melanoma-reactive human cytotoxic t lymphocytes derived...

Vol. 3, 685-696, May 1997 Clinical Cancer Research 685

Melanoma-reactive Human Cytotoxic T Lymphocytes Derived from

Skin Biopsies of Delayed-Type Hypersensitivity Reactions Induced

by Injection of an Autologous Melanoma Cell Line’

Gary A. Waanders,2 Donata Rimoldi,

Danielle Li#{233}nard, Stefan Carrel,3 Ferdy Lejeune,Pierre-Yves Dietrich, Jean-Charles Cerottini,and Pedro RomeroLudwig Institute for Cancer Research, Lausanne Branch, Universityof Lausanne, CH-1066 Epalinges [G. A. W., D. R., D. L., S. C.,J-C. C., P. R.]; Centre Pluridisciplinaire d’Oncologie, CentreHospitalier Universitaire Vaudois, CH-lOll Lausanne [D. L., F. L.];and Laboratoire d’Immunologie des Tumeurs, Division d’Oncologie,Universite de Gen#{232}ve,1211 Geneva 14 [P-Y. D.], Switzerland

ABSTRACT

The expression by melanomas of multiple antigens thatare recognized by specific MHC class I-restricted CTLs hasbeen clearly demonstrated. The goal of many hnmunother-apy protocols being developed is, therefore, the inductionand/or augmentation of CTLS specific for such antigens.One approach has been to Immunize using irradiated autol-

ogous melanoma cells. Responses to this type of Immuniza-tion and others are often subsequently measured by delayed-type hypersensitivity (DTH) reactions. The aim of this workwas to characterize whether specific CTL responses occur atsuch DTH sites. Cutaneous DTH reactions were observedfollowing injection of irradiated autologous melanoma cellsexpressing known tumor antigens. We isolated lymphocytesfrom biopsies of DTH reaction sites and could measuremelanoma-specific CTL activity after 2-3 weeks of culture.The T-cell receptor-V�1 repertoire of the cultured lympho-

cytes, assessed by flow cytometry, was highly skewed in boththe CD4� and CD8� T-cell subsets. The repertoires weredifferent among cultures derived from independent biopsiesof simultaneous or subsequent DTH reaction sites and verydifferent to that of fresh peripheral blood lymphocytes

(PBLs) or PBLs cultured under the same conditions. Noparticular T-cell expansions dominated several DTH reac-

tion sites, nor could they be detected in PBLS. It appears that

Received 1 1/4196; accepted 2/11/97.

The costs of publication of this article were defrayed in part by thepayment of page charges. This article must therefore be hereby markedadvertisement in accordance with 18 U.S.C. Section 1734 solely toindicate this fact.I This work was supported in part by Grant 2304 from La Ligue SuisseContre Ic Cancer, Grant 31-40704.94 from the Swiss National ScienceFoundation, and a grant from the Terwindt Foundation (to P-Y. D.).2 Present address: DiagnoCure, Inc., Sainte-Foy G1V 2K8, Canada.Phone: (41 8) 527-6100; Fax: (418) 527-0240. To whom requests forreprints should be addressed.3 We regretfully announce the passing away of Dr. Stefan Carrel onMarch 18, 1996. We would like to take this opportunity to express oursincerest gratitude for his work.

T-cell responses to this type of immunization may be limitedto the local micmenvironment. Establishing the value ofDTH reactions in determining levels of systemic antitumor

immunity requires further investigation; however, such re-actions may indicate a patient’s competence to mount an

antitumor Immune response and enable the isolation oftumor-specific CTLs for use In tumor antigen identification.

INTRODUCTION

The recent description of numerous MHC class I-restricted

peptides derived from genes expressed by human tumors either

selectively (e.g., MAGE, GAGE, and BAGE) (1-3) or as cell

lineage-specific antigens (e.g., tyrosinase, Melan-AIMART-l,

gplOO, and gp7S) (4-8) and recognized by human CTLs has

prompted new interest in the potential of immunological inter-ventions using specific epitopes of such antigens in the treat-

ment of various cancers (reviewed in Refs. 9 and 10). The

central aim of most such interventions is the induction or aug-

mentation of CFL responses to antigens expressed by tumors.

To this end, several approaches have been used including im-

munization with irradiated autologous or semiallogeneic mela-

noma cells with or without adjuvants (11-14) and/or transfected

with cytokines such as granulocyte-macrophage colony-stimu-

lating factor (15), immunization with antigenic extracts of mel-

anoma cells either alone or in conjunction with adjuvants (16,

17), use of viral constructs engineered to express the antigenic

peptides or proteins (18, 19), immunization using antigen-pre-

senting cells pulsed with defined tumor antigens for expansion

of specific C’FLs (20), and intradermal injection of synthetic

peptides alone (21).

DTh4 reactions in the skin appear to be frequently ob-served in many such immunotherapy protocols and are often

used as an indicator of antitumor immunity and vaccine efficacy

(16, 17, 21). However, very little is known about either the

function, phenotype, specificity, or diversity of the lymphocytes

participating in such DTH reactions. Here we have determined

that diverse, functional CTLs specific for the immunizing cell

line are indeed present at DTH sites. Tumor-reactive CTL could

be derived from biopsies of such sites in a relatively short time.

We demonstrate a remarkable degree of heterogeneity in the

TCR repertoire of these tumor-reactive CTLs at different sitesbut no cumulative response over time (1 year). The rapid deri-

vation of melanoma-specific CTLs from the skin may be im-

4 The abbreviations used are: DTh, delayed-type hypersensitivity; TCR,T-cell receptor; TCR-C, TCR constant domain; TCR-V, TCR variabledomain; IL, interleukin; PBL, peripheral blood lymphocyte; HLA, hu-man leukocyte antigen; RT-PCR, reverse transcription-PCR; mAb,monoclonal antibody; LCL, lymphoblastoid B-cell line.

Research. on January 10, 2020. © 1997 American Association for Cancerclincancerres.aacrjournals.org Downloaded from

http://clincancerres.aacrjournals.org/

686 Melanoma-reactive CTLs in Cutaneous DTH Sites

portant when considering possible adoptive transfer of CTLs as

an immunological intervention. Moreover, these skin-derived,

autologous melanoma-specific C1’L clones could be extremely

useful as probes to identify novel tumor antigens.

Finally, whereas DTH reactions may be indicative of a

patient’s ability to respond to tumor antigens, establishing

whether the reactions adequately assess the level of systemic

T-cell reactivity to the specific immunogen requires further

investigation.

MATERIALS AND METHODS

Patient

Patient LAU63, a 65-year-old male (HLA-Al , A3, B8, Bx)with malignant melanoma (disease-free stage IIIAB, M. D.

Anderson scale) was enrolled in immunotherapy studies with

informed consent. This patient had previously undergone adju-

vant therapy whereby he received up to 3 X 106 units of IFN-a

three times per week for 1 year. This treatment was terminated

approximately 9 months prior to this work.

Immunization

An autologous melanoma cell line (Me235) was derived

from a tumor-infiltrated lymph node and maintained in RPM!

1640 supplemented with 10% FCS. These cells were transferred

to culture medium containing 5% autologous or pooled human

serum at least 2 days prior to injection. Before injection, the

cells were irradiated with a dose of 15,000 rads. A total of no

less than 2 x l0� (first immunization) and up to 10 X lO� cells

(subsequent immunizations) were injected intradermally at mul-

tiple sites (3 to 5) at 5-6-month intervals.

