PbaR, an IclR Family Transcriptional Activator for the Regulation ofthe 3-Phenoxybenzoate 1=,2=-Dioxygenase Gene Cluster inSphingobium wenxiniae JZ-1T

Minggen Cheng, Kai Chen, Suhui Guo, Xing Huang, Jian He, Shunpeng Li, Jiandong Jiang

Key Laboratory of Microbiological Engineering of Agricultural Environment, Ministry of Agriculture, College of Life Sciences, Nanjing Agricultural University, Nanjing,Jiangsu, China

The 3-phenoxybenzoate (3-PBA) 1=,2=-dioxygenase gene cluster (pbaA1A2B cluster), which is responsible for catalyzing 3-phe-noxybenzoate to 3-hydroxybenzoate and catechol, is inducibly expressed in Sphingobium wenxiniae strain JZ-1T by its substrate3-PBA. In this study, we identified a transcriptional activator of the pbaA1A2B cluster, PbaR, using a DNA affinity approach.PbaR is a 253-amino-acid protein with a molecular mass of 28,000 Da. PbaR belongs to the IclR family of transcriptional regula-tors and shows 99% identity to a putative transcriptional regulator that is located on the carbazole-degrading plasmid pCAR3 inSphingomonas sp. strain KA1. Gene disruption and complementation showed that PbaR was essential for transcription of thepbaA1A2B cluster in response to 3-PBA in strain JZ-1T. However, PbaR does not regulate the reductase component gene pbaC.An electrophoretic mobility shift assay and DNase I footprinting showed that PbaR binds specifically to the 29-bp motif AATAGAAAGTCTGCCGTACGGCTATTTTT in the pbaA1A2B promoter area and that the palindromic sequence (GCCGTACGGC)within the motif is essential for PbaR binding. The binding site was located between the �10 box and the ribosome-binding site(downstream of the transcriptional start site), which is distinct from the location of the binding site in previously reported IclRfamily transcriptional regulators. This study reveals the regulatory mechanism for 3-PBA degradation in strain JZ-1T, and theidentification of PbaR increases the variety of regulatory models in the IclR family of transcriptional regulators.

The main metabolite in the degradation of insecticide pyre-throids in mammals (1), insects (2), fungi (3), and bacteria (4,

5) is 3-phenoxybenzoate (3-PBA), a diaryl ether compound. Be-cause of the wide use of pyrethroids (6) and the stability of thediaryl ether compound itself (7), 3-PBA is typically detected as animportant environmental contaminant. To date, two biodegrada-tion systems of 3-PBA have been identified in bacteria (see Fig. S1in the supplemental material): (i) the PobAB system in Pseudomo-nas pseudoalcaligenes POB310 (8), which is a type I Rieske non-heme iron aromatic-ring-hydroxylating oxygenase (RHO), and(ii) the type IV RHO PbaA1A2BC system in Sphingobium wenx-iniae JZ-1T (9). Due to hydroxylation at different positions in thearomatic ring (9), 3-PBA is catabolized to protocatechuate andphenol in the first system and to 3-hydroxybenzoate and catecholin the second system. Although the molecular mechanism of3-PBA degradation in bacteria has been well characterized (8, 9),the regulation of its degradation is still unknown.

Strain JZ-1T can utilize pyrethroids, such as cypermethrin, cy-halothrin, deltamethrin, fenpropathrin, fenvalerate, permethrin,and bifenthrin, and their metabolite 3-PBA as the sole carbon andenergy sources for growth (5, 9). The esterase gene pytH, which isresponsible for the first step of hydrolyzing pyrethroids, is consti-tutively expressed (5), while the expression of the 3-PBA catabolicgene cluster pbaA1A2BC is induced by its substrate 3-PBA (9).PbaA1 and PbaA2 are the � and � subunits of the dioxygenase,respectively, PbaB is a ferredoxin component, and PbaC is a glu-tathione reductase (GR)-type reductase (9). The pbaA1, pbaA2,and pbaB genes are distributed together and form one gene clus-ter, while pbaC is not physically linked to the pbaA1A2B cluster(9). Although the transcription of pbaC is 3-PBA inducible, itstranscriptional level is far lower than that of the pbaA1A2B cluster

under the same conditions (9). Moreover, no candidate transcrip-tional regulator gene was found nearby the pbaA1A2B cluster.

In the present study, by using a DNA affinity approach, an IclRfamily transcriptional regulator, PbaR, was identified as the tran-scriptional activator of the pbaA1A2B cluster in response to 3-PBAin strain JZ-1T. The regulatory mechanism, including the tran-scriptional start site (TSS), the binding site, and the core bindingsequence, and the effect of the substrate on binding were investi-gated, and a regulatory model for PbaR on the pbaA1A2B clusterwas also proposed. PbaR showed an unusual binding site that isdistinct from those of previously reported members of the IclRfamily of transcriptional regulators. The identification of PbaRincreases the variety of regulatory models within the IclR family oftranscriptional regulators.

MATERIALS AND METHODSChemicals and media. Cypermethrin (�97% purity) and 3-PBA (98%purity) were purchased from J&K Scientific, Ltd. (Shanghai, China), wereprepared as a 0.1 M stock solution in methanol, and were sterilized by

Received 29 June 2015 Accepted 10 September 2015

Accepted manuscript posted online 18 September 2015

Citation Cheng M, Chen K, Guo S, Huang X, He J, Li S, Jiang J. 2015. PbaR, an IclRfamily transcriptional activator for the regulation of the 3-phenoxybenzoate 1=,2=-dioxygenase gene cluster in Sphingobium wenxiniae JZ-1T. Appl Environ Microbiol81:8084 –8092. doi:10.1128/AEM.02122-15.

Editor: M. A. Elliot

Address correspondence to Jiandong Jiang, jiang_jjd@njau.edu.cn.

Supplemental material for this article may be found at http://dx.doi.org/10.1128/AEM.02122-15.

Copyright © 2015, American Society for Microbiology. All Rights Reserved.

8084 aem.asm.org December 2015 Volume 81 Number 23Applied and Environmental Microbiology

on January 24, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

membrane filtration (pore size, 0.22 �m). The mineral salt medium(MSM) that was used in this study contained NaCl (1.0 g liter�1),NH4NO3 (1.0 g liter�1), K2HPO4 (1.5 g liter�1), KH2PO4 (0.5 g liter�1),and MgSO4·7H2O (0.2 g liter�1) and had a pH of 7.0. Luria-Bertani (LB)medium contained NaCl (5.0 g liter�1), yeast extract (5.0 g liter�1), andtryptone (10.0 g liter�1).

