INFECTION AND IMMUNITY, Mar. 2007, p. 1229–1236 Vol. 75, No. 30019-9567/07/$08.00�0 doi:10.1128/IAI.01663-06Copyright © 2007, American Society for Microbiology. All Rights Reserved.

Monocyte Chemoattractant Protein 1, Macrophage Inflammatory Protein1�, and RANTES Recruit Macrophages to the Kidney in

a Mouse Model of Hemolytic-Uremic Syndrome�

Tiffany R. Keepers, Lisa K. Gross, and Tom G. Obrig*Division of Nephrology, University of Virginia, Box 800133, 1 Lane Road OMS 5815, Charlottesville, Virginia 22903

Received 17 October 2006/Returned for modification 22 November 2006/Accepted 22 December 2006

The macrophage has previously been implicated in contributing to the renal inflammation associated withhemolytic-uremic syndrome (HUS). However, there is currently no in vivo model detailing the contribution ofthe renal macrophage to the kidney disease associated with HUS. Therefore, renal macrophage recruitmentand inhibition of infiltrating renal macrophages were evaluated in an established HUS mouse model. Mac-rophage recruitment to the kidney was evident by immunohistochemistry 2 h after administration of purifiedStx2 and peaked at 48 h postinjection. Mice administered a combination of Stx2 and lipopolysaccharide (LPS)showed increased macrophage recruitment to the kidney compared to mice treated with Stx2 or LPS alone.Monocyte chemoattractants were induced in the kidney, including monocyte chemoattractant protein 1 (MCP-1/CCL2), macrophage inflammatory protein 1� (MIP-1�/CCL3), and RANTES (CCL5), in a pattern that wascoincident with macrophage infiltration as indicated by immunohistochemistry, protein, and RNA analyses.MCP-1 was the most abundant chemokine, MIP-1� was the least abundant, and RANTES levels were inter-mediate. Mice treated with MCP-1, MIP-1�, and RANTES neutralizing antibodies had a significant decreasein Stx2 plus LPS-induced macrophage accumulation in the kidney, indicating that these chemokines arerequired for macrophage recruitment. Furthermore, mice exposed to these three neutralizing antibodies haddecreased fibrin deposition in their kidneys, implying that macrophages contribute to the renal damageassociated with HUS.

Shiga toxins produced by enterohemorrhagic Escherichiacoli are the causative agents of hemolytic-uremic syndrome(HUS), the primary cause of kidney failure in young children.HUS is characterized by hemolytic anemia, thrombocytopenia,and acute renal failure. After colonization of the colonic epi-thelium, the bacteria secrete Shiga toxins (Stx1 and/or Stx2),which translocate across the basolateral surface of the intesti-nal epithelium into the bloodstream. The Shiga toxins thentravel through the systemic circulation to the kidney, wherethey cause cellular damage by inhibiting protein synthesis intheir target cells (30). The degree of sensitivity of cells to Shigatoxins depends on the relative expression of the Stx-bindingglobotriaosylceramide (Gb3) receptor on each cell type (21).

Previous reports indicate that Shiga toxins do not inhibitprotein synthesis in human monocytes in vitro but rather in-duce monocytes to secrete the cytokines tumor necrosis factoralpha (TNF-�), interleukin-1� (IL-1�), and IL-8 (5, 29, 32).Production of these proinflammatory cytokines from mono-cytes, particularly TNF-� and IL-1�, has been shown to causeincreased expression of the Gb3 receptor on endothelial cellsso that more Stx is able to bind, further exacerbating thedisease process (13, 14, 31). Further evidence that monocytesare involved in the pathogenesis of HUS has been establishedby the analysis of HUS patient samples. Several studies havefound increased monocyte-produced cytokines, specifically,

IL-6, IL-8, and TNF-�, in the sera of HUS patients, indicatingthat monocytes/macrophages are activated during the diseaseprocess. Additionally, detection of IL-6, IL-8, and TNF-� inthe urine of HUS patients in higher amounts than in the serumindicates that these cytokines are produced locally in the kid-ney (9, 10, 33). Evidence of monocyte infiltration into thekidney during HUS was demonstrated by detection of signifi-cantly elevated levels of a potent monocyte chemoattractant,monocyte chemoattractant protein 1 (MCP-1), in the urine ofHUS patients (33). In addition, biopsy specimens clearlyshowed the increased presence of macrophages in HUS patientkidneys (33). These data point to the monocyte/macrophageas an important inflammatory mediator in the progressionof HUS.

Thus, we have investigated the role of macrophages in amurine model of HUS. We show that macrophages are re-cruited to the kidneys of Stx2- and/or lipopolysaccharide(LPS)-treated mice in a time-dependent manner and that thisrecruitment occurs via the release of the chemokines MCP-1(CCL2), RANTES (CCL5), and macrophage inflammatoryprotein 1� (MIP-1�) (CCL3) in the kidney. Moreover, neu-tralization of these chemokines caused decreased renal fibrindeposition, indicating that macrophages, their chemokines, orboth are involved in HUS-associated kidney damage.

