locus report mfalpha1 , saccharomyces cerevisiae · 2013. 10. 1. · locus report mfalpha1 ,...

16
Locus Report MFALPHA1 , Saccharomyces cerevisiae https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/pageview.cgi?view=LocusReportFull&gene_acc=GN000002401[10/1/2013 1:25:44 PM] Introduction Description Mating factor alpha 1, a form of the mating pheromone alpha-factor that is identical or nearly identical to the two forms of alpha-factor encoded by MFALPHA2 Synonyms P2209; YPL187W; MFALPHA1; pheromone-alpha factor Gene Ontology what is this? Molecular function jump to free-text details pheromone activity [E] details Biological process agglutination involved in conjugation with cellular fusion [E], calcium-mediated signaling [E], cell cycle arrest [E], cell morphogenesis [E]... details Cellular component jump to free-text details extracellular region [E] details Expression what is this? Regulation of MFALPHA1 expression jump to free-text details Load in Pathfinder logout h Locus Report - Saccharomyces cerevisiae MFALPHA1 Table of Contents

Upload: others

Post on 08-Sep-2020

23 views

Category:

Documents


0 download

TRANSCRIPT

  • Locus Report MFALPHA1 , Saccharomyces cerevisiae

    https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/pageview.cgi?view=LocusReportFull&gene_acc=GN000002401[10/1/2013 1:25:44 PM]

    Introduction

    Description

    Mating factor alpha 1, a form of the mating pheromone alpha-factor that is identical or nearlyidentical to the two forms of alpha-factor encoded by MFALPHA2

    Synonyms

    P2209; YPL187W; MFALPHA1; pheromone-alpha factor

    Gene Ontology what is this?

    Molecular function jump to free-text details

    pheromone activity [E] details

    Biological process

    agglutination involved in conjugation with cellular fusion [E], calcium-mediated signaling [E], cellcycle arrest [E], cell morphogenesis [E]... details

    Cellular component jump to free-text details

    extracellular region [E] details

    Expression what is this?

    Regulation of MFALPHA1 expression jump to free-text details

    Load in Pathfinder

    logout h Locus Report - Saccharomyces cerevisiae

    MFALPHA1Table of Contents

    https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/help.cgi?src=gene_ontologyhttps://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/pageview.cgi?view=Popup&poptype=popGOMF&protein_acc=PR000004923https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/pageview.cgi?view=Popup&poptype=popGOBP&protein_acc=PR000004923https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/pageview.cgi?view=Popup&poptype=popGOCC&protein_acc=PR000004923https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/help.cgi?src=expressionjavascript: BKLPathfinder('/cgi-bin/build_ghptywl/idb/1.0/transpath/7.4/bin/graph.cgi?style=HMAP&out=text%2Fhtml&format=HTML&id=PR000004923&db=TP&hideb=on&dstup1=2&dstdown1=2&rng=GENR','PR000004923', '/cgi-bin/build_ghptywl/idb/1.0', '/build_ghptywl/idb/1.0/html', '/cgi-bin/build_ghptywl/idb/1.0/transpath/7.4',0);javascript: BKLPathfinder('/cgi-bin/build_ghptywl/idb/1.0/transpath/7.4/bin/graph.cgi?style=HMAP&out=text%2Fhtml&format=HTML&id=PR000004923&db=TP&hideb=on&dstup1=2&dstdown1=2&rng=GENR','PR000004923', '/cgi-bin/build_ghptywl/idb/1.0', '/build_ghptywl/idb/1.0/html', '/cgi-bin/build_ghptywl/idb/1.0/transpath/7.4',0);https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/pageview.cgi?view=Logouthttps://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/searchengine/start.cgi

  • Locus Report MFALPHA1 , Saccharomyces cerevisiae

    https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/pageview.cgi?view=LocusReportFull&gene_acc=GN000002401[10/1/2013 1:25:44 PM]

    Treatments or conditions that influence MFALPHA1 expression (1 entry)

    Physiological changes that influence MFALPHA1 expression (1 entry)

    Proteins, complexes, or pathways that influence MFALPHA1 expression (6 entries)

    View transcription profile experiments measuring relative MFALPHA1

    Show 5 entries

    Search:

    Showing 1 to 1 of 1 entries

    a factor Upregulated by

    Regulator details Effect

    First Previous 1 Next Last

    Show 5 entries

    Search:

    Showing 1 to 1 of 1 entries

    Mat alpha Upregulated by

    Regulator details Effect

    First Previous 1 Next Last

    Show 5 entries

    Search:

    Showing 1 to 5 of 6 entries

    Gal11pp Upregulated by

    Matalpha1pp Upregulated by

    Mcm1pp Upregulated by

    Sin4pp Upregulated by

    Spt14p Upregulated by

    Regulator details Effect

    First Previous 1 2 Next Last

    https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/pageview.cgi?view=GeneRegulatorPopup&gene_acc=GN000002401#Treatmenthttps://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/pageview.cgi?view=GeneRegulatorPopup&gene_acc=GN000002401#Physiologicalhttps://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/pageview.cgi?view=LocusReportFull&protein_acc=PR000007995#protein_sectionhttps://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/pageview.cgi?view=LocusReportFull&protein_acc=PR000029477#protein_sectionhttps://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/pageview.cgi?view=LocusReportFull&protein_acc=PR000007895#protein_sectionhttps://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/pageview.cgi?view=LocusReportFull&protein_acc=PR000007919#protein_sectionhttps://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/pageview.cgi?view=LocusReportFull&protein_acc=PR000036027#protein_sectionhttps://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/pageview.cgi?view=GeneRegulatorPopup&gene_acc=GN000002401#Regulator

  • Locus Report MFALPHA1 , Saccharomyces cerevisiae

    https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/pageview.cgi?view=LocusReportFull&gene_acc=GN000002401[10/1/2013 1:25:44 PM]

    expression

    - Cell Cycle (Mitosis and Meiosis)

