cha pter 2 anticancero u s properties of lactobacill u...

noitcudortnI…2 retpahC

49

AHC 2 RETP

FO SEITREPORP SUORECNACITNA MUTNEMREF SULLICABOTCAL

NOITCUDORTNI 1.2

1.1.2 AMONICRACONEDA ,)CRC( RECNAC LATCEROLOC

.setatS detinU eht ni nemow dna nem htob ni recnac nommoc tsom driht eht si recnac latceroloC

tazinagrO htlaeH dlroW eht ot gnidroccA naht erom setar recnac labolg no troper 3002 lirpA s'noi

9, 5 ylraen dna recnac latceroloc fo sesac wen 000,04 , hcae ediwdlrow detroper era shtaed 000,00

.raey r rojaM srotcaf ksi ,ega era esaesid lewob yrotammalfni ,teid hcir loretselohc dna taf

yllaicepse( non dna sisopylop yratidereh gnidulcni ,noitisopsiderp citeneg dna ,)sitiloc evitareclu -

tnavujdA .yregrus yb elbaruc si recnac latceroloc ,ylrae detceted fI .semordnys sisopylop

.sedon hpmyl eht dehcaer sah taht esaesid ni lavivrus gnolorp nac yparehtomehc gnoL - lavivrus mret

recnac latceroloc ni esaesid fo egats htiw setalerroc ]481[ .

1.1.1.2 ygoloisyhpohtaP

T eh eht fo noitatum cpa eneg )iloc sisopylop suotamoneda( eht fo eno si tneve tseilrae taht sraeppa

ot eb evlovni d ni ved recnac noloc ni tnempole suotamoneda lailimaf yb detceffa slaudividni

eht yb dedocne nietorp ehT .)PAF( sisopylop cpa ateb fo noitadarged eht stegrat eneg - a ,ninetac

htworg setavitca taht xelpmoc lanoitpircsnart a fo tnenopmoc nietorp - sa hcus ,senegocno gnitomorp

ilcyc c ro 1D n - cym . cpa ateb dna ,recnac latceroloc cidarops ni nommoc yrev era snoitatum - ninetac

deifitnedi neeb osla evah snoitatum ]581[ .

tem AND segnahc noitalyh spylop dna srecnac latceroloC .egats pylop eht ta detceted neeb evah

alyhtem AND cimoneg ni ecnalabmi na evah lanoiger dna noitalyhtemopyh labolg htiw ,noit

nac noitalyhtemrepyh saerehw ,noitavitca enegocno ot dael nac noitalyhtemopyH .noitalyhtemrepyh

.seneg rosserppus romut fo gnicnelis ot dael sar regral ni ylnommoc devresbo era snoitatum eneg

ms ton tub spylop htworg pylop ni enegocno siht rof elor a gnitseggus ,spylop rella ]581[ .

,snoiteled q81 era recnac noloc htiw detaicossa seitilamronba lamosomorhC romut dna sessol p71

snoitatum 35p rosserppus sdael noisserpxerevo 2lcB . neeb sah gnilangis htaed llec fo noitibihni ot

bo tnempoleved recnac latceroloc ni tneve ylrae ylevitaler a sa devres ]581[ .


59

yrotsih ylimaF lailimaF .recnac latceroloc fo tnempoleved rof rotcaf ksir tnatropmi yrev a si

eht fo ypoc tnatum a tirehni stneitap hcihw ni ,sisopylop CPA tub erar si ,eneg rosserppus romut

noc 1 rof stnuocca hcihw ,recnac noloc sisopylopnon lailimaF .ksir hgih yrev sref - noloc fo %5

seneg riaper hctamsim AND ni snoitatum detirehni fo esuaceb spoleved ,srecnac ]581[ .

rehtonA recnac lanitsetniortsag rof rotcaf ksir noitpmusnoc lohocla si . ,teiD af ralucitrap ni tnetnoc t

taht dnuof evah seiduts laminA .recnac noloc fo ksir desaercni htiw detaicossa neeb sah ,teid fo

seiduts lareveS .spylop lanitsetni fo noitamrof stneverp narb eyr yrateid dna secudni feeb yrateid

,staem dessecorp dna taem der taht detseggus evah noloc ot esopsiderp ,emeh fo noitca eht hguorht

fo noitamrof gnicnahne yb recnac N- egamad AND ni tluser hcihw ,sdnuopmocosortin ]581[ .

2.1.1.2 recnaC noloC rof sgurD yparehtomehC

e ot xis fo doirep a rof ,noitartsinimda ylhtnom eht sevlovni yllausu yparehtomehc tnavujdA thgi

fo noitanibmoc a ro eno fo ,shtnom ekil sgurd yparehtomehc recnac noloc 5- ,licaruoruolF

nitalpilaxO dna nacetonirI ,nirovocueL .

3.1.1.2 recnac latceroloc fo sisenegohtap raluceloM

eht ni snoitatuM t yllacipyt era eneg )CPA( iloC sisopyloP suotamonedA tneve gnitaitini lacitirc eh

ni )PAF( sisopylop suotamoneda lailimaf fo sesac - sa detaicossa ,srecnac cidarops tsom sa llew

ni gnitluser dewollof si sihT .yawhtap gnilangis tnW eht fo noitavitca k eht ni snoitatum yb - sar

ytisogyzoreteh fo ssol dna enegocno emosomorhc fo )HOL( seneg rosserppus romut erehw ,q81

ni deteled gnidulcni ,4DAMS ,)CCD( recnac noloc dna DAMS 6 35p . snoitatum ,retal rucco

gnirud amonicrac evisavni ot amoneda decnavda eht morf noitisnart eht ]681[ .

tneitap fo seidutS non yratidereh eht htiw s - noloc sisopylop evah emordnys )CCPNH( recnac

taht nwohs a snoitatuM .yawhtap ISM ,yawhtap citeneg dnoces riaper hctamsim AND eht fo eno ni

srorre noiteled ro noitresni ni tluser 2SMP ro ,6HSM ,2HSM ,1HLM semyzne AND ta

toelcunylop .setilletasorcim sa nwonk osla ,staeper edi fo snoitcartnoc dna snoisnapxe gnitluser ehT

staeper eseht %51 dna CCPNH htiw stneitap llA .epytonehp ISM eht enifed sesac cidarops fo

ISM tibihxe ]781[ .

p a3.1.1.2 35

si recnac fo noitneverp ehT yltaerg fo ytiliba ehT .nietorp rosserppus romut 35p eht no tnedneped

ot 35p evomer degamad ,ssecxe sisotpopa yb sllec detcefni ro si lacitirc taluger reporp eht rof fo noi

itlum ni noitarefilorp llec 35p .smsinagro ralullec eb nac sserts lanretni dna lanretxe yb detavitca


69

elbaiv rehtie secudni 35p ,nrut nI .mrof evitca na ni noitalumucca raelcun sti etomorp taht slangis

vitca rettal ehT .sisotpopa ro tserra htworg llec lamron rednU .noisserppus romut rof laicurc si yti

trohs a si 35p snoitidnoc - .nietorp devil S ssert ekil snoitidnoc luf ,egamad AND aixopyh , nu ylemit

senegocno fo noisserpxe cte sretla yllacitsard t eh noitidnoc 35p fo ni gnitluser 35p fo noitavitca eht

dna c opa ro ecnecsenes ,tserra htworg lle .sisotp 35p era syawhtap citotpopa tnedneped yltnerruc

itna rof derolpxe gnieb - tnemtaert recnac sa hcaorppa evitcartta na b noitcnuf citotpopa eht esuace

si 35p fo noisserppus romut rof lacitirc ]881[ .

b3.1.1.2 xaB

T lcB eh - eht snrevog snietorp fo ylimaf 2 citotpopa cisnirtni yawhtap esaeler hcihw , s c emorhcotyc

lcB ehT .airdnohcotim eht morf - oc ylimaf 2 itna sesirpm - orp( citotpopa - orp dna )lavivrus - citotpopa

