in the strain 20b transformation background (Table 2). 385

Next, these 10 transformants were screened for the presence of nontransformed 386

(heterokaryotic) nuclei, by using PCR with primers set so that one is outside the targeted 387

gene, at the flanking ku80 5’ region, and the other is inside the Cbxr cassette (located at 388

the ku80 locus) targeted for replacement by the Hygr cassette (see Homokaryon probe in 389


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

18

Fig. 2A, PCR results in Fig. 2C and primers in Table 1). All 10 transformants were found 390

to be homokaryons, reconfirming the occurrence of HR into the Cbxr cassette, previously 391

located at the ku80 locus, by the Hygr cassette (Table 2). In addition, both the plasmid 392

(pTMS14) and the linear cassette (TMS14) used for transformation produced Δku80 393

homokaryon strains. 394

One of the homokaryon Δku80 hygromycin B-resistant transformants, designated 395

20bH1 (isolated from transformation with the linear TMS14 cassette), was chosen for 396

further characterization. Several phenotypic traits were compared. Strain 20bH1 397

exhibited a phenotype similar to that of the wild-type strain PC9 and the Δku80 carboxin-398

resistant strain (20b), using the criteria described above (Table 3). Production of these 399

strains increases the flexibility of the gene-targeting system, by producing PC9 Δku80 400

strains resistant to either carboxin or hygromycin B. 401

Inactivation of the versatile-peroxidase (VP) encoded by mnp4. The MnP gene 402

family (mnps) of P. ostreatus comprises of five Mn2+-dependent peroxidases (mnp3, 6, 7, 403

8 and 9) and four Mn2+-independent peroxidases (mnp1, 2, 4 and 5; versatile-peroxidases, 404

VPs) (30, 31). Differential expression of mnps is dependent on the presence of Mn+2 in 405

the medium. The predominantly expressed mnp in GP medium non-amended with Mn2+ 406

is a VP encoded by mnp4, exhibiting about 70 fold increase in expression level under 407

Mn2+-deficient relative to Mn2+-amended conditions (3, 31). This gene is identified in the 408

JGI genome database of PC9 v1.0 by protein ID 137757 (30, http://genome.jgi-409

psf.org/PleosPC9_1/PleosPC9_1.home.html), which corresponds to the previously 410

identified protein ID 186006 in PC15 v1.0 (31). Thus, to verify the conclusions based on 411

gene expression data (31) and examine if other MnP activities appear under these 412


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

19

conditions, mnp4 was inactivated, in the current study, using the gene targeting system by 413

producing a homokaryon knockout strain. 414

A gene replacement cassette targeted at HR with the mnp4 CDS was constructed. 415

Both the plasmid (pTMS10) and the linear cassette (TMS10) were used for 416

transformation into P. ostreatus strain 20b (Fig. 3A), and hygromycin B-resistant 417

colonies were isolated. About 50 transformants were subcultured under hygromycin B 418

selection. Subsequently, they were transferred for three rounds of subculturing to medium 419

without selection. Following the subculturing process, all resulting transformants were 420

found to be hygromycin B-resistant;carboxin-resistant. 421

Five transformants (designated 1, 12, 34, 35 and 39) were selected based on 422

growth rate similar to that of the wild-type strain PC9. Genomic DNA was extracted to 423

determine, by PCR, whether the mnp4 CDS was specifically replaced by the Hygr 424

cassette, and to concurrently screen for the presence of nontransformed nuclei. Primers 425

targeting the CDS of mnp4 and three other mnps (mnp2, 3 and 9; which were previously 426

pointed out as important for ligninolytic functionality (3, 15, 30, 31, 39)) were used in the 427

same PCR reaction mixture (see Amplicons in Fig. 3A, PCR results in Fig. 3B and 428

primers in Table 1). While strains PC9 and 20b produced the expected amplicons 429

corresponding to mnp2, 3, 4 and 9, the five hygromycin B-resistant transformants did not 430

produce the mnp4 amplicon, indicating that the transformants are indeed Δmnp4 431

homokaryons, while also demonstrating that the other, sequence-related, mnp loci tested 432

were not affected (Fig. 3B). In addition, this showed that a 100% HR frequency in a 433

strain 20b transformation background implies also for the mnp4 locus (Table 2). 434


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

20

One of the Δmnp4 transformants, designated 34, was chosen for a time-course 435

characterization of its VP activity level. When the Δmnp4 strain was grown in Mn2+-436

deficient GP medium, extracellular enzymes able to oxidize phenol red were not detected 437

either in the presence or absence of Mn2+ in the reaction mixture. In comparison, the 438

wild-type strain PC9 showed a typical activity pattern (Fig. 3C). 439

440

DISCUSSION 441

Pleurotus is the second most economically important edible mushroom 442

worldwide, having medicinal properties and potential in biofuel production, 443

bioremediation and upgrade of animal feed. Analysis of gene function in basidiomycetes 444

is progressing rapidly (2, 34, 37). To meet the challenges of hypothesis-driven 445

experiments at the gene or gene-family level, appropriate tools are required (20, 31, 32, 446

