art science practices and collaborations in bangalore, india

35
Open Source ArtScience practices and collaborations in Bangalore, India Yashas Shetty (Art)ScienceBLR

Upload: hlab14

Post on 17-Jul-2015

176 views

Category:

Art & Photos


1 download

TRANSCRIPT

Page 1: Art science practices and collaborations in bangalore, india

Open Source ArtScience practices and collaborations in Bangalore,

IndiaYashas Shetty

(Art)ScienceBLR

Page 2: Art science practices and collaborations in bangalore, india

Bangalore,India

Page 3: Art science practices and collaborations in bangalore, india
Page 4: Art science practices and collaborations in bangalore, india
Page 5: Art science practices and collaborations in bangalore, india

Indian Institute of Science

Page 6: Art science practices and collaborations in bangalore, india

Infosys campus

Page 7: Art science practices and collaborations in bangalore, india

Srishti School of Art, Design and Technology

Page 8: Art science practices and collaborations in bangalore, india

Srishti School of Art, Design and Technology

Page 9: Art science practices and collaborations in bangalore, india

(Art)ScienceBLR

Page 10: Art science practices and collaborations in bangalore, india

National Center for Biological Sciences

Page 11: Art science practices and collaborations in bangalore, india
Page 12: Art science practices and collaborations in bangalore, india

International Genetically Engineered Machines competion

Page 13: Art science practices and collaborations in bangalore, india
Page 14: Art science practices and collaborations in bangalore, india
Page 15: Art science practices and collaborations in bangalore, india
Page 16: Art science practices and collaborations in bangalore, india
Page 17: Art science practices and collaborations in bangalore, india

Teenage Gene Poems(2009)

Page 18: Art science practices and collaborations in bangalore, india

BBa_K221000 Teenage gene Poems(2009)

• atgacgcaacagcccttccaactcccgcacttctacctgccgcaccccgcacggctcaacccgcatctcgacgaggcccgcgcccactcgacgacgtggg cgcgcgagatgggcatgctggagggctccggggtctgggagcagtccgacctcgaagcccacgactacggcctgctctgcgcctacacccaccccgactg cgacgggccggcgctctccctcatcaccgactggtacgtgtgggtcttcttcttcgacgaccacttcctggagaagtacaaacgcagccaggaccgcctc gccggcaaggcccacctggaccggctcccgctgttcatgccgctcgacgacgccgccgggatgcccgagccgcggaacccggtggaggccggactcgccg acctgtggacccgcacggtgcccgcgatgtcggccgactggcgccgccgcttcgccgtcgccaccgagcacctcctcaacgagtccatgtgggagctgtc caacatcaacgaggggcgggtcgccaacccggtcgagtacatcgagatgcgccgcaaggtcggcggcgccccgtggtcggccgggctcgtggagtacgcg accgccgaggtgcccgccgccgtcgccgggaccaggccgctcagggtgctgatggagacgttctccgacgccgtgcacctgcgcaacgacctcttctcct accagcgcgaggtcgaggacgagggcgagctgagcaacggggtgctggtgttggagaccttcttcggctgcaccacccaggaggccgccgacctggtcaa cgacgtcctcacctcgcggctgcaccagttcgagcacaccgcgttcaccgaggtgcccgccgtcgccctggagaagggcctgaccccgttggaggtcgcc gccgtcggcgcgtacacgaagggcctccaggactggcagtccggcggccacgagtggcacatgcgttccagccgctacatgaacaagggggagcggcccc tggccggctggcaggcgctgaccgggcccggcacctccgcggcggacgtgggagcactgctcgccgacgcggtcgcccaacgggcccgctcctacacg

Page 19: Art science practices and collaborations in bangalore, india

Synthetic/Post Natural Ecologies(2010)

Page 20: Art science practices and collaborations in bangalore, india

DIY LAB equipment

Page 21: Art science practices and collaborations in bangalore, india

DIY Lab Equipment

Page 22: Art science practices and collaborations in bangalore, india

Autonomous Public Lab

Page 23: Art science practices and collaborations in bangalore, india

Searching for Genetically Engineered Machines(2011)

Page 24: Art science practices and collaborations in bangalore, india

Searching for Genetically Engineered Machines(2011)

Page 25: Art science practices and collaborations in bangalore, india

Searching for Genetically Engineered Machines(2011)

Page 26: Art science practices and collaborations in bangalore, india
Page 27: Art science practices and collaborations in bangalore, india

Searching for Genetically Engineered Machines(2011)

Page 28: Art science practices and collaborations in bangalore, india

Biodesign for the Real World

LifePatch(Indonesia) + ArtScienceBLR(India) + EPFL(Swiss)

Page 29: Art science practices and collaborations in bangalore, india

Metamap.in

Page 30: Art science practices and collaborations in bangalore, india

SeasonWatch.in

National Center for Biological Sciences, Bangalore

Page 31: Art science practices and collaborations in bangalore, india

Migrantwatch.in

National Center for Biological Sciences, Bangalore

Page 32: Art science practices and collaborations in bangalore, india

GubbiLabs.in

Page 33: Art science practices and collaborations in bangalore, india

India’s most famous DIY hacker

Page 34: Art science practices and collaborations in bangalore, india
Page 35: Art science practices and collaborations in bangalore, india

Thank you

• Dr. Mukund Thattai, NCBS• Dr. Geetha Narayanan, Srishti• Dr. Marc Dusseiller, Dusjagr Labs, Hackteria• Dr. Sachiko Hirosue, EPFL• LifePatch