a study on mthfr - hindawi publishing corporationdownloads.hindawi.com/archive/2014/310241.pdfmthfr...

Research ArticleA Study on MTHFR C677T Gene Polymorphism andAlcohol Dependence among Meiteis of Manipur India

Huidrom Suraj Singh12 Kabita Salam13 and Kallur Nava Saraswathy1

1 Molecular Anthropology Laboratory Department of Anthropology University of Delhi Delhi 110007 India2Department of Anthropology and Tribal Development Guru Ghasidas Vishwavidyalaya Bilaspur Chhattisgarh 495009 India3The INCLEN Trust International Okhla Industrial Area Phase I New Delhi 110020 India

Correspondence should be addressed to Kallur Nava Saraswathy knsaraswathyyahoocom

Received 28 May 2014 Accepted 15 September 2014 Published 1 October 2014

Academic Editor Ranju Ralhan

Copyright copy 2014 Huidrom Suraj Singh et al This is an open access article distributed under the Creative Commons AttributionLicense which permits unrestricted use distribution and reproduction in any medium provided the original work is properlycited

Chronic alcohol consumption is reported to be associated with increase in plasma homocysteine levels which is further influencedby the polymorphism in methylenetetrahydrofolate reductase (MTHFR) gene The present study aims to understand the extentof the MTHFR C677T polymorphism in alcohol dependent (AD) cases of Meiteis of Manipur a Mendelian population of IndiaMTHFR C677T polymorphism was screened in 313 controls and 139 alcohol dependent (AD) cases who all met DSM-IV criteriafor alcohol dependence Both AD cases and controls were unrelated up to 1st cousin Among the control group different drinkingpatterns like abstainernondrinkers (NDs) occasional drinkers (ODs) andmoderate drinkers (MDs) are included Both the groupswere found to be in Hardy-Weinberg equilibrium (119875 gt 005) Genotypic and allelic frequency distribution of MTHFR C677Tpolymorphism did not differ significantly between AD cases and controls (119875 gt 005) However individuals carrying mutant (T)allele show more than 1-fold increased risk for AD though not significant (OR= 143 95 CI 041ndash501 119875 gt 005) In conclusionMTHFR C677T polymorphism is not found to be risk marker for AD in present studied population However higher prevalenceof the mutant T allele may exacerbate deleterious health risk in future especially among alcohol drinkers

1 Introduction

Alcoholism or alcohol dependence (AD) is a complex traitcharacterized by a cluster of physiological behavioural andcognitive phenomena in which the use of alcohol takes ona much higher priority for a given individual than otherbehaviours that once had greater value [1] TheWorld HealthOrganization (WHO) estimates that about 140million peoplethroughout the world suffer from AD [2] Moreover it is oneof the leading health risks and is likely to becomeworldrsquos thirdlargest risk factor for disease and disability Approximately 25million deaths each year are attributable to alcohol resultingin 4 of all deaths worldwide [3]

Several studies show significance of genetic influencesin substance abuse and dependence [4 5] However com-prehensive molecular and pathophysiological mechanismassociated with AD is not completely revealed yet As genetic

predisposition to AD and its related morbidity and mortalityis undebatable the emerging research has picked upmomen-tum targeting various pathways involved in alcohol con-sumption and metabolism for deeper understanding of thepathophysiology of AD Recent studies revealed associationof gene that encodes themethylenetetrahydrofolate reductase(MTHFRC677T) with AD However findings showed incon-sistent results [6ndash8] Available literature indicates that thispolymorphism confers elevation of plasmaHcy levels leadingto a condition known as hyperhomocysteinemia [9 10]Moreover chronic alcohol consumption is also often found tobe associated with hyperhomocysteinemia [11] Elevation ofHcy levels may further lead to or be associated with severalcomplex diseases or clinical conditions including cardiovas-cular diseases pregnancy complications neural tube defectsAlzheimer disease end-stage renal disease schizophrenia

Hindawi Publishing CorporationJournal of BiomarkersVolume 2014 Article ID 310241 5 pageshttpdxdoiorg1011552014310241