40). In this study we developed tools and protocols that are essential for efficient and 447

reproducible targeted gene manipulations in the white rot fungus P. ostreatus, the oyster 448

mushroom. Adapting these, and other techniques, for use in additional ligninolytic fungi 449

is feasible and could further promote the functional analysis of the genes (and their 450

products) involved in the modification of lignin and other aromatic compounds. 451

Three basic demands were met: (a) production of strains exhibiting a high rate of 452

HR when used as a background for transformation, (b) confirmation of the isogenic 453

(homokaryon) nature of the strains, and (c) verification of the phenotypic fitness of the 454

strains produced. In the process, we also adapted a second dominant selectable marker 455

procedure to be used in a successive transformation. 456


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

21

Systematic high-throughput targeted gene manipulations in Pleurotus have been 457

limited, for two main reasons: first, Pleurotus wild-type strains have a low frequency 458

(2.3%) of site-specific recombination of DNA integration, which is within the 0.1 to 5% 459

range common for most filamentous fungi (20); second, low yield is obtained using 460

protoplast-mediated transformation (13–16, 31), reducing the chances of obtaining a 461

transformant in which gene replacement has occurred. 462

By increasing the rate of HR in Pleurotus, we circumvented the low natural HR 463

rate, resulting in the need to analyze only a few transformants when screening for the 464

desired gene-targeted transformants. To achieve this, we produced a strain whose NHEJ 465

DNA-repair pathway had been inactivated through disruption of ku80. This strategy has 466

been implemented in a number of fungi (representing models, phytopathogens, industrial 467

strains and human pathogens), resulting in 60% to 100% integration, by HR, of targeted 468

gene-replacement cassettes (20). A conventional gene-replacement cassette (containing 2 469

kb 5' and 3' of homologous sequences flanking the target locus, with a dominant-470

resistance cassette in between) (26) targeted to disrupt the ku80 CDS by HR with the 471

carboxin-resistance cassette (Cbxr) (13) was used for transformation of the wild-type P. 472

ostreatus monokaryon strain PC9. It should be noted that all gene-replacement cassettes 473

used in this study were designed to specifically target only the CDS borders of the 474

targeted gene, so as to minimize the chances of interrupting adjacent regulatory 475

sequences that might affect the expression of other genes. 476

Transformed homokaryons could be distinguished from heterokaryons by a PCR 477

assay directly targeting the CDS of the gene intended for disruption, in this case ku80. In 478

addition, before conducting the PCR assay, the transformants were intentionally grown 479


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

22

without selection for at least three subcultures, to unveil potential nontransformed nuclei 480

that might otherwise be “masked” by transformed nuclei under selective culture 481

conditions. This procedure enabled particularly high-sensitivity detection of 482

nontransformed nuclei (compared with Southern analysis). Out of the seven isolated 483

transformants, three were found to be homokaryons. The three transformants were found 484

negative for ectopic integrations by Southern analysis, reconfirming the occurrence of 485

HR into ku80 and the homokaryon nature of the strains. 486

To complete the development of the gene-targeting system and determine its 487

efficacy, a second selectable marker was used in a successive transformation step. One of 488

the constraints of protoplast-mediated transformation is the need to select and regenerate 489

transformed protoplasts in the presence of large amounts of nontransformed mycelial 490

fragments (6, 28). Transformation of P. ostreatus using uracil auxotrophs (18), bialaphos 491

(41), 5-fluoroindole (17), carboxin (13), hygromycin B (16) and phleomycin (19) 492

resistance have been reported. However, we have found that an auxotrophic marker is not 493

suitable for selection in the rich medium conditions required for protoplast regeneration 494

and that, except for carboxin, these markers are not effective. In view of these results, the 495

number of usable selectable markers in Pleurotus is presently quite limited in comparison 496

with other filamentous fungi (40). The fact that Pleurotus is capable of modifying a broad 497

range of complex substrates (11, 29, 35) might contribute to the reduced efficacy of some 498

of the selectable drugs. The mode of action of carboxin is fundamentally different from 499

those of the other selective compounds tested: whereas the latter inhibit protein or DNA 500

synthesis, carboxin inhibits respiration. In contrast to carboxin, the other compounds do 501

not usually kill nonresistant cells; they only inhibit or stop their growth. Cells containing 502


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

23

the corresponding resistance gene need to produce enough of the relevant detoxifying 503

enzymes to allow regeneration and growth, a process that takes time. Among all of the 504

tested compounds, hygromycin B was the best candidate to serve as a dominant selection 505

marker, since it provides fair selection under conventional protoplast regeneration 506

conditions, and it is one of the most widespread (and available) markers used in 507

filamentous fungi (40). 508

Using the sdi1 promoter to drive the hygromycin B-resistance gene (hph) was 509

unsuccessful in producing resistant colonies under the conditions tested. This can be 510

explained by its lower expression levels relative to β-tubulin and the other promoters 511

tested. Thus, we redesigned hph to be driven by the strong β-tubulin promoter (to produce 512

the current Hygr cassette) and subjected the transformation mixture to an overnight 513

regeneration-incubation period before exposure to the selection drug. This was based on 514

the assumption that higher expression of hph, in combination with exposure to conditions 515

in which the transformed cells produce enough HPH to detoxify it, will support better 516

regeneration. Indeed, we were able to pick clearly resistant colonies, with almost no 517

