barley stripe rust national diagnostic protocol

Barley Stripe Rust

National Diagnostic Protocol

Merrin Spackman

Department of Primary Industries

Primary Industries Research Victoria, Horsham.

July 2005

ACKNOWLEDGMENTS

Plant Health Australia funded the project to develop this manual as part of their National

Diagnostic Protocols Initiative. Special acknowledgment is given to Dr Manilal William, CIMMYT Mexico, for diagnostic images and Dr Colin Wellings, University of Sydney, Plant

Breeding Institute, Cobbitty, for diagnostic images and intellectual input.

DISCLAIMER

The scientific and technical content of this document is current to the date published and all efforts were

made to obtain relevant and published information on the pest. New information will be included as it

becomes available, or when the document is reviewed. The material contained in this publication is produced

for general information only. It is not intended as professional advice on any particular matter. No person

should act or fail to act on the basis of any material contained in this publication without first obtaining

specific, independent professional advice. Plant Health Australia and all persons acting for Plant Health

Australia in preparing this publication, expressly disclaim all and any liability to any persons in respect of

anything done by any such person in reliance, whether in whole or in part, on this publication. The views

expressed in this publication are not necessarily those of Plant Health Australia.

2

Contents

1.0 Introduction

1.1 Description

1.2 Spread

1.3 Strains

1.4 Hosts

1.5 Losses

1.6 Control

2.0 National Diagnostic Protocol Procedure

2.1 Purpose and scope of diagnostic protocol

2.2 Responsibility

2.3 Procedure

2.4 Documentation

2.5 Records

3.0 Pest Risk Analysis

3.1 Background

3.2 Species name

3.3 Synonyms

3.4 Common names

3.5 Host Range

3.6 Distribution

3.6.1 Current distribution

3.6.2 Australian status

3.6.3 Potential distribution in Australia

3.7 Plant parts affected

3.7.1 Vegetative

3.7.2 Seedborne

3.8 Disease features

3.9 Biology

3.9.1 Identification

3.9.2 Symptoms

3.9.3 Disease cycle

3

3.9.4 Dispersal

3.10 Assessment of likelihood

3.10.1 Entry potential

3.10.2 Establishment potential

3.10.3 Spread potential

3.11 Overall entry, establishment and spread potential

3.12 Assessment of consequences

3.12.1 Economic impact

3.12.2 Environmental impact

3.12.3 Social impact

3.13 Combination of likelihood and consequences to assess risks

3.14 Surveillance

3.15 Diagnostics

3.16 Training

4.0 Diagnostic protocol

4.1 The diagnostic test/s and diagnostic sequence

4.2 The initial samples

4.2.1 Sample handling and subsampling

4.2.2 Sample storage

4.2.3 Visual symptoms

4.2.4 Documentation

4.3 Further samples

4.3.1 Sample collection, transport and storage

4.3.2 Sample locations

4.4 Confirmation of diagnosis

5.0 Identification of pathogen (primary diagnostic test)

5.1 PCR test

5.1.2 DNA Extraction

5.1.2.1 General items required

5.1.2.2 Method

5.1.3 Detection

5.1.3.1 Items required

5.1.3.2 Primers

4

5.1.3.3 PCR controls

5.1.3.4 PCR reagents

5.1.3.5 PCR program

5.1.3.6 Electrophoresis

5.1.3.7 Results

5.1.3.8 Recipes

5.1.3.9 Ordering information


6.1 Confirmatory (secondary diagnostic) test

6.1.1 Introduction

6.1.2 General items required

6.1.3 Specific items

6.1.4 Method

7.0 Images

8.0 References and websites

8.1 References

8.2 Websites

9.0 Appendices

Appendix 1. Preliminary Information Data Sheet (Plantplan, 2004)

Appendix 2. Personnel Hygiene

Appendix 3. Machinery Hygiene

5

List of Figures

Figure 1. Life Cycle..

Figure 2. Flow diagram of the protocols for the analysis of a suspect plant sample.

Figure 3. Flow chart of protocols for the diagnosis of suspect barley stripe rust-infected plants.

Figure 4. The potential distribution of barley stripe rust in Australia.

Figure 5. Amplification products using SSR primers RJ18.

Figure 6. Amplification products using SSR primers RJ24.

Figure 7. Pressurised spray gun for distributing spores.

Figure 8. Humidity chambers with mister in cool room.

Figure 9. The stripes of stripe rust.

Figure 10. Dr C. Wellings assessing a field trial of barley stripe rust at CIMMYT.

Figure 11. Infection of P.s. hordei on highly susceptible barley.

Figure 12. Striping infection type typical of P.s. hordei infection.

List of Tables

Table 1. Host range of P. striiformis f.sp. hordei.

Table 2. World distribution of P. striiformis f.sp. hordei.

Table 3. Differences in colour, infection position and pattern between the cereal rust diseases.

Table 4. Barley varieties used as differential testers for diagnosis of barley stripe rust.

Table 5. Scale of infection for rust symptoms.

6

1.0 Introduction

Rust diseases have caused sporadic crop losses in most barley producing regions of the world.

Stripe rust, caused by Puccinia striiformis exists in several biological forms (formae speciales) that

vary in host range between and within genera and species of the Gramineae family (Stubbs, 1985).

The pathogen already occurs in Australia on other host species, wheat and barley grass, as distinct

formae speciales. Wheat stripe rust, P. striiformis f.sp. tritici has a low level of infection on barley

and does not cause significant damage to barley crops. Susceptible barley cultivars lose

approximately 10% yield due to barley grass stripe rust (Wellings et al., 2000).

Isolates of the stripe rust pathogen, which demonstrated adaptation to cultivated barley, were

described by European workers in the late nineteenth century (Line, 2002). Barley stripe rust has

caused significant problems in winter barley production in Europe, the UK and the Netherlands

since the 1960s (Stubbs, 1985), Colombia and South America from 1975 (Dubin & Stubbs, 1986),

Mexico from 1990 and the USA from 1991 (Marshall & Sutton, 1995). Since 1991, stripe rust of

barley has quickly spread and become established in the south-central and western USA and is now

the most important disease of barley in western the United States (Line, 2002; Chen, 2004).

When field testing of Australian barley commenced at the International Centre for Wheat and

Maize Improvement (CIMMYT), Mexico, more than 80% of current varieties were very

susceptible to barley stripe rust (Wellings & Park, 2003). With offshore testing and the availability

of molecular markers to select resistance genes (Cakir et al., 2003) pre-emptive breeding is being

initiated to give Australian barley varieties protection from stripe rust incursions.

