nonrandom transduction of recombinant adeno-associated...

JOURNAL OF VIROLOGY,0022-538X/00/$04.0010

Apr. 2000, p. 3793–3803 Vol. 74, No. 8

Copyright © 2000, American Society for Microbiology. All Rights Reserved.

Nonrandom Transduction of Recombinant Adeno-AssociatedVirus Vectors in Mouse Hepatocytes In Vivo: Cell Cycling Does

Not Influence Hepatocyte TransductionCAROL H. MIAO,1 HIROYUKI NAKAI,2 ARTHUR R. THOMPSON,1 THERESA A. STORM,2

WINNIE CHIU,2 RICHARD O. SNYDER,3 AND MARK A. KAY2*

Puget Sound Blood Center, University of Washington, Seattle, Washington,1 and Departments of Pediatrics andGenetics, Stanford University, Stanford,2 and Cell Genesys, Foster City,3 California

Received 3 August 1999/Accepted 5 January 2000

Recombinant adeno-associated virus vectors (rAAV) show promise in preclinical trials for the treatment ofgenetic diseases including hemophilia. Liver-directed gene transfer results in a slow rise in transgene expres-sion, reaching steady-state levels over a period of 5 weeks concomitant with the conversion of the single-stranded rAAV molecules into high-molecular-weight concatemers in about 5% of hepatocytes. Immunohisto-chemistry and RNA in situ hybridization show that the transgene product is made in about ;5% ofhepatocytes, suggesting that most rAAV-mediated gene expression occurs in hepatocytes containing the double-stranded concatemers. In this study, the mechanism(s) involved in stable transduction in vivo was evaluated.While only ;5% of hepatocytes are stably transduced, in situ hybridization experiments demonstrated that thevast majority of the hepatocytes take up AAV-DNA genomes after portal vein infusion of the vector. Twodifferent vectors were infused together or staggered by 1, 3, or 5 weeks, and two-color fluorescent in situhybridization and molecular analyses were performed 5 weeks after the infusion of the second vector. Theseexperiments revealed that a small but changing subpopulation of hepatocytes were permissive to stabletransduction. Furthermore, in animals that received a single infusion of two vectors, about one-third of thetransduced cells contained heteroconcatemers, suggesting that dimer formation was a critical event in theprocess of concatemer formation. To determine if the progression through the cell cycle was important forrAAV transduction, animals were continuously infused with 5*-bromo-2*-deoxyuridine (BrdU), starting at thetime of administration of a rAAV vector that expressed cytoplasmic b-galactosidase. Colabeling for b-galac-tosidase and BrdU revealed that there was no preference for transduction of cycling cells. This was furtherconfirmed by demonstrating no increase in rAAV transduction efficiencies in animals whose livers were inducedto cycle at the time of or after vector administration. Taken together, our studies suggest that while virtuallyall hepatocytes take up vector, unknown cellular factors are required for stable transduction, and that dimerformation is a critical event in the transduction pathway. These studies have important implications forunderstanding the mechanism of integration and may be useful for improving liver gene transfer in vivo.

Recombinant adeno-associated virus vectors (rAAV) havebeen used to deliver therapeutic and in some cases curativeamounts of the factor IX gene into mice and dogs with hemo-philia B (8, 16, 23, 24). After intraportal delivery, factor IXlevels slowly rise during the first 5 weeks to reach a steady-stateconcentration in plasma. During this period, the number ofsingle-stranded rAAV vector genomes slowly decreases andthere is a concomitant increase in the number of high-molec-ular-weight concatemers (15). With a dose of 6.4 3 1010 viralparticles, pulsed-field gel electrophoresis and fluorescent insitu hybridization (FISH) analysis of isolated hepatic nucleishowed that there are concatemers and integrated rAAV pro-viral genomes in about 5% of hepatocytes (15, 24). Morerecently, integration of rAAV into the mouse genome has beenconfirmed by the cloning of mouse chromosomal AAV vectorjunction fragments from liver (17). The number of hepatocytesthat express the rAAV-mediated transgene product, as deter-mined by RNA in situ hybridization and protein immunohis-

tochemistry, is similar to the number of hepatocytes that con-tain the concatemers (24). This suggests that most if not all ofthe gene expression from the liver comes from the hepatocytesthat contain the integrated concatemers.

