development 139, 3880-3890 (2012) doi:10.1242/dev.083576 ... 2012.pdfchromatin immunoprecipitation...

RESEARCH ARTICLE3880

Development 139, 3880-3890 (2012) doi:10.1242/dev.083576© 2012. Published by The Company of Biologists Ltd

INTRODUCTIONA central unanswered question in DNA replication is themechanism by which multicellular eukaryotes select sites in theirgenome to act as origins (Mechali, 2010). A strict DNA consensusfor origins has not been identified. Moreover, which loci areselected to be origins and when they initiate during S phase canchange during development. In humans, origin misregulation is thebasis for specific heritable developmental syndromes andcontributes to genome instability and cancer (Bicknell et al., 2011a;Bicknell et al., 2011b; Guernsey et al., 2011; Hook et al., 2007;Shima et al., 2007). Evidence suggests that chromatin modificationplays an important role in origin developmental plasticity, but themechanism for origin specification and integration withdevelopment remains little understood. In this study, we investigatethese questions using as a model the origins that mediatedevelopmental gene amplification in the Drosophila ovary.

Origin DNA is bound by a pre-replicative complex (pre-RC) thatis then activated to initiate replication during S phase (Remus andDiffley, 2009). Analysis of origins in S. cerevisiae identified a DNAconsensus sequence for the binding site of the origin recognitioncomplex (ORC), a component of the pre-RC. In multicellulareukaryotes, sites of pre-RC binding and replication initiation havebeen mapped genome-wide in a number of organisms, yet a strictDNA consensus for origins has not emerged (Bell et al., 2010;Cadoret, 2008; Cayrou et al., 2011; Eaton et al., 2011; Hiratani et al.,2008; MacAlpine et al., 2010; Schwaiger et al., 2009). Moreover,metazoan ORC has little binding specificity in vitro, except for a bias

for poly(A)-poly(T) tracts and superhelical DNA (Bielinsky et al.,2001; Remus et al., 2004; Vashee et al., 2003). Despite this apparentlack of sequence specificity, replication initiation occurs at preferredgenomic sites in vivo. Which sites are selected to be origins and thetime that they initiate replication during S phase can both changeduring development (Hiratani et al., 2008; Mechali, 2010; Nordmanand Orr-Weaver, 2012; Sasaki et al., 1999; Shinomiya and Ina,1991). Despite recent advances, the mechanisms that determinedifferential origin usage during development remain largelyundefined.

The developmental plasticity of origins provided early evidencethat epigenetic mechanisms might play an important role in originregulation in eukaryotes (Edenberg and Huberman, 1975; Hyrienet al., 1995; Shinomiya and Ina, 1991). Recent genomic analyseshave shown a correlation between active origin loci and chromatinstatus, including nucleosome position, histone modification andhistone variants (Bell et al., 2010; Cadoret, 2008; Cayrou et al.,2011; Eaton et al., 2011; Hiratani et al., 2008; MacAlpine et al.,2010; Muller et al., 2010; Schwaiger et al., 2009). Several studieshave demonstrated that the acetylation of nucleosomes promotesORC binding, active origin selection and early replication initiationduring S phase (Aggarwal and Calvi, 2004; Danis et al., 2004;Hartl et al., 2007; Kim et al., 2011; Pappas et al., 2004; Schwaigeret al., 2009; Vogelauer et al., 2002). Moreover, a number of specifichistone acetyltransferases (HATs) and histone deacetylases(HDACs) have been shown to influence origin activity (Aggarwaland Calvi, 2004; Doyon et al., 2006; Espinosa et al., 2010; Iizukaet al., 2006; Iizuka and Stillman, 1999; Karmakar et al., 2010;Miotto and Struhl, 2008; Miotto and Struhl, 2010; Pappas et al.,2004; Vogelauer et al., 2002; Wong et al., 2010). Nevertheless, howdifferent HATs and HDACS regulate origins in concert withdevelopment remains poorly understood.

Department of Biology, Indiana University, Bloomington, IN 47405, USA.

*Author for correspondence ([email protected])

Accepted 29 July 2012

SUMMARYDNA replication origin activity changes during development. Chromatin modifications are known to influence the genomic locationof origins and the time during S phase that they initiate replication in different cells. However, how chromatin regulates origins inconcert with cell differentiation remains poorly understood. Here, we use developmental gene amplification in Drosophila ovarianfollicle cells as a model to investigate how chromatin modifiers regulate origins in a developmental context. We find that the histoneacetyltransferase (HAT) Chameau (Chm) binds to amplicon origins and is partially required for their function. Depletion of Chm hadrelatively mild effects on origins during gene amplification and genomic replication compared with previous knockdown of itsortholog HBO1 in human cells, which has severe effects on origin function. We show that another HAT, CBP (Nejire), also bindsamplicon origins and is partially required for amplification. Knockdown of Chm and CBP together had a more severe effect onnucleosome acetylation and amplicon origin activity than knockdown of either HAT alone, suggesting that these HATs collaboratein origin regulation. In addition to their local function at the origin, we show that Chm and CBP also globally regulate thedevelopmental transition of follicle cells into the amplification stages of oogenesis. Our results reveal a complexity of originepigenetic regulation by multiple HATs during development and suggest that chromatin modifiers are a nexus that integratesdifferentiation and DNA replication programs.

KEY WORDS: DNA replication, Histone acetylation, Gene amplification

The histone acetyltransferases CBP and Chameau integratedevelopmental and DNA replication programs in Drosophilaovarian follicle cellsKristopher H. McConnell, Michael Dixon and Brian R. Calvi*

DEVELO

PMENT

3881RESEARCH ARTICLEHATs in gene amplification

Early evidence for a role of histone acetylation in originregulation came from analysis of developmental gene amplificationin the Drosophila ovary (Aggarwal and Calvi, 2004; Hartl et al.,2007). Late in oogenesis, the somatic follicle cells surrounding theoocyte cease genomic replication and begin site-specific replicationfrom origins at only six loci (Calvi, 2006; Kim et al., 2011). Thereinitiation of replication from these origins results in theamplification of DNA copy number for genes involved in eggshellsynthesis (Spradling, 1981). Similar to other origins, theseamplicon origins are bound by the pre-RC and regulated by the cellcycle kinases CDK2 and CDC7 [Cdc2c and l(1)G0148 – FlyBase](Calvi, 2006; Calvi et al., 1998; Claycomb and Orr-Weaver, 2005;Landis and Tower, 1999). Precisely at the onset of stage 10B,nucleosomes at amplicon origins become hyperacetylated, ORCbinds and the origin becomes active (Aggarwal and Calvi, 2004;Austin et al., 1999). At the best-characterized origin, DAFC-66D,acetylation rapidly declines in stage 11/12, ORC departs andreplication initiation ceases, but replication forks continue tomigrate outwards (Aggarwal and Calvi, 2004; Austin et al., 1999).Evidence suggested that nucleosome acetylation contributes toamplicon origin locus specificity and the efficiency with whichthey initiate replication (Aggarwal and Calvi, 2004). We recentlyshowed that multiple lysines on histones H3 and H4 arehyperacetylated at the amplicon origins, and that acetylation ofcertain lysines is dependent on different steps of pre-RC assembly(Liu et al., 2012). The acetylation on multiple lysines suggestedthat several HATs might regulate amplicon origins, but the identityof these HATs is not known. Moreover, it is not known howdevelopmental signals integrate with chromatin modifiers to ensureamplicon activity at the proper time in oogenesis.

Here, we use gene amplification in the Drosophila ovary toinvestigate the epigenetic regulation of origins in a developmentalcontext. We show that the HAT Chameau (Chm) is required fornormal levels of amplification, but, unlike its human orthologHBO1, Chm is not absolutely required for gene amplification orgenomic replication. We further show that the HAT CBP (Nejire)collaborates with Chm to promote wild-type levels of geneamplification. Importantly, our data suggest that Chm and CBPmight function both locally at the amplicon origins and globally inthe developmental transition of follicle cells into the amplificationstage of oogenesis. Our results imply that epigenetic mechanismsmight have a more general role for the coordination of DNAreplication programs with cell development.

MATERIALS AND METHODSDrosophila strains and geneticsStandard techniques were used for culture of Drosophila melanogaster at25°C. UAS:Flag-Mcm6 (Schwed et al., 2002) and c323:Gal4 (Manseau etal., 1997) and OregonRmodencode (Roy et al., 2010) were describedpreviously. UAS:Myc-chm and chm14 strains were a gift from Y. Graba andJ. Pradel (Grienenberger et al., 2002). Orc2dsRNA and chmdsRNA-2 wereobtained from the Vienna Drosophila RNAi Center (Dietzl et al., 2007).chmdsRNA-1, chmshRNA, CBPdsRNA-3 and RNAi against mof, Taf1 and enokwere obtained from the Transgenic RNAi Project (TRiP) via theBloomington Drosophila Stock Center (BDSC) (Ni et al., 2008; Ni et al.,2011). RNAi against Pcaf (GCN5) was also from the BDSC (Carre et al.,2005). RNAi against Tip60 was a gift from F. Elefant (Zhu et al., 2007).CBPdsRNA-1, CBPdsRNA-2 and CBP mutant flies were gifts from J. Kumar(Kumar et al., 2004).