Description

P. striiformis is a hemiform rust with uredinial and telial stages being produced during its life

cycle. The urediniospores complete multiple asexual cycles throughout the growing season and

these cycles cause the principle damage to cereal crops (Figure 1). Spores are binucleate. Infection

hyphae have 4 nuclei (Line, 2002). Telia, producing teliospores, form on heavily infected leaves

and leaf bases at the end of the season.

The urediniospores are yellow to orange in colour, spherical, echinulate and 28-34 m in diameter

(Singh et al., 2002). Spores infect leaves and spikelets and develop sporulating pustules in rows of

varying lengths giving the appearance of narrow yellow stripes. Striping is not evident on seedling

leaves, rather the infection covers the leaves in a random fashion. The fungus may affect leaf

sheaths and heads in heavy epidemics (Adams, 1997; Bariana, 2004). The rust is an obligate

pathogen and therefore, must reside within a living host for survival (Adams, 1997).

Conditions are suitable for rust development between April and December and in most years

infections can be observed in crops by September.

7

Figure 1. Life cycle of Puccinia striiformis.

1.1 Spread

Urediniospores of barley stripe rust are capable of moving great distances on wind currents. Barley

stripe rust in South America migrated from Colombia to Chile over a period of only a few years as

a result of wind dispersal (Dubin & Stubbs, 1986). Intercontinental air travel from Europe has been

predicted to be the pathway pattern of P.s. hordei on barley in Columbia.

1.3 Strains

Using a set of 11 differential barley genotypes, 69 races of barley stripe rust have been identified as

occurring in the United States (Chen, 2004). Since 1998 certain races have become predominant

but because of non race-specific resistance, selection pressure has been low and the rust population

still consists of numerous races (Chen, 2004). In Europe, there has been less race diversity

identified with race 24 being predominant (Stubbs, 1985; Dubin & Stubbs, 1986).

1.4 Hosts

Spring barley, Hordeum vulgare, is the primary host for the disease. Certain races of the rust will

also survive on wild barley species such as H. jubatum (foxtail barley) and H. leporinum (barley

grass)(Marshall & Sutton, 1995).

8

1.5 Losses

Resistant varieties show no significant yield loss. Yield losses of 30-70% were estimated when

barley stripe rust was first identified in South America (Dubin & Stubbs, 1986). In 1995, the

highest grain yield loss in susceptible US varieties was 72% (Marshall & Sutton, 1995). Recently,

commercially grown susceptible US cultivars showed a 20% yield loss and cultivars with moderate

levels of adult plant resistance showed a 12% yield loss. (Chen, 2004). In recent years, US state-

wide losses have been lower as highly susceptible cultivars are rarely grown. However, severe

barely stripe rust still appears in test plots on susceptible lines and is a continuing threat (Jackson.

2003).

1.6 Control

There are several control options available to producers:

1. Seed treatment with fungicides may delay the onset of an epidemic by preventing early build

up of the disease on seedlings (Brown et al., 2001).

2. Use of resistant cultivars. However, these are limited at present and no malting barleys with

resistance to P.s. hordei have been developed in the US (Chen, 2004). Current work in

Australia is using offshore field testing and molecular markers to develop resistant varieties as

a pre-emptive control strategy (Wellings et al., 2003; Cakir et al., 2004)

3. Use of cultural control methods to reduce damage and subsequent yield loss, such as use of

earlier maturing varieties (Brown et al., 2001).

4. Spraying with a foliar fungicide if severity is greater than 5% at the late tillering stage eg.

triazole chemicals (Adams, 1997).

9

2.0 National Diagnostic Protocol Procedure

2.1 Purpose and scope of diagnostic protocol

The purpose of this manual is that a nationally accepted standardised protocol is available for the

accurate identification of the barley-attacking form of P. striiformis, the cause of barley stripe rust.

This fungal pathogen is exotic to Australia but is found in many barley producing regions

throughout the world including parts of Europe, North and South America, Mexico and India.

This manual is designed to be a complete guide to the identification of barley stripe rust including a

Pest Risk Analysis, sample collection and diagnostic techniques for identification of P. striiformis

f.sp. hordei and colour plates of symptoms in the field.

2.2 Responsibility

Figure 2 shows a flow diagram of the responsibilities and procedures required when a suspect

sample is received. The responsibilities are also listed quite clearly in the following points:

A: State/territory agriculture departments receiving suspect plant sample:

Receiving scientists will record details of the sample so that a trace back can occur if required.

Receiving scientists will examine the sample and provide diagnostic services in this case,

conducting the biological test on differential cultivars and/or PCR test) to identify the

pathogen.

Receiving scientists will notify the State Quarantine Authority (eg. DPI-Victoria Plant

Standards Branch) of the suspect sample.

State Quarantine Authority will examine the evidence and inform Office of the Chief Plant

Protection Officer (OCPPO) and AQIS and advise scientists of required action.

The State Quarantine Authority will participate in the Consultative Committee on Exotic Plant

Pests and Diseases (CCEPPD), chaired by the Chief Plant Protection Officer and decisions

made and actions required will be passed onto state scientists for action.

Scientists may be requested to provide expert advice to the CCEPPD.

Scientists will undertake testing procedures as advised by the State Authority as indicated in

Figure 3 eg. Conducting a second type of diagnostic test (secondary confirmatory test) and

sending part of the sample to the interstate confirmatory laboratories for repeat of the primary

diagnostic test.

Under direction from the State Authority, state scientists will undertake delimiting surveys if

required and undertake diagnostics on survey samples.

The State Authority will liaise with industry representatives.

10

The State Authority will develop communication strategies in conjunction with the CCEPPD.

The State Authority will report to all interested parties (OCPPO, CCEPPD, AQIS, national

bodies and industry) as required.

The State Authority will keep up to date with the processing of the suspect sample and will

notify the clients of the final result and the corresponding decision for that result.

The State Authority will handle all correspondence with clients. This is very important and is

to be made clear to other personnel involved with handling the sample that they are not to

correspond with the client.

B: Interstate agriculture departments

Scientists will re-examine the suspect sample.

Scientists will repeat diagnostic tests and confirm diagnosis.

Scientists may be requested to provide expert advice to the CCEPPD.

State Quarantine Authority will inform the Chief Plant Protection Officer and the CCEPPD

and will implement their decisions.

C: Office of the Chief Plant Protection Officer (OCPPO)

OCPPO will convene the CCEPPD and the committee will make all decisions regarding the

steps involved in handling and diagnosing the original sample.

The CCEPPD will determine whether or not the incursion requires a national response or

involves only one state and will determine the need for delimiting surveys.