MATERIALS AND METHODS

Shiga toxin purification. Stx2 was purified by immunoaffinity chromatographyfrom cell lysates (kindly provided by Alison O’Brien) of E. coli DH5� containingthe Stx2-producing pJES120 plasmid (17). Briefly, Stx2 was purified using 11E10antibody (26) immobilized using an AminoLink Plus kit (Pierce Biotechnology,Inc., Rockford, IL) according to the manufacturer’s instructions. Endotoxin wasremoved using De-toxi-Gel (Pierce Biotechnology) per the manufacturer’s in-

* Corresponding author. Mailing address: Division of Nephrology,University of Virginia, Box 800133, 1 Lane Road OMS 5815, Char-lottesville, VA 22903. Phone: (434) 982-1063. Fax: (434) 924-5848.E-mail: to3e@virginia.edu.

� Published ahead of print on 12 January 2007.

1229

on February 10, 2021 by guest

http://iai.asm.org/

Dow

nloaded from

structions. Stx2 was negative for endotoxin by a Limulus amebocyte lysatePyrotell assay (sensitivity of 0.06 endotoxin units/ml). Stx2 purity was assessed bysodium dodecyl sulfate-polyacrylamide gel electrophoresis, and Stx2 activity wasmeasured by use of a Vero cell cytotoxicity assay. Although Stx1 and Stx2 haveidentical enzymatic functions, Stx2 was chosen for these experiments becauseStx2 is more frequently associated with clinical isolates of E. coli O157:H7 fromHUS patients than Stx1 (20, 22).

Animal studies. Male C57BL/6 mice weighing 22 to 24 g were purchased fromCharles River Laboratories (Wilmington, MA). Mice were injected intraperito-neally with a low sublethal dose of LPS at 300 �g/kg of body weight (O55:B5;Sigma Chemical Co., St. Louis, MO), 250 ng/kg Stx2 (two times the 50% lethaldose), or a combination of both. These doses were chosen based on previousstudies with our mouse model of HUS (11). At 0, 2, 4, 6, 8, 12, 24, 48, and 72 hafter injection, two mice per time point were euthanized by CO2 inhalation andkidneys were removed. Kidneys collected at 0 h and kidneys from saline-injectedmice were used for controls. Kidneys were processed for RNA, protein, andimmunohistochemistry as described below. Time course experiments were re-peated at least twice. All animal procedures were done in accordance withUniversity of Virginia Animal Care and Use Committee policies.

Real-time reverse transcription-PCR (RT-PCR). One-half mouse kidney wasstored in 2 ml RNALater (Ambion, Austin, TX) at 4°C until RNA extraction.Total RNA was isolated using an RNeasy Midi kit (QIAGEN, Santa Clarita, CA)according to the manufacturer’s instructions. Quantitative real-time PCR wasperformed using an iScript cDNA synthesis kit, iQ SYBR green supermix, and aMiniOpticon thermal cycler (Bio-Rad, Hercules, CA) according to the manu-facturer’s instructions. Data were evaluated using Opticon Monitor 3 software(Bio-Rad). Data were normalized to GAPDH (glyceraldehyde-3-phosphate de-hydrogenase) and calculated as the change (n-fold) in value of the treatmentgroups over the control (saline-injected) groups according to the 2���Ct method(12a). The following primer sequences were used: GAPDH sense, AGAATGGGAAGCTTGTCATC; GAPDH antisense, GTAGACTCCACGACATACTC(melting temperature [Tm], 61.4°C); MCP-1 sense, TTGACCCGTAAATCTGAAGC; MCP-1 antisense, CGAGTCACACTAGTTCACTG (Tm, 58.1°C);RANTES sense, TCGTGCCCACGTCAAGGAGTATTT; RANTES antisense,ACTAGAGCAAGCGATGACAGGGAA (Tm, 62.7°C); MIP-1� sense, TGTTTGCTGCCAAGTAGCCACATC; and MIP-1� antisense, AACAGTGTGAACAACTGGGAGGGA (Tm, 61.3°C).

Protein analysis. After removal of mouse kidneys, one-half kidney was placedinto 1 ml cold tissue homogenization buffer (50 mM HEPES, 1% Triton X-100,1:100 dilution protease inhibitor cocktail [Sigma Chemical Co.]). Kidneys werehomogenized with a Dounce tissue grinder and sonicated using a Branson Soni-fier 250 with output control at 3 for 10 s. After incubation on ice for 30 min,homogenates were centrifuged at 13,500 rpm for 10 min at 4°C. Supernatantswere removed from the homogenates and stored at �70°C until protein analysisby enzyme-linked immunosorbent assay (ELISA). Chemokine protein was quan-tified using DuoSet ELISA development kits (R&D Systems, Minneapolis, MN)according to the manufacturer’s instructions. Total kidney protein was quantifiedvia a bicinchoninic acid protein assay (Pierce Biotechnology) of kidney homog-enate supernatants. Chemokine protein levels were expressed as picograms ofchemokine per microgram of total kidney protein.