2 Journal of Biomarkers

Table 1 Characteristic feature of the selected SNPMTHFR C677T polymorphism

Gene SNP (rs) Position Nucleotide sequence Restriction enzyme Reference

MTHFR C677T (1801133) Exon 4 F51015840TGAAGGAGAAGGTGTCTGCGGGA31015840 Hinf I Arruda et al 1997 [16]R51015840AGGACGGTGCGGTGAGAGTG31015840

Table 2 Genotypic and allelic frequency distribution of MTHFR C677T gene polymorphism among different patterns of alcoholconsumption

Genetic Marker(MTHFR C677T)

AD cases(119873 = 139)

Controls (ND + OD +MD) (119873 = 313)

ND(119873 = 121)

OD(119873 = 113)

MD(119873 = 79)

1205942 (119875 value)

1198751119875211987531198754

CC () 91 (6547) 228 (7284) 89 (7355) 81 (7168) 58 (7342)0283 0366 0876 0352CT () 44 (3165) 78 (2492) 29 (2397) 28 (2478) 21 (2658)

TT () 4 (288) 7 (224) 3 (248) 4 (354) 0C (frequency) 226 (081) 534 (085) 207 (086) 190 (084) 137 (087) 0129 0334 0901 0378T (frequency) 52 (019) 92 (015) 38 (014) 36 (016) 21 (013)119873 number ND nondrinkers OD occasional drinkers MD moderate drinkers1205942 likelihood ratio test comparing genotype and allele frequency 1198751 = AD versus control (ND + OD +MD) 1198752 = AD versus ND 1198753 = ND versus OD 1198754 =

ND versus MD significance level at 5

and noninsulin dependent diabetes as evidenced from sev-eral studies [12 13]

We therefore believe that studying MTHFR C677T genepolymorphism might possibly be helpful for understandingpathophysiology of AD and its associated complex clini-cal conditions particularly among those populations whereprevalence of alcohol consumptiondrinking is very high Butno such trial studies have so far been carried out in any Indiancommunity (according to our knowledge) Thus in the pre-sent study an attempt is made to understand the extent ofMTHFRC677T gene polymorphism inADcases and controlsfrom Meiteis of Manipur where prevalenceoccurrence ofalcohol drinkers is very high [2 14]

2 Methods

21 General Characteristics The present studyrsquos Meitei pop-ulation consisted of 452 subjects of which 139 were ADcases and 313 were unrelated healthy controls matched forethnicity and geography All the subjects included in thepresent study were recruited from four districts of Manipurnamely Imphal East Imphal West Thoubal and Bishnupurwhere Meiteis are the predominant inhabitants Diagnosisof alcohol dependence was made on the basis of Diagnosticand Statistical Manual IV (DSM-IV) criteria for AD [15]Theselected control group included individuals consuming alco-hol (occasional and moderate drinkers) who were not cat-egorized as alcohol dependent according to the DSM-IVcriteria 121 were absolute nondrinkersThe present study wasapproved by the departmental ethics committee DepartmentofAnthropologyUniversity ofDelhi India Informedwrittenconsent was obtained from all the subjects before collectingthe samples

22 Genetic Analysis 5mL of intravenous blood sampleswere collected in ethylenediaminetetraacetic acid coated vac-utainers from all the subjects recruited in the present study

using disposable single-use syringes DNA was isolated fromthe collected samples using standard protocol [17] Identifica-tion of MTHFR C677T polymorphism was performed usingpreviously described protocol usingHinf I restriction enzymedigestion [16] The digested PCR products were observed ona 3 agarose gel electrophoresis stained with ethidium bro-mide Positive and negative controls are run along with sam-ples as quality control Genotyping details of the selected SNPare shown in Table 1

