We will solve the Day to Day Life disease with this sensor

A

Project Report

On

Nano Bio Health Chip

In partial fulfillment of requirements for Final Project

In Course of Nanotechnology and Nanosensor

SUBMITTED TO: Technion(Israel institute of technology)

By: Vasvani Shyam Babiya Kaushik

Monapara Tushar

Nano-bio Chips: Genes to Disease

Table of contents

- Cover page

- Table of contents

- Abstract

- Introduction

- Literature review

- Project description (overall design method for fabrication, and application)

- Conclusions and recommendations

References

Abstract

In this type of nanosensor help us to sense the problem in our body and give the signal how to prevent

that type of problem is depend on human genes so all this type of sensor based on DNA structure so it

is also known as genechips,this type chip fix in our body to sense the disease. This type of sense is

depend on the touch of the body or other human value like hair, nail, etc.

In this project, new enabling micro/nano/bio-technologies toward the development of all-on-chip

systems for on-line bio-monitoring have been explored for applications in: diagnosis, treatment of

patients, cell cultures and environmental monitoring. The project comprises of three main research

tasks: Nano-Bio films for applications in stem cells monitoring, Nano-Bio films for drugs detection,

and innovative ideas in VLSI design for bio-applications.

Microarray activities can be easily integrated into secondary school biology units on genetics, cell

biology, DNA, or biotechnology. Since microarrays touch upon a variety of concepts (including

transcription, differences in gene expression, genetics, cell biology, biotechnology, DNA

hybridization, new technologies, cancer biology, and bioethics), a microarray unit can provide a

framework to help students understand the connections between these concepts. As described in this

laboratory, a complete microarray unit can be carried out in two short class periods.

Introduction

The purpose of this simulation activity is to teach the following:

• DNA microarrays are a powerful emerging technology that scientists use to measure the activity

(transcription) of thousands of genes at one time.

• Genes are “differentially regulated”: All cells in an organism contain the same genes*, but different

genes are expressed (transcribed) in different tissues under different conditions. This is what gives

different tissues their different phenotypes (appearance and function).

*Note: Gametes contain half of the genes that somatic cells do, and enucleated cells (such as

mature red blood cells) do not contain genes.

• Even genes that are not highly expressed (transcribed) may play an important role in the cell. The

lack of expression of a certain gene may also play an important role in the cell.

• Microarrays highlight important connections between genetics, cell biology, genes, DNA,

chromosomes, gene expression, transcription, cancer biology, proteins, technology, and bioethics.

Microarray analysis can also be used to integrate math into the biology curriculum.

Project Overview

Microarray Unit Overview

Detecting patterns or changes in transcription in cells is a way to understand both normal and abnormal

aspects of cell function. A researcher who wanted to look for changes in transcription in a specific

cancer tissue

Could use microarray analysis. As the first step in this process, a gene chip would be created. DNA

chip, microarray, gene chip, and genome chip are all terms that describe a solid matrix, such as a glass

slide, that is imprinted with a precisely arranged pattern of spots, each made up of many copies of a

specific oligonucleotide representing part of a genome (e.g., a human genome).

As the next step, the DNA chip would be used to analyze complementary DNAs (c DNAs) that were

made from mRNA isolated from cancerous and noncancerous parts of the same tissue. The cancerous

and noncancerous DNA samples are flagged with dyes and applied to the prepared chip. The extent to

which each flagged gene adheres to its complement on the chip directly indicates the extent to which

transcription occurred. Computer analysis of the DNA chip reveals which genes were transcribed in

the cancerous tissue and which in the normal tissue, and thus indicates which genes might be important

in the development of the cancer. The use of a microarray in this application allows suspect genes to

be identified years sooner that would have been possible with previous technologies that were unable

to analyze so many genes so precisely at one time.

Gene Expression = Transcription into RNA and Translation into Protein

Transcription Translation

DNA (gene) RNA Protein

(Phenotype / Appearance)

Induced (Expressed) Gene: Repressed (not Expressed) Gene:

Transcription

Gene X Lots of mRNA X Gene Z × no mRNA Z

Gene Expression and Cancer

A single microarray can contain more than 30,000 spots of DNA, each representing a different gene in

an organism. In this laboratory, you will use a DNA microarray (“gene chip”) to study the expression

of six different genes in normal lung cells and lung cancer cells. These results will show how these six

genes are transcribed in normal vs. cancerous lung cells.