Bacterial strains, oligonucleotides, plasmids, and culture condi-tions. The bacterial strains and plasmids that were used in this study arelisted in Table 1, and oligonucleotide primers are listed in Table 2. Esche-richia coli strains were used for recombinant DNA procedures and weregrown at 37°C in LB medium or LB medium supplemented with antibi-otics. Other bacterial strains were grown aerobically at 30°C in LB broth orLB agar. Expression of 3-PBA-degrading genes was induced in MSM sup-plemented with 0.5 mM 3-PBA. Ampicillin (Ap) and streptomycin (Sm)were used at concentrations of 100 �g ml�1. The growth of cells wasevaluated by measuring the value of the optical density at 600 nm (OD600).

Analysis of the transcriptional start sites of the pba cluster. The totalRNA of strain JZ-1T was isolated using the MiniBest universal RNA ex-traction kit (TaKaRa, Dalian, China) according to the manufacturer’sinstructions. The TSSs of the pbaA1A2B cluster and pbaC gene were de-tected by a primer extension assay as described by Lloyd et al. (10). Reversetranscription-PCR (RT-PCR) was performed using the 5=-6-fluoresceinamidite (FAM)-labeled primers FAM-PE and FAM-PEC for thepbaA1A2B cluster and pbaC gene, respectively (Table 2). The RNA andprimer mixture was annealed at 65°C for 10 min; deoxynucleosidetriphosphates (dNTPs) and Moloney murine leukemia virus (MMLV)transcriptase were then added, and the mixture was incubated at 45°C for45 min. The reaction was stopped by heating the mixture at 65°C for 10min. The synthetic cDNA was purified by phenol-chloroform extractionand precipitated with ethanol; the DNA was then dissolved in 10 �l ofdouble-distilled water (ddH2O). For analysis, 1 �l of the DNA solutionwas mixed with 8.5 �l of formamide and 0.5 �l of GeneScan-LIZ 500 sizestandards (Applied Biosystems), and the sample was analyzed on a 3730DNA analyzer. The DNA sequencing reaction was prepared using thenon-FAM-labeled primer PE or PEC (Table 2) as the sequencing primer.

To test whether the pbaA1, pbaA2, and pbaB genes in the pba clusterwere in one transcriptional unit, the sequence of pbaA1A2B was detectedby PCR using cDNA as the template. Due to the difficulty in synthesizinglarge fragments by reverse transcription, the transcriptional unit test in-cluded PCR detection of 6 overlapping fragments in the pbaA1A2B cluster(Fig. 1C).

Identification of a promoter DNA-binding protein by DNA affinitypurification. To identify the probable transcription factor that binds tothe promoter DNA of the pbaA1A2B cluster, a DNA affinity purificationapproach was conducted (11). Cells of strain JZ-1T were grown in 100 mlof LB medium containing 0.5 mM 3-PBA and were harvested by centrif-ugation (12,000 � g for 3 min) at 4°C. After being washed with TN buffer(50 mM Tris-HCl [pH 7.4] and 50 mM NaCl) twice, the precipitated cellswere resuspended in 15 ml of binding buffer (50 mM Tris-HCl [pH 7.4],1 mM EDTA, 1 mM dithiothreitol [DTT], 100 mM NaCl, 0.05% [vol/vol]Triton X-100, and 10% [vol/vol] glycerol) and were then disrupted bysonication at 4°C. The suspension was centrifuged at 12,000 � g for 30min at 4°C and concentrated to 1 ml using an Amicon ultrafiltrationdevice.

The pba promoter area sequence (�359 to �137 bp relative to thetranslation start codon) was amplified using the biotin-modified primerpair bio-pbapt-F/pbapt-R (Table 2). The DNA was then purified using theE.Z.N.A. gel extraction kit (Omega, USA). Approximately 200 pmol of thepromoter DNA was immobilized on streptavidin magnetic beads (NEB,England) according to the manufacturer’s protocol. The beads were thenincubated with 1 ml of crude protein extracts (obtained as describedabove) at 25°C for 1 h with slow shaking. Unbound proteins were re-moved by washing the beads with binding buffer 4 times. Finally, thespecifically bound proteins were eluted with 400 �l of low-NaCl-concen-tration elution buffer A (50 mM Tris-HCl [pH 7.4] and 0.5 M NaCl) andhigh-NaCl-concentration elution buffer B (50 mM Tris-HCl [pH 7.4] and1.0 M NaCl). The eluted proteins were separated by 12% polyacrylamidesodium dodecyl sulfate (SDS)-gel electrophoresis, and 4 bound proteinswith molecular masses of 44.3 kDa were digested with trypsin and iden-tified using matrix-assisted laser desorption ionization–time of flight/time of flight (MALDI-TOF/TOF) mass spectrometry. The polypeptidepeaks were compared with those of computed peptide sequences from thedraft genome sequence of strain JZ-1T.

Genetic disruption and complementation. Two DNA fragments,corresponding to 350-bp flanks upstream and downstream of the pbaRgene, were amplified using the primer pairs MTF1-F/MTF1-R and MTF3-F/MTF3-R, respectively. They were linked to a kanamycin resistance genethat was amplified from plasmid pBBR1-MCS2 (12) with primer pairMTF2-F/MTF2-R by overlap extension PCR. This DNA fragment for ho-mologous recombination was electroporated into strain JZ-1T cells. Apositive genetic disruption mutant, JZ-MT, was achieved by serial cultureon a kanamycin-containing medium until the pbaR gene could no longer

TABLE 1 Strains and plasmids that were used in this study

Strain or plasmid CharacteristicSource orreference(s)

E. coli strainsDH5� F� (lacZYA-argF)U169 �80dlacZM15 recA1 endA1 thi-1 supE44 relA1 deoR

hsdR17(rk� mk

�) phoA �� relA1TaKaRa

BL21(DE3) F� ompT hsdS(rB� mB

�) gal dcm lacY1 (DE3) TaKaRa

Sphingobium wenxiniaeJZ-1T ( DSM 21828T) 3-PBA degrading strain, Smr 5, 9JZ-MT pbaR-disrupted mutant from strain JZ-1T; Kmr Smr This studyJZ-MTC Mutant JZ-MT harboring pBpbaR; Gmr Smr Kmr This study

PlasmidspMD19-T TA clone vector, Apr TaKaRapMpbapt pMD19-T containing pba cluster promoter, Apr This studypBBR1MCS-2 Broad-host-range cloning vector, Kmr 12pBBR1MCS-5 Broad-host-range cloning vector, Gmr 12pBpbaR pBBR1MCS-5 harboring pbaR, Kmr This studypGEX-4T-1 Expression vector, Apr GEpGEpbaR pGEX-4T-1 harboring pbaR, Apr This study

Transcriptional Activator for 3-PBA Catabolism

December 2015 Volume 81 Number 23 aem.asm.org 8085Applied and Environmental Microbiology

on January 24, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

be detected by PCR. At every generation, the pbaA1A2B genes were veri-fied by PCR. The functional pbaR gene was amplified with the primer pairpbaRC-F/pbaRC-R and inserted into the broad-host-range plasmidpBBR1-MCS5 (12) to generate pBpbaR. The plasmid pBpbaR was elec-

troporated into the pbaR mutant JZ-MT to obtain the pbaR-comple-mented strain JZ-MTC.