Immunohistochemistry. One-half kidney was fixed in 4% paraformaldehydefor 24 h, processed, and embedded in paraffin. Sections were cut at 3 �m thickand placed onto charged slides. For macrophage staining, a monoclonal ratanti-mouse monocyte/macrophage F4/80 clone antibody (Serotec, Raleigh, NC)was employed. Macrophages were counted in 10 fields of cortex per kidney at�400 magnification, and an average was calculated for each mouse. Otherantibodies used were polyclonal rabbit anti-mouse RANTES (Serotec), poly-clonal rabbit anti-mouse MIP-1� (Serotec), and polyclonal goat anti-mouseMCP-1 (R&D Systems). For all immunohistochemistry staining, an avidin-biotinhorseradish peroxidase system (Vector Laboratories, Burlingame, CA) was usedwith diaminobenzidine to give a brown-colored end product at the site of detec-tion. Sections were then counterstained in hematoxylin, dehydrated, andmounted. Martius yellow-brilliant crystal scarlet-aniline blue differential stainingwas performed as previously described (28). Martius yellow and phosphotungsticacid in alcoholic solution stain red blood cells, brilliant crystal scarlet stainsmuscle and mature fibrin, and aniline blue stains collagen. Glomeruli positive forfibrin staining were quantified by counting three sets of 20 glomeruli per slideand averaging the percent positive for fibrin at each time point.

Chemokine neutralization. Monoclonal rat anti-mouse RANTES (clone53405), polyclonal goat anti-mouse MIP-1�, and polyclonal goat anti-mouseMCP-1 function neutralizing antibodies and immunoglobulin G (IgG) isotypecontrols (R&D Systems) were all administered intravenously via tail vein injec-tion at 25 �g per mouse 6 h prior to intraperitoneal administration of 225 ng/kg

Stx2 and 300 �g/kg LPS. In the case when more than one antibody was given,mice received 25 �g of each neutralizing antibody mixed together; therefore,mice injected with all three neutralizing antibodies received 75 �g of antibodiestotal. Additionally, rat IgG and goat IgG control antibodies were mixed togetherat 25 �g and injected into mice for controls where more than one neutralizingantibody was used. Antibody doses were chosen based on previous work by othergroups (4). Kidneys were processed for immunohistochemistry as describedabove. Kidney sections of mice treated with antibodies were evaluated for im-mune complex deposition according to the method described by McMahon et al.,and it was determined that immune complexes were not deposited in the kidneysof these mice (16).

Statistical analysis. Data are expressed as means � standard deviations (SD).Statistical analyses were performed using a two-sample t test. A P value of 0.05was considered significant.

RESULTS

Macrophages infiltrate the kidneys of Stx2- and/or LPS-injected mice. C57BL/6 mice were injected with 250 ng/kg Stx2,300 �g/kg LPS, or a combination of the two agents and sacri-ficed throughout a 72-h time course. This time course waschosen because disease progression to death in this model istypically 3 to 4 days (11). F4/80 staining of kidney sectionsshowed an increase in macrophages in the kidney after Stx2and/or LPS injection (Fig. 1). Macrophages were located pri-marily in the cortex in the interstitial space between the tubulesand the capillaries and were also found in the medulla. Noevidence of glomerular macrophages was found in any sam-ples. Macrophage accumulation was evident beginning at 2 hafter injection and was the greatest at 48 h after injection ofeither or both agents (Fig. 2). Treatment of mice with bothStx2 and LPS produced greater macrophage influx than eithertreatment alone. The chronology of macrophage infiltrationsuggests the induction of one or more chemoattractants, firstearly in the time course, as indicated by the peak in macro-phages at 2 to 4 h, and then later in the time course, asindicated by the peaks at 12 and 48 h. Therefore, the temporalinduction of monocyte-specific chemokines was investigated.

Stx2 and/or LPS induces renal macrophage chemokinemRNA expression. Investigation of the chemotactic factorsinvolved in Stx2- and/or LPS-induced monocyte recruitmentled to the determination that MCP-1, MIP-1�, and RANTESwere all elevated in kidneys in the mouse model studied. Che-mokine mRNA was determined using quantitative real-timeRT-PCR as stated in Materials and Methods. MCP-1 mRNAin the kidney peaked at 2 h after injection of Stx2, LPS, or both(Fig. 3A). LPS and Stx2 plus LPS induced 229-fold and 346-fold increases, respectively, in MCP-1 mRNA at 2 h, whichgradually declined until 24 h postinjection. Stx2 induced only a13-fold increase in MCP-1 mRNA at 2 h compared to controllevels, and mRNA was not elevated at any other time point.RANTES mRNA peaked later than MCP-1 mRNA levels (Fig.3B). Stx2 plus LPS induced a 138-fold increase in RANTESmRNA at 6 h and a 127-fold increase in RANTES mRNA at8 h subsequent to injection. LPS alone induced a 112-foldincrease in RANTES mRNA at 6 h postinjection. Injection ofmice with Stx2 alone induced a sixfold increase in RANTESmRNA at 48 h postinjection. The timing of MIP-1� mRNAinduction was similar to that of MCP-1 in all treatment groups(Fig. 3C). LPS and Stx2 plus LPS induced a 144-fold increaseand a 135-fold increase, respectively, in MIP-1� mRNA at 2 h

1230 KEEPERS ET AL. INFECT. IMMUN.

on February 10, 2021 by guest

http://iai.asm.org/

Dow

nloaded from

postinjection. Stx2 alone did not cause a significant increase inrenal MIP-1� mRNA levels.