In cell culture, most but not all integrants contain a single-copy proviral genome (14, 22, 29). Some of the in vitro studieswere done using rAAV vectors that express neomycin phos-photransferase in G418-treated cells where all nonintegratedtransduction events would be quickly lost due to cell division.Whether the rapid cell division in cultured cells, selective pres-sure, metabolic state of the cells, or cell type is responsible forthe differences observed between in vivo and in vitro studies isnot known.

The mechanism(s) by which rAAV genomes transduce liveris not known, and it is not clear why only a small proportion ofhepatocytes are stably transduced, as opposed to other tissueslike brain, muscle, and retina, where high rates of transductioncan be obtained around the injection site (7, 13, 25, 28). Onepossible explanation is that unlike other tissues, with intravas-cular infusion into the liver, rAAV vector virions are not ableto bind or enter the majority of hepatocytes. A previous studyshowed that 10 to 25% of hepatocytes were transduced withrAAV genomes when the vector was coadministered with anadenovirus (6). This suggested that many hepatocytes take uprAAV; however, it was not conclusive, because of the possibil-

* Corresponding author. Mailing address: Department of Pediatrics,300 Pasteur Dr., Rm G305A, Stanford University, Stanford, CA 94305.Phone: (650) 498-6531. Fax: (650) 498-6540. E-mail: [email protected].

† Present address: Division of Molecular Medicine, Department ofPediatrics, Harvard Medical School, Boston, MA 02115.

3793

ity that rAAV entry into the cells was influenced by the ade-novirus particles.

The studies described here were designed to better under-stand the process of liver transduction in vivo. To do this, westudied (i) whether all hepatocytes are equally capable of tak-ing up the vector shortly after its administration and/orwhether there is a defined population of hepatocytes that arepermissive to stable transduction, (ii) the relative frequency ofindependent transduction events, (iii) heteromultimer forma-tion within individual hepatocytes, and (iv) the importance ofthe cell cycle for transduction.

These factors are important not only because they may leadto insights into the mechanism(s) of vector integration, but alsobecause with the vector genome size limitations, they mayallow a means of using two vectors to make a single functionalgene. In early studies, dual vector transduction has been sug-gested in the brain (3, 13, 26) and muscle (19, 31) but themolecular state of the genomes (heterogenomes versus twohomogenomes) was not determined. However, very recent re-sults clearly establish the formation of heteroconcatemers inmuscle (30). If transduction is a random event, then in theliver, where the frequency of transduced hepatocytes is low, theprobability that two vectors will transduce a single cell may bemuch lower than that expected for the muscle and brain, wherea high proportion of transduced cells are found concentratedat the injection site. Thus, it is possible that the mechanism(s)involved in stable transduction will ultimately turn out to bedifferent for different tissues.

MATERIALS AND METHODS

rAAV vector preparation and characterization. Preparation and characteriza-tion of rAAV-FIX from pSSV9-MFG-hFIX, rAAV-TH from pSSV-MFG-TH,rAAV-EF1a-FIX, and rAAV-CMV-LacZ were performed as described previ-ously (10, 17, 24). rAAV-EF1a-LacZ contains a truncated EF1a promoter (17)driving the Escherichia coli lacZ gene. The total particle titer of the rAAV vectorswas determined by a dot-blot assay. The structures of the vectors used are givenin Fig. 1.

Animal studies. All methods of vector infusion, partial hepatectomy, and DNAisolation have been described previously (9, 15, 24). Animals were treated ac-cording to the National Institutes of Health guidelines for animal care and theguidelines of the University of Washington and Stanford University. Adult fe-male C57BL/6, C57BL/6 scid, and C57BL/6 Rag-1 mice were purchased fromJackson Laboratory and infused with rAAV vectors via the portal vein as de-scribed below. Blood samples were taken from the retro-orbital plexus.