RT-qPCR. Strain JZ-1T, the corresponding pbaR mutant strain JZ-MT, and the pbaR-complemented strain JZ-MTC were cultured in an LB

TABLE 2 Oligonucleotides that were used in this study

Function and oligonucleotide Sequence (5=¡ 3=)a

Primer extensionFAM-PE FAM-ATTTGCCATGTCCATCTCCTATAFAM-PEC FAM-TCATTGCGACCGATCCTTCGAACCCPE ATTTGCCATGTCCATCTCCTATAPEC TCATTGCGACCGATCCTTCGAACCC

Transcriptional unit analysispba-F1 AACGGTATAGTCAAAGCCAGCATATpba-R1 CGCATCCCAGTTGCCAAAAATCApba-F2 CGGACGGCTACCACAACAAGCTCpba-R2 AACACGGTCATCACCAGCGAACpba-F3 AGAGATGCGAGCCCGGTTAGGCGATpba-R3 AAGCGCGGGCTCCTTCTTCGGCGTApba-F4 CGAAAATGTCGCCCTCTGTCACCGApba-R4 TCGGCAGGAACCGTTTGTCGAAATCpba-F5 GCCATGCCAGTTCGGACAACCCpba-R5 GCCTCGATCCCCGGAACACCpba-F6 CGGACGGACGTGAATTTACGGTCAApba-R6 CTAGTGTTGCGTCTCAGGGATGGTG

DNA affinity and EMSAbio-pbapt-F Biotin-CCCGGTTTTGGTCCCATTGGTpbapt-F CCCGGTTTTGGTCCCATTGGTpbapt-R AAGAGCCATGAACGGGAGAATpbapt-d-R TACAAAAATAAGACTTTCTATTATATTATCGACAApbapt-d-F TAGAAAGTCTTATTTTTGTATAGGAGATGGACATGpbapt-m-R TACCCCGGTTTTAGACTTTCTATTATATTATCGACpbapt-m-F CTAAAACCGGGGTATTTTTGTATAGGAGATGGACApbapt-m2-R CAAGCCGTACGGCAACCAACCAACCATATTATCGACAAATCTGCCGAATTpbapt-m2-F GGTTGGTTGCCGTACGGCTTGGGGGGTATAGGAGATGGACATGGCAAATCpcpt-F GCCTTCTTGGCTTCGAACTGGCpcpt-R GATCAGAACGTCATAATAGCTCck-F CCTGGTCAGAAAATCCGCCAAGck-R ATATCCTCCCTTCGTCCCGTGA

Gene expressionpbaR-F2 AGCTGGAATTCGGTACAGTTGATAAGGCAT (EcoRI)pbaR-R2 TATGACTCGAGTCAGTTGTCTGACATCAGGCCAAGC (XhoI)

Genetic disruptionMTF1-F ACATCCCATCCCAAATCGGACGCCMTF1-R TGCTTTCTCTTCTGATACGGCACCAAACGACTTCAMTF2-F TGCCGTATCAGAAGAGAAAGCAGGTAGCTTGCAGMTF2-R GCGCCTCCTGTCAGAAGAACTCGTCAAGAAGGCMTF3-F GAGTTCTTCTGACAGGAGGCGCAGGAGCTCGTTCMTF3-R TCGCCGTTGCAGTGTTCCAATCCGMTT-F ATGATAATTCGCCGAGCCCCGATGCMTT-R CCAGTCATAGCCGAATAGCCTCTCCpbaRC-F TTGACTCGAGACATCCCATCCCAAATCGGACGCC (XhoI)pbaRC-R GATTACTAGTGCAAAGCGGTTGACGGAGCCAA (SpeI)

DNase I footprintingpbapt-F3 AGTTGCACGCTCAATGGCGAAACCApbapt-R3 ATTTGCCATGTCCATCTCCTATACAFAM-M13F(�47) FAM-CCCAGTCACGACGTTGTAAAACGM13R(�48) AGCGGATAACAATTTCACACAGGA

a Restriction sites are in boldface, and nucleotide sequences that are different from the template are underlined.

Cheng et al.

8086 aem.asm.org December 2015 Volume 81 Number 23Applied and Environmental Microbiology

on January 24, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

medium with appropriate antibiotics to an OD600 of 0.6. The cells wereharvested and washed twice with MSM. Expression of 3-PBA degradationgenes in washed cells was induced in MSM (the final cell density corre-sponded to an OD600 of 2.0) at 30°C for 3 h in the presence of 0.5 mM3-PBA. MSM with 0.5 mM glucose was used as the control. Total RNA wasextracted as described above; genomic DNA (gDNA) was digested withgDNA Eraser (TaKaRa, China) at 42°C for 2 min. Reverse transcriptionwas then conducted with 1 �g of gDNA-removed RNA using randomprimers. The cDNA was synthesized by incubation at 37°C for 15 min withPrimeScript reverse transcriptase (RTase; TaKaRa), and the reaction wasstopped by heating the mixture at 85°C for 5 s. Every sample was diluted5-fold to serve as a template in quantitative PCR (qPCR). The qPCR wasperformed in an Applied Biosystems 7300 real-time PCR system (AppliedBiosystems, USA) using the SYBR Premix Ex Taq RT-PCR kit (TliRNaseH Plus; TaKaRa, China) as described in the manufacturer’s instruc-tions. The transcription of the 16S rRNA gene was set as an internal stan-dard, and relative expression was quantified according to the 2�CT

threshold cycle (CT) method (13).Purification of PbaR and electrophoretic mobility shift assay