23 Statistical Analysis Genotypic and allele frequencieswere calculated by gene counting method and Hardy-Wein-berg equilibrium (HWE) was determined using the 1205942 good-ness-of-fit test using POPGENE 131 [18] Genotypic andallelic frequency distribution was assessed among the studiedpopulation and comparison was made between NDs andODs NDs and MDs and NDs and AD cases using 1205942 testAssociation of drinking status as well as MTHFR C677Tallelic and genotypic counts with AD was evaluated by Pear-sonrsquos 1205942-test followed by odds ratio (OR) at 95 confidentialinterval (CI) using the freely available 2times2 contingency table[19] Statistical significance was considered at 5 level Powerof the study was calculated using online available software(httpossebiia-staredusgindexphp)

3 Results

In the present study a comparative analysis of the selectedSNP MTHFR C677T polymorphism was carried out amongalcohol dependent (AD) cases and controls to understandthe effects and their outcome However the selected controlgroup included nondrinkers (NDs) and individuals consum-ing alcohol who were not categorized as alcohol dependenceas per DSM-IV criteria rather they were occasional drinkers(ODs) andmoderate drinkers (MDs) To control the biasnessselected genetic marker was assessed in the subgroups ofcontrols that is NDs ODs MDs and AD cases (see Table 2)

Journal of Biomarkers 3

Table 3 Relative risk analysis (Odds Ratio) ofMTHFR C677T polymorphism and different drinking patterns

MTHFRC677T AD Control ND OD MD OR1 (95 CI) 1198751 OR2 (95 CI) 1198752 OR3 (95 CI) 1198753 OR4 (95 CI) 1198754

CC 91 228 89 81 58 Reference Reference Reference ReferenceCT 44 78 29 28 21 141 (091ndash220) 012 148 (085ndash258) 016 106 (058ndash193) 084 111 (058ndash213) 075TT 4 7 3 4 0 143 (041ndash501) mdash 130 (028ndash599) mdash 146 (032ndash674) mdash mdash mdashCT + TT 48 85 32 32 21 141 (092ndash217) 011 147 (086ndash250) 016 110 (062ndash195) 075 101 (053ndash191) 1ND nondrinkers OD occasional drinkers MD moderate drinkersOR1 odd ration between AD and control OR2 odd ration between AD and ND OR3 odd ration between ND and OD OR4 odd ration between ND andMD CI confidential interval1198751 = AD versus control (ND + OD +MD) 1198752 = AD versus ND 1198753 = ND versus OD 1198754 = ND versus MD significance level at 5

Less than 3 of individuals were found to have MTHFR677TT mutant homozygous genotype among the studiedMeitei population The genotypic frequency distribution ofthe MTHFR 667CC 667CT and 667TT genotypes were6547 3165 and 288 respectively among AD casescompared with 7284 2492 and 224 respectivelyamong controls Both groups that is AD cases and controlswere found to be in Hardy-Weinberg equilibrium (119875 gt 005)No significant difference is observed between AD cases andcombined controls with respect to genotypic and allelic fre-quency distribution of MTHFR C677T polymorphism (119875 gt005) Relative risk analysis reveals that individuals who carrymutant T allele in both heterozygous or homozygous condi-tion show more than onefold increased risk for AD (OR =143 CI 041ndash501 andOR = 141 CI 091ndash220 resp) howeverthe riskwas not found to be statistically significant (119875 gt 005)Power of the study was found to be lt20 which could pos-sibly be due to smaller sample size of the studied population

To assess the extent ofMTHFR C677T polymorphism ondifferent patterns of drinking mutant homozygous 677TTgenotype was further assessed in the three subgroups of con-trols (NDs ODs and MDs) and AD cases 677TT genotypeindividuals were found to be lower in NDs (248) as com-pared to ODs (354) and AD cases (288) the differencewas not found to be statistically significant (119875 gt 005)Though 677TT genotype is found to be completely absentamong MDs This could possibly be due to smaller samplesize among themoderate drinkers (MDs) Distribution of themutant T allele frequency showed an increasing trend fromNDs to ODs to AD cases with slight drop among MDs