    + Development/Differentiation

    + Cell-type Specific Expression

    + Signal Transduction Pathways

    + Metabolism and Nutrient Response

    + Stress/Environmental Response

    + Small Molecule Response (Metals, Ions)

    + Drug Response

    Show 5 entries Search:

    Showing 1 to 5 of 24 entries

    Cell cycle (alpha factor arrest

    and release)

    PMID: 9843569

    Cell cycle (cdc15 arrest and

    release)

    PMID: 9843569

    Cell cycle (cell size selection

    and release)

    PMID: 9843569

    Expression during the cell

    cycle - cdc28-13 arrest and

    release

    PMID: 9702192

    Meiosis and sporulation -

    Time course of expression

    during meiosis and

    sporulation

    PMID: 9784122

    EFFECT EXPERIMENT REFERENCE

    First Previous 1 2 3 4 5 Next Last

    https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/pageview.cgi?view=displayexp&assay_no=23&gene_no=5521http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=9843569&dopt=Citationhttps://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/pageview.cgi?view=displayexp&assay_no=25&gene_no=5521http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=9843569&dopt=Citationhttps://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/pageview.cgi?view=displayexp&assay_no=28&gene_no=5521http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=9843569&dopt=Citationhttps://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/pageview.cgi?view=displayexp&assay_no=10&gene_no=5521http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=9702192&dopt=Citationhttps://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/pageview.cgi?view=displayexp&assay_no=32&gene_no=5521http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=9784122&dopt=Citation

  • Locus Report MFALPHA1 , Saccharomyces cerevisiae

    https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/pageview.cgi?view=LocusReportFull&gene_acc=GN000002401[10/1/2013 1:25:44 PM]

    + Chromosome Structure

    + Core Transcriptional Apparatus

    + Transcription Factors

    + Gene Deletions, Disruptions or Mutations

    + Gene Overexpression

    + Other

    View probeset expression values in Nebion’s Genevestigator application

    Mutant Phenotype what is this?

    Phenotypic effects of mutation of MFALPHA1 jump to free-text details

    View Saccharomyces Cerevisiae Morphological Database entry

    Viability : Null Viable

    Show 5 entries

    Search:

    Showing 1 to 4 of 4 entries

    Altered sensitivity to drugs or

    other compounds

    Null

    Decreased mating Unspecified

    mutation type

    Mating factor production or

    secretion defective

    Null

    Mating factor production or

    secretion defective

    Unspecified

    mutation type

    Phenotypic effectdetails Mutation type

    First Previous 1 Next Last

    https://www.genevestigator.com/gv/directlink.jsp?geneIDs=Z73543&geneIDType=SGD_accession_numberhttps://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/help.cgi?src=mutant_phenotypehttp://scmd.gi.k.u-tokyo.ac.jp/datamine/ViewPhoto.do?orf=YPL187Whttps://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/pageview.cgi?view=mutph_popup&protein_acc=PR000004923

  • Locus Report MFALPHA1 , Saccharomyces cerevisiae

    https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/pageview.cgi?view=LocusReportFull&gene_acc=GN000002401[10/1/2013 1:25:44 PM]

    Pathways & Interactions what is this?

    Protein-protein interactions jump to free-text details

    Events triggered by MFALPHA1

    Genes regulated (directly or indirectly) by MFALPHA1

    Transcriptional Regulation what is this?

    Regulation of MFALPHA1 gene expression

    Chromosome : XVI

    Show 5 entries

    Search:

    Showing 1 to 5 of 6 entries

    Erv29p coimmunoprecipitation

    Kar2pp coimmunoprecipitation

    Mfalpha1p coimmunoprecipitation

    Sec61p split-ubiquitin assay

    Sec62pp

    Protein details Method

    First Previous 1 2 Next Last

    Show 5 entries

    Search:

    Showing 1 to 1 of 1 entries

    PRM1(y) Upregulated by

    Gene details Effect

    First Previous 1 Next Last

    https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/help.cgi?src=protein_pathwayshttps://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/help.cgi?src=gene_regulation_activityhttps://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/pageview.cgi?view=LocusReportFull&protein_acc=PR000037505#protein_sectionhttps://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/pageview.cgi?view=LocusReportFull&protein_acc=PR000683040#protein_sectionhttps://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/pageview.cgi?view=LocusReportFull&protein_acc=PR000004923#protein_sectionhttps://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/pageview.cgi?view=LocusReportFull&protein_acc=PR000035862#protein_sectionhttps://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/pageview.cgi?view=LocusReportFull&protein_acc=PR000304537#protein_sectionhttps://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/pageview.cgi?view=ProteinAssociationsPopup&protein_acc=PR000004923https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/pageview.cgi?view=LocusReportFull&gene_acc=GN000025805#gene_generalhttps://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/pageview.cgi?view=ProteinRegulatorPopup&protein_acc=PR000004923

  • Locus Report MFALPHA1 , Saccharomyces cerevisiae

    https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/pageview.cgi?view=LocusReportFull&gene_acc=GN000002401[10/1/2013 1:25:44 PM]

    -400 -300 -200 -100 0 100Start

    * Note: Only binding sites whose location is relative to the TSS are graphically displayed.

    Transcription factor binding sites within the MFALPHA1 gene (5 entries)

    Protein Features what is this?