false-positives or unstable transformants. Furthermore, this transformation procedure 518

proved to be efficient and reproducible, yielding about 100 transformants per 519

transformation experiment (compared to about 250 using carboxin), with either the wild-520

type PC9 or Δku80 strain. Unexpectedly, all of the isolated transformants were found to 521

be homokaryons, in contrast to when carboxin was used, where less than half of the 522

isolated transformants were homokaryons, an outcome that may be a reason for the 523

differences in overall transformation yield compared to carboxin. 524


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

24

The procedure developed here also expanded the flexibility of the gene-targeting 525

system, by producing PC9 Δku80 strains resistant to either carboxin or hygromycin B. In 526

addition, we demonstrated that transformed DNA in the form of a circular plasmid, a 527

linear cassette (purified restriction fragments) and even a PCR product can be used to 528

give correct gene-targeting events. 529

Utilization of a genetically modified background strain in a successive genetic 530

manipulation depends on maintaining its functionality in aspects that might influence the 531

relevant future genetic manipulation. Accordingly, we evaluated the functionality of the 532

strains produced in this work for three aspects related to fundamental properties of 533

Pleurotus: (a) biomass production and linear growth rate, (b) reproductive ability, and (c) 534

ligninolytic activity. Biomass production and linear growth rate of the Δku80 strains 20b 535

(carboxin-resistant) and 20bH1 (hygromycin B-resistant) were found to be similar to 536

those of the parental wild-type PC9 strain. Being a heterothallic homobasidiomycete 537

whose mating is controlled by a bifactorial tetrapolar genetic system, Pleurotus 538

monokaryon strains can only produce a vegetative mycelium, cannot develop fruiting 539

bodies and have a slower growth rate than dikaryons. Monokaryons are also clearly 540

characterized by the absence of clamp connections and a thinner cell wall relative to 541

dikaryons (1, 21–23). PC9 is a monokaryon strain derived by dedikaryotization of the 542

dikaryon commercial strain N001. Since the Δku80 strains are homokaryons derived from 543

transformation of protoclones of PC9, they are expected to maintain the same mating and 544

fruiting abilities as PC9. These abilities were evaluated by mating trials with an 545

incompatible strain, PC15, and examining the formation of a typical dikaryon and 546

production of fruiting bodies under appropriate inductive culture conditions, as well as 547


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

25

the stability of the corresponding resistance trait. All strains exhibited healthy 548

reproductive fitness and retained their resistance to the corresponding selection. Lastly, 549

the extracellular activity of the ligninolytic enzymes laccase and Mn2+-peroxidase of the 550

Δku80 strains was found to be similar to that of PC9, based on enzymatic and Orange II 551

decolorization assays. Taken together, we demonstrated that the produced Δku80 strains 552

are suitable recipients for highly efficient gene-replacement experiments, without 553

compromising fitness levels. 554

The applicability of this system was demonstrated by inactivation of the VP 555

encoding gene mnp4 (3, 30, 31). VP is an enzyme with dual activity and wide substrate 556

specificity associated with its high-redox-potential (E◦>+1.4 V), the presence of two 557

catalytic sites, one for the oxidation of low- and high-redox-potential compounds, and the 558

second for Mn2+-oxidizing peroxidase (E.C. 1.11.1.6) activity. Recent literature point out 559

VP’s catalytic promiscuity, which is attracting great interest due to its potential 560

biotechnological applications (7, 30). To investigate VP’s significance in vivo it was 561

selected for complete and specific inactivation. 562

Δmnp4 homokaryon strains were produced using the gene targeting system. Time-563

course activity assays showed that, in contrast to the wild-type strain PC9, the Δmnp4 564

strain is unable to produce enzymatically oxidized phenol red either in the presence or 565

absence of Mn2+ in the reaction mixture. This finding supports our previous gene 566

expression-based conclusions (31), providing direct proof that mnp4 encodes the 567

predominant VP enzyme in Mn2+-deficient GP medium. This is the first report of a 568

knockout strain in a gene encoding a ligninolytic enzyme in a white-rot fungus. 569


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

26

Furthermore, this illustrates the applicability of the gene targeting system as a versatile 570

platform for directed investigation of Pleurotus lignocellulose degradation system. 571

The new tools and protocols developed in this study for the generation of 572

genetically manipulated strains enhance gene-manipulation ability in P. ostreatus. It is 573

now possible, using the P. ostreatus PC9 homokaryon Δku80 strain as a background 574

strain for transformation, to systematically produce gene-replacement mutants at 100% 575

efficiency, to perform allelic exchange experiments and to introduce mutations with 576

reduced probability of producing other alterations in the genome. It also has the potential 577

to provide a practical means for targeting multiple genes in a single transformation 578

experiment, in conjunction with the double-joint PCR technique, which facilitates the 579

methodical production of gene-replacement cassettes. These new techniques for directed 580

and specific manipulation of gene expression and function, together with the recent 581

availability of the complete genome sequence of P. ostreatus, will enable expanding the 582

analyses of cellular and molecular processes using a genetic approach. Consequently, 583

these advances may contribute to the improvement of Pleurotus physiology and 584

development in terms of agricultural, nutritional, biotechnical, pharmaceutical and 585

bioremediative applications, and to further our understanding of the mechanisms 586

involved in lignin biodegradation. This gene-replacement strategy complements the 587

already proven RNAi approach for altering gene-expression levels (31): while the former 588

can be utilized for complete gene inactivation, the latter can be especially useful in the 589

analysis of essential genes and gene families. 590

591

592


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

27

ACKNOWLEDGMENTS 593

We are deeply grateful to Prof. Takashi Watanabe and Prof. Yoichi Honda, 594

Research Institute for Sustainable Humanosphere, Kyoto University, Japan, for 595

generously providing plasmid pTM1. We are also grateful to Dr. Assaf Eybishtz, Adi 596