To understand the relative risk of MTHFR 677TT geno-type on different patterns of drinking odds ratio was calcu-lated for ODs MDs and AD cases taking NDs as referencegroup Except AD cases (OR = 147 CI 086ndash250) othergroups that is ODs (OR = 110 CI 062ndash195) andMDs (OR =101 CI 053ndash191) showedmore or less than onefold increasedrisk for alcohol dependence though risks were not found tobe statistically significant (119875 gt 005) in all the three alcoholdrinking categories (Table 3)

4 Discussion

Alcohol is a toxic substance that can affect each and everyorgan of human body particularly stomach liver brain andheart Alcohol has been found to interact withMTHFR gene

polymorphism as indicated by several literatures in modi-fying the risk of several complex diseases including cardio-vascular diseases diabetes colon cancer breast cancer andhepatocellular carcinoma [20 21]Moreover previous studieshave associatedMTHFR gene polymorphism with decreasedenzymatic activity and modified homocysteine regulationTherefore chronic alcohol consumptionmay increase the riskof causingdeveloping total plasma homocysteine levels (iehyperhomocysteinemia) which may further lead to severaldisease phenotypes in the presence of the reduced MTHFRactivity associated with the polymorphic gene The presentstudy determines and compares MTHFR C677T polymor-phism among AD cases and controls among Meiteis ofManipur which is reported to have higher prevalence ofalcohol dependence [2 14] One of the contributing factors ofalcohol dependence in Manipur has been cited as widelyavailable in every nook and corner despite the fact that it isofficially declared ldquodryrdquo state

TheMTHFRC677T polymorphism has been investigatedfor its association with several complex diseases in severalstudies across different populations however results are notconsistent One of the possible reasons for this could beattributed to variation in allelic frequency distribution in dif-ferent population groups The 677T allele frequency is foundto be highest in European populations ranging from 241to 643 and hence it is presumed to be originated in Europein the late state of human evolution However zero frequencyof this allele is reported from African population [22]In Indian population distribution of 677T allele ranges fromcomplete absence to 237 and highest frequency was repor-ted fromNorth-Indian population Moreover frequency of Tallele is found to be relatively higher among caste populationsas compared to that of tribal populations of India Lin-guistically Indo-European speakers have relatively higher Tallele frequency followed by Tibeto-Burman Dravidian andAustro-Asiatic speakers [22]

An association study carried out in European Caucasoidpopulation demonstrated significant association of mutantT allele of MTHFR C677T polymorphism with alcoholicpatientswith a history ofwithdrawal symptoms (WS) (T allelefrequency minus controls = 028 AD cases = 039 119875 = 003) [6]Similar findings were also reported by Benyamina et alsuggesting possible role of C677T SNP on the etiology of ADTheMTHFR TT genotype was found to be more prevalent inAD patients with milder alcohol dependence (Babor type A)


and with Lesch type 3 associated with depression [8] In thepresent study no association was found between alleles orgenotypes ofMTHFR C677T polymorphism and AD amongMeiteisofManipurHowever our observation of TTgenotypebeing slightly higher among AD cases (288) as compared tocontrols (224) is in concurrence with the above associationstudies where an excess of mutant homozygotes has beenreported among the AD cases Though no significant differ-ence was observed in the present study 677T allele frequencydistribution among nondrinkers (NDs) that is 014 is inaccordance with previous report [23] Moreover distributionof the mutant T allele frequency showed an increasing trendin the present study fromNDs to ODs to AD cases with slightdrop among MDs Lower frequency of T allele among theMDs could be attributed to smaller sample size as well ascomplete absence of mutant homozygous TT genotype Suchsimilar increasing trend of T allele is also reported amongdifferent subgroups of alcohol use disorders like from healthycontrols (028) to alcoholic patients with mild withdrawalsymptoms (033) up to 040 in alcohol dependent patientshaving withdrawal symptoms [6]