(EMSA). The pbaR gene was amplified with the primer pair pbaR-F2/pbaR-R2 and was then linked to the EcoRI and XhoI sites of pGEX-4T-1to generate the expression plasmid pGEpbaR. E. coli BL21(DE3) cells har-boring pGEpbaR were cultured in LB medium supplemented with 100 mgliter�1 of ampicillin at 37°C to an OD600 of 0.6, and 0.3 mM isopropyl-�-D-thiogalactopyranoside (IPTG) was then added to induce the expressionof glutathione S-transferase (GST)-labeled PbaR. After 12 h of incubation

at 16°C, the cells were harvested from 200-ml cultures by centrifugation,resuspended in phosphate-buffered saline (PBS) (Na2HPO4, 1.44 g li-ter�1; KH2PO4, 0.24 g liter�1; NaCl, 8.0 g liter�1; and KCl, 0.2 g liter�1;pH 7.4), and disrupted by sonication at 4°C. The suspension was centri-fuged at 12,000 � g for 30 min at 4°C. The supernatant was then mixedwith 5 ml of GST-Sefinose resin (Sangon Biotech) for 30 min at 4°C. Aftertwo washes with PBS, a final concentration of 2 U ml�1 thrombin (Sigma)was added to cleave the GST-tagged PbaR from the resin at 4°C for 12 h.The thrombin was then removed using Benzamidine Sepharose (GE). Theresulting protein was concentrated using an Amicon ultrafiltration device.Finally, PbaR was stored in 30% glycerol with 1 mM DTT at �70°C.Protein concentrations were quantified using the Bradford method withbovine serum albumin (BSA) as a standard, and the purity of PbaR wasassayed using 15% SDS-PAGE.

For EMSA, a nonradioactive strategy was implemented according tothe method described by De la Cruz et al. (14). The wild-type 469-bppromoter DNA probe of the pbaA1A2B cluster was amplified using pbapt-F/pbapt-R; a 430-bp promoter sequence of pbaC was amplified using theprimer set pcpt-F/pcpt-R. Nucleotides in the mutated promoter DNAwere introduced by primers (listed in Table 2), and sequences were am-plified using overlapping extension PCR. The fragment with the deleted29-bp motif sequence (AATAGAAAGTCTGCCGTACGGCTATTTTT)was amplified by overlap extension PCR using primers pbapt-F, pbapt-d-R, pbapt-d-F, and pbapt-R. Approximately 20 ng of a promoter probewas mixed with an increasing concentration of purified PbaR in a bindingbuffer (100 mM Tris-HCl [pH 8.0], 50 mM KCl, 5% [vol/vol] glycerol,

FIG 1 (A) TSS of the pbaA1A2B cluster as determined by primer extension assay. By comparing the location of the reverse-transcribed PCR fragment with thatof the standard sequence, the TSS was determined to be A. (B) TSS of pbaC as determined by primer extension assay. C was determined to be the TSS. (C)Schematic diagram of the transcriptional regulation of PbaR. Three DNA fragments that are located at different positions in the genome are shown. A 5-kbfragment conserved with plasmid pCAR3 is displayed on the left, the pbaA1A2B gene cluster is in the middle, and the pbaC gene is on the right. The ellipserepresents the protein PbaR, which activates the transcription of the pbaA1A2B cluster in the presence of 3-PBA (displayed as a solid line). PbaR has no regulatoryeffects on pbaC (displayed as a dashed line). The scale bar represents 500 bp. The amplification fragments for transcriptional unit evaluation are shown under thepbaA1A2B cluster as lines. (D) PCR amplification of the pba cluster using total RNA and cDNA as the templates. The amplified products were detected byelectrophoresis. Lanes 1, 3, 5, 7, 9, and 11 show samples using RNA as the template (negative controls), and lanes 2, 4, 6, 8, 10, and 12 show samples using cDNAas the template. Lanes M, molecular size markers. (E) DNA elements in the pbaA1A2B cluster promoter. The �35 and �10 boxes are shown in boxes, and theTSS is shown by an arrowhead. The PbaR-binding site and the ribosome-binding site (RBS) are indicated by a line above the sequence. (F) DNA elements in thepbaC promoter.

Transcriptional Activator for 3-PBA Catabolism

December 2015 Volume 81 Number 23 aem.asm.org 8087Applied and Environmental Microbiology

on January 24, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

250 �g ml�1 BSA, and 1 mM DTT). A nonspecific DNA sequence (asequence in pbaA2) was used as the negative control. The effects of 3-PBAon the binding of PbaR to the promoter probes were evaluated by adding0.5 mM 3-PBA to the reaction system. The mixture was incubated at 25°Cfor 20 min and was then separated by 6% (vol/vol) native polyacrylamidegel electrophoresis in 0.5� Tris-glycine-EDTA. The DNA or DNA-pro-tein complexes were visualized by ethidium bromide staining.

DNase I footprinting. DNase I footprinting assays were performed asdescribed by Wang et al. (15). The promoter region of pbaA1A2B was PCRamplified with the primer pair pbapt-F3/pbapt-R3 and inserted into theplasmid pMD19-T to generate pMpbapt. To prepare fluorescent FAM-labeled probes, DNA was amplified with Pfu DNA polymerase (TaKaRa,Dalian, China) from the plasmid pMpbapt using the primers FAM-M13F(-47) and M13R(-48). The FAM-labeled probes were purified withthe E.Z.N.A. gel extraction kit (Omega, USA) and were quantified with aNanoDrop 2000c (Thermo Scientific, USA). For each assay, 400 ng ofprobe was incubated with 120 nM PbaR in a total volume of 40 �l. Afterincubation for 30 min at 25°C, 10-�l volumes containing approximately0.015 U of DNase I (Promega) and 100 nmol freshly prepared CaCl2 wereadded and further incubated for 1 min at 25°C. The reaction was stoppedby adding 140 �l of DNase I stop solution (200 mM unbuffered sodiumacetate, 30 mM EDTA, and 0.15% SDS). Samples were first extracted withphenol-chloroform and then were precipitated with ethanol, and the pel-lets were dissolved in 30 �l of Milli-Q water. The preparation of the DNAladder, electrophoresis, and data analysis were performed as described byWang et al. (15), except that the GeneScan-LIZ 500 size standard (AppliedBiosystems) was used.

Nucleotide sequence accession number. The sequence of the 5-kbDNA fragment has been deposited in the GenBank database under theaccession number KT222890.

