Upload File

supplementary figure 2

1
Supplementary Figure B. A.

Upload: emele

Post on 06-Feb-2016

17 views

Category:

Documents


1 download

Report

DESCRIPTION

Supplementary Figure 2. A. B. - PowerPoint PPT Presentation

TRANSCRIPT

Page 1: Supplementary Figure 2

Supplementary Figure 2

B.A.

Supplementary Materials Supplementary Figure Legends

images.nature.com · Web viewSupplementary Figure 7 Supplementary Figure 3 Supplementary Figure 1 Supplementary Materials Supplementary Figures S1-S7 Supplementary Tables S1-S7 Clinical

Supplementary Figure 1 - dm5migu4zj3pb.cloudfront.net · Supplementary Figure 1 A B 0 10 20 30 40 ... Oral glucose tolerance test (OGTT) ... Supplementary Figure 2 A) ) 0.5 0 1 1.5

Supplementary appendix · Supplementary Figure 1. Funnel Plot for total symptoms Supplementary Figure 2. ... positive, negative and general symptom scores are not reported we estimated

Supplementary Information Supplementary Figure S1. Phenotypic … · 2013-02-05 · 2 Supplementary Figures and Legends Fig.S1 Supplementary Figure S1. Phenotypic comparison of the

SUPPLEMENTARY INFORMATION - Geophysicsgeophysics.wustl.edu/seminar/2010_Tauzin_NatureGeo_SOM.pdf · SUPPLEMENTARY INFORMATION doi: 10.1038/ngeo969 2 Supplementary Figure S1 Global

Supplementary Figure 2

Supplementary Figure 1. Supplementary Figure 2 Supplementary Figure 3 A B

Supplementary Figure 1 - Nature · Supplementary Figure 1 ... Supplementary Figure 3. Activation of HIF-1 activity by UCHL1 overexpression. ... EMT6/EF-Luc/EV-1, 2 and

1 Supplementary Figures 2 3 Supplementary Figure 1: TRPV1 expression … · 2017-05-10 · 1 1 Supplementary Figures 2 3 Supplementary Figure 1: TRPV1 expression in the ACC of both

Supplementary Figure Legends

Supplementary Figure 3

Zuo -Supplementary Figure 1 (page 1 of 2)

Supplementary Figures: Supplementary Figure 1 – PANCAN ...df6sxcketz7bb.cloudfront.net/manuscripts/88000/88755/jci.insight.88755.sd.pdfSupplementary Figures: Supplementary Figure

Supplementary Figure 1

Supplementary Figure 2. Kunogi M et al

Supplementary Figure S1

Supplementary Figure S26

Supplementary Figure 1. - NHGRI: Research Server Figure 1. ... Supplementary Figure 2. ... 16 rs2402354TCTGGGTGCCTGAAGTTTCT GAGGGACAGCTCCATTCATC 28,442,316 T T C T C T TTTTTTTTTT TCTCTT

Supplementary Material Figure 2. Phylogenetic

images.nature.com · Web viewVahid Asnafi2, Elizabeth Macintyre 2, Els Verhoeyen1,3 and Melania Tesio2 SUPPLEMENTA L DATA Supplementary figure 1 Supplementary figure 2 Supplementary

Supplementary Figure 1

SUPPLEMENTARY MATERIAL: SUPPLEMENTARY FIGURE 2cambridge.org:id:article:S... · SUPPLEMENTARY MATERIAL: SUPPLEMENTARY FIGURE 2 Image gallery to accompany John Robb (2015), “Prehistoric

SUPPLEMENTARY FIGURE 2 - AACR Journals · 2015. 11. 26. · Vehicle ML264 (2 x 25 mg/kg) KL F5 # 1 A KL F5 # 2 KL F5 # 3 Supplementary Figure 2. Title: SUPPLEMENTARY FIGURE 2 Created

Supplementary Figure 1 - Welcome to the UCLA …€¦ ·  · 2016-06-151 Supplementary Figure 1 Supplementary Figure 1. ... Supplementary Figure 5 Supplementary Figure 5. ... JP10089

Supplementary figure 2. Guillemin et al. Supplementary figure 2. Expression of BCL2L10 in human oocytes analyzed by immunofluorescence. Detection of BCL2L10

Supplementary Figure · 2015. 1. 14. · 2 Supplementary Figure Supplementary Figure 1. Standard and Selected Samples. Chen et al. (2015) Asian Australas. J. Anim. Sci. 28:158-165

Supplementary Information SUPPLEMENTARY … · SUPPLEMENTARY INFORMATION 2 | RESEARCH Supplementary Information 3 Fig. S2 Figure S2: Carbon Rearrangement Networks Used in Various

Supplementary figure 2

SUPPLEMENTARY INFORMATIONmendel.stanford.edu/SidowLab/pdfs/2011ValouevEtAl_Supp.pdf · Supplementary Figure 2 Supplementary Figure 2. Schematic representation of in vitro reconstitution

Supplementary Figure 1. Removing one copy of Rb1 gene … · 2019-11-14 · Supplementary Figure 2 Supplementary Figure 2. The ganglion cells, bipolar cells and horizontal cells in

Supplementary Figure 5

media.nature.com · 1 Supplementary Materials Supplementary Table S1 Supplementary Table S2 Supplementary Table S3 Supplementary Figure S1 Supplementary Figure S2 Supplementary Figure

Supplementary information for: Discovery and … · Supplementary Figure S2 Supplementary Figure S3 Supplementary Figure S4 Supplementary Figure S5 Supplementary Figure S6 Supplementary

Supplementary figure 2