    Overview of protein sequence and structure

    Chromosome : XVI

    Family membership : Secreted

    + View associated sequences and their domains jump to free-text details

    + View related proteins

    + View related protein structure at PDB

    Functional complementation :

    Alpha factor interacts with a receptor on plant fungal pathogen Magnaporthe grisea and preventsdevelopment of the appressorium, a structure required for virulence 99

    Show 5 entries Search:

    Showing 1 to 5 of 5 entries

    Y$MFAL1_01 -482 to -458 * Mcm1p(y) Mcm1p(y) -->

    MF(ALPHA)1(y)

    DNA binding

    Y$MFAL1_02 -368 to -339 * Mcm1p(y) Mcm1p(y) -->

    MF(ALPHA)1(y)

    DNA binding

    Y$MFAL1_03 -318 to -287 * Mcm1p(y) Mcm1p(y) -->

    MF(ALPHA)1(y)

    DNA binding

    Y$MFAL1_03 -318 to -287 * Matalpha1p(y) Matalpha1p(y) -->

    MF(ALPHA)1(y)

    DNA binding

    Y$MFAL1_04 -316 to -287 * Mcm1p(y) Mcm1p(y) -->

    MF(ALPHA)1(y)

    DNA binding

    Identifier LocationBindingFactor(s)

    DNA BindingReaction Effect

    First Previous 1 Next Last

    https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/help.cgi?src=isoformshttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=9148806&dopt=Citationhttps://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/pageview.cgi?view=SiteReport&site_acc=R01045https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/pageview.cgi?view=LocusReportFull&protein_acc=PR000007895#protein_sectionhttps://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/pageview.cgi?view=SiteReport&site_acc=R01046https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/pageview.cgi?view=LocusReportFull&protein_acc=PR000007895#protein_sectionhttps://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/pageview.cgi?view=SiteReport&site_acc=R01047https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/pageview.cgi?view=LocusReportFull&protein_acc=PR000007895#protein_sectionhttps://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/pageview.cgi?view=SiteReport&site_acc=R01047https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/pageview.cgi?view=LocusReportFull&protein_acc=PR000029477#protein_sectionhttps://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/pageview.cgi?view=SiteReport&site_acc=R01901https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/pageview.cgi?view=LocusReportFull&protein_acc=PR000007895#protein_section

  • Locus Report MFALPHA1 , Saccharomyces cerevisiae

    https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/pageview.cgi?view=LocusReportFull&gene_acc=GN000002401[10/1/2013 1:25:44 PM]

    Expression of alfalfa cycMs3, a B-type cyclin, can overcome pheromone-induced cell cycle arrest113

    Extracts from MATalpha cells that produce Sordaria macrospora PPG1 cause a pheromoneresponse (cell cycle arrest and gene activation) in a MATa ste2 null sst2-1 double mutant thatproduces S. macrospora PRE2 21Heterologously produced prepro-alpha factor is transported through the ER to the Golgiapparatus in permeabilized S. pombe, where it becomes glycosylated with galactose 154One of over 700 genes upregulated 1.5 fold or greater following overproduction of Slf1p 3Peptide GYFSYPHGNLF from Glomerella cingulata does not cause cell-cycle arrest, although itshows sequence similarity to Mfalpha1p and Mfalpha2p 49Secretion signal directs secretion of a heterologous protein produced in Pichia pastoris 41Synthetic pheromone (a undecapeptide, the sequence of which is derived from Sordariamacrospora PPG1) causes a pheromone response (shmoo formation) in a MATa ste2 null sst2-1double mutant that produces S. macrospora PRE2 21

    View GPMDB (Mass Spec Database)

    View PhosphoPep Database

    View Phylome DB (Phylogenetic Database)

    Identifiers what is this?

    Accessions mapped to this record

    BIOBASE gene accession : GN000002401, G000952, MO000028988

    View SGD Report

    BIOBASE protein accession : PR000004923

    Search NCBI Entrez

    Gene

    EntrezGene 855914

    Genbank

    1370390 , 171941 , 171942 , 171944 , 341104 , 3938 , 3947 ,

    395386 , J01340 , M17301 , M24080 , M55016 , X01581 , X15154 ,

    X66498 , Z73543

    Pfam PF05522

    SGD S000006108

    Protein

    1197054 , 1326044 , 1370391 , 171943 , 171945 , 3939 , 395387 ,

    http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=7647566&dopt=Citationhttps://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000022445https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000020680https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000002427https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000023134https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000022460http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=15821126&dopt=Citationhttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=1497669&dopt=Citationhttps://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000023005http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=22271760&dopt=Citationhttps://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000002401https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000002402http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=12007806&dopt=Citationhttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=12359089&dopt=Citationhttps://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000022445https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000020680https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000002427https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000023134https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000022460http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=15821126&dopt=Citationhttp://gpmdb.rockefeller.edu/thegpm-cgi/dblist_label.pl?label=YPL187Whttp://www.sbeams.org/dev1/sbeams/cgi/Glycopeptide/peptideSearch.cgi?action=Show_hits_form&search_type=accession&organism=sce&search_term=YPL187Whttp://phylomedb.org/?seqid=YPL187Whttps://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/help.cgi?src=external_identifierhttp://www.yeastgenome.org/cgi-bin/locus.fpl?locus=YPL187Whttp://www.ncbi.nlm.nih.gov/gquery/gquery.fcgi?&term=%28MFALPHA1[TEXT:noexp]%20AND%20cerevisiae[ALL]%29http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=gene&cmd=Retrieve&dopt=Graphics&list_uids=855914http://www.ncbi.nlm.nih.gov/nuccore/1370390http://www.ncbi.nlm.nih.gov/nuccore/171941http://www.ncbi.nlm.nih.gov/nuccore/171942http://www.ncbi.nlm.nih.gov/nuccore/171944http://www.ncbi.nlm.nih.gov/nuccore/341104http://www.ncbi.nlm.nih.gov/nuccore/3938http://www.ncbi.nlm.nih.gov/nuccore/3947http://www.ncbi.nlm.nih.gov/nuccore/395386http://www.ncbi.nlm.nih.gov/nuccore/J01340http://www.ncbi.nlm.nih.gov/nuccore/M17301http://www.ncbi.nlm.nih.gov/nuccore/M24080http://www.ncbi.nlm.nih.gov/nuccore/M55016http://www.ncbi.nlm.nih.gov/nuccore/X01581http://www.ncbi.nlm.nih.gov/nuccore/X15154http://www.ncbi.nlm.nih.gov/nuccore/X66498http://www.ncbi.nlm.nih.gov/nuccore/Z73543http://pfam.janelia.org/family?entry=PF05522http://db.yeastgenome.org/cgi-bin/locus.pl?sgdid=S000006108http://www.ncbi.nlm.nih.gov/protein/1197054http://www.ncbi.nlm.nih.gov/protein/1326044http://www.ncbi.nlm.nih.gov/protein/1370391http://www.ncbi.nlm.nih.gov/protein/171943http://www.ncbi.nlm.nih.gov/protein/171945http://www.ncbi.nlm.nih.gov/protein/3939http://www.ncbi.nlm.nih.gov/protein/395387