RESULTSDetermination of the TSS of the pba cluster. Three promoterswere predicted by the Berkeley Drosophila Genome Project(BDGP) Neural Network Promoter Prediction online program(http://www.fruitfly.org/seq_tools/promoter.html) with a scoreof �0.6 in the region 300 bp upstream of the pbaA1 gene. Todetermine where transcription starts, a primer extension experi-ment was performed. The TSS A was the 59th base upstream of thetranslational start codon (Fig. 1A and E). The �10 box TTCGGCand the �35 box GCAGAATA were predicted according to theTSS (Fig. 1E). The TSS of pbaC was determined to be a C 32 bpupstream of the initiation codon, and the �10 box AGCCGTCCand the �35 box TTGAAA of the pbaC promoter were also pre-dicted (Fig. 1B and F).

All 6 of the overlapping fragments (F1 to F6) within thepbaA1A2B cluster were amplified when cDNA was used as thetemplate (Fig. 1C), indicating that the pbaA1, pbaA2, and pbaBgenes were in one operon and transcribed in a single unit.

PbaR specifically binds to pbaA1A2B promoter DNA. Ac-cording to the results from the primer extension experiment, a496-bp promoter area sequence for the pba cluster (�300 to �196 bprelated to its TSS) was amplified using a biotin-labeled primer andwas immobilized on streptavidin-coated magnetic beads. DNA-binding proteins were analyzed by SDS-PAGE (Fig. 2). According topreviously reported studies, molecular masses of most transcriptionalregulators are approximately or less than 35 kDa. For examples, BenRis 36.4 kDa (16), PnpR is 35 kDa (17), NicR2 is 28 kDa (15), and PcaRis 32 kDa (18). Therefore, proteins in the bands with molecularmasses of 44.3 kDa were further analyzed (Fig. 2). The four proteinbands were excised from the gel and digested with trypsin; the pep-tides were then sequenced using MALDI-TOF/TOF mass spectrom-etry. The peptides were compared with the proteins in the database

that was translated from the draft genome sequence of strain JZ-1T,and each identified protein is listed in Table 3.

The proteins in bands a, c, and d were deduced to be ribo-somal protein, ribosomal protein, and protein S930S ribo-somal, respectively, none of which showed any relationshipwith transcription. However, the protein in band b was de-duced to be a transcriptional regulator that corresponded to a762-bp gene with GTG as the initiation codon. This proteinshows 99% identity with an unidentified putative IclR familytranscriptional regulator (open reading frame 229 [ORF229])from the carbazole-degrading plasmid pCAR3 (GenBank ac-cession number AB270530) in Sphingomonas sp. strain KA1. Theprotein that we identified was designated PbaR (3-PBA dioxyge-nase gene regulator) because of its role in the transcriptional reg-ulation of the pbaA1A2B cluster. PbaR contains 253 amino acidsand has a calculated pI of 8.8 and a molecular mass of 27.7 kDa.The N-terminal amino acids 3 to 52 form a helix-turn-helix(HTH_XRE superfamily) domain (see Fig. S2 in the supplementalmaterial), which is a characteristic of the IclR family of transcrip-tional regulators (19).

PbaR was overexpressed in E. coli BL21(DE3) from the expres-sion vector pGEX-4T-1 and was detected by SDS-PAGE (see Fig.S3 in the supplemental material). Purified PbaR was used in an

FIG 2 SDS-PAGE analysis of pba promoter-binding proteins that were enrichedby a DNA affinity approach. Lane 1 shows proteins that were eluted by 0.5 M NaCl,lane 2 shows proteins that were eluted by 1.0 M NaCl, and lane 3 shows a proteinstandard marker with the molecular masses (in kilodaltons) shown on the right.Four bound bands, marked with a, b, c, and d on the left, were digested with trypsinand were identified using MALDI-TOF/TOF mass spectrometry.

TABLE 3 Bound proteins that were identified by TOF massspectrometry

Bound band Protein and function MMa (kDa)

a rplB, large-subunit ribosomal protein L2 30.38b IclR family transcriptional regulator 27.67c Translation initiation factor 3 19.68d Protein S930S, ribosomal 19.09a MM, molecular mass.

Cheng et al.

8088 aem.asm.org December 2015 Volume 81 Number 23Applied and Environmental Microbiology

on January 24, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

EMSA to test its binding capacity for pbaA1A2B promoter DNA.When 40 nM PbaR was added, a DNA-protein complex wasformed (Fig. 3A). No DNA-protein complex was found for thenonspecific control DNA (sequence in pbaA2) (Fig. 3A). Theseresults indicate that PbaR can specifically bind to the pbaA1A2Bpromoter DNA. Furthermore, the substrate 3-PBA had no effecton the binding (Fig. 3A), which is in agreement with previousreports that IclR-type positive regulators can bind to their targetDNA regions in the absence of effectors (19, 20). To test the abilityof PbaR to bind to the pbaC promoter, EMSA was conductedsimilarly to the way it was conducted for the pbaA1A2B promoter.The EMSA results showed that PbaR did not bind to the pbaCpromoter (Fig. 3B).

PbaR is a transcriptional activator of the pbaA1A2B cluster.Cells of the wild-type strain JZ-1T, the pbaR knockout mutantJZ-MT, and the pbaR-complemented strain JZ-MTC were incu-bated in MSM supplemented with 0.5 mM 3-PBA or cyperme-thrin as the sole carbon resource, and the growth (OD600) wasevaluated every 8 h. As shown in Fig. 4, pbaR mutant strainJZ-MT grew much slower than JZ-1T, while the growth curve ofthe pbaR-complemented strain was similar to that of the wild-typestrain. The results showed that pbaR was essential for the growthof strain JZ-1T on 3-PBA and cypermethrin.

Cells of strains JZ-1T, JZ-MT, and JZ-MTC were also incubatedwith or without 3-PBA, the total RNA of these cells was extracted,and reverse transcription-PCR was performed. The transcrip-tional levels of the pbaA1, pbaA2, pbaB, and pbaC genes wereevaluated. As shown in Fig. 4C, the transcriptional levels of pbaA1,pbaA2, and pbaB in the wild-type strain JZ-1T, when supple-mented with 3-PBA, were 96-, 114-, and 100-fold higher, respec-tively, than their levels in the absence of 3-PBA. In the mutantstrain JZ-MT, the transcriptional levels of pbaA1, pbaA2, and pbaBwere virtually unchanged by the presence or absence of 3-PBA. Inthe pbaR-complemented strain JZ-MTC, the transcriptional levelsof pbaA1, pbaA2, and pbaB were similar to those of the wild-typestrain JZ-1T. However, no significant differences in transcrip-tional levels were observed for the reductase gene pbaC among thestrains JZ-1T, JZ-MT, and JZ-MTC under the same conditions.These results indicate that PbaR is a transcriptional activator ofthe pbaA1A2B cluster but that it has no regulatory effect on thepbaC gene.