Biopsy and Lymphocyte Recovery

Punch biopsies (measuring 5 mm in diameter and approx-

imately 5 mm in depth) of DTH reactions were performed at day

5 at some of the injection sites. Lymphocytes infiltrating the

skin at the DTH reaction sites were harvested after mechanical

dissociation of the biopsies into small fragments using scissors

followed by treatment with 0.1% type I collagenase (Sigma

Immuno Chemicals, Fluka Chemie, Buchs, Switzerland) and

0.02% DNase (Boehringer Mannheim) in complete tissue cul-

ture medium. The enzymatic digestion was performed for 2 h at

37#{176}C.Lymphocytes were separated from the remaining nondi-

gested tissue fragments by allowing the clumps in the suspen-

sion to settle at 1 X g for 5-1 5 mm in normal medium and then

harvesting the lymphocytes from the supematant. Fragments

remaining after the 2-h digestion were further incubated over-

night in the enzyme solution. The lymphocytes from this diges-

tion were then harvested as before. Immunization site biopsy

series 2 and 3 were performed 5 and 1 1 months, respectively,

after the first series.

Lymphocyte Cultures

The skin lymphocytes obtained from the biopsies of DTH

reactions were cultured in 48-well plates in 1 ml of Iscove’s

Modified Dulbecco’s Medium supplemented with 10% pooled

human serum and penicillin and streptomycin (50 units/ml and

50 jig/mI, respectively), in the presence of recombinant IL-2

(200 units/ml, CTLL units) (a kind gift from Glaxo, Geneva,

Switzerland) and recombinant IL-7 (20 ng/ml) (Sigma, Lu-

cernaChem). After this, all cultures were stimulated weekly with

5 x l0� irradiated Me235 cells and maintained in the presence

of IL-2 (100 units/mI) and IL-7 (20 ng/ml), with the exceptionof cultures 1.2, 1.4, and 1.5, which were stimulated weekly with

2 X l0� irradiated Me235 cells and maintained in the presence

of only IL-2 (10 units/ml) after day 7.

Cloning CTLs from Biopsy Sites

Lymphocytes were sorted using a FACStar Plus (Becton

Dickinson, Mountain View, CA) from culture 1.5 on the basis of

the expression of both CD8 and TCR-V�32l.3. These cells werethen plated into 96-well plates at a dose of three cells/well.

These cultures were established with 1% phytohemagglutinin,

50 units/mI IL-2, irradiated Me235 cells (5 X l0� per well), and

irradiated mixed autologous and allogeneic PBLs (1 X l0� per

well). They were restimulated weekly with IL-2 (50 units/mI)

and irradiated Me235 cells (5 X l0� per well) and irradiated

mixed autologous and allogeneic PBL (1 X l0� per well).

Melanoma Cell Lines

Melanoma cell lines were derived from various patients

following mechanical dissociation of resected tumor metastases.

The autologous line Me235 as well as Me190 (HLA-A3, Ax,B7, Bx), Me200 (HLA-A3, A28, B39, Bw62), and Me243(HLA-A24, A29, B44, Bx) grew directly in vitro in RPM! 1640

supplemented with 10% FCS. Me197 (HLA-Al, A29, B7,

Bw52) and Me24l (HLA-A1, A33, B8, B14) were established

from tumors transplanted s.c. into nude mice.

Expression of Genes Encoding Tumor AntigensThe expression of various tumor antigens and �3-actin was

analyzed at the mRNA level using RT-PCR. Briefly, total

mRNA was isolated using Trizol (Life Technologies, Inc.), and

cDNA was synthesized as described previously (22). RT-PCR

was then carried out as described elsewhere (23) using the

following primer pairs for the indicated genes: (a) MAGE-1,

sense 5’-CGGCCGAAGGAACCTGACCCAG and antisense

5’-GCTGGAACCCTCACTGGGTfGCC; (b) MAGE-3, sense

5’-TGGAGGACCAGAGGCCCCC and antisense 5’-GGAC-

GATfATCAGGAGGCCTGC; (c) Melan-A, sense 5’-CTGAC-

CCTACAAGATGCCAAGAG and antisense 5’-ATCATGCA-TFGCAACA1TFATFGATGGAG; (d) tyrosinase, sense 5’-

GGATAGCGGATGCCTCTCAAAG and antisense 5’-CCC-

AAGGAGCCATGACCAGAT; (e) gplOO, sense 5’-GGAA-

GAACACAATGGATCTGG and antisense 5’-CACAGCAT-

CATATGAGAGTAC; and (t) �3-actin, sense 5’-GGCATCGT-

GATGGACTCCG and antisense 5’-GCTGGAAGGTGGA-

CAGCGA.

Immunohistology

Skin biopsies of injection sites were snap frozen using a

liquid N2/isopentane slurry. Thin sections were cut from frozen

tissue samples, labeled with nonconjugated mAbs against CD3,

CD4, CD8, or CD69, followed by a biotinylated anti-mouseimmunoglobulin, and finally with avidin-peroxidase and pro-

cessed, as described previously (24).



A B

L.

0

Ez0

C.)

Fluorescence Intensity (au.)

Actin

Clinical Cancer Research 687

Fig. 1 Antigen expression bythe autologous melanoma cellline Me235. In A, MHC class Iand II expression was assessedusing mAbs B9-12.l and D1-l2,respectively. Shaded curves,

HLA expression following IFN--y-induced up-regulation (48-htreatment with 50 units/mI). Anti-CD2 staining is shown as a neg-ative control for the MHC mAbsand as a control for IFN-’y induc-tion. Viable cells were selectedon the basis of forward and sidelight scatter profiles. Each histo-gram represents 10,000 cells. InB, analysis of the indicated geneswas performed by RT-PCR usingthe primers listed in “Materialsand Methods.” Me235 expresseddetectable amounts of each of thegenes relative to the referencecell lines MZ2-Mel3.0 and 5K-Mel-23.

Immunofluorescence Staining

Lymphocytes from either peripheral blood or skin biop-

sies were stained for two- or three-color flow cytometric

analysis using protocols described previously (25) with slight

modifications. Briefly, any mAb labeling involving an mdi-

rect step (e.g., anti-TCR-V�3 mAbs plus anti-mouse immu-

noglobulin-FITC) was followed by a blocking step using

mouse immunoglobulin prior to any further labeling steps

with directly conjugated mAbs. All mAbs were diluted in

PBS-5% FCS, and titrations were tested on fresh PBLs to

give optimal labeling. All staining was performed in a vol-

ume of 10 p.1 using a minimum of 5 X l0� cells and a

maximum of 106 cells in either V-bottomed tubes or V-

bottomed 96-well plates. Washing steps involved the addition

of at least a 10-fold larger volume of PBS-5% FCS. Cells

were resuspended in final volume of 300-400 p.1 for analysis

using a FACScan (Becton Dickinson). Analysis was per-

formed using the Lysys II software (Becton Dickinson).

mAbs used in this report were as follows. mAbs reactive

with TCRBV2 (E22E7.2), TCRBV3 (LE-89), TCRBV5S1

(IMMU 157), TCRBV5S2 (36213), TCRBV6S1 (CR1304.3),

TCRBV13S6 (JU74), TCRBV14 (Ca 243), TCRBV16 (Ta37),

TCRBV17 (El7.5F3), TCRBV18 (BA62), TCRBV2IS3 (IG

125), and TCRBV22 (IMMU 546) were all obtained from

Immunotech SA (Marseille, France); anti-TCRBV6S7 (OTl45)

0

CV)

c�I c�1 I

��c1)

MAGE-1

MAGE-3

Melan-A

Tyrosinase

gp-100

was obtained from T Cell Diagnostics Inc. (Cambridge, MA);

anti-TCRBV9 (MKB-1 P1.2) and anti-TCRBV23 (Hut 78)

was a gift from Dr. 0. Kanagawa; anti-TCRBV13S1

(Hl3l.21.5.l4.2) and anti-TCRBV13S2 (Hl3.2) was a gift from

Dr. J. Kappler (Howard Hughes, Denver, CO); anti-TCRBV5S3

(3D1 1) and anti-TCRBV8 (MX6) were both produced by Dr. S.