For 59-bromo-29-deoxyuridine (BrdU)-labeling studies, immediately after por-tal vein infusion of the vector and 200 mg of BrdU per kg, a miniosmotic pumpthat can continuously administer BrdU solution in 0.5 N sodium bicarbonate ata rate of 1 mg/day for 14 days (model 2002; Alzet, Palo Alto, Calif.) wasimplanted into the subcutaneous space on the dorsal surface. To allow forimmediate release of BrdU from the pump, all pumps were incubated in salineat 37°C for at least 4 h prior to implantation as recommended by the manufac-turer. These pumps were replaced twice during the experiment, every 12 days forup to 36 days, to allow for continuous labeling of hepatocytes. Additional sub-cutaneous injection of 200 mg of BrdU per kg was administered during thesurgical procedure of pump replacement to ensure continuous labeling. Contin-uous infusion of BrdU at this rate caused no liver damage as determined byserum alanine aminotransferase measurements (data not shown).

FISH in hepatic nuclei. From each group of mice infused with both rAAV-FIXand rAAV-TH, primary mouse hepatocytes were isolated by the collagenaseperfusion method 5 weeks after the infusion of the second vector, rAAV-TH(15). The hepatocytes were subsequently suspended in Williams’s medium sup-plemented with 10% fetal calf serum, filtered, and washed three times with thesame medium. Mouse interphase nuclei were then prepared from freshly isolatedprimary hepatocytes by a standard methanol-acetic acid method. The rAAV-FIXprobe made from the rAAV plasmid, pSSV9-MFG-hFIX, was labeled by nicktranslation, incorporating biotin-14-dATP (GIBCO BRL), and the rAAV-THprobe made from the pSSV-MFG-TH plasmid was labeled by nick translation,incorporating digoxigenin-11-dUTP (Boehringer Mannheim). Labeled DNA(100 ng) was ethanol precipitated along with 10 mg of salmon sperm DNA for useon each slide. The slides were hybridized with both probes in 50% form-amide–23 SSC (13 SSC is 0.15 M NaCl plus 0.015 M sodium citrate)–10%dextran sulfate at 37°C overnight. The next day, the slides were washed in 50%formamide–23 SSC at 42°C and 23 SSC at 42°C. Texas red-conjugated avidinwas used in combination with biotinylated goat anti-avidin antibody for detectionof hybridization signals generated from the rAAV-FIX probe. Mouse anti-digoxigenin antibody was used in combination with fluorescein isothiocyanate-conjugated rabbit anti-mouse immunoglobulin G and fluorescein isothiocyanate-conjugated goat anti-rabbit immunoglobulin G to detect hybridization signalsgenerated from the rAAV-TH probe. The nuclei were counterstained with 49,6-diamidino-2-phenylindole (DAPI). Photomicroscopy was performed with a stan-dard epifluorescence microscope (Zeiss Co.).

FIG. 1. Molecular structures of the vectors. (A) rAAV-FIX; (B) rAAV-TH; (C) rAAV-CMV-LacZ; (D) rAAV-EF1a-LacZ; (E) rAAV-EF1a-FIX. The black boxesat both vector ends represent the inverted terminal repeats. MFG-P, Moloney murine leukemia virus long terminal repeat promoter; IVS, mRNA splice donor/spliceacceptor; hFIX cDNA, human coagulation factor IX cDNA; pA(bGH), bovine growth hormone polyadenylation signal; hTH cDNA, human tyrosine hydroxylasecDNA; CMV-P; human cytomegalovirus immediate-early gene enhancer/promoter; hGH int, human growth hormone intron; lacZ, the bacterial lacZ gene; pA(SV40),simian virus 40 mRNA polyadenylation signal; EF1a-P, human polypeptide elongation factor 1a gene enhancer/promoter; dEF1a-P, truncated EF1a-P; pA(hGH),human growth hormone polyadenylation signal.

3794 MIAO ET AL. J. VIROL.

Southern analyses. Genomic DNA was prepared from primary mouse hepa-tocytes from the mice injected with rAAV-FIX and rAAV-TH. A 15-mg sampleof each DNA was digested with BamHI and XbaI at 37°C overnight and thenelectrophoresed through a 0.8% agarose gel and transferred to a nylon mem-brane (Hybond N1; Amersham). The membrane was prehybridized and thenhybridized with an hFIX cDNA probe at 65°C using a Rapid-Hyb buffer (Am-ersham). The final stringency of washing was 0.13 SSC–0.1% sodium dodecylsulfate at 65°C. After autoradiography, the blot was stripped and then hybridizedwith a TH cDNA probe under the same conditions. The hFIX cDNA probe is 1.4kb in size, and the TH cDNA probe is 1.2 kb. Both probes were labeled to aspecific activity of 108 cpm/mg with [a-32P]dCTP, using a random-primer labelingkit (Stratagene).

