Upload File

supplementary figure 2

2
Supplementary figure 2 a. b. +/+ +/m kb 12 8 M +/+ +/m m/m 2 kb 540bp 387bp c. d. Supplementary figure 2. Generation of Unc5b mutant mice a. Schematic representation of UNC5B. Arrowhead indicates site of gene targeting into the first Ig-domain of the Unc5b gene. IG: immunoglobulin domain, TSP: thrombospondin repeat, TM: transmembrane domain, ZU5: ZU5 domain, DB: domain required for DCC binding, DD: death domain. b. Top: wild-type Unc5b locus. Bottom: targeted allele harboring the ‘secretory gene trap cassette’ 34 . The black bars indicate exons. Domains encoded by individual exons are indicated on top. SS, signal sequence; SA, splice acceptor; ß-geo, ß-galactosidase and neomycin phosphotransferase fusion; IRES, internal ribosomal entry site, PLAP, human placental alkaline phosphatase. c. Southern analysis of ES cell DNA to identify the targeted clones. +, wild-type allele; m, mutant allele. The probe and the detected DNA fragments are indicated in b. d. PCR genotyping of unc5b mutant mice. +, wild-type allele; m, mutant allele. The PCR fragments amplified from the two alleles are indicated by arrows in b. The following primers were used: Unc5b: ACTAGAATGCTGTCCAGAC/AGAGGAGAGCAACGGATG, Plap: TGCACATGCTTTACGTGTG/CGCGTGTCGTGTTGCAC.

Upload: gamada

Post on 14-Feb-2016

47 views

Category:

Documents


0 download

Report

Tags:

DESCRIPTION

Supplementary figure 2. +/+ +/m. kb. 12. 8. M +/+ +/m m/m. 2 kb 540bp 387bp. a. b. c. d. Supplementary figure 2. Generation of Unc5b mutant mice - PowerPoint PPT Presentation

TRANSCRIPT

Page 1: Supplementary figure 2

Supplementary figure 2a.

b.

+/+ +/mkb

12

8

M +/+ +/m m/m

2 kb

540bp387bp

c. d.

Supplementary figure 2. Generation of Unc5b mutant micea. Schematic representation of UNC5B. Arrowhead indicates site of gene targeting into the first Ig-domain of the Unc5b gene. IG: immunoglobulin domain, TSP: thrombospondin repeat, TM: transmembrane domain, ZU5: ZU5 domain, DB: domain required for DCC binding, DD: death domain.b. Top: wild-type Unc5b locus. Bottom: targeted allele harboring the ‘secretory gene trap cassette’34. The black bars indicate exons. Domains encoded by individual exons are indicated on top. SS, signal sequence; SA, splice acceptor; ß-geo, ß-galactosidase and neomycin phosphotransferase fusion; IRES, internal ribosomal entry site, PLAP, human placental alkaline phosphatase. c. Southern analysis of ES cell DNA to identify the targeted clones. +, wild-type allele; m, mutant allele. The probe and the detected DNA fragments are indicated in b. d. PCR genotyping of unc5b mutant mice. +, wild-type allele; m, mutant allele. The PCR fragments amplified from the two alleles are indicated by arrows in b.The following primers were used:Unc5b: ACTAGAATGCTGTCCAGAC/AGAGGAGAGCAACGGATG,Plap: TGCACATGCTTTACGTGTG/CGCGTGTCGTGTTGCAC.

Page 2: Supplementary figure 2

Supplementary figure 2e.

Supplementary figure 2 (continued). Generation of Unc5b mutant micee. Northern blot analysis of total RNA from E10.5 embryos using the probes indicated. Wild-type transcripts were not detected in the mutant. +, wild-type allele; m, mutant allele.f. Real-time RT-PCR analysis of total RNA from E10.5 embryos. The coding regions amplified by different primer pairs are indicated on the left. Expression levels in wild-type are set to 100 percent. Expression levels in the mutants on average are less than 3 percent of wild-type for all coding regions 3’ to the site of gene targeting. +, wild-type allele; m, mutant allele.The following primer pairs were used:Unc5b: ACAGGCACTCCCTCCGGTGG/ATCGTCTATGTGAATGGAGG

TTGCACCACCGTGTGCCCAG/TGCCATGCACTCGCGGCTGCATCAGAGAACTCTAAACGAC/ACCGCTACCACCACAAAGACCAAGGCCCAACAACCCGCAG/TGTCGGCGGAGTCCTGCAGGAGCCTGTTGGTACCAAATGG/TTCTGAAAGTGGGAGGGTGCACTGGGAGGAGGTGGTGACC/AGCTGGTCCAGCAGGATGTGACACACCTGTAGCACTGAAG/GTAGGTTGTGGTAACTGTCCTGGCCAAGTACCAGGAGATTC/TCCGTGGAGGCCAGGCTATGTTGGCCGAGACGCCTGCTGG/TATCTTGAAGGCATAGGGTCCAGAAGCTGTCCATGGACCG/TCATCCTGTTGCCGAGCTTC

Transferrin receptor:TGGGAACAGGTCTTCTGTTG/TGCAGTCCAGCTGGCAAAGA.

18S rRNA

+/+ +/m m/mkb

9.497.46

4.40

2.37 Probe: exons 1-17

9.497.46

4.40

2.37 Probe: exons 5-17

+/+ +/m m/m

5,6

6,7

8,9

9,10

11,12

12,13

13,14

14,15

15,16

16,17

exonsamplified:

0 50 100% normalized expression level

f.