.srebmem P or - snietorp lavivrus lcB edulcni -2 dna lcB - LX orp ; - .kaB dna xaB era snietorp citotpopa

S lcB eht fo stesbu - era seneg ylimaf 2 gnidulcni ,stegrat 35p xaB , axoN dna , .AMUP xaB eht saw

mem tsrif sesaeler dna remidomoh a smrof xaB .35p yb decudni eb ot nwohs puorg siht fo reb

airdnohcotim eht morf c emorhcotyc i noitavitca sserts ot esnopser n esapsac ni stluser hcihw , - 9

35p ni xaB rof tnemeriuqer ehT .noitavitca - ec eb ot sraeppa sisotpopa detaidem ll - tnedneped epyt

]881[ .

c3.1.1.2 esanegyxoolcyC - )2XOC( 2

si 2XOC ne tnatropmi tsom eht fo eno T .recnac noloc ot detaler semyz ovni eh evl XOC fo tnem -2

crac noloc ni eb yam noissergorp sti dna sisenegoni non esuaceb itna ladiorets - sgurd yrotammalfni

XOC dna recnac noloc morf ytilatrom ecuder )sDIASN( - .sDIASN fo stegrat nwonk eht fo eno si 2

XOC - oc ni desaercni era slevel nietorp dna ANRm 2 emos ni dna stneitap morf seussit recnac nol

XOC neewteb pihsnoitaler ehT .senil llec recnac noloc - yb demrifnoc rehtruf si recnac noloc dna 2

eneg dna sDIASN hcihw ni ,iloc sisopylop suotamoneda fo sledom enirum eht gnisu seiduts

ebmun eht ecuder stuokconk XOC .spylop lanitsetni gnipoleved ylsuoenatnops fo r - ni noisserpxe 2

dna ,sisenegoigna romut setomorp ,sisotpopa ot ecnatsiser sesaercni sllec lailehtipe lanitsetni

sisatsatem dna noisavni secnahne ]981[ .

2.1.2 KLIM DETNEMREF – YEHW

eseehc eht gnirud druc eht morf detarapes si yehW - gnikam I .ssecorp retfa gniniamer diuqil eht si t

deldruc neeb sah klim ac eht evomer ot deniarts dna ,snietorp sniatnoc tI .)sdruc( snies ,esotcal


79

,nietorp yehW .taf fo secart dna ,slarenim ,snimativ rper nietorp latot eht fo %02 stnese fo tnetnoc

rojam evif ylno sniatnoc yehW .klim β yleman ,snietorp - ,nilubolgotcal α- ,nimublatcal

editpeporcamocylg dneped( ,)erutcafunam yehw fo dohtem eht no gni ,3 enotpep esoetorp

,nimubla mures dna ,snilubolgonummi ~ pu ekam rehtegot hcihw nietorp yehw fo %58 . fo llA eht

snilubolgonummi dna nimubla mures rof tpecxe snietorp klim rojam lailehtipe yb dezisehtnys era

ni sllec yrammam eht alg klim htob ,noitidda nI .dn ]191 ,091[ smurtsoloc dna ]291[ niatnoc

tnadnuba tsom eht ,snietorp ecnadnuba wol fo sderdnuh yllaretil dna )fL( nirrefotcal gnieb

si erehT .)OPL( esadixorepotcal yllaitnetop a sa ,yehw ylralucitrap dna ,klim ni tseretni gnisaercni

oc evitcaoib fo ecruos larutan hcir ecuder ot sdnuopm dna ksir esaesid / ot ro esaesid tneverp

tnempoleved ]391[ .klim detnemref sah sullicabotcaL retfa tcudorp larutan a si yehW .

1.2.1.2 W snietorp yeh

evah ot detroper neeb evah snietorp yehW ycaciffe ynam ni morf gnignar snoitacilppa tnereffid

,elcsum ,enob no stceffe ,recnac ,enummi ,saercnap ,niarb ,doolb ,msilobatem ,noitcefni dnuow

laeh gniga dna ,gninrael ,gni nietorp yehw A . enizardyhlyhtemid fo tnempoleved eht detibihni teid -

decudni ecim ni ycnangilam ]491[ roper saw tI . nietorp yehw taht det devorpmi traeh dna revil

snoitartnecnoc fo enoihtatulg niga ni ytivegnol desaercni dna ecim g ]591[ . fo noitartsinimdA

,sledom enirum ot snietorp yehw yroterces fo slevel yrailib desaercni AgI ]691[ yehw kliM .

,nietorp htiw rehtegot nietorp cisab klim( noitcarf nietorp cisab sti etomorp ,)]PBM[ enob d

desserppus dna noitamrof noitproser enob ni nem dna namow tluda yhtlaeh ]791[ fo stnuoma hgiH .

ni nimublatcal laromuh eht desaercni teid eht cinelps dna ,ecim fo esnopser sesnopser negotim

]891[ yehW . fo tnuoma elbaredisnoc a sah hcihw ,enimatulg fo ecruos a si ygrene yldipar rof

dna sllec gnidivid ecneh eb ot deredisnoc lativ sserts cilobatem fo semit gnirud yehW .ssenlli ro

ciportonilusni evah snietorp stceffe ni aimecylg laidnarptsop eht ecuder dna dna ,stcejbus yhtlaeh

2 epyT stneitap citebaid ]991[ . ,yduts ledom lamina na nI yehw etartnecnoc nietorp ot nwohs saw

ecuder surivator fo ytireves eht - decudni m a ni aehrraid eci ]002[ .

a1.2.1.2 β- nilubolgotcaL

T eh klim ni nietorp tnadnuba tsom si β- lubolgotcal si tI .ni a A .ylimaf nilacopil eht fo rebmem trap

onima fo ecruos tnatropmi na gnieb morf sdica , t eh tnerehni noitcnuf fo β- nilubolgotcal ton si tey

eht ni etapicitrap ot desoporp neeb sah tI .nwonk oitsegid yam sihT .etanoen eht ni sdipil klim fo n

yb tca ytivitca eht gnicnahne taht sdica yttaf eht fo lavomer hguorht esapil cirtsagerp fo siht tibihni


89

emyzne . M lla kli ti sanietorp siht ot eud si skim s’woc fo noitpmusnoc no rucco ot nwonk ,ygre si

s’woc ni negrella rojam eht klim . P scitoibor gnisserpxe β- tcal eht ni lufesu eb dluoc nilubolgo

tnemeganam ygrella doof fo ecneh dna o fo noitartsinimda lar tnanibmocer sitcal succocotcaL

enivob gnisserpxe β- nilubolgotcal ot nwonk si ecudni esnopser 1hT cificeps a ]102[ .