Carrel (Ludwig Institute for Cancer Research, Lausanne

Branch); anti-CD4, anti-CD8, and anti-CD28 mAbs were ob-

mined from Becton Dickinson.

Molecular Analysis of TCR-V(1

Sequencing of TCR-V�3 Expressed by Clone 2C4. ThisMe235-reactive CTL clone was derived from biopsy culture 1.5

after sorting cells expressing CD8 and TCR-V�32l using a

FACSstar Plus (Becton Dickinson) and culturing at limiting

dilution (three cells/well). Total mRNA was isolated from the

expanded clone using Trizol (Life Technologies, Inc.), and

cDNA was synthesized as described (22). RT-PCR specific for

TCR-V�32l was then performed (35 cycles) using 2 pA of cDNA

as template in a final volume of 100 p.1 using the following

primer pair: TCR-V�32l sense 5’-ATTCACAGUGCCTAAG-

GATCGA and TCR-C�3 antisense 5’-TGCTGACCCCACTGT-GCACCTCcTFCCCATh PCR products were purified using

QlAquick PCR Purification kits (Qiagen, Basel, Switzerland),

and the purified products were directly sequenced using the




# �f(� V

!,�

:,

� -

�

. L- �

� � #{149}�t’ � �

Fig. 2 1-cell infiltration at cutaneous DTH reactions following injection of irradiated autologous melanoma cells. Frozen sections were labeled with

mAbs against CD3 (A), CD4 (B), CD8 (C), and CD69 (D) and developed using anti-mouse immunoglobulin-biotin and avidin-peroxidase. Positivelabeling is indicated by a red-brown color. E, negative control-labeling in the absence of a first-layer mAb. X 150.

Sequenase Version 2.0 DNA Sequencing kit (United States

Biochemical, Cleveland, OH) with slight modifications (26).

The TCR-V�32l PCR primer used above for PCR amplification

was used here to sequence the sense strand, whereas the anti-

sense strand was sequenced using an internal TCR-C� primer

5’-GCTFCTGATGGCTCAAACAC.

CDR3 Size Analysis of TCR-V�1 Transcripts. The size

of the CDR3 region of selected PCR-amplified TCR-V�3 tran-

scripts was analyzed using a run-off procedure, as previously

described (27). Briefly, total RNA was prepared from the T cell

clone and skin biopsies (I to 5 X 106 cells or approximately 100

mg tissue) using Trizol (Life Technologies, Inc.), and converted

to cDNA by standard methods using reverse transcriptase and an

oligo dT primer. These cDNAs were amplified using an exper-

imentally validated TCR-V�32l specific sense primer paired to

one TCR-C�3 anti-sense primer in a 40 cycle RT-PCR (28).

Then, 2 �il aliquots of the PCR products were subjected to I to

5 cycle run-off reactions using dye-labeled oligonucleotide

primers, specific either for TCR-C�3 or one of the 13 human

junctional TCR-J�3 segments. In the case of clone 2C4, an




Table 1 Lymphocyte recoveries from skin biopsies followingmechanical dissociation, collagenase digestion, and in vitro

stimulation

Biopsy Seeded cell no.a Cell no.a Cell no.a Fold increaseno. Day 0 Day 7 Day 15 Days 0-15

2.1 <0.5 1.1 70 �1402.2 <0.5 0.7 43 “80

2.3.1 <0.5 1.5 59 -‘.110

2.3.2 <0.5 1.1 57 -‘.110

PBL 0.5 0.9 10 20

For the first 7 days, cultures were maintained in the presence of

IL-2 (200 units/mI), IL-7 (20 ng/ml), and 5 X 10’ irradiated Me235 cellsin a volume of 1 ml (in 48-well plates). After day 7, all cultures weremaintained in the presence of IL-2 (100 units/mi) and IL-7 (20 ng/ml)

and restimulated weekly with 5 X l0�’ irradiated Me235 cells/well and5 x 10’ irradiated autologous PBLS as feeders.

a Xl06.

oligonucleotide primer specific for the N region was synthesized

and used to probe for the presence of this clone in peripheral

blood and other injection site skin biopsies. The mn-off products

were separated on an automated sequencer (Applied Biosys-

tems), in the presence of fluorescent size markers. The length of

DNA fragments and the fluorescence intensity of the bands were

analyzed with the Gene Scan Analysis software (Applied Bio-

systems).

CTL Assay

Specific CTL activity was assessed using a conventional

5tCr release assay as described previously (29). All assays were

performed in the presence of a 50-fold excess of K562 cells as

cold-target inhibitors. Target cells (1000 per well), K562, and

varying numbers of effector cells (to give effector:target ratios

ranging from 1 : 1 up to 100: 1 in some experiments) were incu-

bated in V-bottomed microwells for 4 h at 37#{176}C,and chromium

release was measured thereafter.

RESULTS

Characterization of the Human Melanoma Cell LineUsed for Immunization. A melanoma cell line (Me235) wasderived from a surgically excised tumor-infiltrated lymph node

of the patient. This cell line expressed high levels of MHC class

I molecules, which were up-regulated by treatment with IFN--y(Fig. 1A). The majority of these cells did not constitutively

express MHC class H but were positive following treatment

with WN--y (Fig. 1A). An unrelated antigen, CD2, showed no

increase following IFN--y treatment. Analysis at the mRNA

level of the expression of genes encoding various antigens by

RT-PCR demonstrated that Me235 expressed the tumor antigens

MAGE-1 and MAGE-3, and the melanocyte lineage-specific

antigens gplOO, tyrosinase, and Melan-A (Fig. 1B). Me235

appeared, therefore, to be a good vaccine candidate and was

irradiated and injected intradermally to evaluate its potential

immunogenicity.

T Cells Are Present among Lymphocytes InfiltratingDTH Sites. The sites of injection of the autologous melanoma

cell line Me235 showed evidence of local inflammation, cry-

thema, and induration typical of DTH reactions. To analyze the

response occurring at these sites, punch biopsies were

performed at day 5 after immunization. Immunohistological

examination of biopsies of the DTh sites revealed a large

proportion of T cells among the cells infiltrating the injection

sites (Fig. 14). Both CD4- and CD8-positive cells were present

(Fig. 2, B and C, respectively), and many of these expressed

classical T-cell activation markers such as CD69 (Fig. 2D).