However in contrast to the present study and otherassociation studies reporting association of MTHFR C677Tgene polymorphismwith AD Saffroy et al reported a contra-dictory result among the Caucasian French populations [7]In fact they attempted to understand the prevalence of theMTHFR C677T polymorphism in AD subjects and itsinfluence on symptoms associated with alcoholism amongCaucasian French populations They observed a significantdecrease inMTHFR 677TT prevalence among AD cases (921242) compared to controls (18 1793) (119875 lt 002) with anodds ratio of 042 for alcoholism in subjects with TTgenotype (95 CI 021ndash083) They reported that MTHFR677TT genotype could play a protective role against alcoholdependence for the first time They also suggested possi-bility of influence of MTHFR C677T polymorphism on thedevelopment of the dependence process itself Howevermoreassociation studies are needed to really understand whetherMTHFR C677TT genotype is protective against AD ornot Though no confirmatory studies have been reportedtill now one of the possible reasons for such inconsistentresults could be attributed to its associations with one-carbonmetabolism pathway as MHFR C677T polymorphism playsan important role in elevation of plasmaHcy levelsMoreoverit is also evident that chronic alcohol consumption is asso-ciated with folate deficiency which may further lead to animpairedmetabolism of homocysteine via inhibitingmethio-nine synthase resulting in the elevation ofHcy level [24] Bothelevation of Hcy level and deficiency of folate may furtherinfluence DNAmethylation rate since folate acts as a methyldonor (via S-adenosylmethionine) for DNA methyltrans-ferase andhistonemethyltransferase [25] Aberration inDNAmethylation status can lead to alterations in reprogrammingof epigenetic patterns thereby affecting gene regulation [26]Further it also alters the dopaminergic neurotransmissionsystem in the brain affecting cognitive behaviours and addic-tion [27] Therefore polymorphism in this gene may indi-rectly propagate the development of alcohol dependence by

impairing homocysteine metabolism via inhibiting methion-ine synthase

Findings of the present study and available literaturessuggest that MTHFR C677T polymorphism influence theetiology of alcohol dependence However focusing on the illeffects of MTHFR C677T gene polymorphism and its inter-action with alcohol would be more meaningful rather thanfocusing on the development of alcohol dependence processHowever present study has some major limitations likesmaller sample size (low study power) and lack of data onrelated biochemical variables including homocysteine levelsfolate and vitamin B

12 Further studies are required to

understand the exact pathophysiological mechanism ofthe development of alcohol dependence with respect toMTHFR C677T gene polymorphism Therefore associationof MTHFR 677TT genotype with hyperhomocysteinemiafolate and vitamin B

12levels could assist physicians in iden-

tifying AD patients as well as improvement in addictionmanagement

5 Conclusions

In brief to our knowledge this is the first study attempted tounderstand the extent ofMTHFRC677T gene polymorphismagainst alcohol dependence in Indian context The presentstudy indicates that MTHFR C677T polymorphism has nodirect significant conferring risk for AD among Meiteis ofManipur However the selected polymorphism may directlyor indirectly affect the one-carbonmetabolism by interactingwith environmental risk factors and subsequently progressingtowards the development of AD Higher prevalence of themutant allele in the studied population may exacerbate dele-terious future health risk among alcohol drinkers (especiallyAD cases) Therefore the present paper paves a way forfurther population specific studies specifically interactionof selected SNP with biochemical variables including homo-cysteine folate vitamin B

12 liver function test etc to

understand its relationship and predictive outcomes of healtheffects as well developing right interventional strategies andtherapeutics

Conflict of Interests

The authors report no conflict of interests

Acknowledgments

The authors wish to thank all the individuals who partic-ipated and contributed to the successful completion of thepresent studyTheywould also like to thankUniversityGrantsCommission (UGC) India for their financial support andCentre for Social Development (CSD) Manipur for allowingthem to collect samples

References

[1] WHOTheICD-10 Classification ofMental andBehaviouralDis-orders Clinical Descriptions and Diagnostic Guidelines WorldHealth Organisation Geneva Switzerland 1992