Stx2 and/or LPS causes increased renal macrophage che-mokine protein expression. Increased renal protein corre-sponded to the elevated mRNA after Stx2 and/or LPS injec-tion. MCP-1 was highly elevated in kidney tissue homogenatesupernatants, as determined by ELISA, with a peak expressionat 2 h after Stx2 and/or LPS injection, which slowly diminishedto control levels by 72 h (Fig. 4A). RANTES protein peaked at4 to 12 h after administration of Stx2 and/or LPS (Fig. 4B).MIP-1� renal protein expression was similar to that of MCP-1,as MIP-1� peaked at 2 h after Stx2 and/or LPS administrationand returned to saline levels by 48 h postinjection (Fig. 4C).Additionally, MIP-1�, MCP-1, and RANTES renal proteinlevels were greater in mice injected with the combination ofStx2 plus LPS than in mice injected with either agent alone.Notably, the most abundant chemokine was MCP-1, with apeak renal protein level at 1,121.8 � 165.6 pg/�g, compared to503.5 � 112.4 pg/�g RANTES and 126.6 � 8.6 pg/�g MIP-1�in mice exposed to Stx2 plus LPS.

Immunohistochemistry confirmed protein expression and

FIG. 2. Renal macrophage accumulation in LPS-, Stx2-, and Stx2plus LPS-injected mice throughout the 72-h time course. Data arefrom duplicate experiments. Macrophages were quantified as de-scribed in Materials and Methods, and data are averages (�SD) fromthree mice. *, P � 0.05 (level increased over that of zero hour control).

FIG. 1. Macrophages are recruited to the kidneys of Stx2- and/or LPS-injected mice. Kidney sections were stained for macrophages (F4/80) at48 h after injection of (A) saline, (B) Stx2, (C) LPS, or (D) Stx2 plus LPS. The dark brown-black color indicates F4/80 staining; arrows indicateselect areas of macrophage accumulation. Images are representative of three to five mice. All images were taken at �400 magnification.

VOL. 75, 2007 RENAL MACROPHAGE RECRUITMENT IN HUS 1231

on February 10, 2021 by guest

http://iai.asm.org/

Dow

nloaded from

determined the location of the chemokine expression in thekidney. MCP-1 protein was present only in the renal cortex andhad a punctate staining pattern in the inner portion of proxi-mal tubules (Fig. 5A and B). RANTES protein exhibited adiffuse staining pattern of the tubules throughout the medulla

and cortex (Fig. 5C and D). MIP-1� staining patterns weresimilar to that of MCP-1, revealing punctate staining of theinner portion of the tubules in both the medulla and the cortex(Fig. 5E and F). It is noteworthy that no staining was found inthe glomeruli for any of the chemokines.

FIG. 3. Chemokine mRNA is induced in the kidneys of Stx2-and/or LPS-injected mice. Levels of (A) MCP-1, (B) RANTES, and(C) MIP-1� in mice injected with Stx2 and/or LPS were determined byquantitative real-time RT-PCR. Data are expressed as increase (n-fold) in mRNA over the 72-h time course compared to saline controls(see Materials and Methods for details). Data are representative oftwo mice per time point, and PCR was performed three times for eachchemokine and mouse.

FIG. 4. Renal chemokine protein is elevated after Stx2 and/or LPSinjection. Levels of (A) MCP-1 protein, (B) RANTES protein, and(C) MIP-1 � protein in the kidneys of mice injected with Stx2 and/orLPS were determined by ELISA. Chemokine levels were normalizedto total kidney protein and are expressed as picograms of chemokineper microgram of total protein. Data are from duplicate experimentsand are the averages (�SD) from two mice. *, P � 0.05 (level in-creased over that of zero hour control); #, P � 0.05 (Stx2 plus LPSlevel increased over that of LPS alone).

1232 KEEPERS ET AL. INFECT. IMMUN.

on February 10, 2021 by guest

http://iai.asm.org/

Dow

nloaded from

Chemokine neutralization in Stx2-plus-LPS-injected micereduces renal macrophage infiltration and fibrin deposition.In order to determine which chemokines were involved in theinduced macrophage infiltration, mice were injected intrave-nously with 25 �g of each neutralizing antibody to MCP-1,

MIP-1�, and/or RANTES 6 h prior to intraperitoneal injectionof Stx2 plus LPS. At 48 h after Stx2 plus LPS injection, kidneyswere removed and macrophages were counted (Fig. 6A). Ad-ministration of anti-MCP-1, anti-MIP-1�, or anti-RANTESantibody alone resulted in a modest reduction (21 to 30%) in

FIG. 5. Chemokines are localized to the tubules of kidneys of Stx2 plus LPS-injected mice. Shown are renal MCP-1 immunohistochemistry ofmice injected with (A) saline or (B) Stx2 plus LPS (2 h postinjection for the latter), renal RANTES immunohistochemistry of mice injected with(C) saline or (D) Stx2 plus LPS (6 h postinjection for the latter), and renal MIP-1� immunohistochemistry of mice injected with (E) saline or(F) Stx2 plus LPS (2 h postinjection for the latter). The brown color and the arrows indicate positive chemokine staining. Data are representativeof three mice. Experiments were performed in duplicate. All images were taken at �400 magnification.