Lymphocytes Harvested from Biopsies of DTH Reac-tion Sites Proliferate in the Presence of Autologous Mela-noma Cells. Lymphocytes were recovered from the biopsiesby mechanical dissociation and collagenase digestion. These

lymphocytes, usually not more than approximately 5 X l0�’ per

biopsy, were cultured with IL-2, IL-7, and 5 X l� irradiated

Me235 cells. In parallel, an equivalent number of PBLs were

placed into culture under the same conditions. As shown for the

second series of biopsies (Table 1), after 15 days the number of

lymphocytes had increased in all cultures, but the most dramatic

increase was seen in the lymphocytes derived from the biopsies

of the DTH sites. In contrast to the injection-site biopsies, we

were unable to obtain enough cells for further analyses from a

similar skin biopsy taken at a distant, noninjected site (data not

shown).

Selection of Melanoma-reactive CTLs from BiopsySites. We carried out phenotypic and functional analyses of

day 15 cultures derived from the first series of biopsies. At this

time point, the percentage of CD3� cells in each culture was

85% or more (Fig. 3A). In cultures 1.2 and 1.4, CD4� T cells

comprised the vast majority, whereas not more than 5% of the

cells expressed CD8 (Fig. 3B). In contrast, the overall pheno-

typic profile was more heterogeneous in culture 1 .5 (these

lymphocytes came from an overnight digestion of pooled frag-

ments remaining after the initial 2-h collagenase digestion of

two biopsies), with approximately 20% of the cells expressing

CD8. As can be seen in Fig. 3C, the vast majority of CD8� T

cells in these cultures, as in all other cultures of lymphocytes,

expressed CD28, with the proportion of CD8 cells expressing

CD28 being roughly equal to those belonging to the CD4 subset

in the panel above. The CD4� subset in PBLs usually expresses

slightly higher levels of CD28 than CD8� T cells (30). In the

presence of Me235 cells, the lymphocyte populations in each

culture became increasingly skewed toward the CD8� T-cell

subset (Fig. 3, D and if).

In parallel with the phenotypic studies at days 15 and 28,

we assessed the levels of CTL activity against the Me235 line or

an autologous EBV-transformed lymphoblastoid cell line (Fig.

4). In addition, CTL activity was measured at day 28 against a

panel of semiallogeneic or allogeneic melanoma cell lines (Fig.

4). The CTL activity in the cultures at day 15 against either the

autologous Me235 cells or the EBV-transformed cells was at

best only very low. However, on day 28, CTL activity against

Me235 was easily detected, with the highest activity seen clearly

in culture 1 .5. At no time were the CTLs in these cultures

specific for either MAGE-l.A1 or MAGE-3.Al peptides re-

stricted to HLA-A1 because pulsing targets (particularly the

autologous EBV line) with either peptide did not significantly

alter the levels of lysis (data not shown). It should be noted that

the Me235 cells express both MAGE genes, as determined by

RT-PCR (Fig. 1), and they are efficiently recognized by both

HLA-Al-restricted MAGE-l- and MAGE-3-specific CTLclones (data not shown).



1.2 I .4

1..

w.0E

z

C)

1.5

� � � J�101

A

10� i�#{233}’#{149}i0 �1 � 1#{233}2� �3 I

CD3Ia’

B

C’l

C-)

E

CD8


Fig. 3 Phenotypic profiles of cultured lym-

phocytes derived from biopsies of DTH reac-

tions induced by injection of irradiated auto-

C logous melanoma cells. A. CD3 expression bylymphocytes following 2 weeks of culture. B,CD4 versus CD8 expression at 2 weeks. C,CD28 versus CD8 expression showing that allof the CD8� cells expressed CD28 at 2 weeks.D, CD28 versus CD8 expression at week 3,showing the increasing percentage of

CD8�CD28� cells. E, week 4 profile of CD28versus CD8 with increased skewing towardCD8�CD28� cells. Viable lymphocytes were

D selected by gating using forward and side lightscatter. Each plot represents at least 10,000

cells.

TCR-V�3 Repertoire Skewing among Cultured Lym-phocytes from Biopsy Sites. Although the TCR-V�3 reper-

toire was not characterized at the time of biopsy because of the

low lymphocyte recovery, the proliferation that occurred in the

following weeks allowed us to perform quantitative TCR-V�

repertoire analyses using a panel of anti-TCR-V�3 mAbs.

The various cultures demonstrated diverse TCR-V�3 reper-

toires with a relatively large amount of variation among biopsy

sites (Table 2). For example, CD8� T cells from culture 1.2

expressed mainly V�l6; in culture 1.4, those expressing V�2

dominated, and in culture 1.5, CD8� cells expressing V�32l.3

were the most frequently detected. In the other series, CD8� T

cells expressing V�32, V�35.1, or V�3l3.2 were also present at

elevated frequencies relative to either fresh or cultured PBLs. In

some cultures (e.g. , 2.2) dominant V�3 expression could not be

determined because of the limited nature of the panel of anti-

TCR-V� mAbs. The skewing in the CD8 subset in each culture

became more pronounced with each restimulation with the

Me235. Stimulation of each culture with anything other than

Me235 resulted in drastic reductions in both the fraction of

CD8� T cells and the frequency of cells expressing the V�3

domains mentioned above (data not shown). Interestingly, we

also observed significant biasing of the repertoire in the CD4�

T-cell subset in the cultures relative to PBLs.



U)U)>1

UI.-

U

aU)

80

60

40

20

0


1#{174}

::40’

20

0

Me235 auto EBV LCL

�

�

:�80

60

�80

60’

40’

20

n�

Me235 auto EBV LCL

��

Me190

�

Me197

�;Me200

�

Me241

�Me243

- . m . �-i��I

C1R-Al

�

I 31030 131030

Lymphocyte to target cell ratio

-.- 1.2 -#{149}-1.4 -t-- 1.5

Fig. 4 CTL activity against autologous and allogeneic target cells.CTL activity was measured in a standard “Cr-release assay as de-scribed. Me235 is the autologous melanoma cell line; auto EBV LCL is

an autologous EBV-transformed lymphoblastoid B-cell line; andMel9O, Me197, Me200, and Me24l are all melanoma cell lines sharingone or more HLA class I alleles with Me235. Me243 does not share anyHLA-A or -B alleles with Me235 (HLA-C was not determined).C1R-Al is a C1R cell line stably transfected with HLA-Al.

The first series of biopsies demonstrated the expansion of

a different repertoire of tumor-reactive cells from each immu-

nization site. In the two subsequent series of injection-site

biopsies, the development of independent repertoires in different

sites was again observed. With the exception of V�32� cells

from cultures 1.4 and 2.1 and V�3l3.2 in cultures 1.4 and 3.1, we

did not repeatedly see the preferential expansion of CD8� T

cells expressing previously elevated V�.3 domains.

A single biopsy (2.3) was divided into two pieces before

lymphocyte isolation and culture (cultures 2.3.1 and 2.3.2) to

determine whether the limiting cell numbers present in biopsies

would give rise to different T-cell populations. As shown in

Table 2, the two cultures demonstrated both very different T-cell

phenotypic profiles (CD4:CD8 ratio) and TCR-V�3 repertoires,

suggesting that the T-cell pool present before culture is limiting,

giving rise to a randomly selected pool from which tumor-

specific cells are derived. As before, we detected specific CU

activity against the Me235 cell line in each culture (data not

shown).