Binding site of PbaR. DNase I footprinting was performed toidentify the PbaR-binding site in the promoter region of thepbaA1A2B cluster. It was found that PbaR protected the 29-bp motifAATAGAAAGTCTGCCGTACGGCTATTTTT, which is locatedfrom bp �16 to �44 relative to the TSS in the pbaA1A2B promoter(Fig. 5). This binding region was located between the �10 box andthe ribosome-binding site (Fig. 1E). If the 29-bp motif was deleted,EMSA showed that the incomplete DNA probe could not bind toPbaR (Fig. 3C). Within the 29-bp motif, there is a palindromic se-

FIG 3 Electrophoretic mobility shift assays. (A) PbaR binds to the pbaA1A2Bcluster promoter. Each lane contains 20 ng of DNA probe. The first 5 lanesshow samples incubated without the substrate 3-PBA, and the next 5 lanesshow samples incubated with 0.5 mM 3-PBA. The concentrations of PbaR,increasing from left to right, are shown above the lanes. The control DNA wasa 163-bp fragment that was amplified from the pbaA2 gene. (B) Electropho-retic mobility shift assays of PbaR binding to the pbaC promoter. The DNAprobe that was used in the first 2 lanes was the pbaA1A2B promoter, which wasused as the positive control, and the next 8 lanes contain pbaC promoter DNA.The 3rd to 6th lanes were incubated without 3-PBA, and the 7th to 10th laneswere incubated with 0.5 mM 3-PBA. (C) EMSA of PbaR binding to the pro-moter DNA with the 29-bp motif deleted. The first three lanes are wild-typepbaA1A2B promoter DNA, which was used as the control, and the next threelanes are 29-bp motif-deleted DNA probes. The sample in each lane was incu-bated with 0.5 mM 3-PBA. (D) Electrophoretic mobility shift assays of PbaRbinding to the mutant pbaA1A2B cluster promoter DNA. The nucleotide se-

quence 5=-GCCGTACGGC-3= in the PbaR-binding site was mutated to 5=-CCCCGGTTTT-3=. The first 3 lanes show wild-type pbaA1A2B promoter DNA,which was used as the positive control, and the next 3 lanes contain mutantpromoter DNA. The sample in each lane was incubated with 0.5 mM 3-PBA.(E) EMSA of PbaR binding to promoter DNA with the 29-bp motif mutated.The sequence besides the palindrome was mutated to GGTTGGTTGGTT-palindrome-TTGGGGG. The first lanes are mutated promoter DNA, and thenext three lanes are wild-type promoter DNA. The sample in each lane wasincubated with 0.5 mM 3-PBA.

Transcriptional Activator for 3-PBA Catabolism

December 2015 Volume 81 Number 23 aem.asm.org 8089Applied and Environmental Microbiology

on January 24, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

quence, 5=-GCCGTACGGC-3= (Fig. 5). To determine whether thepalindromic sequence is essential for PbaR binding, it was mutated to5=-CCCCGGTTTT-3=. EMSA showed that the mutated DNA probedisplayed no binding to PbaR (Fig. 3D). Additionally, to determinethe role of other 19-bp sequences in binding, the 29-bp motif wasmutated to GGTTGGTTGGTTGCCGTACGGCTTGGGGG (mu-

tated sequences underlined), and no stable binding complex wasformed when this mutated DNA probe was used (Fig. 3E). Theseresults indicate that the palindromic sequence plays an importantrole in PbaR sequence recognition and that the motif sequence be-sides the palindrome sequence is important for the stability of theDNA-protein complex.

FIG 4 Growth of wild-type strain JZ-1T (WT), the pbaR knockout mutant (MT), and the pbaR-complemented strain (MTC) on 3-PBA (A) and cypermethrin(B). (C) Transcriptional expression analysis of pbaA1, pbaA2, pbaB, and pbaC in the JZ-1T (WT), the pbaR knockout mutant (MT), and the pbaR-complementedstrain (MTC) in the presence of 0.5 mM glucose (G) or 0.5 mM 3-PBA (S). The transcriptional level of the 16S rRNA gene was used as an internal standard, andthe data in each column were calculated by the 2�CT threshold cycle (CT) method using 3 replicates.

FIG 5 DNase I footprinting analysis of the PbaR-binding site in the pba promoter. A total of 400 ng of 6-carboxyfluorescein-labeled DNA probe was incubatedwith 0 nM PbaR (red line) or 120 nM PbaR (blue line) in the presence of 0.5 mM 3-PBA. The PbaR-protected region is shown in a box, and the protected sequenceis shown at the bottom. The palindromic sequence in the protected region is underlined.

Cheng et al.

8090 aem.asm.org December 2015 Volume 81 Number 23Applied and Environmental Microbiology

on January 24, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

DISCUSSION

PbaR, an IclR family transcriptional activator that regulates thetranscription of the pbaA1A2B cluster, was identified in this study.The pbaR gene was not located together with the pbaA1A2B clus-ter and the pbaC gene (Fig. 1C). PbaR shares 99% identity with aputative transcriptional regulator from the plasmid pCAR3 inSphingomonas sp. KA1 (21). Moreover, a 5-kb fragment contain-ing the pbaR gene was highly conserved with the correspondingfragment on pCAR3 (99.9% similarity). Plasmid pCAR3, which isdeficient in conjugative transfer, contains a complete set of genesthat are involved in carbazole mineralization (22).

PbaR was found to share similarity with IclR-type transcrip-tional regulators (see Fig. S2 in the supplemental material). Inter-estingly, IclR-type transcriptional regulators, including PbaR, thatare involved in the catabolism of xenobiotics are described as ac-tivators (19, 23); examples include PobR in Acinetobacter calcoace-ticus (24, 25), PcaR in Pseudomonas putida (18), and NdpR inRhodococcus opacus (26). In addition, the binding of PbaR topbaA1A2B promoter DNA was effector independent (Fig. 3A).This phenomenon is very common among IclR-type transcrip-tional regulators (23), for which the effector is not essential for theregulator to bind DNA but is essential for the interaction withRNA polymerase (27).