To determine the vector copy number per cell (the number of double-strandedvector genomes per diploid genomic equivalent) in the transduced livers ofrAAV-EF1a-FIX-injected mice, 20 mg of genomic DNA extracted from liverswas digested with XhoI that cuts three times within the vector, electrophoresedtogether with copy number standards, and subjected to Southern blot analysis asdescribed previously (17), with a 1.9-kb vector sequence-specific probe. Theintensity of the bands was quantitated by densitometry.

PCR detection methods. rAAV-FIX and rAAV-TH vector genomes weredetected in the transduced mouse livers by one-round PCR experiments usinginternal primer sets within the cDNA sequence of hFIX and TH, respectively.Two sets of primers were used in nested-PCR experiments to amplify concate-mers composed of the same vector genomes and mixed vector genomes, respec-tively. After electrophoresis of the PCR products, the gel was blotted and hy-bridized with a hFIX cDNA probe. Subsequently, the blots were stripped andhybridized with a TH cDNA probe. The hFIX and TH probes and the hybrid-ization procedures used were the same as the ones in the Southern analysis. Theprimer sequences are as follows: H1, 59 GATGGAGATCAGTGTGAGTCCAATCCATGT; H2, 59 AGTTTAAACCTAGACCGATACATTCACCGA; H3, 59CTCTCAAGGTTCCCTTGAACAAACTCTTCC; H4, 59 ACTGAAGTGGAAGGGACCAGTTTCTTAAC; H8, 59 GCTGGGGTGAAGAGTGTGCAATGAAAGGCA; H9, 59 CCTTGAACAAACTCTTCCAATTTACCTG; T1, 59 GGCCATCATGGTAAGAGG; T2, 59 ACTGGGTGCACTGGAACAC; T3, 59 AAACGTCTCAAACACCTTCACAGCTC; T4, 59 TATCCGCCACGCGTCCTCGCCCATGCACTC; T7, 59 CTCTGCCTGCTTGGCGTCCAGCTCAGACAC;and T10, 59 ACCAAGACCAGACGTACCAGTCAGTCTAC.

DNA in situ hybridization in liver tissue. Livers from mice were fixed in 10%neutral buffered formalin, dehydrated, and paraffin embedded. Sections (5 mm)were cut onto Superfrost Plus charged slides and baked at 60°C for 1 h. PlasmidpAAV-EF1a-LacZ DNA was labeled with digoxigenin-11-dUTP using the DIGHigh Prime (Roche Molecular) random-primer labeling kit.

Slides were deparaffinized in xylene and rehydrated through a series of gradedethanols (100, 95, and 70%) into water. They were then treated in 0.2 N HCl for20 min at room temperature, (RT), briefly rinsed in water, digested with 100 mgof proteinase K per ml in phosphate-buffered saline for 20 min at 37°C, andwashed for 5 min in water. The sections were postfixed for 1 min in 10% neutralbuffered formalin and rinsed in water, treated with 0.1 M triethanolamine–0.25%acetic anhydride for 10 min at RT, and washed twice in phosphate-bufferedsaline for 3 min each. The slides were then dehydrated through a series of gradedethanols (70, 95, and 100%) and allowed to air dry. The tissues were denaturedin 70% formamide–23 SSC for 5 min at 75°C, immediately dipped into a seriesof cold 70, 95, and 100% ethanols, and once again allowed to air dry. Then 0.75mg of labeled probe was added to a hybridization solution consisting of 60 ml of23 hybridization buffer (43 SSC, 23 Denhardt’s solution, 0.2 M sodium phos-phate buffer [pH 6.5]), 60 ml of 20% dextran sulfate, and 0.06 mg of salmon spermDNA per ml. The final probe concentration was 6 mg/ml. The probe was dena-tured at 75°C for 5 min and quickly placed in an ice bath. Approximately 20 mlof diluted probe was applied under a coverslip and hybridized in a moist chamberat 42°C overnight. The next day, the coverslips were removed and the slides weresubjected to a series of posthybridization washes including a 23 SSC–0.1 mMdithiothreitol wash for 30 min at RT followed by a 0.13 SSC–0.1 mM dithio-threitol wash for 30 min at 37°C and a final 3-min rinse in 0.13 SSC.