CTL Activity of Cells Expressing Defined TCR-V�3 Do-mains. To identify which cells were responsible for the specific

C’.FL activity against the Me235 tumor line, cells from biopsy series

1 cultures were sorted by fluorescence-activated cell sorting

according to the expression of CD8 and the various V�3 that were

expanded. Thus, from cultures 1.2, 1.4, and 1.5, we sorted

CD8�V�316� cells, CD8�V132� cells, and CD8�Vf321.3� cells,

respectively. After several weeks of restimulation and proliferation

induced by continuous culture with Me235, high levels of CTL

activity against Me235 were demonstrated by the Vf32� cells and

V�32l.3� cells, whereas the cells expressing V�316 from culture 1.2

had a lower activity (Fig. 5). The latter cells could not be tested

against the auto EBV LCL target because they proliferated poorlyafter sorting.

Functional and Molecular Analysis of an Me235-reac-tive CU Clone. The population of sorted CD8�V�32l.3�cells from culture 1.5 was plated at limiting dilution in the

presence of Me235 cells and IL-2. One of the clones, 2C4,

selected on the basis of rapid growth, was shown to be cyto-

lytically active specifically against Me235 (Fig. 6A). Total RNAfrom clone 2C4 was prepared, and following cDNA synthesis, a

TCR-V�32l-specific V�3/C�3 TCR fragment was amplified by

PCR. The PCR product was directly sequenced and revealed a

V�321.3, D�3l.1, J�32.7, Cr32 rearrangement (Fig. 6B).

We used a PCR assay that takes advantage of the TCR �3

chain CDR3 size heterogeneity of different T-cell clones to deter-

mine the presence of clone 2C4 in vivo. This assay has previously

been shown to be a very useful tool for detecting in vivo oligoclonal

expansions in T-cell populations and to search in vivo for in

vitro-derived CTL clones using N region-specific primers (31).

TCR-V�3/C�3 PCR products were further amplified with a nested

fluorescent C�3 or J�3 primer. The sizes of the fluorescent mn-off

products thus obtained were deteimined by electrophoresis on an

automated DNA sequencer. The size variations of the mn-off

products are only due to differences in the lengths of CDR3

regions, reflecting the imprecise V/D/J joining mechanism. InPBLS from healthy donors, the repertoire of any V�3-C�3 and V�3-J�3

combination is usually represented by a bell-shaped profile with

peaks spaced 3 nucleotides apart corresponding to in-frame

sequences (27).

As expected from its sequence and the position of the

respective primers (C�3, J(32.7, and N), clone 2C4 was charac-

terized by a single peak at 143 nucleotides when its cDNA was

analyzed using the fluorescent C�3 primer (Fig. 6C), at 102

nucleotides using the Jf32.7 primer (Fig. 60, and at 66 nude-

otides with the N primer (data not shown). There was no

dominant peak in TCR-V�321 transcripts extracted from biopsies

2.2 and 4.1, where the profiles obtained suggested a polyclonal

population (Fig. 60. The absence or very low frequency of

clone 2C4 in both these skin biopsies was confirmed using the

J�32.7 primer because no peak was observed at the size of 102

nucleotides. In contrast, a predominant peak was noted in biopsy




Table 2 TCR-V�3 repe rtoires of lym phocytes fro m either fresh P BLs, cultures of PBLs, or skin-infiltrating lymphocyt es derived fr om injection-site biopsies

Fresh CulturedPBLs PBLs Biopsy series 1 Biopsy series 2 Biopsy 3

Culture Culture Culture

1.2 1.4 1.5 2.1 2.2 2.3.1 2.3.2 3.1

TCR-V�3 CD4 CD8 CD4 CD8 CD4 CD8 CD4 CD8 CD4 CD8 CD4 CD8 CD4 CD8 CD4 CD8 CD4 CD8 CD4 CD8domain 60� 7 66 34 91 5 83 14 48 47 36 64 5 95 3 97 45 55 73 21

2 7.6” 5.0 1 1.5 3.7 0.7 0.2 22.6c 69.6 20.2 1.5 18.9 93.4 3.4 36.0 5.4 20.0 1.23 0.5 2.3 3.1 1.0 0.2 2.4 0.2

5. 1 ND” ND 5.8 ND ND ND ND ND ND 12.55.2 0.6 0.6 29.5 1.8 0.2 0.3 0.4 0.2

5.3 1.2 1.0 4.1 13.0 0.6 1.4 0.3 2.5 0.56. 1 ND ND ND ND ND ND ND ND6.7 3.6 0.6 3.8 1.1 0.3 61.6 7.5 12.8 1.1 3.7 9.2 2.5 12.68 5.3 3.0 2.3 3.2 0.4 7.4 0.4 10.0 3.8 2.5

9 3.5 1.6 0.4 3.0 0.2 3.4 3.813.1 3.5 2.5 28.8 8.1 0.4 0.2 7.6 0.6 7.5 53.2 8.213.2 1.6 1.3 0.6 2.7 10.3 0.7 1.5 4.8 10.514 2.4 14.1 6.0 21.2 6.5 5.0 0.5 11.7 1.8 72.4 13.6 18.7 22.8 6.716 1.0 1.2 0.7 62.7 0.3 0.3 0.6 0.717 6.0 4.3 4.0 4.6 7.6 0.3 0.3 3.4 2.6 2.818 1.0 0.6 0.2 0.2 0.3 0.3 0.6 0.4 5.621.3 2.4 2.0 17.0 0.5 0.6 0.2 3.0 22.0 4.7

22 3.5 8.7 0.3 0.9 0.3 3.9 2.8 1.4 2.6 9.4 2.7 4.2

23 0.5 2.7 0.2 0.3 0.3 1.2 0.8 1.0 3.8 2.0

Total 43.7 46.6 79.9 28.3 73.5 76.4 95.7 94.4 79.1 35.1 95.0 93.4 23.6 0 51.6 12.5 94.3 14.8 80.5 29.6

Cultures were maintained under the conditions given in Table 1, with the exception that culture 1.5 contained IL-2 (100 units/ml) and LL-7 (10ng/ml) in the first 7 days and that all cultures from series 1 were maintained after day 7 with IL-2 only (10 units/ml).

a Values represent the percentage of cells in the cultures with the given phenotype.b Numbers correspond to the percentage of cells within the indicated subset expressing the given TCR-V(3 domain. Blank space indicates <0.2%.C Numbers in boldface correspond to those TCR-V�3 domains expressed at a significantly higher percentage than in fresh PBLS.d ND, not determined.

3.2 but at a different size ( 149 nucleotides), suggesting the

presence of a different clonal population. This peak was due to

a rearrangement to the J�32.5 gene segment, whereas no detect-

able V�32l transcripts were rearranged to J�32.7. Using the

primer specific for its N region, clone 2C4 was not detected in

any of the skin biopsies or in pre- and postimmunization PBLS,

even after five cycles of mn-off (data not shown). This result

suggests that clone 2C4 was either absent or present at a very

low frequency (< 1 in iO� T cells; Ref. 27).

DISCUSSION

Immunological interventions for the treatment of malignant

melanoma (and other cancers) aimed at generating effective

T-cell immunity require the in vivo induction and expansion of

CTL clones specific for antigens expressed by the melanoma.

