cells tissues organs systems organism adaptations change in size change in number of cells change...

of 26/26

Post on 19-Jan-2016

213 views

Category:

Documents

0 download

Embed Size (px)

TRANSCRIPT

  • CellsTissuesOrgansSystemsOrganism

  • ADAPTATIONSChange in sizeChange in number of cellsChange into another type of cell

  • ATROPHYDecreased size & functionMetabolic processes shut down to conserve energyDue todecreased demandischemialack of nerve or hormonal stimulationchronic inflammation

  • HYPERTROPHYIncreased size & functional capacityDue tohormonal stimulationincreased functional demand

  • HYPERPLASIAIncrease in number of cellsDue tohormonal stimulationincreased functional demandchronic stress or injury

  • DYSPLASIADisorderly overgrowth of cellsPremalignantReversible

  • METAPLASIAOne cell type to anotherReversible

  • REVERSIBLE OR IRREVERSIBLEAdaptations may be normal physiological responses to stimuli, or pathological conditions

    Reversible InjuryFunctional or morphological changes reverse when stimulus is removed, even if cellular injury has begun:Moderately reduced oxidative phosphorylation of ATP slows active transportAqueous vacuoles may bud from ERhydropic changeFatty vacuoles may appear in cytoplasmfatty change

  • Severe disruption of compartmentalization triggers either necrosis or apoptosiscells dieNecrosis: swelling, protein denaturation and digestion, membrane breakdown and blebbingApoptosis: shrinkage, fragmentation, phagocytosis

  • REVERSIBLE DAMAGE CELLULAR SWELLINGCellular swelling (synonyms: hydropic change, vacuolar degeneration, cellular edema) is an acute reversible change resulting as a response to nonlethal injuries. It is an intracytoplasmic accumulation of water due to incapacity of the cells to maintain the ionic and fluid homeostasis. It is easy to be observed in parenchymal organs : liver (hepatitis, hypoxia), kidney (shock), myocardium (hypoxia, phosphate intoxication). It may be local or diffuse, affecting the whole organ.

  • REVERSIBLE DAMAGE FATTY CHANGEIntracellular accumulations of a variety of materials can occur in response to cellular injury. Here is fatty metamorphosis (fatty change) of the liver in which deranged lipoprotein transport from injury (most often alcoholism) leads to accumulation of lipid in the cytoplasm of hepatocytes.

  • NECROSISPathologic cell deathUsually in a collection of cells fed by a single artery

  • APOPTOSISProgrammed cell deathEspecially during fetal developmentIn response to hormonal cycles (e.g. endometrium)Normal turnover in proliferating tissues (e.g. intestinal epithelium)Cells shrink, not swellNuclei condense and DNA fragmentsCells fragment into membrane-bound bitsBits are phagocytosed by macrophages

  • The main factors acting in aging process and the functional relationship between them

  • Cell cycle is regulated by different specific proteins, cancer supressors, cyclins, and MAP kinases. When these proteins are damaged by mutations cell cycle regulation can be disturbed.

  • We know genes concerned with pathological aging. When they are damaged organism ages much faster. These genes are named gerontogenes - aging genes. Genetic polymorphisms (determining individual's longevity) are found. The existence of longevity gene is still very real. Some age linked diseases are known in medical practice (Werner's, Bloom's, Cocaine's syndromes, progery and other). Patents had damaged various gerontogenes. It was observed that these genes encoded replication, transcription and repair machinery components of the cell.

  • Telomeres are the terminal parts of eukaryotic chromosomes. The influence to aging of telomeres is highly discussed. They are called "molecular clock" of the cell. Cell division times are correlated with telomere length. After each cell division telomeres get shorter. When telomere shortens to the critical stage, the intensity of cell division significantly decreases, and then cell differentiates and ages.

  • CHROMOSOMETTAGGGTTAGGGTTAGGGTTAGGGTTAGGGAATCCCAATCCC53TELOMERE

  • WHAT ARE TELOMERES?Telomeres areRepetitive DNA sequences at the ends of all human chromosomesThey contain thousands of repeats of the six-nucleotide sequence, TTAGGG In humans there are 46 chromosomes and thus 92 telomeres (one at each end) senescent cells have shorter telomereslength differs between speciesin humans 8-14kb longtelomere replication occurs late in the cell cycle

  • HOW DOES TELOMERASE WORK?Telomerase works by adding back telomeric DNA to the ends of chromosomes, thus compensating for the loss of telomeres that normally occurs as cells divide. Most normal cells do not have this enzyme and thus they lose telomeres with each division.

  • *********FIGURE 11 Stages of the cellular response to stress and injurious stimuli.*FIGURE 18 Schematic illustration of the morphologic changes in cell injury culminating in necrosis or apoptosis. Cells do not recover from injury leading to apoptosis. Apoptotic cells may be isolated in tissues and not affect other cells. Necrotic cells in tissues dispense hydrolytic enzymes that damage their neighbors. Recovery from damage leading to necrosis must be early.*In cellular swelling, at gross examination, the affected organ is enlarged, pale and soft. Microscopically, the cells are enlarged, with a clear cytoplasm (due to the presence of small clear or pale vacuoles, with indistinct shape and limits) and a normal nucleus in central position; blood capillaries are compressed, explaining the organ's pallor.

    http://www.pathologyatlas.ro/cellular-swelling-liver.php*http://library.med.utah.edu/WebPath/CINJHTML/CINJ035.html**FIGURE 124 Mechanisms of apoptosis. The two pathways of apoptosis differ in their induction and regulation, and both culminate in the activation of executioner caspases. The induction of apoptosis by the mitochondrial pathway involves the action of sensors and effectors of the Bcl-2 family, which induce leakage of mitochondrial proteins. Also shown are some of the anti-apoptotic proteins (regulators) that inhibit mitochondrial leakiness and cytochrome cdependent caspase activation in the mitochondrial pathway. In the death receptor pathway engagement of death receptors leads directly to caspase activation. The regulators of death receptormediated caspase activation are not shown. ER, endoplasmic reticulum; TNF, tumor necrosis factor.