VOL. 75, 2007 RENAL MACROPHAGE RECRUITMENT IN HUS 1233

on February 10, 2021 by guest

http://iai.asm.org/

Dow

nloaded from

infiltrating macrophages compared to levels for IgG controls.Similarly, administration of anti-MIP-1� plus anti-RANTES oranti-MCP-1 plus anti-MIP-1� antibodies resulted in 22.7% and28.7% reduction in renal macrophages, respectively. However,administration of anti-MCP-1 plus anti-RANTES resulted in a67.9% � 14.4% reduction in macrophage recruitment. Finally,administration of all three antibodies resulted in a 71.9% �17.8% decrease in macrophage infiltration. The anti-MCP-1plus anti-RANTES and the anti-MCP-1 plus anti-RANTESplus anti-MIP-1� groups both had a statistically significantdecrease in renal macrophages compared to levels for theother treatment groups. These data indicate that MCP-1 andRANTES are the major contributors to renal macrophageaccumulation in this mouse model. Additionally, mice treatedwith all three chemokine neutralizing antibodies and injectedwith only Stx2 had a greater than 80% reduction in infiltratingrenal macrophages (data not shown).

In addition to macrophage staining, kidney sections fromthese chemokine-neutralized mice were also stained for fibrindeposition. Increased fibrin deposition is an indication of kid-ney damage and decreased renal filtration. After sections werestained using the Martius yellow-brilliant crystal scarlet-aniline

blue differential stain as described in Materials and Methods,mice were evaluated according to the glomeruli positive forfibrin as indicated by bright red staining. There was a signifi-cant reduction in fibrin deposition in the glomeruli and in thecortex when all three chemokine-neutralizing antibodies wereadministered prior to Stx2 plus LPS injection of the mice (Fig.6B). The reduction in fibrin deposition was evident not only inthe glomeruli but also in the cortex and medulla of mice ad-ministered all three chemokine-neutralizing antibodies (Fig.6C and D). This decrease in fibrin deposition as well as thedecrease in macrophage infiltration suggests that macrophagesare involved, at least in part, in causing the kidney damageassociated with HUS.

DISCUSSION

We have previously established a mouse model of HUS thatexhibits the triad of hemolytic anemia, thrombocytopenia, andrenal failure that defines the disease (11). In the present re-port, we use this mouse model to investigate the role of themacrophage during the development of HUS. We describehere the progression of macrophage infiltration into the kid-

FIG. 6. Chemokine neutralization in mice injected with Stx2 plus LPS inhibits macrophage infiltration and fibrin deposition. Mice were injectedwith neutralizing antibodies 6 h prior to Stx2 plus LPS injection, and kidneys were removed 48 h after Stx2 plus LPS injection. (A) Inhibition ofmacrophage recruitment to the kidneys of mice with chemokine-neutralizing antibodies (25 �g of each antibody alone or mixed as indicated). Dataare percent inhibition of macrophage accumulation compared to the level for the IgG control (25 �g rat IgG and 25 �g goat IgG)-injected mice.Data are the averages from three to five mice and represent two separate experiments. *, P 0.001 (inhibition greater than that for the first fivetreatment groups). (B) Fibrin deposition in the glomeruli of mice injected with Stx2 plus LPS and neutralizing antibodies to MCP-1, RANTES,and/or MIP-1� (25 �g of each antibody alone or mixed as indicated). Data are the averages from three to five mice and represent two separateexperiments. *, P 0.01 (increased over level for the IgG control [25 �g rat IgG and 25 �g goat IgG]). Also shown is differential staining for fibrindeposition in the glomeruli (arrow) and renal cortex (arrowhead) of mice 48 h after Stx2 plus LPS injection and injection of (C) IgG controlantibodies or (D) neutralizing antibodies to MCP-1, RANTES, and MIP-1�. Bright red staining indicates fibrin deposition, and red blood cells arestained yellow. Both images were taken at �200 magnification.

1234 KEEPERS ET AL. INFECT. IMMUN.

on February 10, 2021 by guest

http://iai.asm.org/

Dow

nloaded from

neys of mice injected with Stx2, LPS, or both, as well as theassociated chemokines and their relevance in this model. Fur-thermore, we show that the combination of Stx2 plus LPSinduces a greater influx of macrophages and higher chemokineexpression in the kidney than either Stx2 alone or LPS alone.These data indicate that these two agents produce an addi-tive effect when administered together.

After determining that macrophages were recruited to thekidneys of mice injected with Stx2 and/or LPS in a time-de-pendent manner, we sought to determine the chemokines re-sponsible for this infiltration. Previous studies have shown thatmice or rats injected with LPS have increased macrophageinfiltration and increased levels of renal MCP-1 and RANTES(6, 36). Additionally, mouse models of sepsis, a disease inwhich macrophages are involved, have shown increased levelsof MCP-1, RANTES, and MIP-1� in organs including thekidney, liver, and lungs (15, 18). Analysis of our model re-vealed that these three chemokines were upregulated in thekidneys after Stx2 and/or LPS injection. It is noteworthy thatwhile administration of Stx2 alone did not greatly alter renalmRNA levels of any chemokine, it did cause significantly in-creased protein expression. It is likely that posttranslationalcontrol or storage of the chemokines in renal cells allows forrapid secretion of these chemokines upon exposure to Stx2without upregulation of gene transcription (3, 23, 24). Thesedata suggest that Stx2 and LPS induce renal cells to produceMCP-1 and MIP-1�, resulting in the initial macrophageinfiltration, and to produce RANTES later in the timecourse, resulting in the continued macrophage infiltration ofthe kidney.