Immunolabeling and microscopyAntibody, BrdU and DAPI labeling were performed as previouslydescribed (Calvi and Lilly, 2004). We used the following antibodies andconcentrations: mouse anti-BrdU 1:20 (Becton Dickinson), rabbit anti-CBP

1:200 [gift from M. Mannervik (Lilja et al., 2003)], rabbit anti-H4K12ac1:200 (Upstate Technologies), mouse anti-Cut 1:15 [DevelopmentalStudies Hybridoma Bank (Blochlinger et al., 1990)]. Secondary antibodiesAlexa 488 anti-rabbit, Alexa 488 anti-mouse, Alexa 568 anti-mouse andAlexa 633 anti-mouse were used at 1:500 (Invitrogen). Images were takenwith a Leica DMRA2 widefield epifluorescence microscope, except forFig. 5 and Fig. 6A, which were taken with a Leica SP5 laser scanningconfocal microscope.

Quantification and statistical analysisBrdU and DAPI fluorescence were quantified using Openlab v5.0.2(Improvision). For quantification of BrdU fluorescence, the brightestamplification focus in each nucleus was measured, which corresponds toDAFC-66D. Only nuclei containing visible BrdU foci were included. Forboth BrdU and DAPI fluorescence, 20 wild-type nuclei in each eggchamber were measured to determine the wild-type average fluorescence.Fluorescence intensity of nuclei in each mutant clone was normalized tothe average wild-type fluorescence within the same egg chamber. Statisticalsignificance was determined using an unpaired t-test, except for thequantification of chm14 clone size compared with wild-type twin spot inFig. 3B, which used a paired t-test.

Generation of Chm antibodyThe unique N-terminal 114 amino acids of Chm were cloned into pGEX-6P-1 (GE Healthcare) and expressed in competent E. coli BL-21 cells(Stratagene). GST-Chm1-114 was purified with Glutathione Sepharose 4Bbeads (GE Healthcare), then eluted off the beads and sent to CovanceResearch Products for injection into rabbits. Chm1-114 was then removedfrom GST by PreScission Protease (GE Healthcare) cleavage, conjugatedto Affigel-10 (BioRad), and used for affinity purification of anti-Chmantibody from serum.

Chromatin immunoprecipitation (ChIP)ChIP was performed as described (Negre et al., 2006). Whole ovaries wereisolated by blending well-conditioned females in cold PBS/0.02% Tween20. Ovaries were allowed to settle for 2-3 minutes, then separated fromremaining fly tissue using wire mesh filters. Ovaries were then fixed for15 minutes in 1.8% paraformaldehyde, during which cells were lysed usinga Potter homogenizer and dounce homogenizer (Kontes). This wasfollowed by quenching with 225 mM glycine. Lysates were sonicated to amodal length of 500 bp. Immunoprecipitations were performed overnightat 4°C with primary antibody, then incubated for 2 hours with Protein Aagarose beads (Invitrogen). Beads were centrifuged and washed four timeswith lysis buffer, twice with Tris/EDTA, and eluted overnight at 65°C toreverse crosslinks. Eluted material and input were treated with 1 gRNaseA (Roche 11119915001) and 50 g proteinase K (New EnglandBiolabs). DNA was purified by phenol/chloroform extraction and ethanolprecipitated. qPCR analysis was performed as described (Liu et al., 2012)using the following primers (5�-3�, forward and reverse): ACE3,GCAGTGGCCTGAAAATTCTGCT and AGCTTAGTGCGGCAGT -TTGGAA; Cp18, TCCCTCATACGGTGGTGGATA and CCGGAGTA -CTGAGATCCCACAT; Ori-, GACTCTTCCAAATGGGAACCAC andCAACCGACCTGGAAACCATTAC; ACE3+10kb, GAGACAAGAG -GACCAGCCCATC and GAAAGGGAACCCAAAGCAAACC; Rh2,AGGACCTCAATGGGTTGAGAGA and CCATGGTTGGAGTAAA -TGACCA.

RESULTSThe Drosophila ortholog of HBO1, Chm, interactswith the MCM complex in ovarian follicle cellsThe unit of egg production during Drosophila oogenesis is the eggchamber (Fig. 1A) (Bastock and St Johnston, 2008; Spradling,1993). Egg chambers consist of one oocyte and 15 sister germlinenurse cells surrounded by an epithelial sheet of somatic follicle cells.Egg chambers proceed through 14 defined stages of development asthey migrate down a structure called the ovariole (King, 1970). Thesomatic follicle cells undergo transitions in the cell cycle program in D

EVELO

PMENT

3882

coordination with egg chamber development. Two follicle cell stemcells (FSCs) reside in the anterior of the ovariole in a structure calledthe germarium (Margolis and Spradling, 1995; Nystul and Spradling,2007). FSC daughter cells proliferate and then form an epithelialsheet around the germline cyst, which together bud off as a stage 1egg chamber. Follicle cells increase in number by a canonical mitotic

RESEARCH ARTICLE Development 139 (20)

division cycle before stage 7, and then switch into an endocyclecomprising G and S phases without mitosis (Deng et al., 2001;Lopez-Schier and St Johnston, 2001; Mahowald et al., 1979;Shcherbata et al., 2004). Follicle cells undergo three endocyclesduring stage 7-10A and then in stage 10B enter the amplificationstage during which only select loci reinitiate DNA replication (Calvi,2006; Calvi et al., 1998; Claycomb and Orr-Weaver, 2005; Spradlingand Mahowald, 1980).

Nucleosome acetylation plays an important role in thedevelopmental activation of the amplicon origins. To determinewhich HATs are responsible for this acetylation, we initially focusedon the gene chameau (chm), the Drosophila ortholog of humanHBO1 (KAT7 – Human Genome Nomenclature Committee). Inhuman cells, HBO1 associates with CDT1 and other pre-RC subunitsand acetylates nucleosomes at origins, which is required forsubsequent binding of the hexameric minichromosome maintenance(MCM) helicase complex to origin DNA during pre-RC assembly(Doyon et al., 2006; Iizuka et al., 2006; Iizuka and Stillman, 1999;Miotto and Struhl, 2008; Miotto and Struhl, 2010). Human HBO1protein also physically interacts with the Drosophila ortholog of theMCM subunit Mcm2 in a yeast two-hybrid assay (Burke et al.,2001). We had previously shown that Chm can stimulate geneamplification in Drosophila when tethered to an amplicon origin invivo, suggesting that the function of HBO1/Chm in origin regulationmight be conserved from flies to humans (Aggarwal and Calvi,2004). It is not known, however, whether Chm normally regulatesDrosophila origins during developmental gene amplification orgenomic replication. Previous characterization of chm mutants inDrosophila showed that it is required as a transcriptional co-activatorduring metamorphosis and also influences heterochromatic silencing,but a role in DNA replication has not been explored (Grienenbergeret al., 2002; Miotto et al., 2006).

To determine whether Chm regulates amplicon origins, we firsttested whether Chm physically interacts with the MCM complexin Drosophila follicle cells during gene amplification. TheUAS:Myc-chm and UAS:Flag-Mcm6 epitope-tagged transgeneswere expressed in stage 9-14 follicle cells using the c323:Gal4driver (Fig. 1A) (Grienenberger et al., 2002; Manseau et al., 1997).We had previously used c323:Gal4 and UAS:Flag-Mcm6 to showthat Drosophila Mcm6 associates with the MCM complex and isrequired for developmental gene amplification (Schwed et al.,2002). Immunoprecipitation (IP) of Myc-Chm resulted in co-IP ofFlag-Mcm6 protein (Fig. 1B, lane 4), and the reciprocal IP of Flag-Mcm6 resulted in co-IP of Myc-Chm (Fig. 1B, lane 7). In controls,anti-Myc did not result in IP of Flag-Mcm6 from fly strains lackingMyc-Chm, nor did anti-Flag result in IP of Myc-Chm without Flag-Mcm6 (Fig. 1B, lanes 3 and 8).

To examine endogenous Chm protein, we generated a polyclonalrabbit antibody against the unique N-terminal 114 amino acids ofChm. IP of endogenous Chm protein with this anti-Chm antibodyresulted in co-IP of Flag-Mcm6 (Fig. 1C). IP of endogenous MCMproteins with a pan-MCM antibody that recognizes all six subunitsof the MCM complex resulted in co-IP of Myc-Chm (Fig. 1D)(Klemm and Bell, 2001). We were unable to detect co-IP of Chmwith the MCM complex in wild-type cells without overexpression.Together, these results suggest that Chm physically interacts withthe MCM complex in follicle cells when amplification origins areactive and nucleosomes at the origins are acetylated.