Moshe, Dagan Sade, Aurelia Zemach, Dr. Carmit Ziv and Dr. Hely Oren-Jazan (Agentek 597

Ltd, Tel Aviv, Israel) for their advice and comments. We thank the Joint Genome 598

Institute (US Department of Energy) and the Pleurotus Genome Consortium for access to 599

the P. ostreatus genome database. This work was partially supported by grant No. 600

2011505 from the U.S.-Israel Binational Science Foundation (BSF). 601

602

REFERENCES 603

1. Arjona, D., C. Aragón, J. A. Aguilera, L. Ramírez, and A. G. Pisabarro. 2009. 604

Reproducible and controllable light induction of in vitro fruiting of the white-rot 605

basidiomycete Pleurotus ostreatus. Mycol. Res. 113:552–558. 606

2. Cohen, R., L. Persky, and Y. Hadar. 2002. Biotechnological applications and 607

potential of wood-degrading mushrooms of the genus Pleurotus. Appl. Microbiol. 608

Biotechnol. 58:582–594. 609

3. Cohen, R., Y. Hadar and O. Yarden. 2001. Transcript and activity levels of 610

different Pleurotus ostreatus peroxidases are differentially affected by Mn2+. Environ 611

Microbiol 3:312–322. 612

4. de Jong, J. F., R. A. Ohm, C. de Bekker, H. A. B. Wösten, and L. G. Lugones. 613

2010. Inactivation of ku80 in the mushroom-forming fungus Schizophyllum commune 614


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

28

increases the relative incidence of homologous recombination. FEMS Microbiol. Lett. 615

310:91–95. 616

5. Dvash, E., G. Kra-Oz, C. Ziv, S. Carmeli, and O. Yarden. 2010. The NDR kinase 617

DBF-2 is involved in regulation of mitosis, conidial development, and glycogen 618

metabolism in Neurospora crassa. Eukaryot. Cell 9:502–513. 619

6. Fincham, J. R. 1989. Transformation in fungi. Microbiol. Rev. 53:148–170. 620

7. García-Ruiz, E., D. González-Pérez, F. J. Ruiz-Dueñas, A. T. Martínez, and M. 621

Alcalde. 2012. Directed evolution of a temperature-, peroxide- and alkaline pH-622

tolerant versatile peroxidase. Biochem. J. 441:487–498. 623

8. Grigoriev, I. V., D. Cullen, S. B. Goodwin, D. Hibbett, T. W. Jeffries, C. P. 624

Kubicek, C. Kuske, J. K. Magnuson, F. Martin, J. W. Spatafora, A. Tsang, and 625

S. E. Baker. 2011. Fueling the future with fungal genomics. Mycology 2:192–209. 626

9. Grinhut, T., T. M. Salame, Y. Chen, and Y. Hadar. 2011. Involvement of the 627

ligninolytic enzymes and Fenton like reaction during humic acid degradation by 628

Trametes sp. M23. Appl. Microbiol. Biotechnol. 91:1131–1140. 629

10. Gritz, L., and J. Davies. 1983. Plasmid-encoded hygromycin B resistance: the 630

sequence of hygromycin B phosphotransferase gene and its expression in Escherichia 631

coli and Saccharomyces cerevisiae. Gene 25:179–188. 632

11. Hammel, K. E., and D. Cullen. 2008. Role of fungal peroxidases in biological 633

ligninolysis. Curr. Opin. Plant Biol. 11:349–355. 634

12. Hirano, T., T. Sato, K. Yaegashi, and H. Enei. 2000. Efficient transformation of the 635

edible basidiomycete Lentinus edodes by the vector utilizing the glyceraldehyde-3-636


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

29

phosphate dehydrogenase gene promoter to hygromycin B resistance. Mol. Gen. 637

Genet. 263:1047–1052. 638

13. Honda, Y., T. Matsuyama, T. Irie, T. Watanabe, and M. Kuwahara. 2000. 639

Carboxin resistance transformation of the homobasidiomycete fungus Pleurotus 640

ostreatus. Curr. Genet. 37:209–212. 641

14. Irie, T., Y. Honda, T. Watanabe and M. Kuwahara. 2001. Efficient transformation 642

of filamentous fungus Pleurotus ostreatus using single-strand carrier DNA. Appl. 643