  • Locus Report MFALPHA1 , Saccharomyces cerevisiae

    https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/pageview.cgi?view=LocusReportFull&gene_acc=GN000002401[10/1/2013 1:25:44 PM]

    Genbank

    4388545 , 493497 , AAA18405.1 , AAA34777.1 , AAA34778.1 ,

    AAA88727.1 , CAA25734.1 , CAA25735.1 , CAA33248.1 , CAA47120.1 ,

    CAA97899.1

    Pfam PF05436

    UniProt P01149

    Annotations what is this?Display all annotations

    Description

    Mating factor alpha 1, a form of the mating pheromone alpha-factor that is identical or nearlyidentical to the two forms of alpha-factor encoded by MFALPHA2

    Editor's Notes

    MFalpha1 (pheromone-alpha factor)MFalpha1 and MFalpha2 are similar in domain organization, each containing an N-terminal signal,then a pro region, then tandem alpha-factor repeats with each repeat preceded by a short spacerregion [see 147 ]MFalpha1 contains four tandem and identical C-terminal alpha-factor repeats, whereas MFalpha2contains two tandem repeats, the first having a variant sequence (Asn5,Arg7) which is calledalpha-factor' [see 147 ]MFALPHA1 encodes a precursor polypeptide that is processed to produce four mature alpha-factor peptides of the sequence WHWLQLKPGQPMY, which are all identical to one of the twoalpha-factor peptides encoded by MFALPHA2

    Under normal conditions nearly all alpha-factor is produced from the MFalpha1 precursor, withnegligible production detectable of the variant (Asn5,Arg7) alpha-factor' produced from theMFalpha2 precursor [see 147 ]

    Function jump to controlled vocabulary summary

    Activation of FUS1-LacZ reporter gene transcription in a ste5 null mutant is disrupted byintroduction of ste5 -[delta48-67], ste5 -[delta152-173], ste5 -[delta169-171], ste5 -[C180A],ste5-NLSo , or ste5-NLSb mutations, but not a ste5-NLSm mutation 18Activation of Fus3p is reduced by approximately four-fold in a bni1 null mutant, while Kss1p

    http://www.ncbi.nlm.nih.gov/protein/4388545http://www.ncbi.nlm.nih.gov/protein/493497http://www.ncbi.nlm.nih.gov/protein/AAA18405.1http://www.ncbi.nlm.nih.gov/protein/AAA34777.1http://www.ncbi.nlm.nih.gov/protein/AAA34778.1http://www.ncbi.nlm.nih.gov/protein/AAA88727.1http://www.ncbi.nlm.nih.gov/protein/CAA25734.1http://www.ncbi.nlm.nih.gov/protein/CAA25735.1http://www.ncbi.nlm.nih.gov/protein/CAA33248.1http://www.ncbi.nlm.nih.gov/protein/CAA47120.1http://www.ncbi.nlm.nih.gov/protein/CAA97899.1http://pfam.janelia.org/family?entry=PF05436http://www.uniprot.org/uniprot/P01149https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/help.cgi?src=annotationsjavascript:void(0);https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000002402https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000002401https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000002401https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000002401https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000002401https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000002402http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=2004704&dopt=Citationhttps://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000002401https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000002401https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000002402http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=2004704&dopt=Citationhttps://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000002401https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000002401https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000002402https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000002401https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000002402http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=2004704&dopt=Citationhttps://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000003893https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000023149https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000023149https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000023149https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000023149https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000023149https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000023149https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000023149https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000023149http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=16209942&dopt=Citationhttps://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000021580https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000021130https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000021882

  • Locus Report MFALPHA1 , Saccharomyces cerevisiae

    https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/pageview.cgi?view=LocusReportFull&gene_acc=GN000002401[10/1/2013 1:25:44 PM]

    activity is only slightly reduced 20Addition of high concentrations of alpha-factor (Mfalpha1p , Mfalpha2p) to MATa cells causesinduction of programmed cell death, which requires Ste20p , cytochrome c (Cyc1p , Cyc7p),mitochondrial function, transition pore permeability, and protein synthesis 52Addition to cells before beginning of glycogen accumulation leads to a complete block in glycogensynthesis 149Addition to fus3 mutants does not cause inhibition of glycogen accumulation 149

    more

    Transcript Information

    MRNA has a half-life of 5 min 144

    Catalytic activity

    Analysis of ability of synthetic alpha-factor analogs to induce morphogenesis and agglutinabilityof a cells 118Kd for binding of Bpa (4-benzoyl-L-phenylalanine) alpha factor by Ste2p is 200 nM 51Kinetics of alpha-actor induction of cell-division arrest, agglutination and shmoo formation119