Myc-Chm associates with the DAFC-66D originWe next examined whether Chm associates with amplicon originsin vivo. We used Myc-Chm for ChIP followed by qPCR for

Fig. 1. Chm interacts with the MCM complex and binds theDAFC-66D origin in amplification stage follicle cells. (A)Drosophilaegg chamber development during oogenesis. Development proceedsfrom left to right as shown. The somatic follicle cells surrounding eachegg chamber originate from follicle stem cells (FSCs) in the germarium,proliferate via the mitotic cycle in stages 1-6, proceed through threeendocycles in stages 7-10A, and then amplify specific loci in stages10B-14. The stages during which c323:Gal4 becomes increasinglyactive are indicated beneath by a graded line. (B)Myc-Chm interactswith Flag-Mcm6. UAS:Myc-chm and/or UAS:Flag-Mcm6 were expressedin stage 9-14 follicle cells using c323:Gal4. Ovary lysates wereimmunoprecipitated (IP) with antibodies against Myc (lanes 3 and 4) orFlag (lanes 7 and 8) and analyzed by western blot against either Flag-Mcm6 (lanes 1-4) or Myc-Chm (lanes 5-8). The presence (+) or absence(–) of Flag-Mcm6 and Myc-Chm in the different fly strains is indicatedabove each lane. (C)Endogenous Chm interacts with Flag-Mcm6.c323:Gal4; UAS:Flag-Mcm6 ovary lysates were immunoprecipitatedwith anti-Chm (lane 3) or normal rabbit serum (N, lane 2) and westernblots incubated with anti-Flag. (D)The endogenous MCM complexinteracts with Myc-Chm. c323:Gal4; UAS:Myc-chm ovaries wereimmunoprecipitated with anti-pan-MCM (lane 6) or normal mouseserum (N, lane 5) and western blots incubated with anti-Myc. Asteriskindicates myc-Chm degradation product. (E)Myc-Chm binds the DAFC-66D origin in vivo. ChIP of c323:Gal4; UAS:Myc-chm whole-ovarylysates with anti-Myc. Enriched DNA was analyzed by qPCR usingprimers to ACE3, Ori- and Cp18 regions of the DAFC-66D origin (mapbelow), a region 10 kb distal from the core origin, and the negativecontrol locus Rhodopsin 2 (Rh2). Fold enrichment in the pellet wasnormalized to input and to the Rh2 locus. Plotted values represent theaverage of two biological replicates and error bars represent the range.Enrichment was not observed with pre-immune serum (data notshown).

DEVELO

PMENT

DAFC-66D amplicon origin DNA, normalized to input and theRhodopsin 2 (Rh2) control locus. To achieve specificity for folliclecells late in oogenesis during amplification, we again usedc323:Gal4 to drive expression of UAS:Myc-chm. ChIP with anti-Myc antibodies showed that Myc-Chm was enriched at DAFC-66D, including the ACE3 and Ori- regions, which are bothrequired in cis for origin function (Fig. 1E) (Heck and Spradling,1990; Orr-Weaver and Spradling, 1986). Myc-Chm was alsoenriched within the body of the Cp18 gene, but was less enrichedat a region 10 kb from ACE3 (Fig. 1E). This pattern of enrichmentis consistent with the broad domain of histone acetylation that waspreviously defined at DAFC-66D (Kim et al., 2011; Liu et al.,2012). Together, these results suggest that Chm protein associateswith the MCM complex and the DAFC-66D amplicon originduring gene amplification in follicle cells late in oogenesis.

Chm HAT activity is required for wild-typeamplification levelsOur results suggested that Chm protein associates with and mightdirectly regulate amplicon origins. To genetically test whether chm isrequired in the adult ovary, it was necessary to use conditionalknockdown because chm homozygous null mutants are pupal lethaldue to reduced expression of genes regulated by the JNK pathway(Grienenberger et al., 2002; Miotto et al., 2006). We thereforeinduced RNAi against chm by expressing UAS:hairpin RNAtransgenes in follicle cell clones using a Flp recombinase-inducibleAct:Gal4 (hereafter referred to as Flp-Out) (Pignoni and Zipursky,1997). In this system, heat shock induction of hsp70:Flp recombinaseresults in activation of Act:Gal4 in a single founder cell, which afterseveral days of cell proliferation results in a clone of cells in stage10B egg chambers that expresses UAS:dsRed and the UAS:hairpinRNA. We then assayed developmental amplification in these cells bymeasuring BrdU incorporation into amplification foci usingfluorescence microscopy, and compared it with control cells notexpressing the UAS:hairpin RNA in the same egg chamber (Calviand Lilly, 2004). As proof of principle, we created clones expressingdsRNA against the origin-binding protein Orc2, and analyzed


amplification 5 days later. Similar to loss-of-function mutants ofOrc2, knockdown of Orc2 by RNAi abolished BrdU incorporationinto amplification foci (Fig. 2B) (Landis et al., 1997). RNAiknockdown of the pre-RC protein Double parked (Dup), which is thefly ortholog of Cdt1, also abolished amplification (data not shown),whereas clones expressing Gal4 alone had no effect (Fig. 2A).

We used three different Drosophila strains that contain Gal4-inducible hairpin RNA for knockdown of Chm. These included twoseparate dsRNA hairpins (dsRNA-1 and dsRNA-2) and one shorthairpin microRNA (shRNA) (Dietzl et al., 2007; Ni et al., 2008; Niet al., 2011). Clones expressing either chmdsRNA-1 or chmdsRNA-2

transgenes had prominent amplicon BrdU foci beginning in stage10B (Fig. 2C,D). Quantification revealed, however, that there wasa small but significant reduction in the intensity of BrdU fociwithin the chmdsRNA-expressing cells compared with control cellsin the same egg chambers (Fig. 2G). By contrast, expression of thechmshRNA transgene resulted in a greater reduction in BrdU focalintensity, including some cells with no detectable BrdU foci (Fig.2E,G). In addition, some cells within each clone had BrdUincorporation throughout the nucleus, indicating that the normalsite-specific replication in these cells was disrupted (Fig. 2E). TheRNAi results suggested that Chm is required for wild-type levelsof developmental gene amplification.

RNAi knockdown of Chm with different hairpin transgenesresulted in different severities of phenotype. Although this couldbe due to greater knockdown by chmshRNA, it was possible that themore severe phenotype of chmshRNA was caused by the off-targetknockdown of other genes. We could not distinguish between thesepossibilities with our Chm polyclonal antibody because it did notreliably detect endogenous Chm protein in fixed tissues (data notshown). Therefore, to further test whether Chm is required fordevelopmental gene amplification, we analyzed a chm14 null allele,which is a ~8 kb deletion that removes the last three exons of thegene and disrupts the conserved Myst family HAT domain(Grienenberger et al., 2002). Since animals homozygous for thisallele die during metamorphosis, we created an FRT chm14

chromosome and generated homozygous mutant clones in

Fig. 2. Compromised Chm function reduces, but does not eliminate, amplification. (A-E)UAS:RNA hairpin transgenes corresponding to theindicated gene were expressed in follicle cell clones using a Flp-inducible Act:Gal4 (Flp-Out), and assayed for gene amplification by incorporation ofBrdU, which labels sites of active amplification as foci. Gray, DAPI; red, anti-BrdU labeling. Clones expressing different hairpin RNA transgenes areoutlined in each panel. (A)Act:Gal4 alone, (B) Orc2dsRNA, (C) chmdsRNA-1, (D) chmdsRNA-2, (E) chmshRNA. (F)Gene amplification in permanentchm14/chm14 stem cell clones was analyzed by BrdU labeling (red) and compared with control heterozygous chm14/GFP cells in the same eggchamber. (A-F)Follicle cells from stage 10B egg chambers are shown. Scale bars: 10m. (G)Quantification of BrdU fluorescence intensity at DAFC-66D in cells with reduced chm (red bars) relative to wild-type cells (blue bars) within the same egg chamber. n>40 nuclei from at least threeseparate egg chambers. **P<0.01, ***P<0.0001. Error bars indicate s.e.m. D

EVELO

PMENT

3884

heterozygous chm14/chm+ Ubi:GFP animals. To maximizedepletion of Chm protein, stage 10 follicle cells were assayed foramplification 10 days after heat induction of hsp70:Flprecombinase, at which point permanent GFP-negative clones arederived from a single homozygous chm14 FSC in the germarium(Margolis and Spradling, 1995). These chm14 homozygous mutantfollicle cells had BrdU amplification foci of normal appearancebeginning in stage 10B (Fig. 2F). Quantification of fluorescenceintensity, however, showed that BrdU incorporation was slightlybut significantly reduced in the chm14 homozygous cells comparedwith chm14 heterozygous cells in the same egg chamber (Fig. 2G).This mild phenotype for the chm14 null cells, which are derivedfrom null stem cells after 10 days and ~8 cell divisions, was similarto that of chmdsRNA-1 and chmdsRNA-2. It is likely, therefore, that themore severe phenotype of chmshRNA is due to off-target effects, andthus this hairpin construct was not analyzed further. The combinedresults of this genetic mosaic analysis suggested that Chm is atleast partially required for developmental gene amplification.