Microbiol. Biotechnol. 55:563–565. 644

15. Irie, T., Y. Honda, T. Watanabe, and M. Kuwahara. 2001. Homologous 645

expression of recombinant manganese peroxidase genes in ligninolytic fungus 646

Pleurotus ostreatus. Appl. Microbiol. Biotechnol. 55:566–570. 647

16. Irie, T., Y. Honda, T. Hirano, T. Sato, H. Enei, T. Watanabe, and M. Kuwahara. 648

2001. Stable transformation of Pleurotus ostreatus to hygromycin B resistance using 649

Lentinus edodes GPD expression signals. Appl. Microbiol. Biotechnol. 56:707–709. 650

17. Jia, J. H., J. A. Buswell, and J. F. Peberdy. 1998. Transformation of the edible 651

fungi, Pleurotus ostreatus and Volvariella volvacea. Mycol. Res. 102:876–880. 652

18. Kim, B. G., Y. Magae, Y. B. Yoo, and S. T. Kwon. 1999. Isolation and 653

transformation of uracil auxotrophs of the edible basidiomycete Pleurotus ostreatus. 654

FEMS Microbiol. Lett. 181:225–228. 655

19. Kim, B. G., J. H. Joh, Y. B. Yoo, and Y. Magae. 2003. Transformation of the edible 656

basidiomycete, Pleurotus ostreatus to phleomycin resistance. Mycobiology 31:42–5. 657

20. Kück, U., and B. Hoff. 2010. New tools for the genetic manipulation of filamentous 658

fungi. Appl. Microbiol. Biotechnol. 86:51–62. 659


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

30

21. Kües, U. and Y. Liu. 2000. Fruiting body production in basidiomycetes. Appl. 660

Microbiol. Biotechnol. 54:141–152. 661

22. Larraya, L. M., E. Idareta, D. Arana, E. Ritter, A. G. Pisabarro, and L. 662

Ramı´rez. 2002. Quantitative trait loci controlling vegetative growth rate in the 663

edible basidiomycete Pleurotus ostreatus. Appl. Environ. Microbiol. 68:1109–1114. 664

23. Larraya, L. M., G. Pérez, M. M. Peñas, J. J. P. Baars, T. S. P. Mikosch, A. G. 665

Pisabarro, and L. Ramírez. 1999. Molecular karyotype of the white rot fungus 666

Pleurotus ostreatus. Appl. Environ. Microbiol. 65:3413–3417. 667

24. Levy, M., A. Erental, and O. Yarden. 2008. Efficient gene replacement and direct 668

hyphal transformation in Sclerotinia sclerotiorum. Mol. Plant Pathol. 9:719–725. 669

25. Nakazawa, T., Y. Ando, K. Kitaaki, K. Nakahori, and T. Kamada. 2011. Efficient 670

gene targeting in ΔCc.ku70 or ΔCc.lig4 mutants of the agaricomycete Coprinopsis 671

cinerea. Fungal Genet. Biol. 48:939–946. 672

26. Ninomiya, Y., K. Suzuki, C. Ishii, and H. Inoue. 2004. Highly efficient gene 673

replacements in Neurospora strains deficient for nonhomologous end-joining. Proc. 674

Natl. Acad. Sci. USA 101:12248–12253. 675

27. Punt, P. J., R. P. Oliver, M. A. Dingemanse, P. H. Pouwels, and C. A. M. J. J. 676

van den Hondel. 1987. Transformation of Aspergillus based on the hygromycin B 677

resistance marker from Escherichia coli. Gene 56:117–124. 678

28. Ruiz-Díez, B. 2002. Strategies for the transformation of filamentous fungi. J. Appl. 679

Microbiol. 92:189–195. 680


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

31

29. Ruiz-Dueñas, F. J., and A. T. Martínez. 2009. Microbial degradation of lignin: how 681

a bulky recalcitrant polymer is efficiently recycled in nature and how we can take 682

advantage of this. Microbial. Biotechnol. 2:164–177. 683

30. Ruiz-Dueñas, F. J., E. Ferna´ndez, M. J. Martı´nez, and A. T. Martínez. 2011. 684

Pleurotus ostreatus heme peroxidases: an in silico analysis from the genome 685

sequence to the enzyme molecular structure. C. R. Biol. 334:795–805. 686

31. Salame, T. M., O. Yarden, and Y. Hadar. 2010. Pleurotus ostreatus manganese-687

dependent peroxidase silencing impairs decolourization of Orange II. Microb. 688

Biotechnol. 3:93–106. 689

32. Salame, T. M., C. Ziv, Y. Hadar, and O. Yarden. 2011. RNAi as a potential tool 690

for biotechnological applications in fungi. Appl. Microbiol. Biotechnol. 89:501–512. 691

33. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a 692

laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring 693

Harbor, NY. 694

34. Sánchez, C. 2010. Cultivation of Pleurotus ostreatus and other edible mushrooms. 695

Appl. Microbiol. Biotech. 85:1321–1337. 696

35. Sánchez, C. 2009. Lignocellulosic residues: Biodegradation and bioconversion by 697

fungi. Biotechnol. Adv. 27:185–194. 698

36. Staben, C., B. Jensen, M. Singer, J. Pollock, M. Schechtman, J. Kinsey, and E. 699

Selker. 1989. Use of a bacterial Hygromycin B resistance gene as a dominant 700

selectable marker in Neurospora crassa transformation. Fungal Genet. Newslett. 701