The binding sites of most IclR family transcriptional regula-tors, including MhpR, GenR, and PcaR, are located upstream oftheir TSSs (19). For example, the binding sites of PobR and PcaUare located at bp �55 to �89 and bp �48 to �93 relative to theirTSSs (24, 28), respectively. However, in the case of PbaR, the bind-ing site was located between the �10 box and the ribosome-bind-ing site (bp �16 to �44 relative to its TSS). This sort of down-stream binding region typically represents a repressor-binding site(19, 23). On the other hand, the binding sites of IclR family tran-scriptional regulators seem to be diverse and no conserved se-quences have been found. MhpR, the 3-(3-hydroxyphenyl)propi-onic acid degradation regulator, binds to a 17-bp palindromesequence, GGTGCACCTGGTGCACA (29); GenR, the 3-hy-droxybenzoate and gentisate catabolism regulator, binds to thepalindrome ATTCC-N7(5)-GGAAT (30); PcaR binds to a three-repeat 10-bp DNA sequence, TTTGTTCGAT (18, 27). With re-gard to PbaR, it specifically binds to the 29-bp motif AATAGAAAGTCTGCCGTACGGCTATTTTT, and the palindromicsequence (GCCGTACGGC) is essential for PbaR binding. There-fore, there is no uniform model for the binding pattern of IclR-type transcriptional regulators (19, 23), and PbaR increases thediversity of IclR-type transcriptional regulators with respect to thebinding model.

In the PbaA1A2BC dioxygenase system, pbaA1A2B is in a tran-scriptional unit while pbaC is in another transcriptional unit. Al-though the expression of the pbaC gene is induced by 3-PBA, theexpression of the pbaC gene was much lower than that ofpbaA1A2B at the transcriptional level (Fig. 4). Furthermore, thereis no evidence demonstrating that PbaR regulates the transcrip-tion of the pbaC gene (Fig. 3 and 4). These results indicate thatanother regulator might exist for the transcription of the pbaCgene in response to 3-PBA. However, this suggestion requires fur-ther investigation. Because the reductase component of a dioxy-genase system is typically not specific (21, 31–33), we speculatethat the lower expression of the pbaC gene might be compensatedfor by other isoenzymes, making catabolic progress successful.

ACKNOWLEDGMENTS

This work was supported by grants from the Chinese National ScienceFoundation for Excellent Young Scholars (31222003), the OutstandingYouth Foundation of the Jiangsu Province (BK20130029), the Programfor New Century Excellent Talents in University (NCET-12-0892),and the Fundamental Research Funds for the Central Universities(KYZ201422).

REFERENCES1. Kaneko H. 2011. Pyrethroids: mammalian metabolism and toxicity. J

Agric Food Chem 59:2786 –2791. http://dx.doi.org/10.1021/jf102567z.2. Miyamoto J. 1976. Degradation, metabolism and toxicity of synthetic

pyrethroids. Environ Health Perspect 14:15–28. http://dx.doi.org/10.1289/ehp.761415.

3. Liang WQ, Wang ZY, Li H, Wu PC, Hu JM, Luo N, Cao LX, Liu YH.2005. Purification and characterization of a novel pyrethroid hydrolasefrom Aspergillus niger ZD11. J Agric Food Chem 53:7415–7420. http://dx.doi.org/10.1021/jf051460k.

4. Wu PC, Liu YH, Wang ZY, Zhang XY, Li H, Liang WQ, Luo N, Hu JM,Lu JQ, Luan TG, Cao LX. 2006. Molecular cloning, purification, andbiochemical characterization of a novel pyrethroid-hydrolyzing esterasefrom Klebsiella sp. strain ZD112. J Agric Food Chem 54:836 – 842. http://dx.doi.org/10.1021/jf052691u.

5. Wang BZ, Guo P, Hang BJ, Li L, He J, Li SP. 2009. Cloning of a novelpyrethroid-hydrolyzing carboxylesterase gene from Sphingobium sp.strain JZ-1 and characterization of the gene product. Appl Environ Mi-crobiol 75:5496 –5500. http://dx.doi.org/10.1128/AEM.01298-09.

6. Trunnelle KJ, Bennett DH, Tulve NS, Clifton MS, Davis MD, CalafatAM, Moran R, Tancredi DJ, Hertz-Picciotto I. 2014. Urinary pyrethroidand chlorpyrifos metabolite concentrations in Northern California fami-lies and their relationship to indoor residential insecticide levels, part ofthe study of use of products and exposure related behavior (SUPERB).Environ Sci Technol 48:1931–1939. http://dx.doi.org/10.1021/es403661a.

7. Hoffman DJ, Spann JW, LeCaptain LJ, Bunck CM, Rattner BA. 1991.Developmental toxicity of diphenyl ether herbicides in nestling Americankestrels. J Toxicol Environ Health 34:323–336. http://dx.doi.org/10.1080/15287399109531571.

8. Dehmel U, Engesser KH, Timmis KN, Dwyer DF. 1995. Cloning, nu-cleotide sequence, and expression of the gene encoding a novel dioxyge-nase involved in metabolism of carboxydiphenyl ethers in Pseudomonaspseudoalcaligenes POB310. Arch Microbiol 163:35– 41. http://dx.doi.org/10.1007/BF00262201.

9. Wang C, Chen Q, Wang R, Shi C, Yan X, He J, Hong Q, Li S. 2014. Anovel angular dioxygenase gene cluster encoding 3-phenoxybenzoate1=,2=-dioxygenase in Sphingobium wenxiniae JZ-1. Appl Environ Micro-biol 80:3811–3818. http://dx.doi.org/10.1128/AEM.00208-14.

10. Lloyd AL, Marshall BJ, Mee BJ. 2005. Identifying cloned Helicobacterpylori promoters by primer extension using a FAM-labelled primer andGeneScan analysis. J Microbiol Methods 60:291–298. http://dx.doi.org/10.1016/j.mimet.2004.10.009.

11. Kadonaga JT, Tjian R. 1986. Affinity purification of sequence-specificDNA binding proteins. Proc Natl Acad Sci U S A 83:5889 –5893. http://dx.doi.org/10.1073/pnas.83.16.5889.

12. Kovach ME, Elzer PH, Hill DS, Robertson GT, Farris MA, Roop RM, II,Peterson KM. 1995. Four new derivatives of the broad-host-range cloningvector pBBR1MCS, carrying different antibiotic-resistance cassettes. Gene166:175–176. http://dx.doi.org/10.1016/0378-1119(95)00584-1.

13. Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression datausing real-time quantitative PCR and the 2(-delta delta CT) method.Methods 25:402– 408. http://dx.doi.org/10.1006/meth.2001.1262.