    Pathway

    15 to 30 minutes following pheromone treatment Fus3p activity is increased five-fold relative tonon-inducing conditions, after which the activity of Fus3p declines due to adaptation of cells topersistent stimulus 45Alpha-factor induced cell signaling is modulated by the deubiquitination and destabilization ofSte7p by Ubp3p 53Alpha-factor induced growth arrest is increased five-fold, alpha-factor induced phosphorylation ofSte7p and Ste4p , and alpha-factor induced gene expression is increased 1.7-fold in a ubp3 nullmutant relative to wild-type cells 53Alpha-factor stimulates the high affinity calcium influx system (HACS) in the absence ofcalcineurin (Cna1p-Cnb1p-Cmp1p) 55Cdc39p and Cdc36p function in the pheromone response pathway after Ste2p and before or inconjunction with Ste4p and Ste18p and both appear to be negative regulators of the pathway

    145

    more

    http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=15961405&dopt=Citationhttps://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000002401https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000002402https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000020680https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000023145https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000000019https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000000020http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=11937036&dopt=Citationhttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=1901058&dopt=Citationhttps://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000021580http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=1901058&dopt=Citationjavascript:void(0);http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=2183028&dopt=Citationhttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=6373738&dopt=Citationhttps://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000002427http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=11994008&dopt=Citationhttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=6358212&dopt=Citationhttps://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000021580https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000021580http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=12077316&dopt=Citationhttps://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000023151https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000023315http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=11864977&dopt=Citationhttps://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000023151https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000023148https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000023315http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=11864977&dopt=Citationhttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=11779794&dopt=Citationhttps://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000153932https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000153932https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000153931https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000002427https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000023148https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000023144http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=2099190&dopt=Citationjavascript:void(0);

  • Locus Report MFALPHA1 , Saccharomyces cerevisiae

    https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/pageview.cgi?view=LocusReportFull&gene_acc=GN000002401[10/1/2013 1:25:44 PM]

    Related to

    Alpha-factor has structural similarity to S. pombe P factor mating response pheromone 108Has 38% identity to a protein found in closely-related yeast Y. lipolytica 68Has 48% identity to a protein found in closely-related yeast K. lactis 68Has 58% identity to a protein found in closely-related yeast S. exiguus 68Has 65% identity to a protein found in closely-related yeast Z. rouxii 68

    more

    Mutant phenotype jump to controlled vocabulary summary

    All single, double and triple combinations of the mfalpha1-[N25A], -[N59A], and [N69A]mutations, which remove the N-glycosylation sites, cause slow transport of pro-alpha factorbefore outer chain glycosylation and before the first proteolytic step in processing 148All single, double and triple combinations of the mfalpha1 -[N25A], -[N59A], and [N69A]mutations, which remove the N-glycosylation sites, results in intracellular accumulation ofMFalpha1 precursors which are core glycosylated but are missing outer chain carbohydrates

    148Alpha factor analogs containing Bpa (4-benzoyl-L-phenylalanine) and iodotyrosine activate Ste2prelatively well as compared to wild type 51Alpha-factor analog WHWLQLK[(R)-gamma-lactam]QP[Nle]Y is as active as the [Nle12]-alpha-factor control in growth arrest and gene induction assays 96Alpha-factor analog WHWLQLK[(R)-gamma-lactam]QP[Nle]Y is more active than itsdiastereomeric homolog WHWLQLK[(S)-gamma-lactam]QP[Nle]Y in growth arrest and geneinduction assays 96

    more

    Functional complementation

    Alpha factor interacts with a receptor on plant fungal pathogen Magnaporthe grisea and preventsdevelopment of the appressorium, a structure required for virulence 99Expression of alfalfa cycMs3, a B-type cyclin, can overcome pheromone-induced cell cycle arrest113

    Extracts from MATalpha cells that produce Sordaria macrospora PPG1 cause a pheromoneresponse (cell cycle arrest and gene activation) in a MATa ste2 null sst2-1 double mutant thatproduces S. macrospora PRE2 21Heterologously produced prepro-alpha factor is transported through the ER to the Golgiapparatus in permeabilized S. pombe, where it becomes glycosylated with galactose 154One of over 700 genes upregulated 1.5 fold or greater following overproduction of Slf1p 3

    more

    http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=8314086&dopt=Citationhttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=11152894&dopt=Citationhttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=11152894&dopt=Citationhttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=11152894&dopt=Citationhttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=11152894&dopt=Citationjavascript:void(0);http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=1987155&dopt=Citationhttps://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000002401https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000002401http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=1987155&dopt=Citationhttps://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000002427http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=11994008&dopt=Citationhttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=9730819&dopt=Citationhttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=9730819&dopt=Citationjavascript:void(0);http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=9148806&dopt=Citationhttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=7647566&dopt=Citationhttps://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000022445https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000020680https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000002427https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000023134https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000022460http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=15821126&dopt=Citationhttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=1497669&dopt=Citationhttps://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000023005http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=22271760&dopt=Citationjavascript:void(0);

  • Locus Report MFALPHA1 , Saccharomyces cerevisiae

    https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/pageview.cgi?view=LocusReportFull&gene_acc=GN000002401[10/1/2013 1:25:44 PM]

    Overproduction jump to controlled vocabulary summary

    Overproduction of either Ste3p or Mfalpha1p alone does not restore mating to matalpha1 nullmutant, but overproduction of Ste3p and Mfalpha1p together restores mating to wild-type level

    139Overproduction of Mfalpha1p leads to a four-fold delay in ER export of glycosylated pro-alphafactor (Mfalpha1p , Mfalpha2p) and a 1.3-fold delay in ER export of Prc1p , while no change inexport rate is detected for Gas1p and Pho8p 57

    Genetic interactions

    Addition of high concentrations of alpha-factor (Mfalpha1p , Mfalpha2p) to a cyc1 cyc7 MATadouble mutant results in accumulation of reactive oxygen species, but the cells do not undergoprogrammed cell death, indicating that cytochrome c is required for the cell death response

    52Alpha factor-induced formation of mating projections and rate of recovery from alpha factor isreduced when cells express Ste2p mutant protein with a deletion of C-terminal 105 residues

