discussion of ecological speciation in south atlantic island finches by peter g. ryan, paulette...

Discussion of

Ecological Speciation in South Atlantic Island Finches

byPeter G. Ryan, Paulette Bloomer, Coleen L. Moloney, Tyron J. Grant and Wayne Delport

University of Cape TownUniversity of Pretoria

South Africa

Science

315:1420-1423

BIO101, Oct. 3, 2011

What’s the overall question?

What’s the overall conclusion?

Ecological Speciation in South Atlantic Island Finches

Peter G. Ryan, Paulette Bloomer, Coleen L. Moloney, Tyron J. Grant and Wayne Delport

Examples of sympatric speciation in nature are rare and hotly debated. We describe the parallel speciation of finches on two small islands in the Tristan da Cunha archipelago in the South Atlantic Ocean. Nesospiza buntings are a classic example of a simple adaptive radiation, with two species on each island: an abundant small-billed dietary generalist and a scarce large-billed specialist. Their morphological diversity closely matches the available spectrum of seed sizes, and genetic evidence suggests that they evolved independently on each island. Speciation is complete on the smaller island, where there is a single habitat with strongly bimodal seed size abundance, but is incomplete on the larger island, where a greater diversity of habitats has resulted in three lineages. Our study suggests that the buntings have undergone parallel ecological speciation.

Where in the world is Tristan da Cunha?

The most remote inhabited islands in the world

Where in the world is Tristan da Cunha?

Approx. 250 milesSouth

Approx. 12 milesbetween

Inaccessible Island

Rough circle, 2 miles in diameter.

3 million years old.Ecology largely stable for 20,000 years.

Low coast with high cliffs.Extensive plateau of 300-600 m.

Nightingale IslandSeveral small islands.Largest is approx. 1 mile diameter

18 million years old.Ecology largely stable for 20,000 years.

Mostly low lying (<300 m)

The Flora

Tall tussock grass, Spartina arundinacea

Trees, Phylica

Heath, Blechnum palmiforme

The Flora

Inaccessible Island: Low-lying coast is mostly tussock grasses with a few clumps of trees

East side of plateau is mostly Phylica trees

West side of plateau is mostly heath

Nightingale Island: Mostly tussock grass with a few clumps of trees

Fig. 1A

Nesospiza Finches/Buntings

Evolved from South American finches (crossed 4800 miles of ocean!)

Two species:N. acunhae – also called Tristan Bunting

wide variety dietsmall billfound on both islandsdifferences in ‘upland’ and ‘lowland’ types on Inaccessible

N. wilkinsi – also called Wilkins’ Buntingeats Phylica fruitlarge billfound on both islands

Nesospiza Finches/Buntings

N. dunneisubspecies of N. wilkinsionly found on Inaccessible Island

N. questisubspecies of N. acunhaeonly found on Nightingale Island

Hybrids of dunnei x acunhae

Hybrids only occur on Inaccessible

Each species has a different subspecies

Nesospiza Finches/Buntings Fig. 1BC

Allopatric Speciation:Species developed in geographic isolation,then dispersed and mixed

Sympatric Speciation:One species inhabited both islands,

large and small bills evolved on both islands

Morphological Analyses

Found on Nightingale Island

Found on Inaccessible Island

More extreme morphological differences on Nightingale

Fig. 2A

Ecological Analyses Fig. 2B

Inaccessible

Inaccessible

Inaccessible

Inaccessible

Ecological Analyses Fig. S1

Morphological and Ecological Analyses

Which model do these data support?

Allopatry? Sympatry? Both? Neither?

Genetic Analyses

Analysis of a mitochondrial gene

9 birds on Nightingale analyzed. One genotype found, which is different from those on Inaccessible.

Fig. S2

Which model do these data support? Allopatry? Sympatry? Both? Neither?Which factor is more important – species or location?

Genetic Analyses

For higher resolution, conducted an analysis of a microsatellites

Short, repetitive DNA sequencesHigh levels of variation within speciesVariation in the number of repeatsGenerally between genes, so not selected for or against

372 birds analyzed for 7 microsatellites each

CCGTAGATCGATCGATCTTACTGGT

CCGTAGATCGATCGATCGATCGATCTTACTGGT

Table S2aGenetic Analyses

Does the variation deviate from Hardy-Weinberg?

p-values for a statistically significant deviation from Hardy-Weinberg:

Mic

rosa

telli

te N

ames

Five of the 42 loci/species combinations show evidence of evolution. (may be due to ongoing speciation)

37 of 42 show neutral variation.

Fig. 3BGenetic Analyses

Visual representation of the microsatellite data.Each vertical line is one bird, with location and species/subspecies indicated.Colors code for genotypes at the four microsatellites

26 finches

First bird shows ~65% “green” lineage~25% “blue” lineage~10% “gray” lineageslight amount of “red” lineage

All N. wilkinsi finches on Nightingaleare genetically similar to each other

Figure 3BCGenetic Analyses

Each island/species grouping is well-resolved by the genetic data

Figure 3AGenetic Analyses

Distance of lines corresponds to genetic distance .(Nei’s Genetic Distance, D)

Can also present the microsatellite data as a tree:

Figure 3AGenetic Analyses

Which model do these data support?

Allopatry? Sympatry? Both? Neither?

Which factor is more important – species or location?

Current Model:

Buntings colonized Tristan da Cunha islands

~3 MYA (based on molecular clock data)

Speciation occurred ~0.3-0.4 MYA

Complete speciation on Nightingale

Single habitat

Speciation is not yet done on Inaccessible

Greater habitat diversity

Three lineages, including hybrids

Sympatric Speciation!