igem 2004 review

Click here to load reader

Download iGem 2004 review

Post on 30-Jan-2016

16 views

Category:

Documents

0 download

Embed Size (px)

DESCRIPTION

iGem 2004 review. S ignificant differences between initial and final design. 0. 0. 1. 0. 0. 0. 0. 1. 1. 0. Int 1. Xis 1. Int 2. Xis 3. Int 2. Xis 2. Initial design. PLtetO. rbs. xis2. attB. rbs. gfp. attP*. t0. rbs. int2*. Final design. - PowerPoint PPT Presentation

TRANSCRIPT

Slide 1Initial design
Final design
Int1
0
0
Xis1
Int2
Xis2
Int2
Xis3
1
1
0
0
0
0
0
1
etc. . . .
Race condition problems between each Int and Xis:
Ordering of signal arrival for an input is critical for correct behavior
Possible erroneous outputs caused by latency?
Design 1. Slide 59
AttR
Term
AttL*
4
AttR
Term
AttL*
Design 2. Slide 9: pulse 1a:0,2a:YFP,1b: GFP,2b:0
Design 3. Slide 11: 1a:0, 2a: 0, 1b: YFP, 2b: GFP
P22 Xis +AAV
These[1] were synthesized, all now Bio-bricks. However, they were not completed by the time of the presentation. Work shown in the following slides indicates that this design will not work.
P22 Xis +AAV
p22 Half Bit
[1] Differ slightly from design as described. Pulse 1a: P22 expressed, no signal, flip bit 2 to make terminator and L, R sites. Pulse 2a: alpha intergrase expressed, no signal, flip bit 1 to make no terminator and L, R sites. Pulse 1b: express p22 int and xis, yfp, flip bit 2 to make no terminator and P, B sites. Pulse 2b: express alpha int and xis, GFP, flip 1 to make terminator and P, B (back to initial state).
[2] Means B*?
λ Xis +AAV
GFP
AttP
AttB*
Design 4 / Test . Slide 13: Turn green when terminator in reverse position?
Design 3. Doesn’t work. 1. Can’t read through attP. 2. Cloning problem in Int construct. 3. Overlaps (between attP & end of Int, and beginning of Int & end of Xis).
Int
Xis
IPTG
Ara
GFP
AttP
AttB*
Int
Xis
IPTG
Ara
Start with a simpler one color system that will turn green when the terminator is in the reverse position
12
“Description has that system will green when terminator is in
the reverse position,” though this not clearly depicted.
Xis
Int
attP
attB*
origin
Kan
T0
GFP_AAV
PLlacO
PLtetO
Not designed?
- Lutz-Bujard vector systems PLtetO and PLlacO
Lutz and Bujard, Nuc. Acids Res., 1997, Vol. 25, No. 6 1203-1210
Start with a simpler one color system that will turn green when the terminator is in the reverse position
13
Xis
Int
PLlacO
PLtetO
GFP_AAV
attP
attB*
origin
Kan
dh5aZ1
Beginning of Int and
40 amino acids [1]
Overlap [2]
Cloning problem near
PLlacO in lambda
- Lutz-Bujard vector systems PLtetO and PLlacO
- Lutz and Bujard, Nuc. Acids Res., 1997, Vol. 25, No. 6 1203-1210
14
Seems that one clear problem with reading through att site
GFP_AAV
attP
attB*
PLtetO
GFP_AAV
PLtetO
- Lutz-Bujard vector systems PLtetO and PLlacO
- Lutz and Bujard, Nuc. Acids Res., 1997, Vol. 25, No. 6 1203-1210
15
Reasons for difference not clear.
For test, extrapolate that 2/3 won’t work : can’t have AttP before reporter
Lots of additional points:
Mutagenize erroneous AttP site on int to eliminate overlaps?
Question : is there enough int? What?
How to measure levels of xis and int? Why?
Int binding block read-through?
Need a new strain? Associated between E. Coli genome attB and construct P site?
Consider Gateway system (design 5 informed by this)
AttB sites can be read through only if RBS is after AttB1
AttR
Term
AttL*
Pulse 1
Pulse 2
Start with a simpler one color system that will turn green when the terminator is in the reverse position
Gateway