Supplementary Figure S1

images.nature.com · Web viewVahid Asnafi2, Elizabeth Macintyre 2, Els Verhoeyen1,3 and Melania Tesio2 SUPPLEMENTA L DATA Supplementary figure 1 Supplementary figure 2 Supplementary

Supplementary Figure 1. Removing one copy of Rb1 gene … · 2019-11-14 · Supplementary Figure 2 Supplementary Figure 2. The ganglion cells, bipolar cells and horizontal cells in

SUPPLEMENTARY MATERIAL: SUPPLEMENTARY FIGURE 2cambridge.org:id:article:S... · SUPPLEMENTARY MATERIAL: SUPPLEMENTARY FIGURE 2 Image gallery to accompany John Robb (2015), “Prehistoric

Supplementary Figure 1

Supplementary Figure 5

Supplementary Figure 2

Supplementary Material Figure 2. Phylogenetic

Supplementary Figure 1 - Nature · Supplementary Figure 1 ... Supplementary Figure 3. Activation of HIF-1 activity by UCHL1 overexpression. ... EMT6/EF-Luc/EV-1, 2 and

Supplementary Figure 1. Supplementary Figure 2 Supplementary Figure 3 A B

Supplementary figure 2. Guillemin et al. Supplementary figure 2. Expression of BCL2L10 in human oocytes analyzed by immunofluorescence. Detection of BCL2L10

Supplementary Figure 1 - dm5migu4zj3pb.cloudfront.net · Supplementary Figure 1 A B 0 10 20 30 40 ... Oral glucose tolerance test (OGTT) ... Supplementary Figure 2 A) ) 0.5 0 1 1.5

Supplementary Figure S26

SUPPLEMENTARY INFORMATIONmendel.stanford.edu/SidowLab/pdfs/2011ValouevEtAl_Supp.pdf · Supplementary Figure 2 Supplementary Figure 2. Schematic representation of in vitro reconstitution

Supplementary Figure 1 - Welcome to the UCLA …€¦ ·  · 2016-06-151 Supplementary Figure 1 Supplementary Figure 1. ... Supplementary Figure 5 Supplementary Figure 5. ... JP10089

Supplementary Figure · 2015. 1. 14. · 2 Supplementary Figure Supplementary Figure 1. Standard and Selected Samples. Chen et al. (2015) Asian Australas. J. Anim. Sci. 28:158-165

Supplementary Figure 3

Supplementary information for: Discovery and … · Supplementary Figure S2 Supplementary Figure S3 Supplementary Figure S4 Supplementary Figure S5 Supplementary Figure S6 Supplementary

SUPPLEMENTARY FIGURE 2 - AACR Journals · 2015. 11. 26. · Vehicle ML264 (2 x 25 mg/kg) KL F5 # 1 A KL F5 # 2 KL F5 # 3 Supplementary Figure 2. Title: SUPPLEMENTARY FIGURE 2 Created

Supplementary Materials Supplementary Figure Legends

images.nature.com · Web viewSupplementary Figure 7 Supplementary Figure 3 Supplementary Figure 1 Supplementary Materials Supplementary Figures S1-S7 Supplementary Tables S1-S7 Clinical

Supplementary Figure 2

Supplementary Information SUPPLEMENTARY … · SUPPLEMENTARY INFORMATION 2 | RESEARCH Supplementary Information 3 Fig. S2 Figure S2: Carbon Rearrangement Networks Used in Various

SUPPLEMENTARY INFORMATION - Geophysicsgeophysics.wustl.edu/seminar/2010_Tauzin_NatureGeo_SOM.pdf · SUPPLEMENTARY INFORMATION doi: 10.1038/ngeo969 2 Supplementary Figure S1 Global

media.nature.com · 1 Supplementary Materials Supplementary Table S1 Supplementary Table S2 Supplementary Table S3 Supplementary Figure S1 Supplementary Figure S2 Supplementary Figure

Supplementary Figure 1. - NHGRI: Research Server Figure 1. ... Supplementary Figure 2. ... 16 rs2402354TCTGGGTGCCTGAAGTTTCT GAGGGACAGCTCCATTCATC 28,442,316 T T C T C T TTTTTTTTTT TCTCTT

Supplementary Figures: Supplementary Figure 1 – PANCAN ...df6sxcketz7bb.cloudfront.net/manuscripts/88000/88755/jci.insight.88755.sd.pdfSupplementary Figures: Supplementary Figure

Supplementary Figure 2. Kunogi M et al

1 Supplementary Figures 2 3 Supplementary Figure 1: TRPV1 expression … · 2017-05-10 · 1 1 Supplementary Figures 2 3 Supplementary Figure 1: TRPV1 expression in the ACC of both

Supplementary appendix · Supplementary Figure 1. Funnel Plot for total symptoms Supplementary Figure 2. ... positive, negative and general symptom scores are not reported we estimated

Supplementary figure 2

Supplementary Information Supplementary Figure S1. Phenotypic … · 2013-02-05 · 2 Supplementary Figures and Legends Fig.S1 Supplementary Figure S1. Phenotypic comparison of the

Zuo -Supplementary Figure 1 (page 1 of 2)

Supplementary Figure 1

Supplementary Figure Legends