36:79–81. 702


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

32

37. Stajić, M., J. Vukojević, and S. Duletić-Laušević. 2009. Biology of Pleurotus 703

eryngii and role in biotechnological processes: a review. Crit. Rev. Biotechnol. 704

29:55–66. 705

38. Takahashi, T., O. Mizutani, Y. Shiraishi, and O. Yamada. 2011. Development of 706

an efficient gene-targeting system in Aspergillus luchuensis by deletion of the non-707

homologous end joining system. J. Biosci. Bioeng. 112:529–534. 708

39. Tsukihara, T., Y. Honda, and T. Watanabe. 2006. Molecular breeding of white rot 709

fungus Pleurotus ostreatus by homologous expression of its versatile peroxidase 710

MnP2. Appl. Microbiol. Biotechnol. 71:114–120. 711

40. Weld, R. J., K. M. Plummer, M. A. Carpenter, and H. J. Ridgway. 2006. 712

Approaches to functional genomics in filamentous fungi. Cell Res. 16:31–44. 713

41. Yanai, K., K. Yonekura, H. Usami, M. Hirayama, S. Kajiwara, T. Yamazaki, K. 714

Shishido, and T. Adachi. 1996. The integrative transformation of Pleurotus 715

ostreatus using bialaphos resistance as a dominant selectable marker. Biosci. 716

Biotechnol. Biochem. 60:472–475. 717

42. Yu, J. H., Z. Hamari, K. H. Han, J. A. Seo, Y. Reyes-Domínguez, and C. 718

Scazzocchio. 2004. Double-joint PCR: a PCR-based molecular tool for gene 719

manipulations in filamentous fungi. Fungal Genet. Biol. 41:973–981. 720

721

722

723

724

725


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

33

FIGURE LEGENDS 726

FIG. 1. (A) Strategy for ku80 replacement in P. ostreatus PC9 wild-type strain. The 727

carboxin-resistance cassette (Cbxr) fused to 2 kb of 5' and 3' DNA flanking ku80 (TMS6) 728

was used for transformation. (B) PCR screening for transformants that underwent 729

homologous recombination, using primers targeting the indicated ku80 recombination 730

probe amplicon (Fig. 1A, Table 1) (lanes 1, 3 and 6). (C) PCR screening for homokaryon 731

transformants that underwent homologous recombination, using primers targeting the 732

indicated ku80 homokaryon probe amplicon (Fig. 1A, Table 1) (lanes 3 and 5). 733

734

FIG. 2. (A) Strategy for replacement of the Cbxr cassette at the ku80 locus in P. ostreatus 735

strain Δku80 (20b, carboxin-resistant). The hygromycin B-resistance cassette (Hygr) 736

fused to 2 kb of 5' and 3' DNA flanking ku80 (TMS14) was used for transformation. (B) 737

PCR screening for transformants that underwent homologous recombination, using 738

primers targeting the indicated ku80 recombination probe amplicon (Fig. 2A, Table 1) 739

(lane 1: strain 20b, lanes 2–11: strains 20bH1–10, respectively). (C) PCR screening for 740

homokaryon transformants that underwent homologous recombination, using primers 741

targeting the indicated ku80 homokaryon probe amplicon (Fig. 2A, Table 1) (lane 1: 742

strain 20b, lanes 2–11: strains 20bH1–10, respectively). 743

744

FIG. 3. (A) Strategy for replacement of the mnp4 CDS in P. ostreatus strain Δku80 (20b, 745

carboxin-resistant). The hygromycin B-resistance cassette (Hygr) fused to 2 kb of 5' and 746

3' DNA flanking mnp4 (TMS10) was used for transformation. (B) PCR screening for 747

homokaryon Δmnp4 transformants, while showing that mnp2, 3 and 9 were not targeted, 748


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

34

using primers targeting the indicated amplicon (Fig. 3A, Table 1) (lane 1: PC9 wild-type 749

strain, lane 2: Δku80 strain 20b, lanes 3–7: Δmnp4 strains 1, 12, 34, 35 and 39, 750

respectively). (C) Time-course assay of Mn2+-dependent (+Mn2+) and Mn2+-independent 751

(-Mn2+) peroxidase activities of strains PC9 and 34 (Δmnp4) in liquid culture of Mn2+-752

deficient GP medium, during 10 days of incubation. Data represent the average of three 753

biological replicates. Bars denote the standard deviation. 754

755

FIG. 4. Comparative gene-expression analysis by RT-PCR of P. ostreatus wild-type 756

strain PC9 grown on solid YMG medium containing 0.5 M sucrose, after 10 days of 757

incubation. The analyzed genes were β-tubulin, glyceraldehyde-3-phosphate 758

dehydrogenase (gpd), iron-sulfur protein subunit of succinate dehydrogenase (sdi1) and 759

cross-pathway control (cpc-1), using the primers detailed in Table 1. 760

761

762

763

764


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

P. ostreatus

wild type strain PC9

ku80 region

ku80 replacement cassette

(TMS6)