Scientists have found that some genes are not transcribed as much in cancer cells as in normal cells.

These repressed genes may play an important role in allowing the cancer cells to spread and grow.

Other genes are transcribed more in cancer cells than normal cells. These genes may also play an

important role in making the cells cancerous. There are also many genes that are transcribed at the

same level in both cancer cells and normal cells. These genes probably do not play a significant role

in causing cells to become cancerous. There are also some genes that may not be expressed at all in

normal or cancerous lung cells. Can you think of any examples of these?

Expected Experimental Results

Gene 1 = deep pink (gene induced in cancerous cells)

Gene 2 = purple (mixed pink and blue; gene equally transcribed in both cancerous and noncancerous

cells)

Gene 3 = blue (gene repressed in cancerous cells)

Gene 4 = blank (gene not transcribed in either cancerous or noncancerous cells)

Gene 5 = light pink (gene slightly induced in cancerous cells)

Gene 6 = light blue (gene slightly repressed in cancerous cells)

Nanotechnology and Nasensor

1. We will study gene expression (transcription) in lung cancer cells as compared to that in normallung

cells. The DNA from lung cancer cells will be labeled pink, and the DNA from normal cells will be

labeled blue. We are using atypical colors for our simulated microarrays.

2. If the cDNAs made from the lung cancer cells’ mRNA are labeled red, and the cDNAs made from

thenormal cells’ mRNA are labeled green, for each of the situations below, describe what color you

expect the gene spot to be on a microarray:

GENE DESCRIPTION COLOR OF SPOT

A gene was expressed (transcribed) more in

lung cancer cells than in normal lung cells Red (Pink, in our lab)

A gene was transcribed the same in both cells Yellow (Purple, in our lab)

A gene wasn't transcribed at all in either cell Black (Colorless, in our lab)

A gene was expressed (transcribed) more in

normal lung cells than in lung cancer cells Green (Blue, in our lab)

Overdesign all method for Fabrication

A Committed Relationship

But somewhere, in the tagged sample

of RNA washing over the array, a

match will be made. If the sequence of

bases in the sample RNA matches

that of a DNA probe, then there will

be a perfect match and the sample will

stick to the probe.

Determining a Match

Let's assume that we have a match and

that RNA in our sample bound to

the probes built on the

array. We then rinse the array, so that any RNA that didn't

pair is washed away. The hybridized RNA is tagged with

molecular glue (biotin); it’s as if each hybridized square

on the array has been coated with sticky glue.

Making Glow in the Dark RNA

Because we can’t see RNA, we can’t directly figure out

how much has stuck to the DNA probe on the array. Did

only one strand attach? Or did 1,000,000 strands attach?

To work around this problem, scientists make the RNA glow in the dark by using a fluorescent

molecule that sticks to the biotin.

An Expressed Gene

Researchers wash the fluorescent stain over the array and the glow in the dark molecules (ball) stick

to the biotin glue (small cup). It’s like glitter painting in elementary school -- after pouring sparkle

glitter all over the paper, you shake it off and the glitter only sticks to the places where there was

glue. With microarrays, the fluorescent molecules are “shaken” away and laser light on the array,

causing the stain to fluoresce or “glow”. If a gene is highly expressed, many RNA molecules will

stick to the probe, and the probe location will shine brightly when the laser hits it. If a gene was

expressed at a lower level, less RNA will stick to the probe, and by comparison, that probe location

will be much dimmer when it is hit with the laser.

the stain only sticks to those places on the array wher e RNA has bound. After all of this, researchers shine a

No Match at All

If the sample RNA doesn’t match it will be rejected by the probe on the array. Scientists will know

that no match was made when they shine the laser on the probes and nothing glows.

Measuring All Gene Expression at Once

So far we’ve been looking at expression from

just one gene. And although GeneChip

expression arrays can simultaneously measure

tens of thousands of different genes, let’s

simplify it down

to looking at expression from just four: Gene

1

(2RUDE) Gene 2 (2LOUD) Gene 3

(GETOUT)

Gene 7 (Fat Met.) In this example, Gene1,

Gene2, and Gene3 are expressed because fluorescent RNA has hybridized to teach of the probes. In

their study, scientists find that these genes are only expressed by the loud speakers, and not at all by

normal speakers. Because nothing is known about these genes other than their expression in rude

people, scientists decide to call them 2RUDE,

2LOUD, and GETOUT – a RUDE pathway. Even though they aren’t 100% sure what the genes do,

they know they are consistently expressed by abusive cell phone talkers. Virtually everyone has these

three genes, but the difference is that they are not equally expressed by everyone. In wellmannered

individuals, the RUDE pathway sits idle and its genes are not transcribed into RNA. As a result, that

RNA doesn’t make proteins and those proteins don’t drive a person to unconscionably rude behavior.