Information from each state will be provided to the CCEPPD to enable national decisions to

be made.

OCPPO will provide media releases to the public and interested parties.

OCPPO and the CCEPPD will determine whether or not the pathogen can be eradicated,

contained or will be declared endemic.

2.3 Procedure

Direct examination of symptoms and fungal morphology is not a reliable method due to the

morphological and epidemiological similarities between formae speciales. Identification by PCR is

a reliable, rapid method. Identification using differential cultivars is reliable but slow. Thus the

PCR test is used as the primary test and the biological test on differentials is used as the

confirmatory test although both will be commenced simultaneously.

2.4 Documentation

11

An electronic and a hard copy of this manual are maintained by the Molecular Pathologist, Primary

Industries Research Victoria (PIRVic), Dept. of Primary Industries-Horsham, Victoria and PHA.

2.5 Records

The Recording sheets contained in Appendix 1 must be copied and filled in as appropriate for each

sample received and kept together in a file marked “Suspect barley stripe rust samples”.

12

Figure 2. Flow diagram of the protocols for the analysis of a suspect plant sample

Sample received at State Agriculture Department

Sample logged into relevant diagnostic system and details recorded

Pathologist tests sample using

primary test

Pathologist notifies State Quarantine

Authority

State Quarantine Authority informs

OCPPO and advises Pathologist

Pathologist sends subsample to confirmatory

lab for secondary testing

Pathologist and confirmatory lab repeat tests

using defined protocols

CCEPPD meets and discusses results and

advises scientists of further action

Plantplan used to develop emergency

response plan Further sampling or delimiting survey

may be undertaken

OCPPO and State Authorities develop a

communication strategy

OCPPO and CCEPPD decide on feasibility

of eradication or containment

13

Collect leaf samples from crop

Divide sample into 3 subsamples

Long term storage

Freeze or dry

Store sample at

-80ºC until processed

Sample sent to

confirmatory lab

Identify initial samples using PCR

Confirm diagnosis using differential test

Test survey samples using PCR

Figure 3. Flow chart of protocols for the diagnosis of suspect barley stripe rust-infected plants

14

3.0 Pest Risk Analysis

3.1 Background

Stripe rust is primarily a disease of cool climates (ie, high latitudes, or high elevations at low

latitudes). It has caused widespread, devastating losses in each region where it has occurred. Barley

stripe rust, which was first detected in the United States in 1991, has become the most widely

destructive disease of barley in Western USA. It is known to reduce yields up to 100% in

susceptible varieties and to reduce grain quality. Damage to barley depends on its stage of growth

relative to rust development, with infection beginning at an early plant growth stage causing the

most damage.

3.2 Species name

Puccinia striiformis Westend f.sp. hordei Erikkson & Henning.

3.3 Synonyms

Puccinia glumarum.

3.4 Common names

Barley stripe rust, barley yellow rust, glume rust

3.5 Host range

Table 1. Host range of P. striiformis f.sp. hordei.

Host Reference

Hordeum vulgare L. – common barley Marshall & Sutton (1995)

H. jubatum – foxtail barley Marshall & Sutton (1995)

H. leporinum – barley grass Marshall & Sutton (1995)

3.6 Distribution

3.6.1 Current distribution

Table 2. World distribution of P. striiformis f.sp. hordei

Countries Reference

Asia Stubbs (1985)

Canada Stubbs (1985)

Central Africa Referenced in Chen et al (1995)

Central America Referenced in Chen et al (1995)

China Referenced in Chen et al (1995)

Europe Stubbs (1985)

India Upadhyay & Prakash (1977)

Japan Stubbs (1985)

Nepal Referenced in Chen et al (1995)

North America Marshall & Sutton (1995)

South America Dubin & Stubbs (1984)

15

3.6.2 Australian status

Exotic

3.6.3 Potential distribution in Australia

Barley stripe rust can potentially infect crops in all barley producing areas of Australia.

Figure 4. The potential distribution of barley stripe rust covers the main barley production

areas of Australia (Year Book Australia 2003 Agricultural Crops Australian Bureau of Statistics

http://www.abs.gov.au/Ausstats/[email protected]/Lookup/A244DE90C4781BC4CA256CAE0015BACA).

3.7 Plant parts affected

3.7.1 Vegetative

Primarily leaf. In heavy infections may also affect leaf sheaths and heads.

3.7.2 Seedborne

Not seedborne.

http://www.abs.gov.au/Ausstats/[email protected]/Lookup/A244DE90C4781BC4CA256CAE0015BACA

16

3.8 Disease features

Distinct yellow pustules are generally arranged in stripes along upper leaf surfaces. Rust infections

reduce plant vigour and root growth, increase water loss and decrease the amount of photosynthate

available for grain filling, resulting in reductions in the number and weight of kernels

(http://www.ipmcenters.org/cropprofiles/docs/cabarley.html; Davis and Jackson, 2002).

3.9 Biology

3.9.1 Identification

Stripe rust develops as urediniospores that infect leaves and spikelets producing elongated yellow

pustules (uredinia) in rows of varying lengths, giving the appearance of narrow yellow stripes on

the upper surface of the leaves. In susceptible cultivars, the rust may cover the entire leaf blade and

may also extend into the leaf sheaths and grain heads (Adams, 1997; Bariana, 2004).

Striping is not evident on seedling leaves, rather, the infection covers the leaves in a random

fashion. The rust is an obligate pathogen and therefore, must reside within a living host for

survival (Adams, 1997).

Stripe rust is distinguished from stem and leaf rusts based on colour, position and pattern of

infection (Table 3).

Table 3. Differences in spore colour, position of infection and pustule pattern between the cereal

rust diseases.

Rust Colour Position Pattern

Stripe Yellow Upper leaf surfaces Striped pustules

Stem Dark brown Leaves, leaf sheaths, stems and heads Large pustules

Leaf Mid to light brown Upper leaf surfaces and leaf sheaths Scattered pustules

3.9.2 Symptoms

The primary symptom of stripe rust is the appearance of yellow orange pustules (uredinia) oriented

linearly between vascular bundles of leaves. Glumes also can be infected. Stripe rust symptoms

usually appear earlier in the season than other wheat rusts because the fungus develops at lower

temperatures than the other rust fungi. As plants mature and temperatures increase, the pustules

turn dark and shiny as teliospores are formed. These spores do not play a role in disease

development or survival (Davis and Jackson, 2002).

3.9.3 Disease cycle

P. striiformis grows only on living host plants and survives between seasons on volunteer wheat,

barley and some wild grasses. The amount of over-summering rust available for the following year

depends on the amount of volunteer plants, which in turn is a function of moisture in the off season.