.2.1.2 b1 α- nimublatcaL

α- ni hcir ylralucitrap si taht ecruos nietorp a si nimublatcal .nahpotpyrt rotalumitsonummi na si tI

i sa LI fo noitcudorp eht setalumits t - erutluc ni segahporcam egaval raloevlaohcnorb enivo yb β1

]202[ . α- fo htworg eht stibihni nimublatcal erutluc ni senil llec amonicraconeda noloc namuh

]302[ . tI yvaeh setalehc dna slatem cneh ,oS .sserts evitadixo secuder e nehw si ti yllaro

deretsinimda , α- nimublatcal nac sserts dna lonahte tsniaga tcetorp lasocum cirtsag decudni yrujni

gnitseggus ,star ni taht evah yam ti ssenevitceffe tnega na sa sreclu tneverp ot ]402[ . α - nimublatcal

nwohs osla saw evitceffe eb ot tibihni ni gni noisehda cinegohtaporetne snegohtap eht fo iloc .E ,

muirumihpyt allenomlaS dna , irenxelf allegihS lanitsetni htiw sllec ]502[ .

c1.2.1.2 editpeporcamocylG

)PMG( editpeporcamocylG citamora eht skcal dna sdica onima niahc dehcnarb ni hgih si onima

i na sah tI .enisoryt dna ,nahpotpyrt ,eninalalynehp sdica dica no tceffe yrotibihn ,snoiterces cirtsag

fo noitartnecnoc doolb eht seifidom dna seditpep evitsegid yrotaluger ]602[ . tI yehw ni tneserp si

eht ot eud niesac no nisomyhc fo noitca . dna evisserppusonummi htob strexe PMG

yrotalumitsonummi tI .seitreporp gnitalumits fo elbapac eb ot nwohs saw etalugerpu ot setyconom

itna eht - ammalfni LI rotcaf yrot -1 LI( tsinogatna rotpecer - )AR1 ]702[ .

d1.2.1.2 torP 3 enotpeP esoe

noitcarf enotpep esoetorp ehT s klim fo era sa sah klim retfa noitulos ni niamer taht snietorp esoht

detaeh neeb era erehT .7.4 Hp ot deifidica neht dna setunim 02 rof C°59 ta stnenopmoc rojam ruof

htiw ,enotpep esoetorp esirpmoc taht soetorp e- eht gnieb tnemgarf )3PP( 3 tnenopmoc enotpep

rojam thgiew yb %52 ta tnenopmoc ]802[ yehw ni ylno dnuof si 3PP . dna ,)snamuh fo taht ton tub(

noitatnemref eht yb decudorp si taf fo - e tI .klim enivob eerf ydobitna lanolconom secnahn

noitcudorp sllec amodirbyh namuh yb ]902[ .

e1.2.1.2 snilubolgonummI

ytinummi evissap edivorp yllamron snilubolgonummi kliM osla era yeht tub ,etanoen eht rof

stnega lufrewop yllaitnetop elbarisednu ro cixot evomer ot steid otni detaroprocni eb dluoc taht


99

a tsniaga seidobitna yehw lartsoloc fo noitartnecnoc ehT .srotcaf yrateid eb nac negohtap ralucitrap

eht htiw swoc gnisinummi yb desiar taht yehw enummirepyh ehT .snegitna sti ro negohtap stluser

suoirav tsniaga noitcetorp citcalyhporp edivorp yllaitnetop nac gnidulcni seborcim tug suoitcefni

dna surivator retcabocileH irolyp ]012[ etartnecnoc nietorp klim a ,nitcalorciM . enummirepyh fo

tnioj stibihni ,scigoloiB kliM ellotS morf klim ni noitammalfni stneitap sitirhtraoetso ]112[ .

f1.2.1.2 nimublA mureS enivoB

onima laitnesse fo ecruos a si )ASB( nimubla mures enivoB tI .sdica org eht detibihni eht fo htw

negortse - recnac tsaerb evisnopser FCM enil llec - erutluc ni 7 ]212[ 4 dna , - eniloniuqortin -l- edixo

decudni yticixotoneg ]312[ ro A nisnetubla editpep ASB . alA( ninikores - ueL - syL - alA - prT - reS -

laV - alA - dna ,rotibihni ECA na si )grA gnitcartnoc mueli evah ot detroper si seitivitca gnixaler dna

]412[ .

2.2.1.2 L snietorp ecnadnuba wo

a2.2.1.2 nirrefotcaL

elgnis a ,)fL( nirrefotcaL -c nori niah - .nietorpocylg gnidnib ni tneserp nietorp esnefed larutan a si fL

tsom ,klim gnidulcni arolf lamron ot desopxe ylnommoc snoiterces murtsoloc lasan ,sraet ,

,eciuj citaercnap ,elib ,avilas ,snoiterces snoiterces latineg dna ,sucum lanitsetni ]512[ tneserp si tI .

setis ta slevel hgih ta lairetcab fo noitcefni si ti esuaceb a yb deterces slihportuen niam ehT .

fL fo snoitcnuf fo noitomorp edulcni ,htworg llec lanitsetni noitcefni laiborcim tsniaga noitcetorp

fo noitaluger dna sesnopser enummi cimetsys . fL namuH t sllec B esuom setaitnereffid elbane o

tneserp retteb ot meht sllec T ot negitna ortiv ni ]612[ . tI gnitalumits fo elbapac si tsalboetso llec

gnisaerced dna ,htworg sisenegotsalcoetso T . citycogahp eh setyconom doolb enivob fo ytivitca si

yb desaercni fL ]712[ H . nispep htiw fL fo sisylordy secudorp L nicirrefotca B hcihw setomorp

sisotycogahp slihportuen yb ]812[ LI fo esaeler eht setalumits dna -8 ]912[ . P nispe - enivob detsegid

sllec recnac laro fo htaed llec citotpopa secudni fL ]022[ B . secudni ylevitceles nicirrefotcal enivo

ni sisotpopa senil llec amonicrac dna aimekuel namuh ]122[ . nehW fL enivob ,detsegni elbapac si

gnisserppus fo ni sromut fo tnempoleved eht ot desopxe star fo sugahposeo dna ,gnul ,noloc eht

lacimehc snegonicrac ]222[ o era erehT . gnitartsnomed seiduts rehto 03 rev detsegni yllaro taht

.htworg romut secuder fL enivob


001

b2.2.1.2 esadixorepotcaL

L evitcetorp a sa si )OPL( esadixorepotca tsniaga rotcaf P .seborcim suoitcefni ainomuen ni

suriv azneulfni - saw ecim detcefni yb desserppus or noitartsinimda la OPL fo ]322[ OPL .

tnemtaert evah ot dnuof saw slihportuen peehs fo esod ,gnicnahne na - tceffe ,tnedneped no

noitcudorp edixorepus ]422[ .

c2.2.1.2 yehW ni srotcaF htworG larutaN

m ni tneserp eb ot nwonk srotcaf htworg )EWBM( tcartxe yehw enivob cinegoti era FGT -β FGI , -

dna I - dna ,FGDP ,II FGF - dna 1 - srotcaf htworg esehT .2 detomorp eht fo gnilaeh lanoisicni

star ni sdnuow ]522[ FGT . - β snoitartnecnoc wol ylevitaler ni klim ni tneserp si 1( – gm 4 / tey ,)L

dehcirne eb nac ti hcihw ,tnemelppus laro eht ni sa tibihni nac snamuh ni esaesid s’nhorC 622[ -

]822 , etaxertohtem dna - star ni sitisocum decudni ]922[ .

MIA

iderc neeb evah airetcab citoiborP tsoh eht nihtiw stceffe laicifeneb fo rebmun a htiw det

,sdnuopmoc laiborcimitna fo noitcudorp ,tug eht ni sisatsoemoh fo ecnanetniam :gnidulcni

eht fo srecnac fo noitneverp ,seigrella fo noisserppus eht ,slevel loretselohc doolb fo lortnoc

ludom dna noloc .noitcnuf enummi fo noita gnieb yltnerruc serutluc citoiborp laicremmoc ehT

era noitalupop naidnI fo arolf tug ni secnereffid tnerehnI .nigiro ngierof fo era aidnI ni desu

lupop naidnI ni seiduts ycaciffe tuo yrrac ot evitarepmi si ti ecneh ,rucco ot nwonk ot roirp noita

na yduts ew ,yduts siht ni ecneH .aidnI ni esu rieht mutnemref .L lamron morf detalosi niarts

sti rof tug namuh ortiv ni ot ytiliba .htworg llec romut tneverp

sdohteM & slairetaM…2 retpahC

101

2.2 SDOHTEM DNA SLAIRETAM

1.2.2 ERUTLUC LLEC

stnegaeR :

)a( muideM 0461 IMPR

• si aidem eht fo redwop detardyheD yllaicremmoc elbaliava )aidemiH( .

saw redwoP • .retaw devalcotua elbuod fo lm 0001 ni detutitsnocer

• 2 Mm g enimatul saw ti ot dedda .