A blocking buffer (23 SSC–0.05% Triton X-100) supplemented with 30%normal sheep serum was applied to the sections, and the slides were incubatedin a moist chamber for 2 h at RT. They were then washed twice in Tris-bufferedsaline (TBS) for 10 min at RT. Anti-DIG-AP (Roche Molecular) was applied ata dilution of 1:500 in a buffer (0.3% Triton X-100, TBS) supplemented with 5%normal sheep serum, and the slides were incubated in a moist chamber overnightat RT. Tissue sections were washed twice the next day in TBS for 15 min at RTand placed in an alkaline phosphatase buffer (a mixture of 0.3 M Tris-HCl [pH9.5], 0.15 M MgCl2, and 0.3 M NaCl in equal parts, made immediately prior touse) for 5 min at RT. Nitroblue tetrazolium chloride–5-bromo-4-chloro-3-in-dolylphosphate (NBT-BCIP stock solution from Roche Molecular) color sub-strate was used at a dilution of 40 ml of stock solution to 10 ml of alkalinephosphatase buffer for 1 h 45 min to detect the signals. Slides were washed wellin water, allowed to air dry, and coverslipped with a nonxylene medium.

X-Gal and BrdU double staining of transduced hepatocytes. The mice injectedwith rAAV-EF1a-LacZ and labeled with BrdU were sacrificed 36 days aftervector administration, and the liver and duodenum were harvested, embedded inOCT compound (Tissue-Tek; Sakura Finetek, U.S.A. Inc., Torrance, Calif.), andfrozen in 2-methylbutane chilled with dry ice. Sections (10 mm) were subjected to

X-Gal (5-bromo-4-chloro-3-indolyl-b-D-galactopyranoside) staining for analysisof cytoplasmic b-galactosidase expression (9). For the X-Gal and BrdU doublestaining, 7-mm-thick sections were prepared, stained with X-Gal, and immuno-stained against incorporated BrdU with sheep anti-BrdU antibody (Maine Bio-technology Services, Inc., Portland, Maine) as described elsewhere (18).

Statistical methods. The data obtained from FISH were assessed statistically.The number of transduction events by viral vectors in any cell was assumed tofollow a Poisson distribution. We conditioned on the number of cells having noviral vectors integrated to estimate the parameter of the Poisson distribution, i.e.,P(X 5 0) 5 exp(2l). Then the expected number of cells with 1, 2, 3, etc.,transduction or integration events by viral vectors was calculated by assuming aPoisson distribution with parameter lambda. The fit of the data to this randommodel was evaluated using a chi-square goodness-of-fit statistic, with cells clas-sified as having 1, 2, or more transduction or integration events. Since it was notpossible to determine if cells containing two red or green signals had undergoneindividual transduction events (see Table 1), they were counted as indicating asingle transduction event. This would only underestimate the number of doubletransduction events and decrease the probability of statistical significance.

RESULTS

Functional rAAV genomes are taken up by most hepatocytenuclei in vivo. To attempt to understand why only a smallpercentage of the hepatocytes become transduced in vivo, anexperiment was performed to establish whether all or most ofthe hepatocytes take up the vector genomes. The liver sectionsfrom C57BL/6 mice injected with rAAV-EF1a-LacZ (Fig. 1D)at an estimated multiplicity of infection of 1,000 (1.2 3 1011

particles per mouse, with 108 hepatocytes/liver) were prepared24 h postinjection and examined for rAAV single-strandedvector genomes by DNA in situ hybridization. As shown in Fig.2a and b, most if not all of the hepatocyte nuclei had a positivesignal for rAAV, establishing that the low rate-limiting step fortransduction was not selective nuclear entry of the single-stranded vector genomes.