The next step for the researchers is to use additional techniques showing that the proteins created by

the RUDE genes function to suppress activity in the politeness and common sense regions of the human

brain.

Comparing Gene Expression

The whole point of microarray gene expression

analysis is to compare expression levels between

two samples. In our example comparing loud

talkers and normal-volume talkers, expression

analysis found that 3 genes were more heavily

expressed in rude people than in normal people.

To represent this, researchers construct “heat

maps”, which are graphical displays that color

code gene expression. Increased expression is

color coded in dark grey while decreased

expression is in light grey. The heat map to the

right shows gene expression from 5 loud talkers

and 5 normal talkers. It makes it clear that

2RUDE, 2LOUD and GETOUT are highly

expressed in Loud Talkers, but not in Normal

Talkers. Other genes expression levels, like those

responsible for eye color or freckles, do not

correlate with rude talking behavior.

Classifying Disease

Having found genes responsible for rude behavior, our scientists explore if those same genes are

responsible for other forms of rude behavior. They compare gene expression from 3 people who are

loud cell phone talkers, 3 people with the rude behavior of talking at the movies, and 3 other people

that rudely use the express checkout lane with 25 items. In this example, the researchers might find

that expression of different genes can be used to classify the different types of rude behavior. In this

case, expression of Genes A, B, C are markers for loud movie talkers, whereas expression of Genes X,

Y, Z are markers for the checkout lane abusers. All these people suffer from seemingly identical rude

behavioral disorders, but the genetics of each disease is quite different. By genetically classifying

seemingly identical diseases, researchers can develop more targeted therapies to the distinct forms of

otherwise indistinguishable disease.

An Actual Gene Expression Image

In reality, human expression arrays have over1.3 million different probes used to detect nearly 50,000

different RNA sequences. The result, when translated into a graphic by a computer, looks like a fuzzy

television picture, but when viewed up close, looks just like an illuminated checker board. The

fluorescence coming from each checker square or probe location tells researchers whether a gene is

expressed or not. Some probes measure high concentrations of RNA (strong intensity, white and grey

features) and some do not (weak intensity, light grey and black features). By analyzing images like

this, scientists can measure how much of RNA was present in the sample. They can record that

information, store it, and then compare it to another sample analyzed at a later date. For instance, if a

scientist measures twice as much fluorescence for the 2RUDE gene in a second person, it’s possible

that person will be even more annoying than the first.

Content Standards

The concept of microarrays and their use integrates many different areas of science typically covered

in the high school curriculum, including genetics/heredity, cell biology, DNA/biotechnology,

technology and society, mathematics, and computer science. In addition to content knowledge, the

science skills addressed in the activities include applying scientific knowledge, analyzing and

interpreting data to solve problems, working together in a group with a common goal, and

communication skills. Additional extension activities could include ethical debates on the use of

microarray data. These concepts are the framework of most state science content standards and can be

aligned to the 1996 National Science Education Standards (NSES) for Science Content developed by

the National Research Council. The microarray activities align to the following NSES Science Content

Standards for grades 9–12: Science as Inquiry (A), Life Sciences (C), Science and Technology (E),

Science in Personal and Social Perspectives (F), and History and Nature of Science (G).

For this array to work it is necessary to already have access to sequence information determined through prior

research (that is why this is called “resequencing”). This way, when the DNA is sequenced it can be compared

to known sequences for identification. Also, knowing the sequence helps build specific probes. This way, if

you

are screening for malaria, you only need to look at sequences that are specific for malaria strains allowing for

quick identification. The actual resequencing array is very complicated, with each probe being slightly

different

than the one next to it. The main difference is that a set of four probes is used together to sequence one base.

There are four versions of each probe to test to see if an A, G, C or T is found at a specific position on the

DNA.

In the 25 base long probe, the middle base (#13 – in bold below) is the variable nucleotide that is actually used

to determine the actual base in that position of the target DNA (from the sample). Here is an example

to give

you a visual. Let’s call this probe set W.