X

P. ostreatus

PC9 ku80 strain (20b)

ku80 region

X

Cbxr

Recombination

probe

Southern

probeStyI

BglII

Eco

NI

StyIEco

NI

BglII

BglII

Eco

NI

StyI

BglII

AT

G

TA

G

1 kbp

A

B

2999 bp

M 1 2 3 4 5 6 7C

2174 bp

M 1 2 3 4 5 6 7

StyIEco

NI

Homokaryon

probe

Cbxr

Ku80 CDS


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

P. ostreatus


ku80 region

Cbxr, ku80 locus located,

replacement cassette

(TMS14)

X

Transformed ku80 region

X

Hygr

Recombination

probe

1 kbp

A

B C

4882 bp

2999 bp

M 1 2 3 4 5 6 7 8 9 10 11

Homokaryon

probe

Hygr

Cbxr

M 1 2 3 4 5 6 7 8 9 10 11

NotI

Sph

I


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

P. ostreatus


mnp2/3/4/9 region

mnp4 replacement cassette

(TMS10)

X

P. ostreatus

PC9 ku80 mnp4

strains mnp4 region

X

Hygr

ST

AR

T

ST

OP

1 kbp

A

B

Amplicon

mnp2/3/4/9

CDS

1 2 3 4 5 6 7

Amplicon

mnp2

mnp3

mnp4

mnp9

mnp9

496 bp

mnp3

165 bpmnp2

94 bp

mnp4

282 bp

Hygr

C

0.00

0.02

0.04

0.06

0.08

0.10

0.12

0.14

0 2 4 6 8 10

Acti

vit

y (

U/m

l)

Incubation period (days)

PC9-FULL

PC9-NM

34-FULL

34-NM

PC9 (+Mn2+)

PC9 (-Mn2+)

mnp4 (+Mn2+)

mnp4 (-Mn2+)


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

-tubulin gpdsdi1 cpc-1

300 bp

200 bp

100 bp

M


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

TABLE 1. Oligonucleotides used in this study Template Target Primer designation Sequence (5'→3') Amplicon (bp) Cassette construction ku80 replacement cassette (TMS6)

PC9 genomic DNA ku80 ku80PF AATTGCGGGCTCCTCCGATCTCTGAGTTC 2018 ku80 cbxF-ku80PR GTCGTTGGCAGTGTCATCGGAGTTGGCAATTGGCAAGAGGTT

pTM1 Cbxr ku80PR-cbxF AACCTCTTGCCAATTGCCAACTCCGATGACACTGCCAACGAC 2591 Cbxr ku80TF-cbxR AGTAACATAGCAGAGCCACGACAGCATCGCAAGTGAAACC

PC9 genomic DNA ku80 cbxR-ku80TF GGTTTCACTTGCGATGCTGTCGTGGCTCTGCTATGTTACT 2018 ku80 ku80TR ACGGCCTTTCCAAGCCTCACGACGCGAT Cbxr replacement cassette (TMS14)

PC9 genomic DNA ku80 ku80PF AATTGCGGGCTCCTCCGATCTCTGAGTTC 2023 ku80 btubPF- ku80PR ATTTAGTTTCCTCCCAACAGCATGTTGGCAATTGGCAAGAGGTT

PC9 genomic DNA β-tubulin ku80PR-btubPF AACCTCTTGCCAATTGCCAACATGCTGTTGGGAGGAAACTAAAT 1722 β-tubulin hphF-btubPR GGTGAGTTCAGGCTTTTTCATTCTGCATGGAAAAGAAGTTAGTCG

pCSN44 hph btubPR-hphF CGACTAACTTCTTTTCCATGCAGAATGAAAAAGCCTGAACTCACC 1072 hph ku80TF-hphR AGTAACATAGCAGAGCCACGACCTATTCCTTTGCCCTCGGA

PC9 genomic DNA ku80 hphR- ku80TF TCCGAGGGCAAAGGAATAGGTCGTGGCTCTGCTATGTTACT 2027 ku80 ku80TR ACGGCCTTTCCAAGCCTCACGACGCGAT mnp4 replacement cassette (TMS10)

PC9 genomic DNA mnp4 mnp4PF GATACCTGAGTTCTGGATACCGCCTGAA 2023 mnp4 hygF-mnp4PR ATTTAGTTTCCTCCCAACAGCATGAAATGTCAGCGGAGAGGGT

pTMS14 Hygr mnp4PR-hygF ACCCTCTCCGCTGACATTTCATGCTGTTGGGAGGAAACTAAAT 2760 Hygr mnp4TF-hygR AGCATATTCAGGTATCGAAGCATCTATTCCTTTGCCCTCGGA