Chm knockdown has mild effects on cellproliferation and genomic DNA replicationKnockdown of HBO1 in human cells in culture results in severedefects in MCM loading at origins, which impairs DNA replicationand cell proliferation (Doyon et al., 2006; Iizuka et al., 2006; Iizukaand Stillman, 1999; Miotto and Struhl, 2008; Miotto and Struhl,2010). Therefore, we were surprised to observe large clones offollicle cells after RNAi knockdown and from the mutant chm14

FSC. This suggests that depletion of Chm does not significantlyaffect FSC divisions or the mitotic proliferation of follicle cells thatoccurs before stage 7 of oogenesis. To quantify this, we counted thenumber of cells in the Flp-Out dsRed+ transient clones expressingchmdsRNA-2, and compared them with control clones generated inanimals that do not have a UAS:RNAi transgene. AlthoughchmdsRNA-2-expressing clones had a wide range of cell numbers, thisrange was comparable to that of control clones, suggesting thatdepletion of Chm does not affect cell proliferation (Fig. 3A).However, the RNAi and FSC clones do not have a wild-type ‘twinspot’ to facilitate direct comparison of proliferation rates betweenChm-depleted and wild-type cells in the same egg chambers.Therefore, we generated transient chm14 homozygous mutant clones,and compared the number of cells in these GFP-negative clones withthe corresponding wild-type GFP+/GFP+ twin spots derived fromthe same recombination event. The number of cells in chm14 mutantclones was not significantly different from the twin spot controls


(Fig. 3B). Together, the chm14 and RNAi results suggest thatdepletion of Chm does not have a detectable effect on theproliferation of follicle cells that occurs before stage 7 of oogenesis.

We also determined whether depletion of Chm compromisesendoreplication of DNA during the three follicle cell endocyclesthat occur during stages 7-10A. During each endocycle, DNAendoreplication results in an approximate doubling of cellular DNAcontent and total DAPI fluorescence (Calvi et al., 1998; Mahowaldet al., 1979; Maqbool et al., 2010). To assay final DNA content, wemeasured DAPI fluorescence in cells of stage 10B mutant clonesand compared it with wild-type cells within the same eggchambers. Follicle cells within the permanent chm14 clones hadsimilar DAPI fluorescence to wild-type cells (Fig. 3C). DAPIfluorescence was also similar between chmdsRNA-2 and control cells(Fig. 3C). To directly analyze endoreplication, we labeled ovarieswith BrdU. Examination of endocycling follicle cells during stages7-10A indicated that chm14 clones are indistinguishable from wildtype in the appearance and fraction of BrdU-labeled cells (Fig. 3D).These data suggest that depletion of Chm has, at most, only a mildeffect on endoreplication.

Knockdown of the Drosophila CBP/p300 orthologNejire impairs gene amplificationThe biochemical results suggested that Chm associates with theMCM complex and amplicon origins, but genetic depletion did notcompletely eliminate amplification. We therefore considered thepossibility that the function of Chm at the amplicon origins ispartially redundant with other HATs. In support of this hypothesis,we recently found that numerous lysines on histones H3 and H4are hyperacetylated during gene amplification, suggesting thatmultiple HATs might regulate origins in follicle cells (Liu et al.,2012). To determine whether other HATs regulate geneamplification, we expressed UAS hairpin RNAs against differentHATs using the Flp-Out system. These included RNAi transgenesagainst Pcaf (GCN5), mof, enok, Taf1, Tip60 and CBP (seeMaterials and methods). From this candidate screen, we found thatknockdown of Nejire (Nej), which is the Drosophila ortholog ofthe HAT CBP/p300, impaired amplification (Akimaru et al., 1997).

We used two strains that have the same UAS:CBP hairpin RNAinserted in different genomic positions and have been shown todisrupt normal eye development (Kumar et al., 2004). Expression ofUAS:CBPdsRNA-1 severely reduced incorporation of BrdU intoamplification foci, whereas UAS:CBPdsRNA-2 did not, the likely resultof a genomic position effect on hairpin RNA expression

Fig. 3. Compromised Chm function has mild effects on cell proliferation and genomic replication. (A)The number of nuclei in Flp-Outclones. n9 stage 7-9 egg chambers representing more than 700 cells per genotype. (B)The number of nuclei in homozygous chm14 clonescompared with their homozygous wild-type ‘twin spot’ (GFP/GFP). n21 egg chambers and more than 400 cells per genotype. (C)To assesspolyploid DNA content after endocycles, total DAPI fluorescence was measured within stage 10B follicle cells with reduced Chm (red bars) relativeto wild-type cells (blue bars) within the same egg chamber. Error bars indicate s.e.m. (D) BrdU labeling of endocycling chm14 cells from a stage 9egg chamber. Scale bar: 25m. D

EVELO

PMENT

(Fig. 4A,B,I). Consistent with the severity of phenotypes, UAS:CBPdsRNA-2 clones had reduced but detectable CBP protein,whereas CBP protein was undetectable in UAS:CBPdsRNA-1 clones(Fig. 4E,F). Expression of a third CBP hairpin RNA, UAS:CBPdsRNA-

3, also severely disrupted amplification and greatly reduced CBPprotein levels (Fig. 4C,G) (Ni et al., 2008). In addition, some cells inthe UAS:CBPdsRNA-3 and UAS:CBPdsRNA-1 clones had BrdU labelingthroughout the nucleus (Fig. 4A,C). We attempted to validate theseRNAi results by clonal analysis of CBP loss-of-function alleles usingthe Flp/FRT system. Clones of the mild alleles CBP131 and CBPS342

did not have an effect on BrdU incorporation at amplicon loci (Fig.4D,I; data not shown). CBP131 clones also had no effect on CBPprotein levels (Fig. 4H). We could not recover follicle cell clones ofmore severe CBP alleles, indicating that they are cell lethal andprecluding our ability to test their effect on gene amplification (datanot shown). Nonetheless, the RNAi results suggested that CBP isrequired for normal developmental gene amplification, a result thatwe pursue further below.

CBP associates with the DAFC-66D originTo test whether CBP functions locally at amplicon origins, wedetermined whether CBP co-localizes with BrdU amplification fociin follicle cells. Ovaries clonally expressing CBPdsRNA-1 werelabeled for BrdU and CBP (Lilja et al., 2003). Wild-type stage 10B


follicle cells had anti-CBP labeling throughout the nucleus, with asignificantly brighter focus of CBP labeling. This focus co-localized with the brightest BrdU amplification focus, whichcorresponds to DAFC-66D (Fig. 5A-C) (Calvi et al., 1998). In theneighboring CBPdsRNA-1-expressing cells, both the overall levelsand focal labeling of CBP at DAFC-66D were reduced oreliminated, indicating that focal anti-CBP labeling in wild-typecells reflects enrichment of CBP protein at DAFC-66D.

To quantify the binding of CBP to DAFC-66D with higherresolution, we used anti-CBP antibodies for ChIP on whole ovariesfrom wild-type flies. This showed that CBP is 2-fold enriched atACE3 relative to the Rh2 control locus (Fig. 5D). CBP enrichmentwas lower at Ori- and within the body of the Cp18 gene, and wasnot enriched 10 kb from ACE3 (Fig. 5D). Since these experimentsused chromatin from whole ovaries, this is a conservative estimatefor CBP occupancy at DAFC-66D in amplification stage folliclecells. The combined imaging and ChIP results suggest that CBPassociates with, and might act locally at, DAFC-66D.

Combined knockdown of chm and CBPcompromises nucleosome acetylation andseverely reduces amplificationOur results suggested that both Chm and CBP associate with theDAFC-66D amplicon origin and contribute to normal levels of

Fig. 4. RNAi knockdown of CBP reduces amplification. (A-C,E-G) Three separate hairpin RNA transgenes against CBP were expressed in clonesusing the Flp-Out system and labeled with BrdU (red, A-C) or anti-CBP (green, E-G). (D)CBP131 clones were generated by Flp/FRT and labeled withBrdU. (H)CBP131 clones labeled with anti-CBP. (I)Quantification of BrdU fluorescence intensity in UAS:hairpin RNA-expressing clones. n>40 nucleifrom at least three egg chambers. ***P<0.0001. Error bars indicate s.e.m. Scale bars: 10m.