Only one infected leaf per 30 hectares of regrowth needs to survive the summer to produce severe

http://www.ipmcenters.org/cropprofiles/docs/cabarley.html

17

rust infections (Hollaway, 2005). Rust spores are spread by wind to initiate and spread infections.

The optimum temperature for the germination of urediniospores is 10-12oC. Spores germinate over

6-8 hours in conditions of high humidity and temperatures between 5 and 15oC. Infections result by

urediniospores producing adhesion pads to maintain contact with the host cuticle, and a germ-tube

that grows across the leaf surface and enters the leaf via stomata. An infection peg forms through

the stomatal pore and gives rise to a vesicle from which infection hyphae develop that branch out

and can infect the whole of the leaf tissue (Park, 2000). The optimum temperature for development

of stripe rust in plants is 13-18oC. Under optimum conditions, the time from inoculation to

sporulation is 12-13 days (Line, 2002; Davis & Jackson, 2002). Late in the summer, telia

develop as linear black pustules on the leaf.

3.9.4 Dispersal

Spread is by urediniospores blown in the wind between plants and fields.

3.10 Assessment of likelihood

3.10.1 Entry potential

Entry potential is Low, but possible given there is a high frequency of travel between countries

where the pathogen exists and Australian farming areas. Entry is possible by spores being carried

on clothing (Wellings et al., 1987; 2000).

3.10.2 Establishment potential

HIGH

Formae speciales of P. striiformis already occur in Australia on other host species.

Current commercial barley cultivars in Australia are highly susceptible to barley stripe rust.

Climatic conditions in world regions where the disease already occurs are similar to the barley

producing areas of Australia.

3.10.3 Spread potential

HIGH

Spores are spread large distances on wind currents. Barley stripe rust in Australia would

spread easily such as the new wheat stripe rust pathotype detected in Western Australia 2002

spread to the eastern states within 12 months (Bariana et al., 2004).

3.11 Overall entry, establishment and spread potential

HIGH

The probability of entry, establishment and spread is determined by combining the likelihood

of entry, establishment and spread.

18

3.12 Assessment of consequences

3.12.1 Economic impact

EXTREME

The disease has the potential to greatly effect the barley industry in Australia in a similar manner to

the wheat stripe rust incursions of 1979 and 2002. Australian barley varieties have little resistance

to barley stripe rust and an incursion is likely to develop into an epidemic. Data from trials held at

CIMMYT, Mexico indicate that Australian barley cultivars are vulnerable to P.s. hordei in the

event of this pathogen being introduced to barley producing areas (Wellings et al., 2003). In the

US losses up to 70% of barley yield are estimated to be due barley stripe rust infection (Dubin &

Stubbs, 1986).

Conservative estimates are that fungicide costs for control of the new pathotype of wheat stripe rust

in Australia in 2004 cost $90 million. In this case, genetic resistance is still effective, as compared

to barley stripe rust incursions where there is limited genetic resistance in barley cultivars.

However, the figures provide a benchmark for potential control costs of barley stripe rust

(Hollaway, 2005). This estimate does not include costs incurred by yield loss or take into account

the smaller barley production area compared to wheat.

3.12.2 Environmental impact

MEDIUM

There is no potential to degrade the environment or otherwise alter the ecosystem by affecting

species composition or reducing the longevity or competitiveness of wild hosts. However, there is

potential impact on the environment as a result of multiple in-season chemical applications in years

of severe epidemics.

3.12.3 Social impact

MEDIUM

The reduction in the value of production would be expected to cause moderate social impact with

significant losses to local barley producers and processors (livestock feed, malt producers) and the

broader community.

19

3.13 Combination of likelihood and consequences to assess risks

Economic risk – EXTREME – specific action is immediately required to reduce risk.

Environmental risk – MEDIUM – managed through routine procedures.

Social risk – MEDIUM - adoption of generic risk treatment plans will reduce the risk to

suitable levels.

3.14 Surveillance

The importance of maintaining vigilance for exotic pathogens within the grains industry becomes

clearly important when past experiences with exotic incursions and the impact they have on the

host industry are remembered. Stripe rust infections on barley in Australia have so far been

identified as either P.s. tritici or barley grass stripe rust but consistent monitoring of future

infections should be maintained to ensure that an incursion of the exotic formae speciales is

detected early. Growers and agronomists should be encouraged to send stripe rust infections on

barley to their state departments of agriculture where an experienced plant pathologist can perform

identification. For effective control and possible containment of an exotic plant disease to occur

rapid identification of the disease is necessary.

3.15 Diagnostics

After preliminary examination of the infected plant for the presence of stripe rust, diagnosis of

barley stripe rust would be a two-stage process. Firstly, a PCR test would be used to distinguish

the infection from the other endemic species. Secondly, a test on differentials would be used to

confirm the PCR test. The PCR test would be done first to give a rapid result that can be acted on

immediately as the differential test takes a number of weeks to complete. The primary test would

require sample processing in a specialised laboratory capable of molecular techniques. An

experienced plant pathologist at The University of Sydney, Plant Breeding Institute, Cobbitty

would perform the differential test.

3.16 Training

Growers and agronomists are currently aware of stripe rust symptoms and of the ongoing

monitoring of formae speciales and races in seasonal infections.

20

4.0 Diagnostic protocol

4.1 The diagnostic test/s and diagnostic sequence

PCR is the primary test to be used in the identification of barley rust infections. The test uses

specific diagnostic molecular markers able to distinguish barley stripe rust from wheat and barley

grass stripe rusts. This test uses infected plant material as the source of DNA for testing.

Identification by virulence on differential cultivars is the current test used for all rust infections. It

can distinguish formae speciales and races within formae speciales.

4.2 The initial samples

4.2.1 Sample handling and subsampling

It is important that the samples are entered onto sample reference sheets (Appendix 1) which

contain sufficient information to enable revisiting of the site, describe symptoms and other relevant

information and recording of diagnostic test results. It is vital that information is provided here to

ensure that samples are handled correctly, that sub samples are taken as reference samples and so

that material can be sent to other experts for confirmation.

4.2.2 Sample storage

As soon as the diagnostician becomes aware that the sample submitted for diagnosis may be an

exotic or emergency pathogen, the diagnostician has the responsibility to seek expert advice from

State Plant Standards or equivalent or AQIS or the Office of the Chief Plant protection officer

(OCPPO) on the appropriate manner/location in which the sample should be stored and appropriate

further testing/action. It is not appropriate for the diagnostician to continue tests without informing

the proper authorities.