[2] WHOGlobal Status Report on AlcoholWHOGeneva Switzer-land 2004

[3] WHO Global Status Report on Alcohol and Health WHOGeneva Switzerland 2011

[4] M-A Enoch ldquoGenetic and environmental influences on thedevelopment of alcoholism resilience vs riskrdquo Annals of theNew York Academy of Sciences vol 1094 pp 193ndash201 2006

[5] D M Dick and A Agrawal ldquoThe genetics of alcohol and otherdrug dependencerdquo Alcohol Research and Health vol 31 no 2pp 111ndash118 2008

[6] U C Lutz A Batra W Kolb F MacHicao S Maurer andM D Kohnke ldquoMethylenetetrahydrofolate reductase C677T-polymorphism and its association with alcohol withdrawalseizurerdquoAlcoholism Clinical andExperimental Research vol 30no 12 pp 1966ndash1971 2006

[7] R Saffroy A Benyamina P Pham et al ldquoProtective effectagainst alcohol dependence of the thermolabile variant ofMTHFRrdquoDrug andAlcohol Dependence vol 96 no 1-2 pp 30ndash36 2008

[8] A Benyamina R Saffroy L Blecha et al ldquoAssociation betweenMTHFR 677C-T polymorphism and alcohol dependenceaccording to Lesch and Babor typologyrdquo Addiction Biology vol14 no 4 pp 503ndash505 2009

[9] P Frosst H J Blom R Milos et al ldquoA candidate genetic riskfactor for vascular disease a commonmutation inmethylenete-trahydrofolate reductaserdquoNature Genetics vol 10 no 1 pp 111ndash113 1995

[10] L L N Husemoen T F Thomsen M Fenger H L Joslashrgensenand T Joslashrgensen ldquoContribution of thermolabile methylenete-trahydrofolate reductase variant to total plasma homocysteinelevels in healthymen andwomen Inter99 (2)rdquoGenetic Epidemi-ology vol 24 no 4 pp 322ndash330 2003

[11] S Bleich M Carl K Bayerlein et al ldquoEvidence of increasedhomocysteine levels in alcoholism the Franconian alcoholismresearch studies (FARS)rdquoAlcoholism Clinical and ExperimentalResearch vol 29 no 3 pp 334ndash336 2005

[12] Homocysteine Studies Collaboration ldquoHomocysteine and riskof ischemic heart disease and stroke a meta-analysisrdquo Journal ofAmerican Medical Association vol 288 no 16 pp 2015ndash20222002

[13] S Seshadri A Beiser J Selhub et al ldquoPlasma homocysteine asa risk factor for dementia and Alzheimerrsquos diseaserdquo The NewEngland Journal of Medicine vol 346 no 7 pp 476ndash483 2002

[14] S Ningombam Y Hutin and M V Murhekar ldquoPrevalence andpattern of substance use among the higher secondary schoolstudents of Imphal Manipur Indiardquo National Medical Journalof India vol 24 no 1 pp 11ndash15 2011

[15] American Psychiatric Association Diagnostic and StatisticalManual of Mental Disorders Fourth Edition (DSM-IV) Amer-ican Psychiatric Press Washington DC USA 1994

[16] V R Arruda P M von Zuben L C Chiaparini J MAnnichino-Bizzacchi and F F Costa ldquoThe mutation Ala 677gtVal in the methylene tetrahydrofolate reductase gene a riskfactor for arterial disease and venous thrombosisrdquo Thrombosisand Haemostasis vol 77 no 5 pp 818ndash821 1997

[17] S A Miller D D Dykes and H F Polesky ldquoA simple saltingout procedure for extracting DNA from human nucleated cellsrdquoNucleic Acids Research vol 16 no 3 p 1215 1988

[18] F C Yeh and R Yang Popgene Version 131 Microsoft WindowBased Freeware for Population Genetic Analysis Universityof Alberta and Tim Boyle Centre for International ForestryResearch Alberta Canada 1999

[19] httpvassarstatsnetodds2x2html[20] L B Bailey ldquoFolate methyl-related nutrients alcohol and

the MTHFR 677CgtT polymorphism affect cancer risk intakerecommendationsrdquo Journal of Nutrition vol 133 supplement 1no 11 pp 3748ndash3753 2003