The characteristics of interactions between tumors and the im-

mune system that lead to the development of clinically signifi-

cant CTL responses are not clearly defined. For example, the

DTh reaction has been reported in various cancer immunother-

apy protocols (16, 17, 21), but the relevance of this response to

overall tumor immunity is controversial. We have determined

that specific CTLs can be isolated from the lymphocytes par-

ticipating in DTH reactions following intradermal injection of

irradiated autologous tumor cells into the skin over a period of

I year. We found different, highly skewed repertoires among T

cells localized at the different injection sites. Similar results

have recently been obtained in a mouse experimental model (32)

and from injection site DTH biopsies in another patient under

study in this group (data not shown). Within these T-cell pop-

ulations we observed diverse CTLs specific for as yet unknown

tumor peptides but minimally not the HLA-Al-restricted pep-

tides of MAGE-l or MAGE-3. The presence ofCU specific for

the autologous melanoma in the biopsy sites in the skin was

consistently observed in each series of injections and biopsies

over the 1-year period.

In the absence of any molecular or functional characteriza-

tion of the TCR repertoire in situ before injection and at the time

of biopsy, we are not able to say how these CTLs arose, i.e.,

through antigen-specific or nonspecific recruitment or by

induction of proliferation of resident skin lymphocytes.

Given the low levels of specific CTL activity observed at the

early in vitro time points, we assume that the majority of cells

present at the time of biopsy were most likely not specifically

reactive with the immunizing autologous melanoma cells

(using conventional CU assays to measure their function),

consistent with previous measurements of specific T-cell

frequencies in inflammed skin lesions (33). Nonetheless, the

number of melanoma-reactive CTLs was probably greater

among DTH lymphocytes than among the same number of

PBLs because proliferation following stimulation with



‘1 Ut?

CD8�V�l16�

80

0)0)>1

U

00)

0)

80

60

40

20

CD8�VI12�

.�.-. .CD8�V1321�

1,

80

60


40

20

0 ‘ � ‘

3 10 30 100

Lymphocyte to target cell ratIo

-0�- Me235

-.-- Auto EBVLCL

Fig. 5 CTL activity against Me235 and autologous EBV LCL of T-cellpopulations sorted according to TCR-V�3 expression. Cells were labeled

using CD8 and the relevant mAbs against the indicated TCR-V�3 do-main. Sorted cells were cultured with Me235 for 4-6 weeks to allowexpansion before testing in the “Cr-release assay.

Me235 was greater, and CU activity could be easily detected

in DTH lymphocytes.

After coculture with the autologous tumor, we observed

a pronounced skewing of the TCR-V�3 repertoire in each

culture and a gradual increase in the percentage of CD8� T

cells. The TCR repertoire skewing in the CD8� subset was

not due to the presence of CD28 cells, shown previously to

be comprised of oligoclonal populations of cells with a

highly biased TCR-V�3 repertoire (34). In each culture, the

TCR-V�3 repertoire skewing was different. We could imagine

that the low number of cells present in each biopsy (on the

order of iO� cells, of which only part are CD8� T cells)

would give rise to a repertoire of very limited diversity. Thus,

random sampling of such a limited T-cell pool could account

for the heterogeneity of the responses from one site to the

next. In addition, we must bear in mind that the autologous

tumor cell line used for the immunizations expressed multiple

tumor antigens, which could conceivably lead to the presen-

tation of several CTL epitopes in the context of more than

one MHC molecule inducing selection of multiple CTLs with

diverse specificity, as has been shown previously (4, 9, 12,

14, 35). A murine model suggests that the CTL response may

lock on to a few antigenic determinants early on (32). Thus,

some specific CTL clones may be selected randomly from a

pool of limited size and diversity and proliferate at the

expense of other potentially specific CTL clones. Regardless,

the repertoire restrictions observed were entirely dependent

on the presence of the Me235 line. Omission of the autolo-

gous melanoma line from the cultures resulted in a reversal of

both the subset and repertoire skewing. This selection of

CD8� T cells through the induction of dramatic proliferation

in the presence of the Me235 line suggested specific recog-

nition of MHC class I-restricted antigens expressed by the

cell line. Indeed, CTL activity could be inhibited efficiently

by the anti-MHC class I mAb W6/32 (data not shown).

Interestingly, in the earlier cultures significant repertoire

skewing was also seen in the CD4� T-cell subset, consistent

with other reports showing CD4� T cells reacting with mela-

nomas (36-38). The reason for such selection in this subset is

not clear, but it should be noted that a minor fraction (1-3%) of

the stimulating cell line Me235 constitutively expresses MHC

class II molecules at the cell surface and that following exposure

to !FN--y, the majority of cells express MHC class II. In this

regard, we have observed IFN-’y production by CD8� T cells

recognizing Me235 (data not shown).

Tumor-specific CTLs derived from biopsies of DTH

reactions may be useful in screening genomic or cDNA

libraries to identify genes encoding new target antigens in

immunizing tumor cell lines. This approach has proved suc-

cessful using CTLs derived from circulating lymphocytes or

tumor-infiltrating lymphocyte cultures (2-6, 8, 9). In this

context, although the biopsies were from an HLA-Al mdi-

vidual, it is interesting that thus far, none of the CTLs

obtained have shown any specificity for the known HLA-A1-

restricted epitopes from MAGE-1 or MAGE-3. In any case,

new peptide epitopes from any of the known tumor genes or

from new genes may prove to be important as immunogens

for the induction of CTL.

The relevance of the CTLs derived from each biopsy site to

the overall level of specific CTL immunity was investigated

using a PCR-based approach (27, 31) because the exact anti-

genic specificity of the clones was not known. After determining

the nucleotide sequence of the TCR-�3 chain of clone 2C4, we

probed PBL and subsequent immunization-site biopsies (before

in vitro expansion) using a clonotypic N-region primer. We

were unable to detect any T cells using the same TCR-�3 chain

as the clone (i.e., using the same rearrangement with similar

CDR3 length or using the same N-region), suggesting that this

clone may not have expanded sufficiently in vivo to allow

subsequent detection. Indeed, a large degree of proliferation

would have been required to detect the clone in the PBLs (by

PCR) or to have homing of the clone to subsequent imrnuniza-

tion sites (where it might be re-isolated and expanded in vitro).

In fact, the CTLs isolated from each DTh biopsy and expanded

in vitro may not have produced any progeny in vivo simply



U,U,

>1

C.,

a.U,

5 #{149}CTC AA& 00k GTA GAC TCC Ac? CTC AAG ATC

L K G V D S T L K I

CAG C�T OCA AAG CTT GAG GAC TCG 0CC OTO

Q P A K L E D S A V

TAT CTC TOT 0CC AOC AGC ?PA GAC AGA 0CC

Y L C A S S L D R A

A B

100�

0�301�

Lymphocyte to target cell ratIo

-0- Me235

. Auto EBV LCL

C

TAC GAG CAG TAC TTC

Y K Q V F

CTC ACO GTC ACA GAG

I, T V T K

TTC CCA CCC GAF P P

000 CCG QOC ACC AUG

U P 3 T R

GAC CTG AAA AAC GTG

D L K N V

clone 2C4

Biopsy 2.2

Biopsy 3.2

Biopsy 4.1

694 Melanoma-reactive CFLs in Cutaneous DTH Sites

V�21-C�3I,,.I,,.I’

120 140 160

�V�321-J�2.7

‘

80 100 120

4V�21-J�32.5.

100 120

-“-

146JL

99 1�1e 120

.�.