To establish that these cells contained a substantial numberof nuclear rAAV genomes that were actually capable of trans-duction, two mice infused with 1.0 3 1011 particles of rAAV-CMV-LacZ were sacrificed 18 h later and primary mousehepatocytes were cultured from these animals. At 6 h afterisolation, the hepatocytes were infected for 24 h with a wild-type adenovirus type 2 (controls were cultured without adeno-virus) at a dose known to infect about 90% of hepatocytes (11).The wild-type adenovirus was used to supply helper gene func-tion to allow second-strand rAAV synthesis to proceed into apotential transcriptionally active molecule (5, 6, 19, 31). From65 to 71% (n 5 2 animals) of the adenovirus-infected and lessthan 0.1% of the non-adenovirus-infected hepatocytes stainedpositive with X-Gal, demonstrating that the majority of hepa-tocytes have “transduction-competent” rAAV genomes (Fig.2c and d) shortly after vector administration in vivo.

These single-stranded competent genomes were lost overtime, because when a similar study was performed 5 weeksafter infusion of 1.8 3 100 rAAV-EF1a-LacZ particles intoC57BL/6 Rag-1 mice (n 5 3) (to avoid immune system re-sponses to the E. coli b-galactosidase), there was only a slight(threefold) enhancement from 0.7 6 0.1% (representing stablerAAV transduction) to 2.1 6 0.3% X-Gal-positive cells withthe addition of wild-type adenovirus. This is consistent withour previous findings that single-stranded rAAV vector ge-nomes decrease over a 5- to 13-week period (15).

A changing subpopulation of hepatocytes is permissive tostable rAAV transduction, and dimer formation is an impor-tant event in achieving stable transduction. To further evalu-ate the mechanism(s) of transduction in vivo, a mixed-vectorexperiment was performed. A total of 1.0 3 1011 particles ofrAAV encoding human factor IX (rAAV-FIX) were infusedper C57BL/6-scid mouse (scid mice were used to eliminate thehumoral immune response to the vector and avoid interference

VOL. 74, 2000 MECHANISM OF rAAV TRANSDUCTION IN HEPATOCYTES IN VIVO 3795

with repeat dosing) into four groups of animals (n 5 3/group)through their portal vein. Each group of mice was then infusedwith 1.0 3 1011 particles of rAAV encoding tyrosine hydroxy-lase (rAAV-TH) at the same time (T1) or 1 week (T2), 3 weeks(T3), or 5 weeks (T4) after rAAV-FIX infusion. Interphasenuclei were prepared from primary hepatocytes isolated fromeach group of mice 5 weeks after rAAV-TH infusion to deter-mine the distribution of the two genomes in the nucleus bytwo-color FISH (Fig. 3) (data are summarized in Table 1).

Consistent with our previous studies (15, 24), we found that asmall percentage of the nuclei (3.2% to 6.8%) contained rAAVsignals (a quantitative measure of transduction efficiency) (Ta-ble 1).

Most of the rAAV stably transduced positive nuclei con-tained either rAAV-FIX genomes (red) (Fig. 3A) orrAAV-TH genomes (green) (Fig. 3B) (Table 1). However,when rAAV-FIX and rAAV-TH were infused at the sametime, 42% of the transduced cells contained both genomes

FIG. 2. DNA in situ hybridization and biological assay for functional rAAV genomes. (A and B) C57BL/6 mice (n 5 2) were injected with 1.2 3 1011 particles ofrAAV-EF1a-LacZ by intraportal infusion. One day later, the animals were sacrificed and the livers were examined for the presence of rAAV genomes. (A)Representative liver sample from one of two rAAV-treated animals. Original magnification, 3200. (B) Liver sample from a non-rAAV control. Original magnification,3100. Note the presence of staining in most of the hepatocyte nuclei in panel A. (C and D) C57BL/6 mice (n 5 2) were injected with 1.0 3 1011 particles ofAAV-CMV-LacZ by intraportal infusion. At 18 h after rAAV was administered, mouse hepatocytes were prepared and plated in six-well dishes. At 6 h later, the cellswere infected with wild-type adenovirus type 2 at a multiplicity of infection of 100 (C [original magnification, 3100]) or not infected (D [original magnification, 350]).At 24 h later, the cells were stained with X-Gal.