[21] R Saffroy P Pham F Chiappini et al ldquoThe MTHFR 677CgtTpolymorphism is associated with an increased risk of hep-atocellular carcinoma in patients with alcoholic cirrhosisrdquoCarcinogenesis vol 25 no 8 pp 1443ndash1448 2004

[22] K N Saraswathy M Asghar R Samtani et al ldquoSpectrum ofMTHFR gene SNPs C677T and A1298C a study among 23population groups of IndiardquoMolecular Biology Reports vol 39no 4 pp 5025ndash5031 2012

[23] S Kabita H S Singh D S Chongtham and K N SaraswathyldquoMTHFR C677T polymorphism among Meiteis of Manipur(India)rdquo Ethnicity and Disease vol 23 no 3 pp 379ndash381 2013

[24] S Bleich D Degner K Javaheripour C Kurth and J Kornhu-ber ldquoHomocysteine and alcoholismrdquo Journal of Neural Trans-mission vol 60 pp 187ndash196 2000

[25] M P Mattson and T B Shea ldquoFolate and homocysteinemetabolism in neural plasticity and neurodegenerative disor-dersrdquo Trends in Neurosciences vol 26 no 3 pp 137ndash146 2003

[26] A Fuso L Seminara R A Cavallaro F DrsquoAnselmi and SScarpa ldquoS-adenosylmethioninehomocysteine cycle alterationsmodify DNA methylation status with consequent deregulationof PS1 and BACE and beta-amyloid productionrdquoMolecular andCellular Neuroscience vol 28 no 1 pp 195ndash204 2005

[27] D Bonsch B Lenz J Kornhuber and S Bleich ldquoDNA hyper-methylation of the alpha synuclein promoter in patients withalcoholismrdquo NeuroReport vol 16 no 2 pp 167ndash170 2005

Submit your manuscripts athttpwwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014


MEDIATORSINFLAMMATION

of


Behavioural Neurology

EndocrinologyInternational Journal of



Disease Markers


BioMed Research International

OncologyJournal of



Oxidative Medicine and Cellular Longevity


PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of



Computational and Mathematical Methods in Medicine

OphthalmologyJournal of


Diabetes ResearchJournal of



Research and TreatmentAIDS


Gastroenterology Research and Practice


Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom


Table 1 Characteristic feature of the selected SNPMTHFR C677T polymorphism

Gene SNP (rs) Position Nucleotide sequence Restriction enzyme Reference

MTHFR C677T (1801133) Exon 4 F51015840TGAAGGAGAAGGTGTCTGCGGGA31015840 Hinf I Arruda et al 1997 [16]R51015840AGGACGGTGCGGTGAGAGTG31015840

Table 2 Genotypic and allelic frequency distribution of MTHFR C677T gene polymorphism among different patterns of alcoholconsumption

Genetic Marker(MTHFR C677T)

AD cases(119873 = 139)

Controls (ND + OD +MD) (119873 = 313)

ND(119873 = 121)

OD(119873 = 113)

MD(119873 = 79)

1205942 (119875 value)

1198751119875211987531198754

CC () 91 (6547) 228 (7284) 89 (7355) 81 (7168) 58 (7342)0283 0366 0876 0352CT () 44 (3165) 78 (2492) 29 (2397) 28 (2478) 21 (2658)

TT () 4 (288) 7 (224) 3 (248) 4 (354) 0C (frequency) 226 (081) 534 (085) 207 (086) 190 (084) 137 (087) 0129 0334 0901 0378T (frequency) 52 (019) 92 (015) 38 (014) 36 (016) 21 (013)119873 number ND nondrinkers OD occasional drinkers MD moderate drinkers1205942 likelihood ratio test comparing genotype and allele frequency 1198751 = AD versus control (ND + OD +MD) 1198752 = AD versus ND 1198753 = ND versus OD 1198754 =

ND versus MD significance level at 5

and noninsulin dependent diabetes as evidenced from sev-eral studies [12 13]