Probe W1 - ATCGGGTAAACTAAAGGCTACTGCCT

Probe W2 - ATCGGGTAAACTCAAGGCTACTGCCT

Probe W3 – ATCGGGTAAACTGAAGGCTACTGCCT

Probe W4 – ATCGGGTAAACTTAAGGCTACTGCCT

Future Vision

This belt of cubic crystal pyramid is an example for an

innovative sensor that I would like to have in my everyday life.

This belt is creative and applicable, because,

1. In this belt every colours of cubic have its own important.

2Each colour denoted the level of toxin , glucose , red blood cells , vitamin, sugar , amino acids , proteins

, sodium , magnesium ,

calcium , wbc , lymphocytes etc.

3. Information of the colour

Yellow Lymphocytes

Red RBCs

White WBCs

Purple Magnesium

Pink proteins

Saffron Amino acids

Sky blue sugar

green glucose

Suppose that

Lymphocytes in your body are in loss or destroy in any percent that must colour of belt change

Because of property of nano particles.

RBCs OR WBCs in your body are decreasing & increasing in any percent that intensity of colour will

be change. vitmin in your body are decreasing & increasing in any percent that intensity of colour will

be change.

Like

L

y

m

p

h

o

s

i

t

e

s

R

B

C

s

W

B

C

s

M

e

g

n

e

s

i

u

m

p

r

o

t

i

n

s

A

m

i

n

o

a

c

i

d

s

s

u

g

e

r

g

l

u

c

o

s

e

s

o

d

i

u

m

m

a

g

n

e

s

i

u

m

L

y

m

p

h

o

c

y

t

e

s

L

y

m

p

h

o

c

y

t

e

s

First of all this belt like black

Suppose any change in our body colour of belt is change. As shown in figure 1

This belt is important in our life because

Suppose decrease red blood cell so change the colour of belt

So you can know which food eat for increase red blood cell and also know which type of disease

probability enter in our body.

We save our body form attack of disease.

Working

Whenever increase sugar level the nanoparticle gain energy from sugar atom and change the colour

stap by stap. `

So you can see the change of colour.

Application

Main Results on Nano-Bio-Chip for Stem Cells Monitoring

Nano-biosensing provides new tools to investigate cellular differentiation and proliferation. Among

the various metabolic compounds secreted by cells during their life cycle, glucose, lactate and

hydrogen peroxide (H2O2) are of main interest. Glucose is the “fuel” of cells while lactate and

hydrogen peroxide production is related to cell suffering. Nano-structured electrodes may enhance the

compound sensitivity in order to precisely detect cell cycle variation. In this research task, the detection

with electrodes structured by using multi-walled carbon nanotubes (CNT) have been investigated to

be considered for an amperometric biochip. A significant improvement in sensitivity has been

achieved, indicating that carbon nanotubes are the right candidates to improve biosensing,. Also, first

experiments on glucose and lactate detection in stem cells have been carried out. Future projects

originated by this study will be on the development of bio-chips to be integrated in petri dishes for

automatic stem cell culture monitoring.

Main Results on Nano-Bio-Chip for Drugs Detection

Personalized therapy requires accurate and frequent monitoring of drugs metabolic response in living

organisms during drug treatments. In case of high risk side effects, e.g. therapies with interfering anti-

cancer molecules cocktails, direct monitoring of the patient’s drug metabolism is essential as the

metabolic pathways efficacy is highly variable on a patient-by-patient basis. Moreover, anti-cancer

pharmacological treatments are often based on cocktails of different drugs. Currently, there are no fully

mature biochip systems to monitor multi-panel drug amounts in blood or in serum. The aim of this task

has been to investigate the complexity of multiple drugs detection for point-of-care and/or implantable

systems to be used in personalized therapy. Probes investigated for biochips are the P450 cytochromes

as they are key-role proteins in drugs metabolism. Multiple drugs detection has been carried out both

by simulations

References

http://www.bio.davidson.edu/courses/genomics/chip/chip.html

http://gcat.davidson.edu/Pirelli/index.htm

www.bio.davidson.edu/GCAT

http://www.bio.davidson.edu/projects/GCAT/HSChips/Hschips.html

http://gslc.genetics.utah.edu/units/biotech/microarray/

http://www.hinsdale86.org/staff/kgabric/labsOnline/Microarrayer2.doc

http://www.bio.davidson.edu/projects/GCAT/HSChips/hs_kit_math_module_v2.pdf

www.hhmi.org/biointeractive/genomics/genechipdata/index.html