(Fig. 3C and D). While 0.9% of the hepatocytes (28% oftransduced hepatocytes) contained a hybrid genome signal(yellow), indicative of a single transduction event using a mix-ture of the two vector genomes (Fig. 3C), 0.4% of the hepa-tocytes (12.5% of transduced hepatocytes) contained separatered and green signals in the same nucleus (Fig. 3D), indicatingtwo separate transduction events at different loci within thesame cell. These results have intriguing implications. If manyof the input vector genomes were involved in a transductionevent, we would expect that most of the FISH signals wouldcontain a red-green mix (yellow), whereas if a single genomewere used, a yellow signal would never be observed. The ap-proximate 1:1:1 red/green/yellow ratio of rAAV-positive nuclei

was most consistent with dimer formation as a critical event inthe transduction pathway.

Next, we examined whether rAAV transduction in hepato-cytes was a random event. For this purpose, we assumed that acell containing both a red and green signal was the subject oftwo independent transduction events. Yellow signals werecounted as a single transduction event because the probabilityof two independent events occurring in close enough proximityto yield a yellow signal would be small. Furthermore, even ifside-by-side transduction events were to occur on rare occa-sions, their exclusion as double transduction events would onlydecrease the statistical significance. By assuming that the trans-duction of a viral vector in any cell follows a Poisson distribu-

FIG. 2—Continued.


tion, the fit of the data to a random model was evaluated usinga chi-square goodness-of-fit statistic, with cells classified ashaving one or multiple transduction events. From this randommodel, the number of cells with dual transduction events at

time point T1 was predicted to occur at much lower frequency(0.05%) than the actual observed frequency (at least 0.4%[Table 1]) (P , 0.00001). These analyses indicate that rAAVtransduction was not a random event and that there is a finite

FIG. 3. FISH from mice transduced in vivo with rAAV-FIX and rAAV-TH vectors. C57BL/6-scid mice were infused with 1.0 3 1011 particles of each rAAV-FIXand rAAV-TH vectors. At 5 weeks later, mouse interphase nuclei from freshly isolated primary hepatocytes were subjected to FISH with fluorescence-labeledrAAV-FIX and/or rAAV-TH probes. Nuclei contained only rAAV-FIX signal (A), only rAAV-TH signal (B), separate rAAV-FIX and rAAV-TH signals (C), oroverlapping rAAV-FIX and rAAV-TH signals (D). The discrete red hybridization signals were produced by hybridizing with the rAAV-FIX probe, the green signalswere produced by hybridizing with the rAAV-TH probe, and the yellow signal was generated from overlapping red and green signals. Rare cells contained two red ortwo green signals (not shown). Because some hepatocytes undergo DNA synthesis without nuclear or cell division, it is not possible to determine whether these doublylabeled single-color signals represent two independent events or DNA synthesis after transduction; these were counted as single red or green positive cells.

TABLE 1. Summary of coinfusion of two vectors

Time points No. of nucleiexamined

No. (%) of nuclei that werea: Total no. (%) oftransduced cellsaRed Green Red and green Yellow

Day 0, rAAV-FIX; day 0,rAAV-TH (T1)

2,010 22 (1.1 6 0.13) 15 (0.8 6 0.11) 8 (0.4 6 0.07) 19 (0.9 6 0.22) 64 (3.2 6 0.53)


2,210 28 (1.3 6 0.13) 48 (2.2 6 0.11) 3 (0.1 6 0.0) 13 (0.6 6 0.15) 92 (4.2 6 0.1)


1,820 30 (1.7 6 0.04) 56 (3.1 6 0.04) 5 (0.3 6 0.12) 0 91 (5.0 6 0.04)


1,940 42 (2.2 6 0.03) 89 (4.6 6 0.01) 0 0 131 (6.8 6 0.02)

a There were three animals per group. The nuclei counted per group are roughly equally divided among the three animals. The percentage of positive hepatocytesis given with the standard deviations in parentheses. The standard deviations were calculated using the individual transduction efficiencies from three mice perexperimental group. On occasion, individual nuclei were found that contained two separate red or green signals. Because it was not possible to differentiate betweentwo independent transduction events in the same cell and a single transduction event followed by nuclear DNA synthesis, these nuclei were scored as single transductionevents. This would slightly underestimate the number of hepatocytes that had undergone double transduction events.


number of hepatocytes permissive to rAAV transduction. Asthe time between the injection of vector 1 and vector 2 in-creases, the number of dual-transduction events decreases butthe total number of transduced hepatocytes increases, suggest-ing that cells permissive to transduction change over time.Taken together, our data suggest that there exists a relativelysmall subpopulation of hepatocytes that are permissive totransduction but that these cells are not static and change overtime.