Fig. 5. CBP associates with the amplification origin at DAFC-66D. (A-C)Stage 10B egg chamber containing CBPdsRNA-1-expressing clones co-labeled with anti-CBP (A green) and BrdU (B red). (C)Merged image of A and B shows co-localization of CBP and BrdU foci. Insets show highermagnification image of a single nucleus. (D)ChIP with anti-CBP from Oregon-R whole ovaries followed by qPCR for DAFC-66D as described in Fig.1E. Error bars indicate represent the range of two biological replicates. Scale bars: 10m. D

EVELO

PMENT

3886

gene amplification. To further explore whether both HATscontribute to amplification, we co-expressed hairpin RNA againstChm and CBP using the Flp-Out method. To examine possiblesynergism between these knockdowns, we chose to co-expresschmdsRNA-1 and CBPdsRNA-2 because each of these hairpins on theirown had little to no effect on gene amplification (Fig. 2C and Fig.4B). By contrast, co-expression of both these RNAi hairpinstogether resulted in severe reductions in BrdU incorporation atamplicon foci. Foci were undetectable in most cells, and some cellshad incorporation of BrdU throughout the nucleus (Fig. 6A). CBPprotein levels were similar between the chmdsRNA-1; CBPdsRNA-2

double- and CBPdsRNA-2 single-knockdown cells, suggesting thatthe severe phenotype of the double knockdown was not caused byfurther reductions in CBP protein (Fig. 6B and Fig. 4F). Thesynergistic phenotype of Chm and CBP double RNAi furthersuggests that these HATs are both important for the regulation ofdevelopmental gene amplification.

To evaluate whether Chm and CBP are required for histoneacetylation in follicle cells, we labeled clones expressing


UAS:hairpin RNA transgenes with antibodies against histone H4acetylated on lysine 12 (anti-H4K12Ac), a modification that weshowed is greatly enriched at amplicon origins when they areactive (Liu et al., 2012). Anti-H4K12Ac antibodies labelsthroughout follicle cell nuclei, with more prominent labeling at focithat correspond to the hyperacetylated and active amplicon origins(Fig. 6C-G) (Liu et al., 2012). In addition, anti-H4K12Ac brightlylabels a focus that corresponds to a chromatin domain near theheterochromatic DAPI bright spot (Fig. 6C-G). Althoughknockdown of either HAT alone did not have a detectable effect onH4K12 acetylation (data not shown), co-expressing chmdsRNA-1;CBPdsRNA-2 reduced both total nuclear and focal labeling ofH4K12ac at the amplicons, but did not affect the H4K12Ac focusnear the DAPI-bright spot (Fig. 6C-G). Together, these resultssuggest that Chm and CBP collaborate to acetylate H4K12 andregulate amplification origins in follicle cells.

Knockdown of chm and CBP compromises thedevelopmental transition to amplificationThe imaging and ChIP results suggested that Chm and CBPproteins might act locally at the amplicon origins. However,knockdown of CBP resulted in nucleus-wide incorporation of BrdUin some cells, a cellular phenotype that was also frequent in thechm; CBP double knockdown (Fig. 4A,C and Fig. 6A). To explainthis result, we considered the possibility that Chm and CBP mightbe globally required for the transition of follicle cells fromendocycles to amplification during stage 10A/B. To address this,we used an antibody against the transcription factor Cut, which isnormally undetectable during endocycles but increases to higherlevels at the onset of amplification in stage 10B (Blochlinger et al.,1990; Sun and Deng, 2005). Cut expression in stage 10B eggchambers was slightly reduced by expression of chmdsRNA-1 orchmdsRNA-2, and not detectably reduced after expression ofCBPdsRNA-2, all of which had only mild effects on amplification(Fig. 7A-C). By contrast, CBPdsRNA-1 single knockdown, which hada more severe amplification phenotype, reduced Cut labelingfurther (Fig. 7D). Importantly, the double knockdown withchmdsRNA-1; CBPdsRNA-2, each of which had mild effects onamplification on its own, had much lower levels of Cut, consistentwith the strong effect of this double knockdown on amplification(Fig. 7E). chmdsRNA-1; CBPdsRNA-2 double-knockdown clones alsoshowed an increase in the levels of Hindsight (Hnt; Pebbled –FlyBase), which is normally downregulated during the transitionfrom endocycles to amplification (data not shown) (Sun and Deng,2007).

There are two possible explanations for persistent genomicreplication in stage 10B. Either the normal three follicle cellendocycles are delayed relative to egg chamber development, orfollicle cells are undergoing an additional fourth endocycle. DAPIfluorescence intensity was not significantly different in thechmdsRNA-1; CBPdsRNA-2 double-knockdown clones in stage 10B orstage 12 (Fig. 7F). Therefore, we could not distinguish whetherfollicle cells are just finishing a delayed third, or just beginning anew fourth, genomic endoreplication. In summary, the resultssuggest that Chm and CBP, in addition to acting locally atamplicons, might act globally to regulate the developmentaltransition of follicle cells from endocycles to gene amplification.

DISCUSSIONWe investigated which HAT enzymes participate in the epigeneticregulation of gene amplification origins in the Drosophila ovary.We found that the HAT Chm, which is the Drosophila ortholog of

Fig. 6. Combined knockdown of Chm and CBP causes a severereduction in amplification. (A)chmdsRNA-1 and CBPdsRNA-2 were bothexpressed in clones using the Flp-Out system and labeled with BrdU.(B)chmdsRNA-1; CBPdsRNA-2 double-RNAi clones labeled with anti-CBP.(C)chmdsRNA-1; CBPdsRNA-2 double-RNAi clone labeled with anti-H4K12Ac. (D)The same clone from C labeled with DAPI. (E-G)Magnified images of nuclei from C and D (boxed regions).(E)Anti-H4K12Ac, (F) DAPI, (G) merged image. H4K12Ac focicorresponding to amplicons are indicated by arrows and the islands ofH4K12Ac near the DAPI-bright heterochromatin are indicated byarrowheads. Scale bars: 10m. D

EVELO

PMENT

human HBO1, is important for DNA replication programs inovarian follicle cells. However, in stark contrast to the absoluterequirement of HBO1 at mammalian origins, knockdown of chmdid not completely eliminate gene amplification in follicle cells andhad only mild effects on endoreplication and cell proliferation. Ourresults suggest that a second HAT, CBP, collaborates with Chm,and that both HATs act locally to acetylate nucleosomes at theorigin to stimulate gene amplification. In addition to this localfunction, our data suggest that these HATs might also be globallyrequired for follicle cells to undergo the developmental transitionfrom endocycles into the amplification stage of oogenesis. Thesedata imply that Chm and CBP integrate follicle cell developmentwith DNA replication programs, and raise the possibility that thecoordination of origin activity with cell differentiation bychromatin modifiers might be a general theme in development.

Acetylation at amplicon originsWe and others had shown that amplicon origins becomehyperacetylated when they are active beginning in stage 10B, andthat this acetylation is important for origin specification andefficiency (Aggarwal and Calvi, 2004; Hartl et al., 2007). However,which HATs are responsible for the developmental regulation ofamplicon origins remained unknown. Our data suggest that theHAT Chm binds the MCM complex, associates with ampliconDNA, and is required for normal amplicon origin activity in folliclecells late in oogenesis (Fig. 8). These data are consistent with the


requirement of HBO1 for loading the MCM complex during pre-RC formation in human cells and frog extracts (Doyon et al., 2006;Iizuka et al., 2006; Iizuka and Stillman, 1999; Miotto and Struhl,2008; Miotto and Struhl, 2010). Furthermore, we have previouslyshown that tethering Chm directly to DAFC-66D promotesamplification (Aggarwal and Calvi, 2004). However, whereasdepletion of HBO1 has severe effects on origin activity and cellularproliferation, the depletion of Chm did not completely eliminateamplification, had only mild effects on endoreplication, and nodemonstrable effects on cell proliferation. One possibility is thatwe have not completely eliminated Chm activity. We were unableto directly assess the degree of knockdown among the differentgenotypes because our Chm antibody recognizes overexpressedprotein but does not detect endogenous levels of Chm. Moreover,because the knockdown was only in a subset of follicle cells, wewere unable to assess the relative levels of chm mRNA by qPCR.Importantly, the chm14 allele, which deletes essential regions of theMyst family HAT domain, had mild effects on DNA replication infollicle cell clones, and imaginal discs of homozygous chm14 larvaealso did not have defects in cell proliferation (data not shown).Together, our data suggest that, although Chm associates with andregulates origins similar to its mammalian ortholog HBO1, Chmmight not be absolutely essential for the function of all origins.