S • etanobracib muido ot Hp tsujda ot dedda saw .4.7

• 2.0 hguorht dessap neht saw sihT noitartlif detarepo muucav a fo pleh eht htiw retlif mµ 2

.tinu

• .selttob elirets ot detouqilla saw aidem deretlif ehT

• 4 ta derots saw sihT snoitulos citoibitna fo snoitartnecnoc gnikrow retfa esu llit C° sa(

)woleb nwohs .ti ot dedda erew

)b( hpsohP )SBP( enilaS dereffuB eta

lCaN Mm 731 g 0.8

lCK Mm 7.2 g 2.0

aN Mm 01 2 OPH 4 g 7.1

HK Mm 2 2 OP 4 g 72.0

illiM - H Q 2O lm 0001

SBP )c( – ATDE

lCaN Mm731 g 0.4

lCK Mm7.2 g 1.0

aN Mm01 2 OPH 4 58.0 g

HK Mm2 2 OP 4 631.0 g

enimaid enelyhtE Mm5.0

dica citeca artet )ATDE( g 90.0

illiM - H Q 2 O lm 005


201

5.0 evlossiD dna 4.7 ot Hp tsujda dna stnenopmoc rehto ddA .0.8 Hp ta ATDE Mm

.emulov lanif ot pu ekam

)d( ATDE nispyrT

nispyrT 52.0 g

esoculG 30.0 g

SBP – ATDE 001 lm

.retlif egnirys mµ 2.0 gnisu ezliretS

erutxim gnizeerF )e(

SBF lm 59

lm 5 )OSMD( edixohpluS lyhtemiD

revoc ro krad ni erotS .Cº 4 ta liof htiw

)f( BF( mures enivob lateF )S

nim 06 rof Cº 55 ta detavitcani taeH fo snoitartnecnoc ta desu dna eht ot dedda %01

.muidem IMPR

)g( erutluc llec rof desu scitoibitnA fo tsiL

.oN.lS citoibitnA kcotS

.cnoc

gnikroW

.cnoc

ot dedda eb ot tnuomA

0001 aidem lm

1 nillicineP 5 5 U / lm 05 / U lm lµ 001

2 nicymatneG 04 gm lm/ 60 gµ lm / lm 5.1

3 nicymotpertS 5.0 g lm/ 05 gµ lm / lµ 001

4 niciretohpmA gm 5 lm/ gµ 52.0 lm / lµ 05

)h( fo tsiL c senil lle u .des

.oN.lS emaN citsiretcarahC nigirO

1 92 TH amonicraconeda noloC namuH

2 51 TCH oC amonicraconeda nol namuH

3 502 OLOC amonicraconeda noloC namuH

4 704 TNI S yrbmE( muilehtipe enitsetni llam )cino namuH

5 6 CEI muilehtipe enitsetni llamS taR


301

:serudecorP

• ,enuP ,)SCCN( secneicS lleC rof retneC lanoitaN morf deniatbo erew senil llec llA .aidnI

• spyrt saw SCCN morf deniatbo saw taht ksalf tneulfnoc ehT 2 ot no derutluc bus dna desini

ro 3 / sksalf 52T mm 51x06 p irte .noitavreserpoyrc rof derots osla dna setalp

• dna Cº 73 ta detabucni erew sksalf ehT htiw 5 OC % 2 noitatnemelppus .

ispyrT bus dna noitazin – senil llec fo gnigassap / erutluc

• rof noisiced dna epocsorcim tsartnoc esahp a rednu ecneulfnoc rof dekcehc saw ksalf ehT

.enod saw gnittilps dna noitasinispyrt

• esnir saw ecafrus tnerehda eht dna dedracsid saw ksalf eht ni aidem ehT .SBP htiw yltneg d

• nispyrT fo lm1 fo noitidda yb dewollof saw sihT – .noitulos ATDE

• m saw tI a derevoc noitulos eht taht erus ed .ecafrus tnerehda elohw eht

• fo emit A 2 - nim 5 saw a woll de .sllec fo reyalonom eht no tca ot nispyrt eht rof ( yticapo ehT

trats reyal llec tneulfnoc eht yb desuac s .desinispyrt teg sllec erom sa raeppasid ot )

• IMPR fo lm 1 0461 SBF %01 gniniatnoc aidem a saw dd de eht ni noitulos nispyrt eht ot

.ksalf ( sllec eht no noitca nispyrt eht esaerced lliw aidem IMPR eht ni SBF ehT .)

• T aera tnerehda elohw eh f saw hsul de htiw )gnihtorf hcum gnisuac tuohtiw( semit lareves

noitulos siht emac sllec tnerehda lla taht os .noitulos otni

• T noitulos eh derrefsnart saw irets otni nwod nips erew sllec dna sebut el .

• T gniniatnoc nispyrt eh tnatanrepus devomer saw IMPR hserf dna 0461 muidem dedda ot

.siht

• IMPR 0461 emulov tneiciffus ni dedda saw .sllec fo noitartnecnoc derised eht teg ot

• noisnepsus llec sihT saw IMPR gniniatnoc )s( ksalf wen ot dedda 0461 etagaporp ot aidem

eg txen eht .sllec fo egassap / noitaren

egarots morf laviver dna senil llec fo noitavreserpoyrC

• retfa tellep llec ehT noitasinispyrt IMPR fo lm 5.0 ni dednepsus saw 0461 a ot dedda dna

fo lm 5.0 gniniatnoc laiv elirets f letairporppa delebal dna erutxim gnizeer .y

• a ot derrefsnart retal dna eci ni decalp saw laiv ehT - 08 .rezeerf Cº

• .negortin diuqil otni decalp eb ot yad txen eht tuo nekat saw sihT


401

• dna negortin diuqil fo tuo nekat saw laiv eht ,sllec devreserpoyrc fo laviver fo emit tA

.dewaht ylkciuq

• IMPR gniniatnoc setalp / sksalf ot dedda neht erew laiv eht fo stnetnoc ehT 0461 .muidem

tnuoc lleC

• IMPR fo lm 1 ni dednepsus erew noitasinispyrt retfa sllec ehT 0461 .

• rebmahc gnitnuoc rueabuen devorpmi na fo egats eht ot no degrahc saw lµ 01

T • .detnuoc erew serauqs renroc 4 eht ni sllec fo rebmun eh

• :swollof sa enod saw noitaluclaC

01 X rotcaf noituliD X serauqs 4 lla ni sllec fo gvA = tnuoc lleC 4 sllec / lm

YASSA YTICIXOTOTYC 2.2.2

:stnegaeR

)a( TTM 3( - 5,4( - lozaihtlyhtemid -2- )ly - 5,2 - ynehpid )edimorb muilozartetl yassA

tnegaeR TTM

redwoP TTM gm 5

SBP lm 1

.noitartnecnoc gnikrow rof 0461 IMPR htiw 01 ni 1 detulid si noitulos kcots sihT

reffuB noitasilibuloS )b(

)%1( 001 X notirT lm 5

lCH N1.0 7.614 lµ

osI - lonaporp lm 05 otpu ekam

orP :erudec

• 69 ni tuo deirrac saw yassa TTM ehT - .setalp ertitorcim erutluc eussit llew

• ( dedees erew slleC 01 x 5 4 sllec llew / 42 rof detabucni erew setalp eht dna llew hcae otni ) -

84 73 ta h OC %5 ;C° 2 .