Fresh plant samples should be stored under cool conditions either in a cool room or

refrigerator. It is important that samples not be allowed to „sweat‟ in sealed plastic bags, this

allows for rapid deterioration and contamination of the sample and which may render it non-

viable for diagnostic purposes.

Wrapping fresh plant samples in damp (not wet) paper and storing in open containers can be a

good method of maintaining plant samples for short periods.

Fresh leaves bearing rust symptoms should be dispatched as soon as possible in paper

envelopes (not plastic and not moistened) to:

Cereal Rust Survey Plant Breeding Institute

Private Bag 11

Camden

NSW 2570

21

If possible rust spores should be collected from infected plant tissue, dried and stored long term

at –80oC.

4.2.3 Visual symptoms

Stripe rust is present when leaves, especially those low in the canopy, show yellow stripes of

pustules. The pustules are raised above the leaf surface and can be easily wiped off leaving a

yellow stain. Visual symptoms should be recorded and photos taken where possible.

4.2.4 Documentation

Accurate documentation of specimens, sub-sampling and sample processing is vital if large

numbers of samples are to be inspected and processed. Trace back of specimens needs to be an

accurate, easy task, especially if results are to be released to the public. It is vitally important that

all possible details are collected regarding the origin of samples. Information collected here will

give some indication of the source of disease, and the likelihood of spread. The information will

also form the starting point of any crop surveys. Any results and findings should also be kept with

the sample log sheets. Specimen worksheets will also be necessary for recording diagnostic

processing and results. It is important to note that proper documentation of samples and diagnostic

procedures and results is initiated at this stage.

4.3 Further samples

Once initial samples have been received and preliminary diagnosis made, follow up samples to

confirm identification of the pathogen will be necessary. This will involve sampling directly from

the infected crop, and sampling crops over a larger area to determine the extent of disease

distribution. The total number of samples collected at this point may run into the hundreds or even

thousands. It is vital that a system of sample identification is determined early in the procedure to

allow for rapid sample processing and accurate recording of results. Follow up samples will be

forwarded to the nominated diagnostic laboratories for processing.

22

4.3.1 Sample collection, transport and storage

Samples should be initially collected over a representative area of the infected crop to determine

the disease distribution. The disease will appear as hot spots within the crop. When these are well

developed and just before the disease becomes general in the crop, the average infected leaf area, as

a percentage of the crop, will be about 1%. Sampling of crops over a district area and further will

be based upon the origins of the initial suspect sample.

Samples should be treated in a manner that allows them to arrive at the laboratory in a fresh, well-

preserved state. Samples should be transported in clearly labelled paper bags. Once removed from

the field, fresh plant samples can deteriorate and become contaminated by other mould fungi and

bacteria. To store viable material, spores should be removed from the leaf tissue, dried* and stored

at –80oC or under liquid nitrogen. Infected plant tissue to be used for PCR analysis can be placed in

a –800C freezer and stored for an indefinite period under these conditions without damaging fungal

DNA.

* In an actively sporulating leaf sample the spores can be tapped off easily into an uncovered glass

petri-dish, placed over glycerol and dried at Room Temperature (RT) for 6 hrs only in a sealed

container.

4.3.2 Sample locations

It is important to record the precise location of all samples collected, preferably using GPS, or if

this is not available, map references including longitude and latitude and road names should be

recorded. Property names and owners should also be included where possible.


It is important that all diagnoses of suspected exotic and emergency pathogens are undertaken

according to the following parameters:

The lab/diagnostician has expertise in this form of diagnosis,

the test is undertaken as described in this manual,

the results are confirmed by diagnosis in another recognised laboratory or another

diagnostician and

Where possible diagnosis is confirmed by a second method.

23

5.0 Identification of pathogen (primary diagnostic test)

5.1 PCR test for detection of P.s. hordei

Preliminary examination of the suspect plant sample will determine if the causal pathogen is P.

striiformis. Characteristics of the colour, position and pattern of infection will be assessed in the

preliminary examination (see Table 3). The PCR test described will distinguish P. striiformis from

other common barley attacking foliar pathogens and identify the P. striiformis formae speciales

present.

5.1.2 DNA Extraction

5.1. 2.1 General items required

1. Samples - infected/suspect plant tissue.

2. 2-20 l pipettes, 20-200 l pipettes, 200-1000 l pipettes, and sterile tips.

3. Balance (that weighs to at least two decimal places) and weighboats.

4. Disposable gloves.

5. Microcentrifuge.

6. 1.5 ml and 2 ml sterile microcentrifuge tubes.

7. 65°C and 20°C incubators.

8. Fume hood.

9. Sterile distilled water

10. Fast prep extractor (Invitrogen®).

11. PCR Master Mix (2X) (Promega®)

5.1.2.2 Method

N.B All buffer recipes can be found in section 5.3.8

1. Collect infected leaf tissue from the field and snap freeze 0.5 cm2 segments in 1.5 ml

microcentrifuge tubes with liquid nitrogen.

2. Grind infected leaf tissue in flat bottom tubes with disposable plastic beads in 5 sets of 30 s

with cooling in between, using fast prep machine (Invitrogen®)

3. Add 1 ml warm extraction buffer and transfer to 2 ml microcentrifuge tube

4. Add 600 l 20% SDS (final concentration 1%)

5. Gently shake for 1hr at 20oC

6. Mix with 130 l CTAB/NaCl solution and 150 l 5M NaCl

7. Incubate at 65oC for 20 min

8. Divide mixture in two and extract with an equal volume of chloroform:isoamyl alcohol (24:1)

24

9. Precipitate with 600 l cold isopropanol (20 min incubation at 4 oC then 13000 rpm spin for 20

min at 4oC)

10. Rinse with 70% ethanol (EtOH) and dry.

11. Resuspend in 40 l R40 (TE + RNase).

12. Store samples at –20oC.

5.1.3 Detection

5.1.3.1 Items required

1. 0-2 l, 2-20 l, 20-200 l, and 200-1000 l pipettes and sterile tips.

2. 0.2 ml sterile PCR tubes.

3. Microcentrifuge.

4. Disposable gloves.

5. Cooler racks.

6. Thermocycler.

7. DNA Molecular Weight markers (hyperladder IV, Bioline®).

8. Vertical gel electrophoresis tanks and rigs (CBS Scientific Co. model DASG-400-50).

9. Power pack.

10. UV transilluminator with camera.

5.1.3.2 Primers

For specific, sensitive amplification of P. striiformis DNA use the following specific simple

sequence repeat (SSR) primers for analysis by acrylamide gel electrophoresis.