PC9 genomic DNA mnp4 hygR-mnp4TF TCCGAGGGCAAAGGAATAGATGCTTCGATACCTGAATATGCT 2251 mnp4 mnp4TR TTCTCATCTGAATCGTGACTACCAT Analysis of construct integration ku80 replacement cassette (TMS6) Recombination probe

strain specific genomic DNA ku80 ku80-2506 ACGCCTGTGCACACTGTCT 2999 Cbxr cbx-831 TGAGGGCCGTATACCCATAA Homokaryon probe

strain specific genomic DNA ku80 ku80+971 GGAAGCTTTCGAGATCAACG 2174 ku80 ku80+3145 ACTCAGAGCCACAAGCCTATTG Southern probe

pTMS6 ku80 ku80+2861 TCGGCAGTACAAACACACAA 1539 ku80 ku80+4400 CATTTTCCTTTTCGGATTTGA Cbxr replacement cassette (TMS14) Recombination probe

strain specific genomic DNA ku80 ku80-2506 ACGCCTGTGCACACTGTCT 4882 Hygr hph+677 GATGTTGGCGACCTCGTATT Homokaryon probe

strain specific genomic DNA ku80 ku80-2506 ACGCCTGTGCACACTGTCT 2999 Cbxr cbx-831 TGAGGGCCGTATACCCATAA mnp4 replacement cassette (TMS10) Amplicon

strain specific genomic DNA mnp2 mnp2+947 TTGACCCCTCCGTAAGTGAC 94 mnp2+1041 CGAGCGAGAACACCTTTACC

strain specific genomic DNA mnp3 mnp3+1103 GCCCGTGGTATGTATTCAGC 165 mnp3+1268 AAGCTTGGCCTGGTTGTCTA


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

strain specific genomic DNA mnp4 mnp4+1084 CCCGGAGTTTTTGATTCTCA 282 mnp4+1366 ATCAAAGGCTGCAAGGAAGA

strain specific genomic DNA mnp9 mnp9+216 ATACCCTGCGTTTTCTGTGG 496 mnp9+712 TACCAAGGGGAAAGCACTTG Gene expression

strain-specific total cDNA sdi1 sdi1+202 CCCATGATTCTGGATGCTCT 198 sdi1 sdi1+380 GATGTACATGTGCGGCAAAG

strain-specific total cDNA β-tubulin btub+358 GTGCGTAAGGAAGCTGAGGG 201 β-tubulin btub+538 TGTGGCATTGTACGGCTCAAC

strain-specific total cDNA gpd gpd+203 AGGGAAAGCCGATCCATATC 200 gpd gpd+323 GTTAACACCGCAGACGAACA

strain-specific total cDNA cpc-1 cpc-1+239 ACACTCCGTTCGAGGATGAC 210 cpc-1 cpc-1+429 GATCCAACAATGGTGTGTCG


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

TABLE 2. Frequency of homologous integration, homokaryons and ectopic integration

at the ku80 locus, in the wild-type and Δku80 strain, respectively

Strain Homologous integrationa Homokaryonsb Ectopic integrationc

PC9 (wild-type) 7/300 (2.3%) 3/7 (43%) 0/3

20b (Δku80) 15/15 (100%) 15/15 (100%) not tested

aHomologous integration was screened for in 300 out of 1000 carboxin-resistant

transformants produced, and in 15 out of 150 hygromycin B-resistant transformants

produced (10 of which targeting the ku80 locus, and 5 of which targeting the mnp4

locus).

bHomokaryons were screened for in the transformants showing homologous integration.

cEctopic integration was screened for in selected homokaryon transformants.


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

TABLE 3. Phenotype of P. ostreatus wild-type and Δku80 strains

Straina PC9 20b 20bH1

Linear growth

rate (mm/24 h)b 7.4±0.1 7.3±0.1 6.9±0.1

Biomass

production

(mg/flask)c

135.8±24.7 137.6±27.3 130.9±19.1

Laccase activity

(mU/mg dry

weight)c

0.74±0.14 0.72±0.14 0.71±0.10

Mn2+-peroxidase

activity

(mU/mg dry

weight)c

13.6±2.5 13.5±2.7 9.3±1.4

Orange II

decolorization

in liquid culture

(% of control)d

96.8±0.1 96.8±0.1 96.7±0.1

Orange II

decolorized area

in solid culture

(cm2)d

11.1±1.1 11.0±1.0 10.1±0.9

Resistance to no yes no


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

carboxine

Resistance to

hygromycin Be no no yes

Mycelium

phenotypef

monokaryon

monokaryon monokaryon

Mycelium

phenotype after

mating with

PC15f

dikaryon

dikaryon dikaryon

Resistance to

carboxin

after mating with

PC15e

no yes no

Resistance to

hygromycin B

after mating with

PC15e

no no yes


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

Fruiting body

production

after mating with

PC15g

yes

yes

yes

aPC9 and PC15 are monokaryon strains derived by dedikaryotization of the commercial

dikaryon strain N001; 20b is a carboxin-resistant Δku80 strain produced by

transformation on PC9 background; 20bH1 is a hygromycin B-resistant Δku80 strain

produced by transformation on 20b background.

bGrown on solid YMG culture for 10 days. Data represent the averages of three

biological replicates.

cAfter 10 days of incubation in liquid GP culture. Data represent the averages of five

biological replicates.

dAfter 10 days of incubation in liquid or solid GP culture amended with Orange II.

Noninoculated medium amended with Orange II was used as a control Data represent the

averages of three biological replicates.

eGrown on solid YMG culture amended with either carboxin or hygromycin B.

fGrown on solid YMG culture for 10 days. Visually characterized microscopically. Scale

bars represent 10 µm.

gIn vitro production of fruiting bodies after 12–14 days on solid YMG medium. Data

represent four biological replicates.


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

a gene-targeting system for pleurotus ostreatus : demonstrating the predominance of versatile

Documents