• .dedracsid saw aidem eht ,noitabucni retfA

• ehT w yticixototyc sa gnidda yb deiduts 71 & 43 μ g / lm IMPR ni yehw deretlif eht fo 0461

lanif( v 002 emulo .sllew eht ot )llew / lµ

• .llew hcae ot dedda saw tnegaer TTM fo lμ 001 ,noitabucni srh 2 retfA


501

• rof h 4 fo doirep noitabucni na yb dewollof saw sihT .tnempoleved ruoloc eht

• fo lμ 05 nehT s .etatipicerp nazamrof eht evlossid ot dedda saw reffub noitasilibulo

• 075 ta daer saw llew hcae fo ).D.O( ytisned lacitpo ehT redaer etalp ASILE yb mn )daroiB( .

• ot tcepser htiw sllec elbaiv fo segatnecrep ehT .denimreted erew lortnoc

GNINIATS DAED DNA EVIL 3.2.2

:stnegaeR

)a( erutxim eyd egnaro enidircA / edimorb muidihtE

001 noituloS kcotS X

edimorB muidihtE gm 05

egnarO enidircA gm 51

lm 94 ddA .lonahte %59 fo lm 1 ni evlossiD ellitsid d lm1 otni edivid ;llew xiM .retaw

.ezeerf dna stouqila

1 noitulos gnikroW X

i erotS .SBP htiw 001:1 kcots eht etuliD º 4 ta elttob rebma n rof C .htnom 1

:erudecorP

• lliw sllec evil erehw sllec daed dna evil neewteb setaitnereffid dohtem gniniats laud sihT

htiw neerg ecseroulf egnaro enidirca htiw egnaro niats sllec daed elihw , edimorb muidihte .

c 704 TNI dna 92 TH • 5 fo ytisned a ta setalp erutluc eussit llew 69 otni dedees erew slle x 01 6

.llew rep sllec

• 43( yehw htiw detaert erew slleC gµ / orp fo lm .slavretni emit gniyrav rof )niet

• .desinispyrt neht dna SBP htiw dehsaw neht erew slleC

• .nispyrt evomer ot SBP htiw dehsaw dna slaiv ni detcelloc erew slleC

• .oitar 1:1 a ni SBP ni dednepsus sllec eht ot dedda saw eyd eht fo noitulos gnikrow ehT

• .detnuoc dna rebmahc gnitnuoc a ot no degrahc won saw sihT


601

YASSA TEMOC 4.2.2

:stnegaeR

)a( )SBP( enilaS dereffuB etahpsohP

731 lCaN Mm 0.8 g

7.2 lCK Mm 2.0 g

01 aN Mm 2 OPH 4 7.1 g

2 HK Mm 2 OP 4 72.0 g


)b( noituloS gnisyL

5.2 lCaN M g 1.641

001 ATDE Mm g 2.73

01 esab amzirT Mm 2.1 g

I • stneidergn lm 007 tuoba ot dedda erew illiM - H Q 2 dna O derrits .

• ylraeN g 8 HOaN dedda saw erutxim eht dna a saw woll de evlossid ot .

T • Hp eh a saw tsujd de detartnecnoc gnisu 0.01 ot .HOaN ro lCH

dam saw tI • m 098 otpu e l illiM htiw - H Q 2 X notirT eht( O - 001 esaercni d emulov eht

,)tnuoma tcerroc eht ot dna erots d .erutarepmet moor ta

• X notirT %1 hserf :noitulos gnisyl laniF - 001 saw dda de fer neht dna , ta rof etaregir

nim 03 tsael da edils ot roirp .noitid

)c( reffuB siserohportcelE

A noituloS - HOaN N 01

HOaN g 002


B noituloS - ATDE Mm 002

ATDE g 98.41

illiM - H Q 2O lm 002 01 Hp ;

B hto derots erew stnegaer .erutarepmet moor ta


701

ur siserohportcele hcae erofeb hserf edam( reffuB X1 )n

HOaN lm 03

ATDE lm 0.5


.31> Hp erusne ot reffub eht fo Hp eht erusaem ,esu ot roirP

)d( reffuB noitazilartueN

sirT M 4.0 g 5.84


Hp 5.7

m 0001 otpu ekaM l illiM htiw - H Q 2 .erutarepmet moor ta erots ,O

)e( tS noituloS gninia



.erutarepmet moor ta erots

kcots X1 roF - lm 9 htiw lm 1 xim illiM - H Q 2 .O

)f( )SBP ni( esoraga tniop gnitlem woL %1

)g( .sedils eht gnitaoc rof )retaw ni( esoraga gnitlem lamroN %1

:erudecorP

perP sedils esab fo noitara

• dna lio enihcam eht evomer ot emalf eulb a revo denrub dna lonahtem ni deppid erew sedilS

.tsud

• deraperp saw esoraga gnitlem lamron %1 .)retaw Q illiM ni(

• eno ot pu deppid erew sedils ,toh llits saw esoraga elihW - rf eht driht yltneg dna aera detso

.devomer

• .yrd ot ecafrus talf a no yart a ni dial dna esoraga evomer ot depiw saw edils fo edisrednU

• .esu erofeb yad eht deraperp erew sedilS


801

yehw htiw sllec fo tnemtaerT

sllec 704 TNI dna 92 TH • 06 otni dedees erew x p mm 51 irte 5 fo ytisned a ta setalp x 01 6

08 ot worg ot dewolla dna etalp rep sllec - .ecneulfnoc %09

• ( yehw htiw detaert erew slleC 43 gµ / .h2 rof )nietorp fo lm

• ,SBP htiw dehsaw erew sllec ,h2 retfA .sllec eht ot dedda saw nispyrt %500.0

• a saw siht oT dd .nispyrt hcneuq ot )SBF htiw( muidem fo tnuoma lauqe de

• gnitlem wol %1 fo lμ 57 rep emulov ssel ro lμ 01 ni nekat erew sllec 000,01 yletamixorppA

esoraga tniop )APML( .

sllec htiw sedils fo noitaraperP

• pils revoc a dna sedils esab eht otno dereyal saw noisnepsus llec ehT saw .ti no decalp

• ecalp erew sedilS .denedrah reyal esoraga litnu skcap eci no d

• saw reyal esoraga driht a dna ffo dedils yltneg saw pils revoC lμ 09( dedda APML eht ot )

.sedils

• reyal esoraga eht litnu yart edils eht ot denruter sedils dna decalper erew spils revoC

.denedrah

fo gnisyL sllec

• evomer erew spils revoC d deraperp ylhserf ,dloc otni derewol ylwols erew sedils eht dna

tcetorp( noitulos gnisyl de irfer dna )thgil morf h 2 fo muminim a rof detareg .

siserohportcelE

• h 2 retfA s gnisyl eht morf devomer yltneg erew sedils ,Cº4~ ta dna noitulo erew ecalp d edis

.xob leg latnoziroh eht no edis yb

• deraperp ylhserf htiw dellif erew sriovreser reffuB e siserohportcel b eht litnu )31>Hp( reffu

.sedils eht derevoc yletelpmoc level diuqil

• rof reffub enilakla eht ni tis ot tel erew sedilS im 02 n dna AND eht fo gnidniwnu rof wolla ot

ilakla fo noisserpxe eht suht - .egamad elibal

• saw ylppus rewoP dna stlov 42 ot no denrut tnerruc eht detsujda saw yb serepmaillim 003 ot

.level reffub eht gnirewol ro gnisiar

• rohportcele suht erew sedils ehT 3 rof dese nim 0 .

noitazilartueN

detfil yltneg erew sedilS • ecalp dna reffub eht morf d yart niard a no


901

c saw tI • n htiw detao dna esiw pord reffub noitazilartue ot dewolla tis nim 5 tsael ta rof .