    105Alpha pheromone (MFALPHA1 , MFALPHA2) is constitutively produced in a ste3 mutant [see140 ]

    Asg7 null mutation does not affect alpha-factor (Mfalpha1p , Mfalpha2p) induced cell-cycle arrestin MATa cells 73Bar1 null mutant displays normal polarized growth in response to alpha-factor 106

    more

    Physical interactions jump to controlled vocabulary summary

    Alpha factor (Mfalpha1p , Mfalpha2p)-induced transcription of FUS1 is reduced to 50% in a ste2 -[N388S] mutant, which exhibits decreased interaction with Ste4p and Gpa1p , relative to wild-type cells 63Alpha factor analogs with positions 2, 4, 6, 10, and 11 substituted with Bpa (4-benzoyl-L-phenylalanine) bind Ste2p with 100- to 1500-fold decreased affinity as compared to wild type

    51Alpha factor analogs with residues Trp1 , Trp3 , Gln5, Lys7 , Pro8, Met12 , or Tyr13 substitutedwith Bpa (4-benzoyl-L-phenylalanine) bind Ste2p similar to wild type with 4- to 45-folddecreases in affinity 51Alpha factor and alpha-factor analogs with residues 5 to 13 substituted with alanine showdecreased binding affinity for Ste2p -[Y266A] mutant as compared to wild type 39Alpha factor-induced FUS1 expression is reduced in a ste2 -[L102C] or ste2 -[T114C] mutant to

    https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000002428https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000002401https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000020678https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000002428https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000002401http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=2653961&dopt=Citationhttps://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000002401https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000002401https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000002402https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000022456https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000021589https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000002591http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=11711675&dopt=Citationhttps://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000002401https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000002402https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000000019https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000000020https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000020680http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=11937036&dopt=Citationhttps://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000002427http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=8524302&dopt=Citationhttps://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000002401https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000002402https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000002428http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=2257622&dopt=Citationhttps://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000021058https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000021058https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000002401https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000002402https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000020680http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=11073983&dopt=Citationhttps://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000021100https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000021100http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=8397402&dopt=Citationjavascript:void(0);https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000002401https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000002402https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000003893https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000002427https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000023148https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000021649http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=11287148&dopt=Citationhttps://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000002427http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=11994008&dopt=Citationhttps://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000000055https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000023281https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000021925https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000021989https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000002427http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=11994008&dopt=Citationhttps://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000002427http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=12427030&dopt=Citationhttps://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000003893https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000002427https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000002427

  • Locus Report MFALPHA1 , Saccharomyces cerevisiae

    https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/pageview.cgi?view=LocusReportFull&gene_acc=GN000002401[10/1/2013 1:25:44 PM]

    20% of wild type, although pheromone binds to the mutant receptors with wild-type affinity46

    more

    Domains

    Carboxy-terminal amino acids are more important for receptor binding than are other residues,while amino-terminal residues are important for signal transduction 97

    Localization jump to controlled vocabulary summary

    A488-alpha-factor colocalizes with Abp1p and Sla1p to the plasma membrane as spots whichthen disappear upon internalization, indicating receptor-mediated internalization occurs at corticalactin patches 14A594-alpha-factor localizes to endocytic compartments and then to the vacuole, indicatingreceptor-mediated endocytosis 14Cells arrested in early M-phase via mutations in either cdc13 , cdc15 , or cdc20 rapidlyinternalize alpha-factor 151Glycosylated pro-alpha factor (Mfalpha1p , Mfalpha2p) accumulates in the ER in the erv29 nullmutant 57Insertion into microsomes in vitro is completely inhibited by ATP depletion 42

    more

    Maturation

    Accumulation of prepro-alpha factor in the cytoplasm of an lsh1 null mutant that overproducesYol031p occurs to a lesser extent than for the lhs1 null mutant 70After glycosylation processing continues with three proteolytic cleavage steps, first cleavage byKex2p N-terminal to each repeat, which also removes the pro region, then C-terminal trimmingby Kex1p , then N-terminal trimming by Ste13p [see 130 ] 117 [see 148 ]Amount of pseudomature form of alpha factor (Mfalpha1p , Mfalpha2p) secreted by a gga1 gga2double null mutant is significantly greater than wild-type 58Budding efficiency of glycosylated pro-alpha factor from ER-derived vesicles is not altered invesicles from emp24 null mutant cells 82Coexpression of human IGF1 containing an alpha-factor leader with a mutant Kex2p containingan ER retention signal prevents intermolecular disulfide bond formation between IGF1monomers, indicating that the alpha-factor leader may be responsible for disulfide-linkeddimerization 153

    more

    http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=12058045&dopt=Citationjavascript:void(0);http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=9727865&dopt=Citationhttps://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000020926https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000023002https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000000006http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=16574772&dopt=Citationhttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=16574772&dopt=Citationhttps://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000021195https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000021197https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000021199http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=1656226&dopt=Citationhttps://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000002401https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000002402https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000024575http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=11711675&dopt=Citationhttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=12269836&dopt=Citationjavascript:void(0);https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000156221http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=11101517&dopt=Citationhttps://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000021857https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000021856https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000023142http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=3288097&dopt=Citationhttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=6754095&dopt=Citationhttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=1987155&dopt=Citationhttps://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000002401https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000002402https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000024014https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000024657http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=11694590&dopt=Citationhttps://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000021482http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=10704443&dopt=Citationhttps://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000021857http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=1618297&dopt=Citationjavascript:void(0);

  • Locus Report MFALPHA1 , Saccharomyces cerevisiae

    https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/pageview.cgi?view=LocusReportFull&gene_acc=GN000002401[10/1/2013 1:25:44 PM]