The relatively mild phenotype of chm mutants raised thepossibility that there is a developmental complexity of originregulation by multiple HATs that has not been revealed by theanalysis of cells in culture. In agreement with this interpretation,we found that the HAT CBP also associated with amplicon originDAFC-66D, and that CBP knockdown partially compromised geneamplification (Fig. 8). While some of the hairpin RNAs againstChm and CBP had mild phenotypes, using these hairpin RNAs toknockdown both HATs together resulted in a synergistic, moresevere replication phenotype and also reduced acetylation ofH4K12. One interpretation is that these HATs are partiallyredundant in function or contribute in parallel in a non-additiveway to origin activity. This idea is consistent with recent evidencethat the level of nucleosome hyperacetylation quantitativelycorrelates with the number of initiation events at different ampliconorigins (Kim et al., 2011; Liu et al., 2012). Our recent finding thata multitude of lysines are hyperacetylated on nucleosomes whenthese origins are active also raises the possibility that other HATs

Fig. 7. Knockdown of Chm and CBP perturbs the developmentaltransition to amplification. (A-E)Stage 10B follicle cell Flp-Out cloneswere labeled with anti-Cut (green). (A)chmdsRNA-1, (B) chmdsRNA-2, (C)CBPdsRNA-2, (D) CBPdsRNA-1, or (E) chmdsRNA-1; CBPdsRNA-2.(F)Quantification of total DAPI fluorescence in stage 10B and stage 12follicle cells expressing chmdsRNA-1; CBPdsRNA-2 (red) compared with wild-type cells in the same egg chamber (blue). n60 nuclei from three eggchambers. Error bars indicate s.e.m. Scale bars: 10m.

Fig. 8. Model for regulation of developmental gene amplificationby Chm and CBP. Chm and CBP are globally required for thedevelopmental transition of follicle cells from endocycles toamplification stages (above). In addition, Chm and CBP are locallyrequired during amplification stages for acetylation of H4K12 and foractivity of the amplicon origins. See text for details.

DEVELO

PMENT

3888

regulate amplicon origins and await discovery. An important futuregoal is to identify the cadre of HATs and HDACS at these originsand determine how the balance of their activity regulates originspecificity and developmental timing.

Although our data suggest that both Chm and CBP have a localfunction at amplicon origins, the mechanism by which acetylationpromotes origin activity remains unclear. Our previous evidencesuggested that nucleosome acetylation correlates with the locusspecificity of ORC binding, but recent evidence also suggests thatacetylation on some lysines occurs during pre-RC assembly and isdownstream of, and depends on, ORC binding (Aggarwal andCalvi, 2004; Liu et al., 2012). It is also possible that Chm or CBPregulates the origin by acetylating pre-RC or other non-histoneproteins, consistent with recent evidence from other systems(Glozak and Seto, 2009; Iizuka et al., 2006). Another importantquestion is how these HATs are recruited specifically to theamplicon origins. Two transcription factor complexes have beenshown to bind to the amplicons and to be required for normal levelsof amplification: the Myeloblastosis-Multivulva B complex (Myb-MuvB) and the steroid hormone Ecdysone receptor-Ultraspiracle(EcR-Usp) (Beall et al., 2002; Hackney et al., 2007; Shea et al.,1990). It might be that one or both of these complexes mediateschromatin regulation of the origins by recruiting HATs and otherchromatin modifiers. In fact, CBP is known to be a transcriptionalco-activator of Myb in both Drosophila and mammalian cells (Daiet al., 1996; Hou et al., 1997).

Integration of DNA replication programs withdevelopmentOur data suggest that CBP and Chm also contribute indirectly toamplicon origin activity by globally regulating the development offollicle cells (Fig. 8). The most severe knockdown of these HATsresulted in reduced expression of Cut and persistent Hnt, twodevelopmental markers for the endocycle-to-amplification stagetransition (Sun and Deng, 2005). One possibility is that Chm andCBP control the expression of genes that are important for thisdevelopmental transition, consistent with their known activity astranscriptional regulators from flies to humans (Chan and LaThangue, 2001; Doyon et al., 2006; Miotto et al., 2006; Miotto andStruhl, 2006). The evidence for both local and global activity ofthese HATs suggest that they integrate the activity of ampliconorigins with follicle cell development.

Our results using the model amplicon origins might have widerimplications for understanding how plastic origin activity iscoordinated with development. DNA replication programs can varywidely in development, with both the genomic location of originsand the time that they initiate during S phase differing among cells(Mechali, 2010; Nordman and Orr-Weaver, 2012). These variationsin DNA replication mirror changes in the modification of theepigenome during development and underscore the importantcontribution of acetylation and other chromatin modifications toorigin activity. Highly relevant to our results, mammalian CBP, aspart of the DARRT complex, is required for transcription of the -globin genes and for the initiation of DNA replication at the -globin locus early during S phase in erythroid cells (Aladjem,2007; Dhar et al., 1988; Karmakar et al., 2010). Disruption of theDARRT complex not only prevents transcription and originfunction locally, but also affects cell differentiation globally(Karmakar et al., 2010). In light of this and other emergingevidence in the field, our results raise the possibility that epigeneticregulators actively coordinate DNA replication programs with celldifferentiation as a general theme during development.


AcknowledgementsWe thank Y. Graba, J. Pradel, J. Kumar, F. Elefant, the Bloomington DrosophilaStock Center and the Vienna Drosophila RNAi Center for fly stocks; M.Mannervik for the generous gift of anti-CBP antibody; Jim Powers and theIndiana Light Microscopy and Imaging Center (LMIC) for assistance withconfocal microscopy; and members of the B.R.C. laboratory for critical readingof the manuscript and helpful discussion.

FundingThis work was supported by the National Institutes of Health (NIH)[postdoctoral fellowship F32 GM080089 to K.H.M., R01 GM61290-11 toB.R.C.]. Deposited in PMC for release after 12 months.

Competing interests statementThe authors declare no competing financial interests.

ReferencesAggarwal, B. D. and Calvi, B. R. (2004). Chromatin regulates origin activity in

Drosophila follicle cells. Nature 430, 372-376.Akimaru, H., Chen, Y., Dai, P., Hou, D. X., Nonaka, M., Smolik, S. M.,

Armstrong, S., Goodman, R. H. and Ishii, S. (1997). Drosophila CBP is a co-activator of cubitus interruptus in hedgehog signalling. Nature 386, 735-738.

Aladjem, M. I. (2007). Replication in context: dynamic regulation of DNAreplication patterns in metazoans. Nat. Rev. Genet. 8, 588-600.

Austin, R. J., Orr-Weaver, T. L. and Bell, S. P. (1999). Drosophila ORC specificallybinds to ACE3, an origin of DNA replication control element. Genes Dev. 13,2639-2649.

Bastock, R. and St Johnston, D. (2008). Drosophila oogenesis. Curr. Biol. 18,R1082-R1087.

Beall, E. L., Manak, J. R., Zhou, S., Bell, M., Lipsick, J. S. and Botchan, M. R.(2002). Role for a Drosophila Myb-containing protein complex in site-specificDNA replication. Nature 420, 833-837.

Bell, O., Schwaiger, M., Oakeley, E. J., Lienert, F., Beisel, C., Stadler, M. B.and Schubeler, D. (2010). Accessibility of the Drosophila genome discriminatesPcG repression, H4K16 acetylation and replication timing. Nat. Struct. Mol. Biol.17, 894-900.

Bicknell, L. S., Bongers, E. M., Leitch, A., Brown, S., Schoots, J., Harley, M. E.,Aftimos, S., Al-Aama, J. Y., Bober, M., Brown, P. A. et al. (2011a). Mutationsin the pre-replication complex cause Meier-Gorlin syndrome. Nat. Genet. 43,356-359.

Bicknell, L. S., Walker, S., Klingseisen, A., Stiff, T., Leitch, A., Kerzendorfer,C., Martin, C. A., Yeyati, P., Al Sanna, N., Bober, M. et al. (2011b).Mutations in ORC1, encoding the largest subunit of the origin recognitioncomplex, cause microcephalic primordial dwarfism resembling Meier-Gorlinsyndrome. Nat. Genet. 43, 350-355.

Bielinsky, A. K., Blitzblau, H., Beall, E. L., Ezrokhi, M., Smith, H. S., Botchan,M. R. and Gerbi, S. A. (2001). Origin recognition complex binding to ametazoan replication origin. Curr. Biol. 11, 1427-1431.

Blochlinger, K., Bodmer, R., Jan, L. Y. and Jan, Y. N. (1990). Patterns ofexpression of cut, a protein required for external sensory organ development inwild-type and cut mutant Drosophila embryos. Genes Dev. 4, 1322-1331.

Burke, T. W., Cook, J. G., Asano, M. and Nevins, J. R. (2001). Replicationfactors MCM2 and ORC1 interact with the histone acetyltransferase HBO1. J.Biol. Chem. 276, 15397-15408.

Cadoret, J. C. (2008). Genome-wide studies highlight indirect links betweenhuman replication origins and gene regulation. Proc. Natl. Acad. Sci. USA 105,15837-15842.

Calvi, B. R. (2006). Developmental DNA amplification. In DNA Replication andHuman Disease (ed. M. L. DePamphilis), pp. 233-255. Cold Spring Harbor, NY:Cold Spring Harbor Laboratory Press.

Calvi, B. R. and Lilly, M. A. (2004). BrdU labeling and nuclear flow sorting of theDrosophila ovary. In Drosophila Cytogenetics Protocols (ed. D. Henderson), pp.203-213. Totowa: Humana Press.