We therefore believe that studying MTHFR C677T genepolymorphism might possibly be helpful for understandingpathophysiology of AD and its associated complex clini-cal conditions particularly among those populations whereprevalence of alcohol consumptiondrinking is very high Butno such trial studies have so far been carried out in any Indiancommunity (according to our knowledge) Thus in the pre-sent study an attempt is made to understand the extent ofMTHFRC677T gene polymorphism inADcases and controlsfrom Meiteis of Manipur where prevalenceoccurrence ofalcohol drinkers is very high [2 14]

2 Methods

21 General Characteristics The present studyrsquos Meitei pop-ulation consisted of 452 subjects of which 139 were ADcases and 313 were unrelated healthy controls matched forethnicity and geography All the subjects included in thepresent study were recruited from four districts of Manipurnamely Imphal East Imphal West Thoubal and Bishnupurwhere Meiteis are the predominant inhabitants Diagnosisof alcohol dependence was made on the basis of Diagnosticand Statistical Manual IV (DSM-IV) criteria for AD [15]Theselected control group included individuals consuming alco-hol (occasional and moderate drinkers) who were not cat-egorized as alcohol dependent according to the DSM-IVcriteria 121 were absolute nondrinkersThe present study wasapproved by the departmental ethics committee DepartmentofAnthropologyUniversity ofDelhi India Informedwrittenconsent was obtained from all the subjects before collectingthe samples

22 Genetic Analysis 5mL of intravenous blood sampleswere collected in ethylenediaminetetraacetic acid coated vac-utainers from all the subjects recruited in the present study

using disposable single-use syringes DNA was isolated fromthe collected samples using standard protocol [17] Identifica-tion of MTHFR C677T polymorphism was performed usingpreviously described protocol usingHinf I restriction enzymedigestion [16] The digested PCR products were observed ona 3 agarose gel electrophoresis stained with ethidium bro-mide Positive and negative controls are run along with sam-ples as quality control Genotyping details of the selected SNPare shown in Table 1

23 Statistical Analysis Genotypic and allele frequencieswere calculated by gene counting method and Hardy-Wein-berg equilibrium (HWE) was determined using the 1205942 good-ness-of-fit test using POPGENE 131 [18] Genotypic andallelic frequency distribution was assessed among the studiedpopulation and comparison was made between NDs andODs NDs and MDs and NDs and AD cases using 1205942 testAssociation of drinking status as well as MTHFR C677Tallelic and genotypic counts with AD was evaluated by Pear-sonrsquos 1205942-test followed by odds ratio (OR) at 95 confidentialinterval (CI) using the freely available 2times2 contingency table[19] Statistical significance was considered at 5 level Powerof the study was calculated using online available software(httpossebiia-staredusgindexphp)

3 Results

In the present study a comparative analysis of the selectedSNP MTHFR C677T polymorphism was carried out amongalcohol dependent (AD) cases and controls to understandthe effects and their outcome However the selected controlgroup included nondrinkers (NDs) and individuals consum-ing alcohol who were not categorized as alcohol dependenceas per DSM-IV criteria rather they were occasional drinkers(ODs) andmoderate drinkers (MDs) To control the biasnessselected genetic marker was assessed in the subgroups ofcontrols that is NDs ODs MDs and AD cases (see Table 2)








4 Discussion














5 Conclusions






Acknowledgments


References


































of






Disease Markers



OncologyJournal of





PPAR Research



Journal of

ObesityJournal of























4 Discussion














5 Conclusions






Acknowledgments


References


































of






Disease Markers



OncologyJournal of





PPAR Research



Journal of

ObesityJournal of

























5 Conclusions






Acknowledgments


References


































of






Disease Markers



OncologyJournal of





PPAR Research



Journal of

ObesityJournal of
















































of






Disease Markers



OncologyJournal of





PPAR Research



Journal of

ObesityJournal of
















a study on mthfr - hindawi publishing corporationdownloads.hindawi.com/archive/2014/310241.pdfmthfr...

Documents