    Modifications

    Mutant alpha factor precursors that have three mutated N-glycosylation acceptor sites are O-mannosylated in vivo, whereas wild-type precursor is not 62N-glycosylation of pro-alpha-factor is important but not essential for ER-to Golgi transport or forproteolytic processing, as mutations that ablate the N glycosylation sites result in decreased butnot complete loss of alpha-factor secretion 148O-mannosylation of mutant alpha factor precursors that have three mutated N-glycosylationacceptor sites can be enhanced in an Sec61p-dependent manner in vitro by addition of ATP andcytosol 62O-mannosylation of mutant alpha factor precursors that have three mutated N-glycosylationacceptor sites is Pmt2p-dependent 62Post-translational modification does not require Vps55p 50

    more

    Regulation jump to controlled vocabulary summary

    28 base pair sequence in promoter, GTCTCCCAATGTAGAAAAGTACATCATA, is necessary andsufficient for proper expression patterns in diploid cells 127Alpha-factor secretion is reduced in itc1 null mutant MATalpha cells 35Alpha-specific genes MFALPHA1 , MFALPHA2 , and STE3 are repressed in a MATa strain underanaerobic as well as aerobic conditions, based on microarray experiments using glucose-limitedchemostat cultures 84Alpha1p binds two P'Q elements MFALPHA1 promoter in a complex with Mcm1p , based on DNAfootprinting analysis 128Cell-type specific regulation requires Snf5p 142

    more

    Turnover

    Hydrolyzed by extracellular protease Bar1p [see 106 ]Rate of degradation is delayed in vma2 null mutant 111Rates of internalization and degradation are not altered in ypt52 or ypt53 null mutant 111Ypt51 null mutant does not display a defect in alpha-factor internalization but displays a defect inalpha factor degradation 111Ypt51 ypt52 and ypt51 ypt53 double null mutants display a more severe delay in alpha-factordegradation than ypt51 null mutant 111

    more

    http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=11294909&dopt=Citationhttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=1987155&dopt=Citationhttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=11294909&dopt=Citationhttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=11294909&dopt=Citationhttps://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000024960http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=12006663&dopt=Citationjavascript:void(0);http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=3517864&dopt=Citationhttps://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000024368http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=12624196&dopt=Citationhttps://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000002401https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000002402https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000002428https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000020680http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=10601195&dopt=Citationhttps://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000020678https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000020678https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000002401https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000003956http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=3304657&dopt=Citationhttps://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000156080http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=2233708&dopt=Citationjavascript:void(0);https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000021100http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=8397402&dopt=Citationhttps://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000023363http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=8163546&dopt=Citationhttps://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000026408https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000026409http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=8163546&dopt=Citationhttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=8163546&dopt=Citationhttps://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000023379https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000023379https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000026408https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000023379https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000026409https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000023379http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=8163546&dopt=Citationjavascript:void(0);

  • Locus Report MFALPHA1 , Saccharomyces cerevisiae

    https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/pageview.cgi?view=LocusReportFull&gene_acc=GN000002401[10/1/2013 1:25:44 PM]

    Abundance

    Produced at about 100-fold higher amount than the product of MFALPHA2 136 130 [see126 ]

    Purified

    Synthetic analogs purified 51

    Sequence ref

    Genomic sequence encodes a pre-proprotein containing 4 copies of the mature pheromone117

    Structure

    Productive interaction between alpha factor and the alpha factor receptor requires a bend or turnin alpha factor 96Ste2p residues Ser47 and Thr48 are adjacent to alpha factor residue Gln10 when pheromone isbound to Ste2p 60

    Motif(s)

    Contains a hydrophobic sorting signal that mediates Erv29p-dependent packaging (of glycopro-alpha-factor) into COPII vesicles 22Has a cleavable signal sequence 131Residue Gln10 is required for receptor selectivity 60Residues His2 , Leu4 , Leu6, Pro10, an hydrophobic residue 12, and an aromatic residue 13 ofalpha-factor are important for both Ste2p-agonist and -antagonist activity 102Residues Pro8-Gly9 appear to form a beta-turn that may be important for biological activity [see96 ]

    more

    Drug effects

    https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000002402http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=2685554&dopt=Citationhttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=3288097&dopt=Citationhttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=3887136&dopt=Citationhttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=11994008&dopt=Citationhttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=6754095&dopt=Citationhttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=9730819&dopt=Citationhttps://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000002427https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000002427https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000002427http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=11495900&dopt=Citationhttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=15516922&dopt=Citationhttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=3283123&dopt=Citationhttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=11495900&dopt=Citationhttps://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000021721https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000003936https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?PR000682956http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=8756627&dopt=Citationhttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=9730819&dopt=Citationjavascript:void(0);

  • Locus Report MFALPHA1 , Saccharomyces cerevisiae

    https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/pageview.cgi?view=LocusReportFull&gene_acc=GN000002401[10/1/2013 1:25:44 PM]

    Alpha-factor analog extending from residue 3 to residue 13, and containing a gamma-lactam inthe turn region, has no biological activity and inhibits normal alpha factor function 96Cell wall protrusion formation upon treatment of MAT a cells with alpha mating pheromone isabolished by inhibitors of cell wall synthesis such as 2-deoxy-D-glucose and 2-deoxy-2-fluoro-mannose, but not by polyoxin D, an inhibitor of chitin synthetase 160Cycloheximide inhibits the programmed cell death-like response of MATa cells to highconcentrations of alpha-factor (Mfalpha1p , Mfalpha2p), indicating that protein synthesis isrequired for this response 52Cyclosporin A inhibits the programmed cell death-like response of MATa cells to highconcentrations of alpha-factor (Mfalpha1p , Mfalpha2p) through its effect on the permeabilitytransition pore 52Ethidium bromide destruction of mitochondrial DNA does not inhibit shmooing of MATa cells inresponse to alpha-factor (Mfalpha1p , Mfalpha2p), indicating that mitochondrial functions are notimportant for shmooing 52