Immunohistochemistry for these chemokines revealed thatall three chemokines were located in tubular cells and thatnone were in the glomeruli. These data correlated with the factthat macrophages were located only in the tubular interstitiumand did not infiltrate the glomeruli. It is not surprising thatthese chemokines are produced by tubular epithelial cells, con-sidering previous studies documenting the ability of these cellsto produce various cytokines and chemokines, includingMCP-1, RANTES, and MIP-1� (1, 37). Additionally, renaltubular cells have been shown to be a primary target of Stx inanimal models and in cell culture, inducing both apoptosis andcytokine secretion (8, 12, 19, 34, 35).

MCP-1 and RANTES were the most abundant renal che-mokines induced by Stx2 plus LPS. Thus, it was hypothesizedthat MCP-1 and RANTES were the primary inducers of theStx2 plus LPS-induced renal macrophage infiltration. To testthis hypothesis, mice were treated with neutralizing antibodiesto MCP-1, RANTES, and MIP-1� in all possible combinationsprior to Stx2 plus LPS injection. A previous study by Fillionet al. demonstrated that neutralizing antibodies to MCP-1,RANTES, and MIP-1� reduced macrophages in the lungs ofpneumococcus-infected mice by 33% only when administeredtogether, not separately (4). In contrast, we found that administrationof these chemokines separately resulted in a modest reduction(20 to 30%) in Stx2 plus LPS-induced renal macrophage ac-cumulation. Furthermore, neutralizing both RANTES andMCP-1 proved to be as effective at significantly reducing renalmacrophages as neutralizing RANTES, MCP-1, and MIP-1�.These data are a strong indication that MCP-1 and RANTESare the primary chemoattractants involved in Stx2 plus LPS-

induced renal macrophage infiltration. A complete inhibitionof macrophage infiltration was not observed; however, it islikely that, at the doses used, the chemokines are not com-pletely neutralized by the antibodies. Alternatively, other che-mokines may be involved in the macrophage infiltration seen inour model. Of note, gene array analysis done by our lab hasshown that the RNA of the macrophage chemokine IP-10/CXCL10 is upregulated in mouse kidneys (see the supplemen-tary material in reference 11). The role of this chemokine inour HUS mouse model is currently under investigation.

To determine whether macrophage inhibition had any effecton kidney function, kidneys from mice administered anti-MCP-1, anti-RANTES, and anti-MIP-1� antibodies prior toStx2 plus LPS injection were evaluated for fibrin deposition.Fibrin-rich thrombi in the renal microvasculature are associ-ated with HUS and diminished kidney function in these pa-tients (2, 27, 30). Furthermore, it has been shown, by using amodel of experimental glomerulonephritis in the rabbit, thatmacrophages can induce glomerular fibrin deposition (7). Wehave also shown previously in our HUS mouse model that anincrease in renal fibrin deposition is associated with an increasein serum creatinine and a decrease in kidney function (11).Using a differential stain for fibrin, we found that mice admin-istered all three chemokine-neutralizing antibodies and Stx2plus LPS had significantly decreased glomerular and total kid-ney fibrin deposition. This likely indicates that the recruitedmacrophages or the chemokines RANTES, MIP-1�, andMCP-1 contribute to diminished renal function and to thepathology of the HUS disease state. In support of this conclu-sion, Palermo et al. found that depleting mice of splenic andliver macrophages reduced Stx2 plus LPS-induced mortality(25).

In summary, we have demonstrated that macrophages infil-trate the kidneys of an HUS mouse model primarily via thechemokines MCP-1 and RANTES. Currently, we are investi-gating whether it is the macrophages or the chemokines thatcontribute to the increased fibrin deposition found in ourmodel. Additionally, we are evaluating whether depletion ofmacrophages or monocytes from the circulation will have anyeffect on renal disease and survival. Although we have notspecifically investigated the usefulness of chemokine neutral-ization as a therapy for HUS in a more clinical setting, exper-iments that would test the efficacy of such treatment after Stx2and LPS exposure are a priority for our laboratory. Nonethe-less, the data presented here suggest that neutralizing thesemacrophage chemokines may be a useful therapeutic for ame-liorating the kidney damage associated with HUS.

ACKNOWLEDGMENT

This research was supported by funding from USPHS grant AI24431(T.G.O.).

REFERENCES

1. Anders, H.-J., V. Vielhauer, and D. Schlondorff. 2003. Chemokines andchemokine receptors are involved in the resolution or progression of renaldisease. Kidney Int. 63:401–415.

2. Blackall, D. P., and M. B. Marques. 2004. Hemolytic uremic syndromerevisited: Shiga toxin, factor H, and fibrin generation. Am. J. Clin. Pathol.121(Suppl.):S81–S88.