RJ18f – 5‟ CTGCCCATGCTCTTCGTC 3‟

RJ18r – 5‟ GATGAAGTGGGTGCTGCTG 3‟

ERJ24f – 5‟ TTGCTGAGTAGTTTGCGGTGAG 3‟

ERJ24r – 5‟ CTCAAGCCCATCCTCCAACC 3‟

5.1.3.3 PCR controls

1. Positive control, ie. a DNA extract from barley tissue infected with P. striiformis

2. Uninfected plant control, ie. a DNA extract from uninfected barley tissue.

3. No template control, ie. an aliquot of the PCR Master Mix minus DNA template.

25

5.1.3.4 PCR reagents

Reagents 1 x reaction

2x master mix (Promega) 5 l

F + R Primer mix (2.5 M) 2 l

DNA 2 l

H2O q.v. 10 l

Promega Master Mix #M7501

Forward and Reverse primers synthesised by Sigma-Genosys®.

5.1.3.5 PCR Program

Temperature Time Cycle #

95 1 min 1

94 30 s 50 30 s

72 30 s 35

72 2 min 1

4 hold 1

5.1.3.6 Electrophoresis

1. Add 2 l loading dye to PCR reaction.

2. Run 5 l PCR reaction on vertical 8% polyacrylamide/bisacrylamide gel in 1x TBE at 300

volts for 3 hrs or until light blue dye has migrated ¾ the length of the gel. Use 5 l

hyperladderIV as size ladder.

3. Stain in 0.1 mg/ml ethidium bromide by shaking for 10 min.

4. Destain in water by shaking for 10 min.

5. Visualise on UV transilluminator.

26

5.1.3.7 Results

1. RJ18

RJ18 amplifies a single band from PSH (362bp). Double banding patterns are observed in

BGYR (362bp and 335bp) and PST (362bp and 341bp).

Host tissue does not amplify similar bands.

Overlap of band sizes with yellow leaf spot was observed.

For the marker RJ18 to be useful in a diagnostic test the infection must not be a mixture of

formae speciales.

Figure 5: Amplification products using SSR primers RJ18. Lanes 1-4 - barley grass stripe rust.

Lanes5-17 - P.s. tritici. Lanes 18-24 - P.s. hordei. Lanes 25-26 - P.s. poae (bluegrass

stripe rust, US origin)

362bp 341bp

335bp

27

2. RJ24

RJ24 amplifies 2 bands from PSH (223bp & 211bp) that are different from the bands

amplified from BGYR (225bp and 205bp) and from PST (217bp and 199bp). No band was

amplified from PSP

Host tissue does not amplify similar band sizes.

No observed overlap of band size with other pathogens tested.

RJ24 is the preferred marker for a diagnostic test.

Figure 6: Amplification products using SSR primers RJ24. Lanes 1-3 - barley grass stripe rust.

Lanes 4-13 - P.s. tritici. Lanes 14-19 - P.s. hordei. Lanes 20-21 - P.s. poae.

217bp

199bp

225bp

205bp

223bp

211bp

RJ2

4 M BGYR PSH PST PSP

bp

300

200

28

5.1.3.8 Recipes

1. Extraction Buffer

100 ml final

1 M Tris-HCl, pH 8.0 5 ml 50 mM

NaCl 0.8g 150 mM

EDTA 3.7g 100 mM

Dissolve solids and mix solutions in 100 ml sterile RO water.

Autoclave before use.

Store at room temperature.

Note: EDTA is a hazardous substance. Read MSDS before use.

2. CTAB/NaCl

10 ml final

Cetyl Trimethyl Ammonium Bromide (CTAB) 1 g 10%

NaCl 0.4 g 0.7 M




3. R40 – 40 g/ml Rnase in TE buffer

50 ml

1 M Tris-Cl pH 8.0 0.5 ml

0.5 M EDTA pH 8.0 0.1 ml

10 mg/ml Rnase A 0.2 ml




RJ18 RJ24

M BGYR PSH PST PSP BGYR PST PSP PSH

362

335

bp bp

300

200

Figure 1. RJ18 (a) and RJ24 (b) fragments amplified from barley grass stripe rust (BGYR), P.s. f.sp. tritici

(PST), P.s. f.sp. hordei (PSH) and P.s. f.sp. poae (PSP) RJ18 (a) amplified a single band from PSH (362bp) which is

different from the double banding patterns observed in BGYR

(362bp and 335bp) and PST (362bp and 341bp).


Overlap of band sizes with yellow leaf spot.

For the putative marker, RJ18 to be useful in a diagnostic test

the infection must not be a mixture of forma speciales.

RJ24 (b) amplified 2 bands from PSH (223bp & 211bp) that

are different from the bands amplified from BGYR (225bp and

205bp) and from PST (217bp and 199bp).


No observed overlap of band size with other pathogens

tested.


(a) (b) RJ18 RJ24


362

335

bp bp

300

200














tested.


(a) (b) RJ18 RJ24


362

335

bp bp

300

200














tested.


(a) (b) RJ18 RJ24


362

335

bp bp

300

200














tested.


(a) (b) RJ18 RJ24


362

335

bp bp

300

200














tested.


(a) (b)

29

4. 5 x TBE Buffer

1 L final

Tris base 54.0 g 0.4 M

Boric acid 27.5g 0.05 M

0.5 M EDTA pH 8.0 20.0 ml 0.001 M

Dissolve components in 1 L sterile RO water.


Dilute to 1X concentration for use.

5. 8% Acrylamide/bisacrylamide gel

Acrylamide gels are run on CBS Scientific Co. model DASG-400-50 apparatus set up as described in Shi et al. (2001).

190ml final

40% acrylamide:bis (29:1) 28.5 ml 6%

0.5931 x TBE 160 ml 0.5 x 10% ammonium persulfate 1.35 ml

TEMED 0.15 mL

Make up immediately prior to use. TEMED should be added last.

Mix well and pour into previously set up glass plates. Insert well comb and remove any

bubbles that form.

Leave to set for 1 hr minimum.

Remove comb carefully and wash out wells with 1 x TBE.

NB. ACRYLAMIDE IS A CARCINOGEN AND APPROPRIATE GLOVES, SAFETY GLASSES AND LABORATORY

COATS MUST BE WORN AT ALL TIMES. READ MSDS BEFORE USE

10% ammonium persulfate (APS) should be used fresh. If several gels are to be run in succession

make up 10 ml and store at 4oC.

6. 6x Loading dye

50 ml

1 x TE

5 ml

Glycerol

25 ml

Bromophenol blue 0.125 g

Xylene cyanoll FF* 0.125 g

Make up in 50 ml RO water.