• S sedil d erew owt noitazilartuen eht detaeper dna deniar .semit erom

gniniatS

• 08 htiw deniats erew sedilS μl e X1 nim 5 rof ,edimorB muidiht

saw tI • .niats ssecxe evomer ot retaw dellitsid dellihc ni deppid neht

• snoitavresbo ,egamad AND fo noitazilausiv roF ew rBtE fo edam er - x04 a gnisu AND deniats

tcejbo .epocsorcim tnecseroulf a no evi

GNINIATS V NIXENNA 5.2.2 ( f tiK )amgiS mor

:erudecorP

• setalp llew 69 ni dedees sllec 704 TNI dna 92 TH 01x5 fo ytisned a ta 6 .llew rep sllec

• tnemtaert yehW gµ43( / )nietorp fo lm 2 rof tuo deirrac erew sllec eht ot h.

• .SBP ni dehsaw dna desinispyrt neht erew slleC

• 01 ot dedda neht saw tI μl .noitulos gniniats V nixenna

• .SBP htiw dehsaw saw niats ssecxE

x02 rednu deweiv erew slleC • .epocsorcim tnecseroulf a no evitcejbo

ESATPIRCSNART ESREVER 6.2.2 – NOITCAER NIAHC ESAREMYLOP

:desu sremirp fo tsiL

eneG noitceriD ecneuqeS eziS tcudorP

F ’5 - GT CTT CTA CTG TCC CCG GTC - ’3 35 p

R ’5 - CG TCA CTG TCG TGT ACT GCC - ’3

pb 242

F ’5 - AGACGAGTCTCGACCACCCGG - ’3 xaB

R ’5 - TGAAACCCTGCGGGTGCACCG - ’3

pb 974

F ’5 - TAAAAGGGTGTTAGAGTAAACTT - ’3 XOC - 2

R ’5 - TTCTATGAGTCCGTCTCT ACTAGA - ’3

pb 503

F ’5 - GAGGTACCACCACTTCTGCGG - ’3 HDPAG

R ’5 - CGGTTC CAGTAGGTACTGTTGAA - ’3

pb 302


011

ANR fo noitalosI enil llec 92 TH morf

sllec 92 TH • 06 otni dedees erew x m 51 m p irte 5 fo ytisned a ta setalp x 01 6 etalp rep sllec

08 ot worg ot dewolla dna - .ecneulfnoc %09

• erew sllec ehT yehw htiw detaert 43( gµ / )nietorp fo lm .srh 4 rof

• non dna sllec detaert yehw morf detalosi saw ANR - sllec detaert )lortnoc( debircsed sa

woleb .

c erew sllec desinispyrT • irtne deguf .nim 5 rof mpr 000,41 ta

• dna dedracsid saw tnatanrepuS .SBP fo lm1 htiw dehsaw saw tellep eht

T • 005 tellep eht o o lµ ANR f - tnegaer sserpxe )satnemreF morf tiK( dna dedda saw sllec

s erew yb dednepsu v gnixetro .

k saw sihT • utarepmet moor ta tpe .nim 5 rof er

• 002 c fo lµ trov dna ebut eht ot dedda saw mroforolh dexe .

k saw sihT • tpe .nim 01 rof erutarepmet moor ta

• irtneC .nim 5 rof mpr 000,41 ta tuo deirrac saw noitaguf

• otni detcelloc saw reyal tsomreppU wen laiv .reyal mottob eht gnibrutsid tuohtiw

• osi fo lµ 005 .noitulos detcelloc ot dedda saw lonaporp

T • k saw sih tpe .nim 01 rof erutarepmet moor ta

• c yltneuqesbus dna dexetrov saw tellep ANR irtne rof mpr 000,41 ta tuo deirrac saw noitaguf

m 01 .ni

• osi fo %57 fo lµ 005 tuoba tellep eht ot dna dedracsid saw tnatanrepuS .dedda saw lonaporp

• irtneC w noitaguf rof mpr 000,41 ta tuo deirrac sa m 01 .ni

• op saw tnatanrepus ehT slaiv eht gnipeek yb deird saw tellep eht dna ffo deru .detrevni

• .retaw CPED fo lµ 03 ni devlossid saw tellep ,deird yletelpmoc dah ti retfA

ANR fo noitacifitnauQ

• deifitnauq saw ANR gnisu pordonaN retemotohportceps .

• .knalb eht sa desu saw retaw CPED fo lµ 2

• saw ANR latot eht fo lµ 2 2 fo ecnabrosba na ta daer 6 062 dna mn0 / gnidaer mn 082

.nekat saw


111

sisehtnys ANDc ( morf tik eniloiB ) ehT : ht fo detsisnoc sisehtnys ANDc rof liatkcoc e

:gniwollof )tresni tik eht ni nevig snoitcurtsni rep sa(

tnegaeR )lµ( ytitnauQ

ANR 5

)Td( ogilO 1

retaw CPED 6

nim 01 rof Cº 56 ta detabucnI

nim 5 rof eci no detabucnI

reffub x5 4

rotibihni esaNR )lµ / u 01( 1

xim PTNd Mm 01 2

tpircsnart esreveR esa )lµ / u 002( 1

h 2 rof Cº 24 ta detabucnI

eci no decalP

noitcaer niahc esaremyloP )RCP(

rof sremirp cificeps rof RCP yb noitacifilpma ot detcejbus saw ANDc dezisehtnys ehT

XOC ,xaB ,35 p - .HDPAG dna 2

liatkcoc RCP

tnegaeR ( ytitnauQ lµ )

ANDc 4

wroF remirp dra 1

remirp esreveR 1

xim der ydaeR 5

snoitidnoc noitcaer RCP

noitcaeR )C º( pmeT emiT

noitarutaneD 59 ces 03

gnilaennA 84 nim 2

noisnetxE 27 ces 03

54 selcyc fo .oN


211

siserohportcele leg esoragA

w snocilpma ehT .siserohportcele leg esoraga yb dezilausiv ere

reffub siserohportcelE )a(

noituloS :A HOaN N 01

HOaN g 002

illiM - H Q 2O m 005 l

: B noituloS ATDE Mm 002

ATDE g 98.41

illiM - H Q 2O m 002 l 01 Hp ;

erutarepmet moor ta derotS

hcae erofeb hserf edam( reffuB X1 )nur siserohportcele

HOaN lm 03

ATDE lm 0.5


)b( noituloS gniniatS



erutarepmet moor ta derotS

:erudecorP

esoraga %5.1 • 1 htiw deraperp saw .reffub siserohportcele x

lla dna detlem saw sihT • rof decalp sbmoc htiw yart siserohportcele na ni tes ot dewo

.sllew

.sllew eht ni dedaol erew stcudorp RCP ehT •

4/3 nar selpmas eht llit V 021 ta tuo deirrac saw siserohportcelE • ht .ecnatsid eht

isu deweiv dna noitulos gniniats htiw deniats saw leg ehT • noitatnemucod leg a gn

.metsys

noissucsiD & stluseR…2 retpahC

311

3.2 NOISSUCSID DNA STLUSER

1.3.2 YEHW FO NOITARAPERP

htiw detaluconi dna devalcotua saw klim enivoB mutnemref .L citats rednu noitabucnI .

llep erew sdilos klim dna airetcab ehT .klim detnemref dedleiy thginrevo snoitidnoc dette

saw )yehw( tnatanrepus raelc eht dna setunim 02 rof mpr 0006 ta noitagufirtnec yb nwod

.noitartlif egnirys retfa seiduts eht rof desu

2.3.2 NOLOC TSNIAGA YEHW FO TCEFFE CIXOTOTYC DESAERCNI

SENIL LLEC AMONICRAC

C TCH ,92 TH( senil llec amonicrac nolo )502 OLOC dna 51 sa llew sa noloc lamron

)704 TNI dna 6 CEI( senil llec lailehtipe ot detcejbus erew mutnemref .L .tnemtaert yehw

.yassa TTM yb deiduts erew yticixototyc / ytilibaiv llec nehT yehw eht taht devresbo saw tI

esuac senil llec eht ot tnemtaert 51 TCH ,92 TH( senil llec amonicrac noloc ot yticixototyc d

)704 TNI dna 6 CEI( senil llec lailehtipe noloc lamron ot ton tub )502 OLOC dna giF( eru .