3. Comerford, I., and R. J. Nibbs. 2005. Post-translational control of chemo-kines: a role for decoy receptors? Immunol. Lett. 96:163–174.

4. Fillion, I., N. Ouellet, M. Simard, Y. Bergeron, S. Sato, and M. G. Bergeron.

VOL. 75, 2007 RENAL MACROPHAGE RECRUITMENT IN HUS 1235

on February 10, 2021 by guest

http://iai.asm.org/

Dow

nloaded from

2001. Role of chemokines and formyl peptides in pneumococcal pneumonia-induced monocyte/macrophage recruitment. J. Immunol. 166:7353–7361.

5. Guessous, F., M. Marcinkiewicz, R. Polanowska-Grabowska, T. R. Keepers,T. Obrig, and A. R. Gear. 2005. Shiga toxin 2 and lipopolysaccharide causemonocytic THP-1 cells to release factors which activate platelet function.Thromb. Haemostasis 94:1019–1027.

6. Haberstroh, U., J. Pocock, C. Gomez-Guerrero, U. Helmchen, A. Hamann,J. C. Gutierrez-Ramos, R. A. Stahl, and F. Thaiss. 2002. Expression of thechemokines MCP-1/CCL2 and RANTES/CCL5 is differentially regulated byinfiltrating inflammatory cells. Kidney Int. 62:1264–1276.

7. Holdsworth, S. R., and P. G. Tipping. 1985. Macrophage-induced glomerularfibrin deposition in experimental glomerulonephritis in the rabbit. J. Clin.Investig. 76:1367–1374.

8. Hughes, A. K., P. K. Stricklett, and D. E. Kohan. 1998. Shiga toxin-1 regu-lation of cytokine production by human proximal tubule cells. Kidney Int.54:1093–1106.

9. Inward, C. D., M. Varagunam, D. Adu, D. V. Milford, and C. M. Taylor.1997. Cytokines in haemolytic uraemic syndrome associated with verocyto-toxin-producing Escherichia coli infection. Arch. Dis. Child 77:145–147.

10. Karpman, D., A. Andreasson, H. Thysell, B. S. Kaplan, and C. Svanborg.1995. Cytokines in childhood hemolytic uremic syndrome and thromboticthrombocytopenic purpura. Pediatr. Nephrol. 9:694–699.

11. Keepers, T. R., M. A. Psotka, L. K. Gross, and T. G. Obrig. 2006. A murinemodel of HUS: Shiga toxin with lipopolysaccharide mimics the renal damageand physiologic response of human disease. J. Am. Soc. Nephrol. 17:3404–3414.

12. Kiyokawa, N., T. Taguchi, T. Mori, H. Uchida, N. Sato, T. Takeda, and J.Fujimoto. 1998. Induction of apoptosis in normal human renal tubular epi-thelial cells by Escherichia coli Shiga toxins 1 and 2. J. Infect. Dis. 178:178–184.

12a.Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene expressiondata using real-time quantitative PCR and the 2(-��C(t)) method. Methods25:402–408.

13. Louise, C. B., and T. G. Obrig. 1992. Shiga toxin-associated hemolytic uremicsyndrome: combined cytotoxic effects of Shiga toxin and lipopolysaccharide(endotoxin) on human vascular endothelial cells in vitro. Infect. Immun.60:1536–1543.

14. Louise, C. B., and T. G. Obrig. 1991. Shiga toxin-associated hemolytic-uremic syndrome: combined cytotoxic effects of Shiga toxin, interleukin-1beta, and tumor necrosis factor alpha on human vascular endothelial cells invitro. Infect. Immun. 59:4173–4179.

15. Matsukawa, A., C. M. Hogaboam, N. W. Lukacs, P. M. Lincoln, R. M.Strieter, and S. L. Kunkel. 2000. Endogenous MCP-1 influences systemiccytokine balance in a murine model of acute septic peritonitis. Exp. Mol.Pathol. 68:77–84.

16. McMahon, J. T., J. L. Myles, and R. R. Tubbs. 2002. Demonstration ofimmune complex deposits using fluorescence microscopy of hematoxylin andeosin-stained sections of Hollande’s fixed renal biopsies. Mod. Pathol. 15:988–997.

17. Melton-Celsa, A. R., and A. D. O’Brien. 2000. Shiga toxins of Shigelladysenteriae and Escherichia coli, p. 385–406. In K. Aktories and I. Just (ed.),Handbook of experimental pharmacology. Springer, Freiburg, Germany.

18. Ness, T. L., K. J. Carpenter, J. L. Ewing, C. J. Gerard, C. M. Hogaboam, andS. L. Kunkel. 2004. CCR1 and CC chemokine ligand 5 interactions exacer-bate innate immune responses during sepsis. J. Immunol. 173:6938–6948.

19. Nestoridi, E., R. I. Kushak, D. Duguerre, E. F. Grabowski, and J. R. Ingelfinger.2005. Up-regulation of tissue factor activity on human proximal tubular epithe-lial cells in response to Shiga toxin. Kidney Int. 67:2254–2266.