149 111

149 108 105

because the conditions in vivo were not appropriate (e.g., limited

antigen or cytokines) or because the precursors were removed

from the site in the biopsy. Therefore, the failure to detect in

vivo the clones expanded in vitro does not necessarily imply that

no systemic antitumor immunity resulted from the immuniza-

tion. The kinetics of the response and any clonal dominance that

may ensue in vivo and its relevance to that seen in vitro require

further study.

In summary, the T cells found participating in DTh reac-

Lions induced by injection of autologous melanoma cells appear

to be randomly sampled from a T-cell pool of limited size.

Nonetheless, a portion of the CTLs present at each of the sites

showed specificity for the immunizing cell line. Thus, the DTHreactions may indicate the potential of the patient’s immune

Fig. 6 Functional and molecular

characteristics of autologous melano-ma-specific T-cell clone 2C4 and its

absence from subsequent DTH reac-tion site biopsies. Clone 2C4 was de-rived from CD8�V�32l� cells sortedby flow cytometry and cultured inlimiting dilution. A, 51Cr-release as-say showing that clone 2C4 specifi-cally lyses the autologous melanomaline Me235 but fails to react with theautologous EBV LCL. B, partial

cDNA sequence of the TCR-�3 chainof clone 2C4. C, CDR3 size profilesof V�321/C�3 and selected V�321/J(3run-off products for clone 2C4 andsubsequent immunization site skin bi-opsies. All steps (first PCR, mn-offreaction, and migration) were donesimultaneously. The graphs repre-senting CDR3 size patterns were nor-malized to 100% for the most intensepeak.

system to mount a response to particular immunogens. Indeed,

specific CTLs derived from these sites could eventually be

useful as probes for detecting new tumor antigens or as effectors

in adoptive immunotherapy protocols.

ACKNOWLEDGMENTS

We thank Nicole Montandon, Magali Schreyer, Danielle MinaIdis,

Valerie Schnuriger, and Anne-Lise Quiquerez for technical assistance.

Our thanks also go to Drs. J. Kappler and 0. Kanagawa for the kind gifts

of mAbs against various TCR-V�3 domains. We would also like to give

special thanks to patient LAU63 for his enthusiastic collaboration and

the personnel of the Centre Pluridisciplinaire d’Oncologie for their hardwork in collection of blood samples.




REFERENCES

1. Dc Plaen, E., Arden, K., Traversari, C., Galorio, J. J., Szikora, J. P.,Dc Smet, C., Brasseur, F., van der Bruggen, P., Leth#{233},B., Lurquin, C.,Brasseur, R., Chomez, P., de Backer, 0., Cazenave, W., and Boon, T.Structure, chromosomal localization, and expression of 12 genes of theMAGE family. Immunogenetics, 40: 360-369, 1994.

2. Van den Eynde, B., Peeters, 0., de Backer, 0., Gaugler, B., Lucas,

S., and Boon, T. A new family of genes coding for an antigen recog-nized by autologous cytolytic T lymphocytes on a human melanoma. J.Exp. Med., 182: 689-698, 1995.

3. Boel, P., Wildmann, C., Sensi, M. L., Brasseur, R., Renauld, J. C.,

Coulie, P., Boon, T., and van der Bruggen, P. BAGE: a new geneencoding an antigen recognized on human melanomas by cytolytic Tlymphocytes. Immunity, 2: 167-175, 1995.

4. W#{246}lfel,T., Van Pd, A., Brichard, V., Schneider, J., Seliger, B.,Meyer zum Buschenfelde, K. H., and Boon, T. Two tyrosinase non-apeptides recognized on HLA-A2 melanomas by autologous cytolytic Tlymphocytes. Eur. J. Immunol., 24: 759-764, 1994.

5. Coulie, P. 0., Brichard, V., Van Pci, A., W#{246}lfel,T., Schneider, J.,Traversari, C., Mattei, S., Dc Plaen, E., Lurquin, C., Szikora, J. P.,Renauld, J. C., and Boon, T. A new gene coding for a differentiationantigen recognized by autologous cytolytic T lymphocytes on HLA-A2melanomas. J. Exp. Med., 180: 35-42, 1994.

6. Kawakami, Y., Eliyahu, S., Delgado, C. H., Robbins, P. F., Rivoltini,L., Topalian, S. L., Mild, T., and Rosenberg, S. A. Cloning of the genecoding for a shared human melanoma antigen recognized by autologousT cells infiltrating into tumor. Proc. Natl. Acad. Sci. USA, 91: 35 15-3519, 1994.

7. Cox, A. L., Skipper, J., Chen, Y., Henderson, R. A., Darrow, T. L.,

Shabanowitz, J., Engelhard, V. H., Hunt, D. F., and Slingluff, C. L., Jr.Identification of a peptide recognized by five melanoma-specific humancytotoxic T cell lines. Science (Washington DC), 264: 716-719, 1994.

8. Wang, R. F., Robbins, P. F., Kawakami, Y., Kang, X. Q., andRosenberg, S. A. Identification of a gene encoding a melanoma tumorantigen recognized by HLA-A3l-restricted tumor infiltrating lympho-cytes. J. Exp. Med., 181: 799-804, 1995.

9. Boon, T., Cerottini, J. C., Van den Eynde, B., van der Bruggen, P.,and Van Pd, A. Tumor antigens recognized by T lymphocytes. Annu.Rev. Immunol., 12: 337-365, 1994.

10. Boon, T., Gajewski, T. F., and Coulie, P. G. From defined humantumor antigens to effective immunization? Immunol. Today, 16: 334-

337, 1995.

11. Berd, D., Maguire, H. C., Jr., McCue, P., and Mastrangelo, M. J.Treatment of metastatic melanoma with an autologous tumor-cell vac-

cine: clinical and immunologic results in 64 patients. J. Clin. Oncol., 8:1858-1867, 1990.

12. Herr, W., W#{246}lfel,T., Heike, M. Meyer zum BUschenfelde, K. H.,

and Knuth, A. Frequency analysis of tumor-reactive cytotoxic T lym-phocytes in peripheral blood of a melanoma patient vaccinated withautologous tumor cells. Cancer Immunol. Immunother., 39: 93-99,1994.

13. Hoon, D. S. B., Yuzuki, D., Hayashida, M., and Morton, D. L.Melanoma patients immunized with melanoma cell vaccine induceantibody responses to recombinant MAGE-l antigen. J. Immunol., 154:730-737, 1995.

14. Lehmann, F., Marchand, M., Hainaut, P., Pouillart, P., Sastre, X.,Ikeda. H., Boon, T., and Coulie, P. G. Differences in the antigensrecognized by cytolytic T cells on two successive metastases of amelanoma patient are consistent with immune selection. Eur. J. Immu-nol., 25: 340-347, 1995.

15. Dranoff, G., Jaffee, E., Lazenby, A., Golumbek, P., Levitsky, H.,Brose, K., Jackson, V., Hamada, H., Pardoll, D., and Mulligan, R. C.Vaccination with irradiated tumor cells engineered to secrete murinegranulocyte-macrophage colony stimulating factor stimulates potent,specific, and long-lasting anti-tumor immunity. Proc. Natl. Acad. Sci.USA, 90: 3539-3543, 1993.

16. Bystryn, J. C., Oratz, R., Roses, D., Harris, M., Henn, M., and Lew,R. Relationship between immune response to melanoma vaccine immu-

nization and clinical outcome in stage II malignant melanoma. Cancer(Phila.), 69: 1 157-1 164, 1992.