.2 )1 llec recnac eht fo ytilibaiv llec egatnecrep eht taht detacidni stluser yassa TTM ehT .

desaerced senil retfa 502 OLOC dna 51 TCH ,92 TH rof ylevitcepser %54 dna %75 ,%84 ot

gµ 43 fo noitartnecnoc a ta tnemtaert yehw fo sruoh 2 / deniamer senil llec lamron ehT lm

CEI rof ylevitcepser %48 dna 08 ta elbaiv erom 704 TNI dna 6 yehw taht deton osla saw tI .

a ta gµ 71 fo noitartnecnoc / OLOC dna 51 TCH naht 92 TH ot cixot erom ylthgils saw lm

.502

01 dna 5 ot erusopxe nO h 27 rof yehw % eht ot tnarelot erom saw 704 TNI taht nees saw ti ,

ats sllec 92 TH elihw ygolohprom dna ytisned ni egnahc elttil dewohs dna yehw teg ot detr

detaolf dna dehcated h 27 yb muidem eht otni tuo tceffe sihT .dednuor emaceb osla slleC .

01 sa tnedneped esod eb ot nees saw dna tnemhcated desaercni dewohs erusopxe yehw %

yehw %5 naht gnitaolf giF( eru . .2 )2 .

vah snoitcnuf dna selor tnereffiD desaeler seditpep evitca yllacigoloib rof desoporp neeb e

nwohs erew noitatnemref gnirud desaeler sdica yttaf eerf dna seditpeP .sklim detnemref morf

yltnacifingis erew snietorp klim fo seliforp ciditpep ehT .esnopser enummi eht esaercni ot

retfa tnereffid a eb dluoc sisyloetorp laiborcim taht gnitseggus ,BAL yb noitatnemref


411

itnetop seditpep evitcaoib fo ecruos la ]032[ . truhgoy morf sisylaid yb detarapes snoitcarF

ni noitibihni ruomut dewohs oviv ni syassa enirum ]132[ .

tcaretni yam airetcab eht yb decudorp dnuopmoc elbulos a ro airetcab dica citcaL yltcerid

htworg rieht tibihni dna erutluc ni sllec ruomut htiw ]232[ . airetcab dica citcaL yltnacifingis

TH enil llec recnac noloc namuh eht fo ytilibaiv dna htworg eht decuder - 92 a htiw ,erutluc ni

taht gnitseggus ,semyzne redrob hsurb dna VI esaditpep lyditpepid ni esaercni tnacifingis

evah thgim sllec eseht ssecorp noitaitnereffid a deretne ]332[ . ref kliM yb detnem ,sitnafni .B

sulihpodica .L ,silamina .B ,mudifib .B dna iesacarap .L 7FCM eht fo htworg eht detibihni

airetcab fo ecneserp eht ot detaler gnieb ton tceffe evitarefilorpitna eht ,enil llec recnac tsaerb

]432[ . dnif esehT a fo ecneserp eht tseggus sgni dica citcal yb decudorp dnuopmoc elbulos

ofsnart laiborcim eht ro noitatnemref klim gnirud airetcab stnenopmoc klim emos fo noitamr

laedi na si airetcab dica citcal fo tatibah larutan a gnieb kliM .mrof evitca yllacigoloib a ni

itna fo noitcudorp rof muidem - non si dna dnuopmoc evitarefilorp - .sllec nailammam ot cixot

eht detartsnomed evah seiduts reilraE eb thgim taht tub ,muidem SRM htiw tceffe recnac itna

ton sah enil llec lamron a htiw nosirapmoc eht oslA .sllec nailammam rof cixot yllaitnetop

rof ton dna sllec recnac rof ylevitceles si yticixot eht taht dewohs ew ereH .erofeb enod neeb

.sllec lamron


511

erugiF 1.2 : erugiF :1.2 yticixototyc desaercnI tsniaga yehw fo senil llec recnac noloc .

( snoitartnecnoc gnisaercni htiw detaert erew senil lamron dna recnaC dna 71 gμ 43 / )lm

rof yehw fo 2 ytilibaiv ni esaerced tnedneped esod a dewohs senil llec recnac noloC .h

enil llec lamron eht ot derapmoc nehw .s :slobmyS (92 TH )▲ ( 51 TCH )○( 502 OLOC )●

( 6 CEI ) (704 TNI dna )■ .

yehw fo noitartnecnoC µ lm / g002040608001021

gu 0 gu 71 gu43

6 CEI704 TNI

92TH51TCH

502 OLOC

0 71 430

02

04

06

08

001

021

ytilibaiv llec %

yehw fo noitartnecnoC µ lm / g002040608001021

gu 0 gu 71 gu43

6 CEI704 TNI

92TH51TCH

502 OLOC

0 71 430

02

04

06

08

001

021

ytilibaiv llec %

002040608001021

gu 0 gu 71 gu43

6 CEI704 TNI

92TH51TCH

502 OLOC

0 71 430

02

04

06

08

001

021

ytilibaiv llec %


611

.2 erugiF :2 cipocsorciM yticixototyc desaercni gniwohs erutcip sdrawot yehw fo

.sllec recnac TH( recnac ehT - TNI( senil llec lamron dna )92 - %5 htiw detaert erew )704

rof yehw %01 dna 27 ht desuac yticixototyc ehT .h dna dednuor eb ot sllec 92 TH e

ffa ton era llec 704 TNI .dehcated .detce

lortnoC yehW %5 yehW %01

lortnoC yehW %5 yehW %01

TH - 92

TNI - 704


711

3.3.2 SLLEC 92 TH NI HTAED LLEC DESAERCNI TNEMTAERT YEHW

ot desu saw egnaro enidirca dna edimorb muidihte gnisu dohtem gniniats laud ehT

TNI lamron ehT .yehw fo stceffe cixototyc ot eud htaed llec gniogrednu sllec eht hsiugnitsid

a 6 CEI ,704 43 ot detcejbus 92 TH enil llec recnac eht dn gµ / emit gniyrav rof yehw lm

ecnecseroulf gnisu dezilausiv dna dohtem gniniats laud eht htiw deniats erew slavretni

deniats sllec eht fo tsom dna emit revo htaed llec desaercni dewohs sllec 92 TH .epocsorcim

o egnar giF( eru . .2 )A3 llec ssel yltnacifingis dewohs sllec 6 CEI sa llew sa sllec 704 TNI .

92 TH ni htaed llec eht ,yehw ot erusopxe fo sruoh 8 ylraen retfA .erusopxe yehw no htaed

08 ylraen hcaer ot yllacitsard desaercni sruoh 42 fo dne eht yb htaed llec % giF( eru . .2 )B3 .

yticixototyc ehT saw htaed llec rotinom ot gniniats daed dna evil a htiw demrifnoc rehtruf

w sllec evil ssecorp gniniats siht nI .yehw ot erusopxe ot eud sllec 92 TH ni gnirrucco

ecseroulf d s sllec daed elihw ,edimorb muidihte htiw neerg niat de enidirca htiw egnaro

sllec recnac sdrawot yticixot evitceles ehT .egnaro saw htaed eht yb ereh detarobale rehtruf

08 ylraen fo llec eht ,yrartnoc eht nO .yehw ot erusopxe fo sruoh 42 retfa sllec 92 TH fo %

sllec lamron ni htaed saw 02 woleb .%

.3.2 4 RETFA SENIL LLEC AMONICRAC NOLOC FO EGAMAD AND DESAERCNI

TNEMTAERT YEHW

fo noitceteD .htaed llec yduts ot depoleved neeb evah stnegaer dna seuqinhcet fo yteirav A

fo yduts eht ni seuqinhcet desu yltneuqerf tsom eht fo eno yltnerruc si noitatnemgarf AND

gnirrucco egamad AND erusaem ot loot lufesu dna elpmis a si yassa temoc ehT .htaed llec ni

ot gnidael ,siserohportcele gnirud dniheb sliart AND detnemgarf ehT .htaed gniogrednu sllec

.liat temoc eht fo noitamrof

usopxe retfa sllec 704 TNI dna 92 TH ehT ot er 43 gµ / lm temoc ot detcejbus erew yehw

yb detacidni sa sllec 92 TH ni gnirrucco egamad AND evisnetxe detacidni tluser ehT .yassa

erew hcihw sllec 704 TNI eht elihw ;leg esoraga no sllec laudividni yb noitamrof temoc eht

cixototyc eht yb detceffa ton noitamrof temoc wohs ton did yehw fo stceffe giF( eru . .2 )4 .