Promoter – rbs – Fusion – attB1 – gene of interest – attB2
Promoter – attB1 – rbs – gene of interest – attB2 – Fusion
attB1 and attB2 can be read through with no stop codons but the ribosome binding site (Shine Delgarno) must be included after the attB1 if a native start is required
16
B* site, rather than attP?
Again, why inverting
- Lutz-Bujard vector systems PLtetO and PLlacO
- Lutz and Bujard, Nuc. Acids Res., 1997, Vol. 25, No. 6 1203-1210
17
How to measure levels?
Int binding blocks read-thru?
- Lutz-Bujard vector systems PLtetO and PLlacO
- Lutz and Bujard, Nuc. Acids Res., 1997, Vol. 25, No. 6 1203-1210
18
Gateway [1] uses three methods
Promoter – attB1 – rbs – gene of interest – attB2
Promoter – rbs – Fusion – attB1 – gene of interest – attB2
Promoter – attB1 – rbs – gene of interest – attB2 – Fusion
[1] http://www.bioresearchonline.com/article.mvc/GATEWAY-Cloning-TechnologyA-Universal-Cloning-0001
- Lutz-Bujard vector systems PLtetO and PLlacO
- Lutz and Bujard, Nuc. Acids Res., 1997, Vol. 25, No. 6 1203-1210
19
Gateway [1] uses three methods
Promoter – attB1 – rbs – gene of interest – attB2
Promoter – rbs – Fusion – attB1 – gene of interest – attB2
Promoter – attB1 – rbs – gene of interest – attB2 – Fusion
PLlacO
Xis-attB-GFP junction. want to make a protein across the junction
GFP-attP-terminator
We want the attP and a transcriptional terminator to follow the GFP
- Lutz-Bujard vector systems PLtetO and PLlacO
- Lutz and Bujard, Nuc. Acids Res., 1997, Vol. 25, No. 6 1203-1210
20
Reasons for difference not clear.
Design 4: Xis-attB-GFP junction (make a protein across the junction) and GFP-attP-terminator
Term
GFP
AttP
AttB*
What was done with overlaps?
Is there enough int?
Int binding read-through?
What is the right strain?
*int 58 aa coding region to allow GFP in same operon; why?
Start with a simpler one color system that will turn green when the terminator is in the reverse position
Gateway
Promoter – rbs – Fusion – attB1 – gene of interest – attB2
Promoter – attB1 – rbs – gene of interest – attB2 – Fusion
attB1 and attB2 can be read through with no stop codons but the ribosome binding site (Shine Delgarno) must be included after the attB1 if a native start is required
21
xis
attB
rbs
gfp
attP*
rbs
PLtetO
rbs
int*
--H--D--K--L--I--T--Q--R--I--R--N--A--K--V--V--K--E--A--A--Y--A--*--
ttcatgacaagctaataacgcagcgcattcgtaatgcgaaggtcgttaaggaggcagcctatgcgtaagga
attB
rbs
t0
PLtetO: Lambda phage promoter with tet operator sites acting as repressive elements
rbs:Ribosome binding sites (Shine Delgarno) TAAGGAGG is complementary to 16S rRNA
attB/attB1: Phage P22 attachment site in host (capital letters are the Gateway l attB1)
xis: Phage P22 excisionase
int*: 58 aa coding region to allow GFP in same operon. Corresponds to first 41 aa of Int.
22
t0: Bacteriophage lambda transcriptional terminator
23
l xis
l attB1
K--A--K--S--*--*-- M—R—K—G-
-R--R--S--H—N—N—K—F—V—Q—K—S—R—L—R—R—Q—A--Y—A--*
AAGGCGAAGTCAtaataACAAGTTTGTACAAAAAAGCAGGCTaaggaggcaggcctatgcgtaagga
attB1
rbs
t0
rbs
PLtetO: Lambda phage promoter with tet operator sites acting as repressive elements
rbs:Ribosome binding sites (Shine Delgarno) TAAGGAGG is complementary to 16S rRNA
attB1: Phage l attachment site attB1 from Gateway (BOB’)
xis: Phage P22 excisionase
int*: 58 aa coding region to allow GFP in same operon. Corresponds to first 41 aa of Int.
24
rbs
PLtetO
rbs
int*
t0
rbs
attP: Phage integrase sites from phage l modified by Gateway (p’op)
t0: Bacteriophage lambda transcriptional terminator
25