Calvi, B. R., Lilly, M. A. and Spradling, A. C. (1998). Cell cycle control of choriongene amplification. Genes Dev. 12, 734-744.

Carre, C., Szymczak, D., Pidoux, J. and Antoniewski, C. (2005). The histone H3acetylase dGcn5 is a key player in Drosophila melanogaster metamorphosis.Mol. Cell. Biol. 25, 8228-8238.

Cayrou, C., Coulombe, P., Vigneron, A., Stanojcic, S., Ganier, O., Peiffer, I.,Rivals, E., Puy, A., Laurent-Chabalier, S., Desprat, R. et al. (2011). Genome-scale analysis of metazoan replication origins reveals their organization inspecific but flexible sites defined by conserved features. Genome Res. 21, 1438-1449.

Chan, H. M. and La Thangue, N. B. (2001). p300/CBP proteins: HATs fortranscriptional bridges and scaffolds. J. Cell Sci. 114, 2363-2373.

Claycomb, J. M. and Orr-Weaver, T. L. (2005). Developmental geneamplification: insights into DNA replication and gene expression. Trends Genet.21, 149-162. D

EVELO

PMENT


Dai, P., Akimaru, H., Tanaka, Y., Hou, D. X., Yasukawa, T., Kanei-Ishii, C.,Takahashi, T. and Ishii, S. (1996). CBP as a transcriptional coactivator of c-Myb. Genes Dev. 10, 528-540.

Danis, E., Brodolin, K., Menut, S., Maiorano, D., Girard-Reydet, C. andMechali, M. (2004). Specification of a DNA replication origin by a transcriptioncomplex. Nat. Cell Biol. 6, 721-730.

Deng, W. M., Althauser, C. and Ruohola-Baker, H. (2001). Notch-Deltasignaling induces a transition from mitotic cell cycle to endocycle in Drosophilafollicle cells. Development 128, 4737-4746.

Dhar, V., Mager, D., Iqbal, A. and Schildkraut, C. L. (1988). The coordinatereplication of the human beta-globin gene domain reflects its transcriptionalactivity and nuclease hypersensitivity. Mol. Cell. Biol. 8, 4958-4965.

Dietzl, G., Chen, D., Schnorrer, F., Su, K. C., Barinova, Y., Fellner, M., Gasser,B., Kinsey, K., Oppel, S., Scheiblauer, S. et al. (2007). A genome-widetransgenic RNAi library for conditional gene inactivation in Drosophila. Nature448, 151-156.

Doyon, Y., Cayrou, C., Ullah, M., Landry, A. J., Cote, V., Selleck, W., Lane, W.S., Tan, S., Yang, X. J. and Cote, J. (2006). ING tumor suppressor proteins arecritical regulators of chromatin acetylation required for genome expression andperpetuation. Mol. Cell 21, 51-64.

Eaton, M. L., Prinz, J. A., MacAlpine, H. K., Tretyakov, G., Kharchenko, P. V.and MacAlpine, D. M. (2011). Chromatin signatures of the Drosophilareplication program. Genome Res. 21, 164-174.

Edenberg, H. J. and Huberman, J. A. (1975). Eukaryotic chromosomereplication. Annu. Rev. Genet. 9, 245-284.

Espinosa, M. C., Rehman, M. A., Chisamore-Robert, P., Jeffery, D. andYankulov, K. (2010). GCN5 is a positive regulator of origins of DNA replicationin Saccharomyces cerevisiae. PLoS ONE 5, e8964.

Glozak, M. A. and Seto, E. (2009). Acetylation/deacetylation modulates thestability of DNA replication licensing factor Cdt1. J. Biol. Chem. 284, 11446-11453.

Grienenberger, A., Miotto, B., Sagnier, T., Cavalli, G., Schramke, V., Geli, V.,Mariol, M. C., Berenger, H., Graba, Y. and Pradel, J. (2002). The MYSTdomain acetyltransferase Chameau functions in epigenetic mechanisms oftranscriptional repression. Curr. Biol. 12, 762-766.

Guernsey, D. L., Matsuoka, M., Jiang, H., Evans, S., Macgillivray, C.,Nightingale, M., Perry, S., Ferguson, M., LeBlanc, M., Paquette, J. et al.(2011). Mutations in origin recognition complex gene ORC4 cause Meier-Gorlinsyndrome. Nat. Genet. 43, 360-364.

Hackney, J. F., Pucci, C., Naes, E. and Dobens, L. (2007). Ras signalingmodulates activity of the ecdysone receptor EcR during cell migration in theDrosophila ovary. Dev. Dyn. 236, 1213-1226.

Hartl, T., Boswell, C., Orr-Weaver, T. L. and Bosco, G. (2007). Developmentallyregulated histone modifications in Drosophila follicle cells: initiation of geneamplification is associated with histone H3 and H4 hyperacetylation and H1phosphorylation. Chromosoma 116, 197-214.

Heck, M. and Spradling, A. (1990). Multiple replication origins are used duringDrosophila chorion gene amplification. J. Cell Biol. 110, 903-914.

Hiratani, I., Ryba, T., Itoh, M., Yokochi, T., Schwaiger, M., Chang, C. W.,Lyou, Y., Townes, T. M., Schubeler, D. and Gilbert, D. M. (2008). Globalreorganization of replication domains during embryonic stem cell differentiation.PLoS Biol. 6, e245.

Hook, S. S., Lin, J. J. and Dutta, A. (2007). Mechanisms to control rereplicationand implications for cancer. Curr. Opin. Cell Biol. 19, 663-671.

Hou, D. X., Akimaru, H. and Ishii, S. (1997). Trans-activation by the Drosophilamyb gene product requires a Drosophila homologue of CBP. FEBS Lett. 413, 60-64.

Hyrien, O., Maric, C. and Mechali, M. (1995). Transition in specification ofembryonic metazoan DNA replication origins. Science 270, 994-997.

Iizuka, M. and Stillman, B. (1999). Histone acetyltransferase HBO1 interacts withthe ORC1 subunit of the human initiator protein. J. Biol. Chem. 274, 23027-23034.

Iizuka, M., Matsui, T., Takisawa, H. and Smith, M. M. (2006). Regulation ofreplication licensing by acetyltransferase Hbo1. Mol. Cell. Biol. 26, 1098-1108.

Karmakar, S., Mahajan, M. C., Schulz, V., Boyapaty, G. and Weissman, S. M.(2010). A multiprotein complex necessary for both transcription and DNAreplication at the beta-globin locus. EMBO J. 29, 3260-3271.

Kim, J. C., Nordman, J., Xie, F., Kashevsky, H., Eng, T., Li, S., MacAlpine, D.M. and Orr-Weaver, T. L. (2011). Integrative analysis of gene amplification inDrosophila follicle cells: parameters of origin activation and repression. GenesDev. 25, 1384-1398.

King, R. C. (1970). Ovarian Development in Drosophila melanogaster. New York:Academic Press.

Klemm, R. D. and Bell, S. P. (2001). ATP bound to the origin recognition complexis important for preRC formation. Proc. Natl. Acad. Sci. USA 98, 8361-8367.

Kumar, J. P., Jamal, T., Doetsch, A., Turner, F. R. and Duffy, J. B. (2004). CREBbinding protein functions during successive stages of eye development inDrosophila. Genetics 168, 877-893.

Landis, G. and Tower, J. (1999). The Drosophila chiffon gene is required forchorion gene amplification, and is related to the yeast Dbf4 regulator of DNAreplication and cell cycle. Development 126, 4281-4293.

Landis, G., Kelley, R., Spradling, A. and Tower, J. (1997). The k43 gene,required for chorion gene amplification and diploid cell chromosome replication,encodes the Drosophila homolog of yeast origin recognition complex subunit 2.Proc. Natl. Acad. Sci. USA 94, 3888-3892.

Lilja, T., Qi, D., Stabell, M. and Mannervik, M. (2003). The CBP coactivatorfunctions both upstream and downstream of Dpp/Screw signaling in the earlyDrosophila embryo. Dev. Biol. 262, 294-302.

Liu, J., McConnell, K., Dixon, M. and Calvi, B. R. (2012). Analysis of modelreplication origins in Drosophila reveals new aspects of the chromatin landscapeand its relationship to origin activity and the prereplicative complex. Mol. Biol.Cell 23, 200-212.

Lopez-Schier, H. and St Johnston, D. (2001). Delta signaling from the germ linecontrols the proliferation and differentiation of the somatic follicle cells duringDrosophila oogenesis. Genes Dev. 15, 1393-1405.

MacAlpine, H. K., Gordan, R., Powell, S. K., Hartemink, A. J. and MacAlpine,D. M. (2010). Drosophila ORC localizes to open chromatin and marks sites ofcohesin complex loading. Genome Res. 20, 201-211.