    more

    Functional Genomics

    MRNA abundance fluctuates during the cell cycle, peaking in late G1 phase 98MRNA is more abundant in mating type alpha cells than in mating type a cells, as determined byoligonucleotide microarray experiment 94Null mutant, constructed in a systematic high-throughput deletion study, is viable 87One of 103 genes whose transcriptional expression is downregulated in str4 null mutant inresponse to homocysteine and S-adenosyl methionine (SAM), as determined by microarrayanalysis 41

    more

    Other

    Alpha factor is degraded by MATa cells to inactive fragments, with the first cleavage occurringbetween Leu6 and Lys7 164Alpha-factor-stimulated increases in chitin synthetase and glucan synthetase activity areabolished when cells are treated with the protein synthesis inhibitor cycloheximide 158Cdc28 and cyr1 mutants are competent to induce FUS1 in response to alpha-factor 151Conditional silencing of a MFALPHA1-lacZ fusion has been obtained with antisense RNA(complementary to the 5' untranslated region) expressed from vector pSAL4 (in whichtranscription is controlled by Cu2+) but not pYES2 (in which transcription is controlled bygalactose) 15MATa bar1 sst2 cells engineered to express alpha-factor exhibit a self-arrest phenotype 132

    http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=9730819&dopt=Citationhttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=776942&dopt=Citationhttps://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000020680https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000002401https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000002402http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=11937036&dopt=Citationhttps://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000020680https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000002401https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000002402http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=11937036&dopt=Citationhttps://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000020680https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000002401https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000002402http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=11937036&dopt=Citationjavascript:void(0);http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=9702192&dopt=Citationhttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=9788350&dopt=Citationhttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=10436161&dopt=Citationhttps://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000021352http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=21504896&dopt=Citationhttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=23192348&dopt=Citationjavascript:void(0);https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000020680https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000021925http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=391400&dopt=Citationhttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=1386720&dopt=Citationhttps://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000002458https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000002458https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000020870https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000003893http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=1656226&dopt=Citationhttps://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000002401http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=16343443&dopt=Citationhttps://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000020680https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000020680https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000021100https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/get.cgi?GN000023134http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=3067083&dopt=Citation

  • Locus Report MFALPHA1 , Saccharomyces cerevisiae

    https://portal.biobase-international.com/cgi-bin/build_ghptywl/idb/1.0/pageview.cgi?view=LocusReportFull&gene_acc=GN000002401[10/1/2013 1:25:44 PM]

    more

    References (164 entries)Click the Genes in this reference image to view other genes annotated to the reference

    Copyright BIOBASE All rights reserved. Not for distribution.

    Show 5 entries Search:

    Showing 1 to 5 of 164 entries

    1 23192348 Patil, V. A., Fox, J. L., Gohil, V. M., Winge, D. R., Greenberg, M. L., Loss of

    cardiolipin leads to perturbation of mitochondrial and cellular iron

    homeostasis. J Biol Chem 288 (3) 1696-705 (2013).

    Show abstract Genes in this reference

    2 22326528 Wilmes, A., Hanna, R., Heathcott, R. W., Northcote, P. T., Atkinson, P. H.,

    Bellows, D. S., Miller, J. H., Chemical genetic profiling of the microtubule-

    targeting agent peloruside A in budding yeast Saccharomyces cerevisiae.

    Gene 497 (2) 140-6 (2012). Show abstract Genes in this reference

    3 22271760 Schenk, L., Meinel, D. M., Strasser, K., Gerber, A. P., La-motif-dependent

    mRNA association with Slf1 promotes copper detoxification in yeast. RNA 18

    (3) 449-61 (2012). Show abstract Genes in this reference

    4 21504896 Kumar, A., John, L., Maity, S., Manchanda, M., Sharma, A., Saini, N.,

    Chakraborty, K., Sengupta, S., Converging evidence of mitochondrial

    dysfunction in a yeast model of homocysteine metabolism imbalance. J Biol

    Chem 286 (24) 21779-95 (2011).

    Show abstract Genes in this reference

    5 21483810 Guillemette, B., Drogaris, P., Lin, H. H., Armstrong, H., Hiragami-Hamada,

    K., Imhof, A., Bonneil, E., Thibault, P., Verreault, A., Festenstein, R. J., H3

    lysine 4 is acetylated at active gene promoters and is regulated by h3 lysine

    4 methylation. PLoS Genet 7 (3) e1001354 (2011).

    Show abstract Genes in this reference

    Sl.No PMID Citation

    First Previous 1 2 3 4 5 Next Last

    javascript:void(0);http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=23192348&dopt=Citationjavascript:void(0);javascript:void(0);http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=22326528&dopt=Citationjavascript:void(0);javascript:void(0);http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=22271760&dopt=Citationjavascript:void(0);javascript:void(0);http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=21504896&dopt=Citationjavascript:void(0);javascript:void(0);http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=21483810&dopt=Citationjavascript:void(0);javascript:void(0);

    biobase-international.comLocus Report MFALPHA1 , Saccharomyces cerevisiae

    wmZ2VuZV9hY2M9R04wMDAwMDI0MDEA: DataTables_Table_0_length: [5]input1: DataTables_Table_1_length: [5]input1_(1): DataTables_Table_2_length: [5]input1_(1)_(2): DataTables_Table_3_length: [5]input1_(1)_(2)_(3): DataTables_Table_17_length: [5]input1_(1)_(2)_(3)_(4): DataTables_Table_18_length: [5]input1_(1)_(2)_(3)_(4)_(5): DataTables_Table_19_length: [5]input1_(1)_(2)_(3)_(4)_(5)_(6): DataTables_Table_20_length: [5]input1_(1)_(2)_(3)_(4)_(5)_(6)_(7): locusrefTable_length: [5]input1_(1)_(2)_(3)_(4)_(5)_(6)_(7)_(8):