20. O’Brien, A. D., V. L. Tesh, A. Donohue-Rolfe, M. P. Jackson, S. Olsnes, K.Sandvig, A. A. Lindberg, and G. T. Keusch. 1992. Shiga toxin: biochemistry,

genetics, mode of action, and role in pathogenesis. Curr. Top. Microbiol.Immunol. 180:65–94.

21. Obrig, T. G., P. J. Del Vecchio, J. E. Brown, T. P. Moran, B. M. Rowland,T. K. Judge, and S. W. Rothman. 1988. Direct cytotoxic action of Shiga toxinon human vascular endothelial cells. Infect. Immun. 56:2373–2378.

22. Ostroff, S. M., P. I. Tarr, M. A. Neill, J. H. Lewis, N. Hargrett-Bean, andJ. M. Kobayashi. 1989. Toxin genotypes and plasmid profiles as determi-nants of systemic sequelae in Escherichia coli O157:H7 infections. J. Infect.Dis. 160:994–998.

23. Oynebraten, I., O. Bakke, P. Brandtzaeg, F. E. Johansen, and G. Haraldsen.2004. Rapid chemokine secretion from endothelial cells originates from 2distinct compartments. Blood 104:314–320.

24. Oynebraten, I., N. Barois, K. Hagelsteen, F. E. Johansen, O. Bakke, and G.Haraldsen. 2005. Characterization of a novel chemokine-containing storagegranule in endothelial cells: evidence for preferential exocytosis mediated byprotein kinase A and diacylglycerol. J. Immunol. 175:5358–5369.

25. Palermo, M. S., M. F. Alves Rosa, N. Van Rooijen, and M. A. Isturiz. 1999.Depletion of liver and splenic macrophages reduces the lethality of Shigatoxin-2 in a mouse model. Clin. Exp. Immunol. 116:462–467.

26. Perera, L. P., L. R. Marques, and A. D. O’Brien. 1988. Isolation and char-acterization of monoclonal antibodies to Shiga-like toxin II of enterohem-orrhagic Escherichia coli and use of the monoclonal antibodies in a colonyenzyme-linked immunosorbent assay. J. Clin. Microbiol. 26:2127–2131.

27. Proesmans, W. 2001. The role of coagulation and fibrinolysis in the patho-genesis of diarrhea-associated hemolytic uremic syndrome. Semin. Thromb.Hemost. 27:201–205.

28. Pusey, W., and C. A. Edwards. 1978. A modification of the martius yellow-scarlet red-aniline blue method for fibrin. Stain Technol. 53:58–59.

29. Ramegowda, B., and V. L. Tesh. 1996. Differentiation-associated toxin re-ceptor modulation, cytokine production, and sensitivity to Shiga-like toxinsin human monocytes and monocytic cell lines. Infect. Immun. 64:1173–1180.

30. Tarr, P. I., C. A. Gordon, and W. L. Chandler. 2005. Shiga-toxin-producingEscherichia coli and haemolytic uraemic syndrome. Lancet 365:1073–1086.

31. van de Kar, N. C., L. A. Monnens, M. A. Karmali, and V. W. van Hinsbergh.1992. Tumor necrosis factor and interleukin-1 induce expression of theverocytotoxin receptor globotriaosylceramide on human endothelial cells:implications for the pathogenesis of the hemolytic uremic syndrome. Blood80:2755–2764.

32. van Setten, P. A., L. A. Monnens, R. G. Verstraten, L. P. van den Heuvel, andV. W. van Hinsbergh. 1996. Effects of verocytotoxin-1 on nonadherent hu-man monocytes: binding characteristics, protein synthesis, and induction ofcytokine release. Blood 88:174–183.

33. van Setten, P. A., V. W. van Hinsbergh, L. P. van den Heuvel, F. Preyers,H. B. Dijkman, K. J. Assmann, T. J. van der Velden, and L. A. Monnens.1998. Monocyte chemoattractant protein-1 and interleukin-8 levels in urineand serum of patents with hemolytic uremic syndrome. Pediatr. Res. 43:759–767.

34. Wadolkowski, E. A., L. M. Sung, J. A. Burris, J. E. Samuel, and A. D.O’Brien. 1990. Acute renal tubular necrosis and death of mice orally infectedwith Escherichia coli strains that produce Shiga-like toxin type II. Infect.Immun. 58:3959–3965.

35. Yamamoto, E. T., M. Mizuno, K. Nishikawa, S. Miyazawa, L. Zhang, S.Matsuo, and Y. Natori. 2005. Shiga toxin 1 causes direct renal injury in rats.Infect. Immun. 73:7099–7106.

36. Zager, R. A., A. C. M. Johnson, S. Y. Hanson, and S. Lund. 2006. Acutenephrotoxic and obstructive injury primes the kidney to endotoxin-drivencytokine/chemokine production. Kidney Int. 69:1181–1188.

37. Zheng, G., Y. Wang, D. Mahajan, X. Qin, S. I. Alexander, and D. C. Harris.2005. The role of tubulointerstitial inflammation. Kidney Int. Suppl. 94:S96–S100.

Editor: A. D. O’Brien

1236 KEEPERS ET AL. INFECT. IMMUN.

on February 10, 2021 by guest

http://iai.asm.org/

Dow

nloaded from