30

7. TE Buffer

1 L final

1M Tris HCl (pH 8.0) 10 ml 10 mM

0.5M EDTA (pH 8.0) 2 ml 1 mM

Mix reagents in 1 L sterile RO water.



Stock solutions prepared as described below.

8. 1.0 M Tris HCl (pH 8.0)

12.1 g Tris base dissolved in 100 ml sterile RO water.

pH to 8.0 with concentrated HCl.

9. 0.5 M EDTA (pH8.0) ethylenediamine trisodium acetate

18.6 g EDTA dissolved in 100 ml sterile RO water

pH to 8.0 with NaOH while stirring. Solid will not dissolve until close to pH8.0

Autoclave before use

Store at room temperature

31

5.1.3.9 Ordering Information

1. Suppliers and catalogue numbers

Chemical Supplier Catalogue #

40% acrylamide:bis (29:1) Biorad 161-0146

Agarose Progen 2000011

Ammonium persulfate ICN 802811

Boric acid Sigma 11611

Bromophenol blue Sigma B-5525

Chloroform Merck 10077 6B

CTAB Merck 102342

EDTA Sigma 43178-8

Ethanol Merck 10476.9020

Ethidium bromide Merck 443922U

Glycerol Sigma G6279

HCl Merck 10307 6P

Isoamylalcohol Sigma I-9392

isopropanol Sigma I-9516

Maleic hydrazide Merck 8.20471.0100

NaCl Merck 1024.3

NaOH Merck 106482

Ribonuclease A (Rnase A) Sigma R-4875

TEMED (tetramethylethylene diamine) Sigma T-8133

Tris base Merck 108382

Xylene cyanol FF Aldrich 33594-0

2. PCR requirements

Consumable Supplier Cat#

PCR Master Mix Promega M7501

Hyperladder IV Bioline BIO-33030

32

6.0 Confirmation of diagnosis 6.1 Virulence on differential wheat and barley cultivars for detection of Ps. hordei.

6.1.1 Introduction

Preliminary examination of the suspect plant sample will determine if the causal pathogen is P.

striiformis. Characteristics of the colour, position and pattern of infection will be assessed in the

preliminary examination (see Table 3). The PCR test described will distinguish P. striiformis from

other common barley-attacking foliar pathogens and identify the P. striiformis formae speciales

present. The test barley cultivar differentials is only used as a confirmatory test because of the

length of time it takes to complete. The differential test will differentiate Ps tritici infections from

Ps hordei infections and differentiate between four pathotypes of Ps hordei.

6.1.2 General items required

humidifier

constant temperature room

potting mix

pots

6.1.3 Specific items

Set of differentials (see Table 4)

Inoculation apparatus (Figure 7)

Incubation facilities (Figure 8).

Inoculating mineral oil (Shellsol T®)

Figure 7. Pressurised spray gun for distributing spores suspended in mineral oil over leaf

surfaces.

33

Figure 8. Humidity chambers with mister in cool room for incubation of plants inoculated

with stripe rust.

6.1.4 Method

Germinate 5 seeds of the barley differential genotypes shown in Table 4 in separate pots.

At 4-5 days water dry pots with 0.04% maleic hydrazide (for ordering see section 5.3.8.1). Do

not water on the day following treatment.

Suspend urediniospores in light mineral oil (Shellsol T®) and spray a fine mist over plant

leaves in a spray chamber. Spray above plants and allow mist to fall onto the leaves. Note: Too

much oil can burn leaves and inhibit infection.

Leave to dry.

Place inoculated plants in a dew chamber at 10°C under plastic covers (100% RH) for 18 to 24

hours to initiate infection and then move to a growth chamber set at 16°C for symptom

development.

Record infection type data from 14 days after inoculation according to the standard 0-9 scale

for infection type (Table 5, Chen, 2004).

Correlate infection type with host and/or resistance gene to determine formae speciales and

pathotype (Table 4).

34

Table 4. Barley varieties used as differential testers for diagnosis of barley stripe rust. The

expected reaction type of four different pathotypes of barley stripe rust and of wheat stripe rust on

each variety is shown.

Differential

Tester

Barley Stripe Rust Pathotype Wheat

Stripe

Rust Race 23 Race 24 Race 24 Race 57

Cambrinus R S S R R

Astrix R S S R R

Agio R S S R R

Bigo R R S R R

Varunda R R S R R

Mazurka R R S R R

Atem S S S S R

Keg S S S S R

Sultan S S S S R

Berac S S S S R

Heils Franken R S R R R

Topper S S S S R

Fong Tien S S S S S

Table 5. Scale of infection for rust symptoms

Value Necrosis or Chlorosis Sporulation Host rating

0 None None RESISTANT (R)

1 Flecks None

2 Blotches/stripes None

3 Blotches/stripes Trace

4 Blotches/stripes Light

5 Blotches/stripes Intermediate

6 Blotches/stripes Moderate

7 Blotches/stripes Abundant

8 Chlorosis behind sporulating area Abundant

9 None Abundant SUSCEPTIBLE (S)

35

7.0 Images

Figure 9. The stripes of stripe rust are made up of many tiny pustules arranged between the leaf

veins (Photo by Jack Kelly Clark from R. M. Davis & L. F. Jackson (2002).

Figure 10. Dr C. Wellings assessing a field trial of barley stripe rust at CIMMYT, 2003 (Courtesy

of Dr C. Wellings, PBI, Cobbitty).

36

Figure 11. Field plot showing a susceptible infection of P.s hordei on barley (Courtesy of Dr C.

Wellings, PBI, Cobbitty).

Figure 12. Striping infection type typical of P.s. hordei infection

(Courtesy of Dr M. William, CIMMYT, Mexico).

37

8.0 References and websites

8.1 References

Brown, W.M., Hill, J.P. & Velasco, V.R. (2001). Barley yellow rust in North America.

Phytopathology 39:367-385

Cakir, M., Spackman, M., Wellings, C.R., Galwey, N.W., Moody, D.B., Poulsen, D.,

Ogbonnaya, F.C. & Vivar, H. (2003). Molecular mapping as a tool for pre-emptive breeding for

resistance to the exotic barley pathogen, Puccinia striiformis f.sp. hordei. Australian Journal of Agricultural Research 54:1-7

Chen. X., Line, R.F. & Leung, H. (1995). Virulence and Polymorphic DNA relationships of

Puccinia striiformis f.sp. hordei to other rusts. Phytopathology 85:1335-1342

Dubin, H.J. & Stubbs, R.W. (1986). Epidemic Spread of barley Stripe Rust in South America. Plant Disease 70:141-144

Hollaway, G. (2005). Stripe Rust Management: Update. Agriculture Notes, August.