811

:3.2 erugiF deniats daed dna evil fo noitatneserper lacihparg dna erutcip cipocsorciM

.senil llec )A( egami cipocsorciM fo detaert yehw 92 TH( recnac ; amonicrac noloc dna )

sllec lamron 704 TNI( .) rof yehw htiw detaert erew slleC h 42 gnisu etalp eht morf dehcated ,

htiw deniats ,nispyrt fo erutxim a e enidirca dna edimorb muidiht dehpargotohp dna . elihW

ts erew sllec daed ,egnaro enidirca yb neerg deniats erew sllec evil muidihte yb egnaro denia

.edimorb fo noitatneserper lacihparg ehT )B( fo esaercni tnedneped emit 92 TH htaed llec

retfa tnemtaert yehw 6 CEI dna 704 TNI senil llec lamron ot derapmoc .

TH - 92

TNI - 704

lortnoC detaert yehW B A


911

:4.2 erugiF fo erutcip cipocsorciM )yassa temoc( siserohportcele leg llec elgnis eht . ehT

egami - rof tnemtaert yehw retfa )92 TH( sllec recnac fo sllec depahs temoc gniwohs h2

enil llec lamroN .egamad AND desaercni gnitacidni ( 704 TNI ) .noitamrof temoc ssel dewohs

detaert yehWlortnoC

TH - 92

TNI - 704


021

5.3.2 I FO NOITCUDN TPOPA SENIL LLEC AMONICRAC NOLOC FO SISO NO TNEMTAERT YEHW

wolf ,yehw fo stceffe cixotyc eht ot eud gnirrucco htaed llec fo erutan eht dnatsrednu oT

sllec 92 TH taht nees saw tI .tuo deirrac saw V nixenna gnisu yassa cirtemotyc ew er

gniogrednu otpopa c eht sa sis nixenna yb deniats eb ot meht desuac enarbmem llec ni segnah

ereht ,704 TNI ni elihw )CTIF( V saw gniniats V nixenna on giF( eru . .2 )A5 . esreveR

dewohs hcihw fo htob xaB dna 35 p srekram sisotpopa rof tuo deirrac saw RCP esatpircsnart

l noisserpxe desaercni XOC .tnemtaert yehw retfa sisotpopa fo noitcudni gnitacidni sleve - 2

slevel noisserpxe desaerced dewohs rekram cificeps recnac noloc a si hcihw giF( eru . .2 )B5 .

fo kramllah a si enarbmem amsalp eht fo ytirgetni larutcurts fo ssol ehT sisotpopa dna

tneserper etercsid sti niatniam regnol on nac llec a hcihw ta tniopdne lanif nommoc eht s

fo noitacolsnarT .tnemnorivne eht morf ytitnedi ( enires lyditahpsohp )SP ecafrus retuo eht ot

langis noitingocer a sa sevres enarbmem amsalp eht fo ec gniyd fo sisotycogahp rof sll ]532[ .

psohp fo ssoL hcihw ,V nixenna fo esu eht htiw yllatnemirepxe detceted si yrtemmysa dipiloh

sdnib yllacificeps SP detagujnoc yltnecseroulf nehw yrtemotyc wolf yb detceted eb nac dna

]632[ . A tpop ,ekatpu eyd lativ htiw yltnerrucnoc gniniats V nixenna yalpsid sllec cito

gnidnib V nixenna taht gnitacidni saw o tluser eht wolf yb dewohs eW .egamad enarbmem f

ogrednu sllec 92 TH eht taht segami cipocsorcim dna yrtemotyc tpopa nehw htaed llec cito

.yehw ot desopxe


121

:5.2 erugiF sisotpopa fo noitcudnI / ehw retfa sllec recnac noloc fo sisocren .tnemtaert y

erutcip cipocsorciM )A( fo yehw ot erusopxe retfa )92 TH( sllec recnac evitisop V nixennA .

RCP TR )B( .gniniats V nixenna on swohs 704 TNI enil llec lamroN xaB ,35p fo sisylana

XOC dna - .tnemtaert yehw retfa 2 desaercnI ANR p fo noisserpxe ,35 B dna xa desaerced

XOC fo noisserpxe - devresbo erew 2 . eC 4 rof yehw htiw detaert erew sll ANR erofeb h

.noitalosi HDPAG devres .)eneg gnipeek esuoh( lortnoc evitisop a sa

704 TNI 92 TH

taerT lortnoC detaerT lortnoCde

0

5

01

51

02

52

6 CEI 92 TH

sisorceN

%

0

5

01

51

02

52

6 CEI 92 TH

sisorceN

%

B A

HDPAG 302( pb )

35P )pb242(

xaB 974( pb )

2XOC )pb503(

92 TH

T C

704 TNI 92 TH

taerT lortnoC detaerT lortnoCde

0

5

01

51

02

52

6 CEI 92 TH

sisorceN

%

0

5

01

51

02

52

6 CEI 92 TH

sisorceN

%

B A

HDPAG 302( pb )

35P )pb242(

xaB 974( pb )

2XOC )pb503(

92 TH

T C

HDPAG 302( pb )

35P )pb242(

xaB 974( pb )

2XOC )pb503(

92 TH

T C

snoisulcnoC…2 retpahC

221

NOISULCNOC 4.2 S

mutnemref .L yehw ot yticixot erom desuac ec amonicraconeda noloc l ll TH seni - ,92

TCH - OLOC dna 51 - 502 naht ot mron CEI senil llec la - TNI & 6 - 704 .

fo gnidnuor dna tnemhcated erom dewohs sruoh 27 rof senil llec ot tnemtaert yehW

.704 TNI ni nees ton erew serutaef cixototyc esehT .92 TH ni sllec

mutnemref .L sesuac yehw cni aer htaed llec des naht enil llec recnac noloc 92 TH ni

.enil llec 704 TNI lamron

egamad AND egamad desaercni dewohs ,yassa temoc yb dessessa nehw TH ot - sllec 92

TNI naht - sllec 704 .

mutnemref .L yehw tnemtaert el sllec 92 TH fo ennA rof tluser evitisop a ot d V nix

.sisotpopa fo noitcudni gnitacidni ,gniniats

noisserpxe ni esaercni na dewohs xaB dna 35 p ekil seneg detaler sisotpopa fo RCP TR

slevel tnemtaert yehw retfa sllec 92 TH ni .

hw 2XOC cificeps recnac noloc a si hci noisserpxe desaerced dewohs rekram slevel ni

RCP TR syassa .

hguorhT ortiv ni taht ereh nwohs neeb sah ti ,seiduts mutnemref .L cixototyc si yehw

.senil llec recnac ni sisotpopa secudni dna lamina ot dednetxe eb ot sdeen yduts sihT

eht etadilav ot stnemirepxe ledom ortiv ni .stluser

uq ehT sesuac yehw yhw ot sa noitse htaed llec recnac ni ylno eb ot sniamer sllec

.noitseuq siht sserdda ot dedeen era level ralucelom eht ta seiduts deliateD .derewsna

cha pter 2 anticancero u s properties of lactobacill u...

Documents