14. De la Cruz MA, Fernandez-Mora M, Guadarrama C, Flores-Valdez MA,Bustamante VH, Vazquez A, Calva E. 2007. LeuO antagonizes H-NS andStpA-dependent repression in Salmonella enterica ompS1. Mol Microbiol66:727–743. http://dx.doi.org/10.1111/j.1365-2958.2007.05958.x.

15. Wang L, Tang H, Yu H, Yao Y, Xu P. 2014. An unusual repressorcontrols the expression of a crucial nicotine-degrading gene cluster inPseudomonas putida S16. Mol Microbiol 91:1252–1269. http://dx.doi.org/10.1111/mmi.12533.

16. Cowles CE, Nichols NN, Harwood CS. 2000. BenR, a XylS homologue,regulates three different pathways of aromatic acid degradation in Pseu-

Transcriptional Activator for 3-PBA Catabolism

December 2015 Volume 81 Number 23 aem.asm.org 8091Applied and Environmental Microbiology

on January 24, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

domonas putida. J Bacteriol 182:6339 – 6346. http://dx.doi.org/10.1128/JB.182.22.6339-6346.2000.

17. Zhang WM, Zhang JJ, Jiang X, Chao H, Zhou NY. 2015. Transcriptionalactivation of multiple operons involved in para-nitrophenol degradationby Pseudomonas sp. strain WBC-3. Appl Environ Microbiol 81:220 –230.http://dx.doi.org/10.1128/AEM.02720-14.

18. Romero-Steiner S, Parales RE, Harwood CS, Houghton JE. 1994. Char-acterization of the pcaR regulatory gene from Pseudomonas putida, whichis required for the complete degradation of p-hydroxybenzoate. J Bacte-riol 176:5771–5779.

19. Molina-Henares AJ, Krell T, Eugenia Guazzaroni M, Segura A, RamosJL. 2006. Members of the IclR family of bacterial transcriptional regulatorsfunction as activators and/or repressors. FEMS Microbiol Rev 30:157–186. http://dx.doi.org/10.1111/j.1574-6976.2005.00008.x.

20. Bassler B, Vogel J. 2013. Bacterial regulatory mechanisms: the gene andbeyond. Curr Opin Microbiol 16:109 –111. http://dx.doi.org/10.1016/j.mib.2013.04.001.

21. Urata M, Uchimura H, Noguchi H, Sakaguchi T, Takemura T, Eto K,Habe H, Omori T, Yamane H, Nojiri H. 2006. Plasmid pCAR3 containsmultiple gene sets involved in the conversion of carbazole to anthranilate.Appl Environ Microbiol 72:3198 –3205. http://dx.doi.org/10.1128/AEM.72.5.3198-3205.2006.

22. Shintani M, Urata M, Inoue K, Eto K, Habe H, Omori T, Yamane H,Nojiri H. 2007. The Sphingomonas plasmid pCAR3 is involved in com-plete mineralization of carbazole. J Bacteriol 189:2007–2020. http://dx.doi.org/10.1128/JB.01486-06.

23. Tropel D, van der Meer JR. 2004. Bacterial transcriptional regulators fordegradation pathways of aromatic compounds. Microbiol Mol Biol Rev68:474 –500. http://dx.doi.org/10.1128/MMBR.68.3.474-500.2004.

24. DiMarco AA, Ornston LN. 1994. Regulation of p-hydroxybenzoate hy-droxylase synthesis by PobR bound to an operator in Acinetobacter cal-coaceticus. J Bacteriol 176:4277– 4284.

25. DiMarco AA, Averhoff B, Ornston LN. 1993. Identification of the tran-scriptional activator pobR and characterization of its role in the expression

of pobA, the structural gene for p-hydroxybenzoate hydroxylase in Acin-etobacter calcoaceticus. J Bacteriol 175:4499 – 4506.

26. Nga DP, Altenbuchner J, Heiss GS. 2004. NpdR, a repressor involved in2,4,6-trinitrophenol degradation in Rhodococcus opacus HL PM-1. J Bac-teriol 186:98 –103. http://dx.doi.org/10.1128/JB.186.1.98-103.2004.

27. Guo Z, Houghton JE. 1999. PcaR-mediated activation and repression ofpca genes from Pseudomonas putida are propagated by its binding to boththe �35 and the �10 promoter elements. Mol Microbiol 32:253–263.http://dx.doi.org/10.1046/j.1365-2958.1999.01342.x.

28. Gerischer U, Segura A, Ornston LN. 1998. PcaU, a transcriptional acti-vator of genes for protocatechuate utilization in Acinetobacter. J Bacteriol180:1512–1524.

29. Torres B, Porras G, Garcia JL, Diaz E. 2003. Regulation of the mhpcluster responsible for 3-(3-hydroxyphenyl)propionic acid degradation inEscherichia coli. J Biol Chem 278:27575–27585. http://dx.doi.org/10.1074/jbc.M303245200.

30. Chao H, Zhou NY. 2013. GenR, an IclR-type regulator, activates andrepresses the transcription of gen genes involved in 3-hydroxybenzoateand gentisate catabolism in Corynebacterium glutamicum. J Bacteriol 195:1598 –1609. http://dx.doi.org/10.1128/JB.02216-12.

31. Gu T, Zhou C, Sorensen SR, Zhang J, He J, Yu P, Yan X, Li S. 2013. Thenovel bacterial N-demethylase PdmAB is responsible for the initial step ofN,N-dimethyl-substituted phenylurea herbicide degradation. Appl Envi-ron Microbiol 79:7846 –7856. http://dx.doi.org/10.1128/AEM.02478-13.

32. Krivobok S, Kuony S, Meyer C, Louwagie M, Willison JC, Jouanneau Y.2003. Identification of pyrene-induced proteins in Mycobacterium sp.strain 6PY1: evidence for two ring-hydroxylating dioxygenases. J Bacteriol185:3828 –3841. http://dx.doi.org/10.1128/JB.185.13.3828-3841.2003.

33. Khan AA, Wang RF, Cao WW, Doerge DR, Wennerstrom D, CernigliaCE. 2001. Molecular cloning, nucleotide sequence, and expression ofgenes encoding a polycyclic aromatic ring dioxygenase from Mycobacte-rium sp. strain PYR-1. Appl Environ Microbiol 67:3577–3585. http://dx.doi.org/10.1128/AEM.67.8.3577-3585.2001.

Cheng et al.

8092 aem.asm.org December 2015 Volume 81 Number 23Applied and Environmental Microbiology

on January 24, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from