Mahowald, A., Caulton, J., Edwards, M. and Floyd, A. (1979). Loss ofcentrioles and polyploidization in follicle cells of Drosophila melanogaster. Exp.Cell Res. 118, 404-410.

Manseau, L., Baradaran, A., Brower, D., Budhu, A., Elefant, F., Phan, H.,Philp, A. V., Yang, M., Glover, D., Kaiser, K. et al. (1997). GAL4 enhancertraps expressed in the embryo, larval brain, imaginal discs, and ovary ofDrosophila. Dev. Dyn. 209, 310-322.

Maqbool, S. B., Mehrotra, S., Kolpakas, A., Durden, C., Zhang, B., Zhong, H.and Calvi, B. R. (2010). Dampened activity of E2F1-DP and Myb-MuvBtranscription factors in Drosophila endocycling cells. J. Cell Sci. 123, 4095-4106.

Margolis, J. and Spradling, A. (1995). Identification and behavior of epithelialstem cells in the Drosophila ovary. Development 121, 3797-3807.

Mechali, M. (2010). Eukaryotic DNA replication origins: many choices forappropriate answers. Nat. Rev. Mol. Cell Biol. 11, 728-738.

Miotto, B. and Struhl, K. (2006). Differential gene regulation by selectiveassociation of transcriptional coactivators and bZIP DNA-binding domains. Mol.Cell. Biol. 26, 5969-5982.

Miotto, B. and Struhl, K. (2008). HBO1 histone acetylase is a coactivator of thereplication licensing factor Cdt1. Genes Dev. 22, 2633-2638.

Miotto, B. and Struhl, K. (2010). HBO1 histone acetylase activity is essential forDNA replication licensing and inhibited by Geminin. Mol. Cell 37, 57-66.

Miotto, B., Sagnier, T., Berenger, H., Bohmann, D., Pradel, J. and Graba, Y.(2006). Chameau HAT and DRpd3 HDAC function as antagonistic cofactors ofJNK/AP-1-dependent transcription during Drosophila metamorphosis. GenesDev. 20, 101-112.

Muller, P., Park, S., Shor, E., Huebert, D. J., Warren, C. L., Ansari, A. Z.,Weinreich, M., Eaton, M. L., MacAlpine, D. M. and Fox, C. A. (2010). Theconserved bromo-adjacent homology domain of yeast Orc1 functions in theselection of DNA replication origins within chromatin. Genes Dev. 24, 1418-1433.

Negre, N., Lavrov, S., Hennetin, J., Bellis, M. and Cavalli, G. (2006). Mappingthe distribution of chromatin proteins by ChIP on chip. Methods Enzymol. 410,316-341.

Ni, J. Q., Markstein, M., Binari, R., Pfeiffer, B., Liu, L. P., Villalta, C., Booker,M., Perkins, L. and Perrimon, N. (2008). Vector and parameters for targetedtransgenic RNA interference in Drosophila melanogaster. Nat. Methods 5, 49-51.

Ni, J. Q., Zhou, R., Czech, B., Liu, L. P., Holderbaum, L., Yang-Zhou, D., Shim,H. S., Tao, R., Handler, D., Karpowicz, P. et al. (2011). A genome-scale shRNAresource for transgenic RNAi in Drosophila. Nat. Methods 8, 405-407.

Nordman, J. and Orr-Weaver, T. L. (2012). Regulation of DNA replication duringdevelopment. Development 139, 455-464.

Nystul, T. and Spradling, A. (2007). An epithelial niche in the Drosophila ovaryundergoes long-range stem cell replacement. Cell Stem Cell 1, 277-285.

Orr-Weaver, T. and Spradling, A. (1986). Drosophila chorion gene amplificationrequires an upstream region regulating s18 transcription. Mol. Cell. Biol. 6,4624-4633.

Pappas, D. L., Jr, Frisch, R. and Weinreich, M. (2004). The NAD(+)-dependentSir2p histone deacetylase is a negative regulator of chromosomal DNAreplication. Genes Dev. 18, 769-781.

Pignoni, F. and Zipursky, S. L. (1997). Induction of Drosophila eye developmentby decapentaplegic. Development 124, 271-278.

Remus, D. and Diffley, J. F. (2009). Eukaryotic DNA replication control: Lock andload, then fire. Curr. Opin. Cell Biol. 21, 771-777.

Remus, D., Beall, E. L. and Botchan, M. R. (2004). DNA topology, not DNAsequence, is a critical determinant for Drosophila ORC-DNA binding. EMBO J.23, 897-907.

Roy, S., Ernst, J., Kharchenko, P. V., Kheradpour, P., Negre, N., Eaton, M. L.,Landolin, J. M., Bristow, C. A., Ma, L., Lin, M. F. et al. (2010). Identificationof functional elements and regulatory circuits by Drosophila modENCODE.Science 330, 1787-1797. D

EVELO

PMENT

3890 RESEARCH ARTICLE Development 139 (20)

Sasaki, T., Sawado, T., Yamaguchi, M. and Shinomiya, T. (1999). Specificationof regions of DNA replication initiation during embryogenesis in the 65-kilobaseDNApolalpha-dE2F locus of Drosophila melanogaster. Mol. Cell. Biol. 19, 547-555.

Schwaiger, M., Stadler, M. B., Bell, O., Kohler, H., Oakeley, E. J. andSchubeler, D. (2009). Chromatin state marks cell-type- and gender-specificreplication of the Drosophila genome. Genes Dev. 23, 589-601.

Schwed, G., May, N., Pechersky, Y. and Calvi, B. R. (2002). Drosophilaminichromosome maintenance 6 is required for chorion gene amplification andgenomic replication. Mol. Biol. Cell 13, 607-620.

Shcherbata, H. R., Althauser, C., Findley, S. D. and Ruohola-Baker, H. (2004).The mitotic-to-endocycle switch in Drosophila follicle cells is executed by Notch-dependent regulation of G1/S, G2/M and M/G1 cell-cycle transitions.Development 131, 3169-3181.

Shea, M., King, D., Conboy, M., Mariani, B. and Kafatos, F. (1990). Proteinsthat bind to chorion cis-regulatory elements: A new C2H2 protein and a C2C2steroid receptor-like component. Genes Dev. 4, 1128-1140.

Shima, N., Alcaraz, A., Liachko, I., Buske, T. R., Andrews, C. A., Munroe, R. J.,Hartford, S. A., Tye, B. K. and Schimenti, J. C. (2007). A viable allele ofMcm4 causes chromosome instability and mammary adenocarcinomas in mice.Nat. Genet. 39, 93-98.

Shinomiya, T. and Ina, S. (1991). Analysis of chromosomal replicons in earlyembryos of Drosophila melanogaster by two-dimensional gel electrophoresis.Nucleic Acids Res. 19, 3935-3941.

Spradling, A. (1981). The organization and amplification of two chromosomaldomains containing Drosophila chorion genes. Cell 27, 193-201.

Spradling, A. (1993). Developmental genetics of oogenesis. In The Developmentof Drosophila melanogaster (ed. M. Bate and A. Martinez-Arias), pp. 1-70. ColdSpring Harbor, NY: Cold Spring Harbor Laboratory Press.

Spradling, A. and Mahowald, A. (1980). Amplification of genes for chorionproteins during oogenesis in Drosophila melanogaster. Proc. Natl. Acad. Sci. USA77, 1096-1100.

Sun, J. and Deng, W. M. (2005). Notch-dependent downregulation of thehomeodomain gene cut is required for the mitotic cycle/endocycle switch andcell differentiation in Drosophila follicle cells. Development 132, 4299-4308.

Sun, J. and Deng, W. M. (2007). Hindsight mediates the role of notch insuppressing hedgehog signaling and cell proliferation. Dev. Cell 12, 431-442.

Vashee, S., Cvetic, C., Lu, W., Simancek, P., Kelly, T. J. and Walter, J. C. (2003).Sequence-independent DNA binding and replication initiation by the humanorigin recognition complex. Genes Dev. 17, 1894-1908.

Vogelauer, M., Rubbi, L., Lucas, I., Brewer, B. J. and Grunstein, M. (2002).Histone acetylation regulates the time of replication origin firing. Mol. Cell 10,1223-1233.

Wong, P. G., Glozak, M. A., Cao, T. V., Vaziri, C., Seto, E. and Alexandrow, M.(2010). Chromatin unfolding by Cdt1 regulates MCM loading via opposingfunctions of HBO1 and HDAC11-geminin. Cell Cycle 9, 4351-4363.

Zhu, X., Singh, N., Donnelly, C., Boimel, P. and Elefant, F. (2007). The cloningand characterization of the histone acetyltransferase human homologDmel\TIP60 in Drosophila melanogaster: Dmel\TIP60 is essential for multicellulardevelopment. Genetics 175, 1229-1240.

DEVELO

PMENT

development 139, 3880-3890 (2012) doi:10.1242/dev.083576 ... 2012.pdfchromatin immunoprecipitation...

Documents