17. Schultz, N., Oratz, R., Chen, D., Zeleniuch-Jacquotte, A., Abeles,G., and Bystryn, J. C. Effect of DETOX as an adjuvant for melanomavaccine. Vaccine, 13: 503-508, 1995.

18. Irvine, K. R., McCabe, B. J., Rosenberg, S. A., and Restifo, N. P.Synthetic oligonucleotide expressed by a recombinant vaccinia viruselicits therapeutic C’I’L. J. Immunol., 154: 4651-4657, 1995.

19. Chen, P. W., Wang, M., Bronte, V., Thai, Y., Rosenberg, S. A., andRestifo, N. P. Therapeutic antitumor response after immunization witha recombinant adenovirus encoding a model tumor-associated antigen.J. Immunol., 156: 224-231, 1996.

20. Mukherji, B., Chakraborty, N. 0., Yamasaki, S., Okino, T.,Yamase, H., Sporn, J. R., Kurtzman, S. K., Ergin, M. 1., Ozols, J.,Meehan, J., and Mauri, F. Induction of antigen-specific cytolytic T cellsin situ in human melanoma by immunization with synthetic peptide-pulsed autologous antigen presenting cells. Proc. Natl. Acad. Sci. USA,92: 8078-8082, 1995.

21. Jaeger, E., Bernhard, H., Romero, P., Ringhoffer, M., Arand, M.,Karbach, J., Ilsemann, C., Hagedorn, M., and Knuth, A. Generation ofcytotoxic T-cell responses with synthetic melanoma-associated peptidesin vivo: implications for tumor vaccines with melanoma-associatedantigens. mt. J. Cancer, 66: 162-169, 1996.

22. Waanders, G. A., Lees, R. K., Held, W., and MacDonald, H. R.

Quantitation of endogenous mouse mammary tumor virus superantigenexpression by lymphocyte subsets. Eur. J. Immunol., 25: 2632-2637,1995.

23. Brasseur, F., Rimoldi, D., Li#{233}nard,D., Leth#{233},B., Carrel, S., Arienti,F., Suter, L., Vanwijck, R., Bourlond, A., Humblet, Y., Vacca, A.,Conese, M., Lahaye, T., Degiovanni, G., Deraemaecker, R., Beauduin,M., Sastre, X., Salamon, E., Dr#{233}no,B., Jager, E., Knuth, A., Chevreau,C., Suciu, S., Lachapelle, J. M., Pouillart, P., Parmiani, G., Lejeune, F.,Cerottini, J. C., Boon, T., and Marchand, M. Expression ofMAGE genesin primary and metastatic cutaneous melanoma. mt. J. Cancer, 63:375-380, 1995.

24. Carrel, S., Dor#{233},J-F., Ruiter, D. J., Prade, M., Lejeune, F. J.,Kleeberg, U. R., Rflmke, P., and Brocker, E. V. The EORTC melanomagroup exchange program: evaluation of a multicenter monoclonal anti-body study. mt. J. Cancer, 48: 836-847, 1991.

25. Waanders, G. A., Lussow, A. R., and MacDonald, H. R. Skewed Icell receptor Va repertoire among superantigen reactive murine T cells.mt. Immunol., 5: 55-61, 1993.

26. Casanova, J. L. Sequencing double-stranded linear DNA with Se-quenase and (a-35S)dATP. Methods Mol. Biol., 23: 191-197, 1993.

27. Pannetier, C., Even, J., and Kourilsky, P. 1 cell repertoire diversityand clonal expansions in normal and clinical samples. Immunol. Today,16: 176-181, 1995.

28. Genev#{233}e,C., Diu, A., Nierat, J., Caignard, A., Dietrich, P. Y.,Ferradini, L., Roman-Roman, S., Triebel, F., and Hercend, I. An

experimentally validated panel of subfamily-specific oligonucleotideprimers (Val-w29IV�3l-w24) for the study of human I cell receptorvariable gene segment usage by polymerase chain reaction. Eur. J. Im-munol., 22: 1261-1269, 1992.

29. Romero, P., Pannetier, C., Herman, J., Jongeneel, C. V., Cerottini,J. C., and Coulie, P. G. Multiple specificities in the repertoire of amelanoma patient’s cytolytic I lymphocytes directed against tumorantigen MAGE-l.Al. J. Exp. Med., 182: 1019-1028, 1995.

30. Azuma, M., Phillips, J. H., and Lanier, L. L. CD28 I lympho-cytes: antigenic properties. J. Immunol., 150: 1 147-1 159, 1993.

31. Caignard, A., Guillard, M., Gaudin, C., Escudier, B., Triebel, F.,and Dietrich, P. Y. In situ demonstration of renal cell carcinoma-specificI-cell clones. Int. J. Cancer, 66: 564-570, 1996.

32. Brichard, V. G., Warnier, 0., Van PcI, A., Morlighem, 0., Lucas,S., and Boon, I. Individual differences in the orientation of the cytolyticI cell response against mouse tumor P815. Eur. J. Immunol., 25:

664-671, 1995.




33. Kalish, R. S., and Johnson, K. L. Enrichment and function

of urushiol (poison ivy)-specific I lymphocytes in lesions of aller-gic contact dermatitis to urushiol. J. Immunol., 145: 3706-3713,1990.

34. Posnett, D. N., Sinha, R., Kabak, S., and Russo, C. Clonalpopulations of I cells in normal elderly humans: the I cell equivalentto “benign monoclonal gammopathy.” J. Exp. Med., 179: 609-618,1994.

35. Van den Eynde, B., Hainaut, P., H#{233}rin,M., Knuth, A., Lemoine, C.,Weynants, P., Van der Bruggen, P., Fauchet, R., and Boon, T. Presenceon a human melanoma of multiple antigens recognized by autologousC’rL. Int. J. Cancer, 44: 634-640, 1989.

36. lopalian, S. L, Rivoltini, L., Mancini, M., Markus, N. R., Robbins,P. F., Kawakami, Y., and Rosenberg, S. A. Human CD4� I cells specifi-cally recognize a shared melanoma-associated antigen encoded by thetyrosinase gene. Proc. Natl. Aced. Sci. USA, 91: 9461-9465, 1994.

37. Takahashi, T., Chapman, P. B., Yang, S. Y., Hara, I., Vijayasaradhi,S., and Houghton, A. N. Reactivity of autologous CD4� T lymphocytesagainst human melanoma: evidence for a shared melanoma antigenpresented by HLA-DR15. J. Immunol., 154: 772-779, 1995.

38. Le Dr#{233}an, E., Gervois, N., Diez, E., Semana, G., Dreno, B., andJotereau, F. HLA class H-restricted recognition of common tumor

epitopes on human melanoma cells by CD4� melanoma-infiltratinglymphocytes. Eur. J. Immunol., 25: 2732-2736, 1995.



1997;3:685-696. Clin Cancer Res G A Waanders, D Rimoldi, D Liénard, et al. induced by injection of an autologous melanoma cell line.from skin biopsies of delayed-type hypersensitivity reactions Melanoma-reactive human cytotoxic T lymphocytes derived

Updated version

http://clincancerres.aacrjournals.org/content/3/5/685

Access the most recent version of this article at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected] at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://clincancerres.aacrjournals.org/content/3/5/685To request permission to re-use all or part of this article, use this link



http://clincancerres.aacrjournals.org/cgi/alerts

mailto:[email protected]



melanoma-reactive human cytotoxic t lymphocytes derived...

Documents