Line, R.F. (2002). Stripe rust of wheat and barley in North America: A retrospective historical review. Annual Review of Phytopathology 40:75-119

Marshall, D. & Sutton, R.L. (1995). Epidemiology of Stripe Rust Virulence of Puccinia

striiformis f.sp. hordei, and Yield Loss in Barley. Plant Disease 79:732-737

Park, R. (2000). Rust Fungi. Encyclopedia of Microbiology, Volume 4 Second Edition Academic Press. pp 195-211

Roelfs, A.P., Singh, R.P. and Saari, E.E. (1992). Rust diseases of Wheat: Concepts and methods

of disease management. Mexico. D.F.:CIMMYT

Shi, J., Ward, R. and Wang, D. (2001). Application of a high throughput, low cost, non-

denaturing polyacrylamide gel system for wheat microsatellite mapping. 2001 National Fusarium

Head Blight forum pp25-29.

Stubbs, R.W. (1985). Stripe rust. The cereal rusts volume II: Diseases, Distribution,

Epidemiology and Control. (A. P. Roelfs & W. R. Bushnell, eds) pp 61-101.

Wellings,C.R., McIntosh,R.A. and Walker,J. (1987). Puccinia striiformis f.sp. tritici in eastern

Australia-possible means of entry and implications for plant quarantine. Plant Pathology 36:239-241.

Wellings, C.R., Burden, J.J., McIntosh R.A., Wallwork H., Raman, H. & Murray, G.M.

(2000). A new variant of Puccinia striiformis causing stripe rust on barley and wild Hordeum species in Australia. Plant Pathology: 49:803

8.2 Websites

Adams, E.B. 1997. Plant Diseases: Barley Stripe Rust. Washington State University Update

EB1839 at http://cru.cahe.wsu.edu/CEPublications/eb1839/eb1839.html (4/04/2005)

Bariana, H., Wellings, C. & Park, R. (2004) The rust diseases of winter cereals – Diagnosis and

epidemiology. Research Updates at

http://www.grdc.com.au/growers/res_upd/north/045S/bariana.htm

Chen, X. (2004) Epidemiology of barley stripe rust and races of Puccinia striiformis f.sp. hordei: the first decade in the United States. Cereal Rusts and Powdery Mildews Bulletin at

http://www.crpmb.org/2004/1029chen/

http://cru.cahe.wsu.edu/CEPublications/eb1839/eb1839.html

http://www.grdc.com.au/growers/res_upd/north/045S/batiana.htm

http://www.crpmb.org/2004/1029chen/

38

Davis, R.M. & Jackson, L. F. (2002) UC IPM Pest Management Guidelines: Small Grains

Stripe Rusts of Wheat and Barley, Pathogen: Puccinia striiformis. U CANR Publication 3466 at http://axp.ipm.ucdavis.edu/PMG/r730100511.html (07/06/2005).

Singh, R.P., Huerta-Espino, J. & Roelfs, A.P. (2002). The wheat rusts. Bread Wheat

Improvement and Production. B.C. Curtis, S. Rajaram, H. Gomez Macpherson (eds) FAO Plant

Production and Protection Series No. 30 at http://www.fao.org/documents/show_cdr.asp?url_file=/DOCREP/006/Y4011E/y4011e0g.htm

(4/04/2005)

Singh, R.P., Huerta-Espina,J., Roelfs, A.P. The wheat rusts at

http://www.rao.org/DOCREP/006/Y4011E/y4011e0g.htm

Wellings C & Park,R. (2003) Meeting the challenge of stripe rust of barley. Ground cover 47 at

http://www.grdc.com.au/growers/gc/gc47/rust.htm (31/05/2005)

http://axp.ipm.ucdavis.edu/PMG/r730100511.html

http://www.fao.org/documents/show_cdr.asp?url_file=/DOCREP/006/Y4011E/y4011e0g.htm

http://www.rao.org/DOCREP/006/Y4011E/y4011e0g.htm

http://www.grdc.com.au/growers/gc/gc47/rust.htm

39

Appendices

Appendix 1. Preliminary Information Data Sheet (Plantplan, 2004).

Date: / /

SUBJECT

Site details:

Ownership:

Location:

Map (lat. & long.):

GPS identifier:

Host plant location (clearly mark plant if necessary):

HOST DETAILS

Species and variety:

Age:

Developmental stage:

DAMAGE

Description of symptoms:

Part of host affected:

Percent incidence:

Percent severity:

DETAILS OF WHEN AND WHERE THE PEST WAS FIRST NOTICED:

RECORDS OF PRODUCT MOVEMENT ON AND OFF DETECTION SITE:

SYMPTOMS / PHOTOGRAPHS:

FURTHER DETAILS OR COMMENTS:

Appendix 2 Personnel Hygiene

On entering the paddock, personnel must :

Wear protective overalls and rubber boots.

Prepare footbath of bleach, and spray bottles of methylated spirits brew (95% metho, 5% water)

for use following completion of the inspection.

Conduct inspections by foot (refer to Appendix 3 Machinery Hygiene for vehicle access).

On leaving the paddock, personnel must :

Wash boots in footbath of disinfectant (solution of household bleach 10%) and remove adhering

material, ie soil, with a suitable brush (ie domestic scrubbing brush).

Spray boots with methylated sprits brew until soaked .

Remove overalls and place into a bag and seal.

Exterior of sample bags to be sprayed/swabbed with methylated spirits brew.

Spray hands with methylated spirits brew irrespective of whether disposable gloves have been

worn.

You must decontaminate before leaving the paddock always.

Overalls must be washed and allowed to completely dry before being used again. If disposable

overalls are used, they can be either washed, or if disposed, sent to land fill or burnt.

Appendix 3 Machinery Hygiene

No machinery, including vehicles, are to enter paddock without prior approval from the

applicant. Approval to use vehicles in paddock must be included with the application for

access.

Decontamination procedures must be followed immediately before leaving the site at the area

identified for decontamination.

Decontaminate the machinery by removing all visible barley trash and wash down with a high

pressure spray using detergent, paying particular attention to the underside, axles, wheels and

tyres. This also includes all hand held tools such as hoes and shovels.

Personal decontamination procedures must follow the decontamination of machinery.

It is recommended that any machinery or vehicle that has entered the paddock is not to be taken

into another green lupin crop this season.

Harvest Machinery

In addition to the above requirements, machinery will be cleaned of all seed and trash

remaining. This material will be destroyed in a manner approved by the relevant State

Authority (ie, landfill within quarantine boundary or similar).

barley stripe rust national diagnostic protocol

Documents