Molecular analysis of mixed rAAV concatemers in vivo. Tobegin to understand the molecular nature of the transduced

rAAV genome in cells, Southern and PCR analyses were per-formed. Southern analysis of the genomic DNA digested withenzymes that cleave twice within either vector demonstratedthe presence of both rAAV-FIX and rAAV-TH in the trans-duced mouse liver in all four groups of mice (data not shown).Furthermore, we confirmed the presence of both vector ge-nomes in mouse liver by PCR amplification using internalprimer sets (Fig. 4a) within the cDNA sequence of hFIX andTH (Fig. 4b, lanes 1 and 2 and lanes 6 and 7). Since it was moredifficult to amplify longer sequences from genomic DNA, weused a nested-PCR amplification method with two sets of vec-tor-specific primers, as shown in Fig. 4a, to detect the presenceof head-to-tail concatemers, circular monomers or dimerscomposed of the same vector genomes, or mixed-vector ge-nomes. After electrophoresis of the PCR products, the gel wasblotted and hybridized with the hFIX cDNA probe. Subse-quently, the same blots were stripped and hybridized with theTH cDNA probe. The control monomer vector band and con-

FIG. 4. PCR detection of the vector genomes from transduced mouse hepa-tocytes. (a) Proposed structure of the amplified fragments. Horizontal arrowsindicate the location and direction of PCR primers, and the sizes of the expectedfragments are given. (b) The vector genomes were amplified from liver DNA ofanimals in each of the four groups (T1, both rAAV vectors infused at the sametime; T2, vectors administered 1 week apart; T3, vectors administered 3 weeksapart; and T4, vectors administered 5 weeks apart) as summarized in Table 1.The presence of vector genomes in the mouse liver was confirmed by PCRexperiments using sequence-specific primer sets within the cDNA sequence ofhFIX (H1 and H2) (lanes 1 and 6) and TH (T1 and T2) (lanes 2 and 7). Two setsof primers as shown in panel a were used in nested PCR experiments to amplifyvector-vector junctions composed of the same vector genomes and mixed-vectorgenomes, respectively. After electrophoresis of the PCR products, the gel wasblotted and hybridized with an hFIX cDNA probe (lanes 1 to 5). Subsequently,the blots were stripped and hybridized with a TH cDNA probe (lanes 6 to 10).Primer sets consisting of H3-H4 and H8-H9 amplified head-to-tail rAAV-FIXmolecules that hybridized with the hFIX probe but not the TH probe (lanes 3and 8), primer sets consisting of T3-T4 and T7-T10 amplified head-to-tailrAAV-TH molecules which hybridized with the TH probe but not the hFIXprobe (lanes 4 and 9), and primer sets consisting of H3-T4 and H9-T10 amplifiedhead-to-tail rAAV-TH-rAAV-FIX mixed dimers which hybridized with bothhFIX and TH probes (lanes 5 and 10). While a 2.7-kb band could arise from aPCR artifact, the livers from mice infused at the later time points (T3 and T4),which do contain both vector genomes in the same liver samples, do not give the2.7-kb band.


catemers composed of rAAV-FIX genomes hybridized withthe hFIX probe only but not with the TH probe (Fig. 4b, lanes1, 3, 6, and 8), whereas control monomer and concatemers ofrAAV-TH hybridized with the TH probe only but not with thehFIX probe (lanes 2, 4, 7, and 9). The majority of the mole-cules are in a head-to-tail orientation; however, with longerexposure, minor bands of ;0.9 kb corresponding to the tail-to-tail orientation could sometimes be detected (data notshown).

Most interestingly, a single band of ;2.7 kb was amplified by

PCR and hybridized with both hFIX and TH probes; it wasfound to represent a mixed-genome species (Fig. 4b, lanes 5and 10 in samples T1 and T2 only). The mixed concatemerscontaining rAAV-FIX and rAAV-TH genomes in a head-to-tail orientation were detected only in hepatocytes of mice giventhe two constructs simultaneously or 1 week apart, not in thoseof mice given the constructs 3 and 5 weeks apart; this wasconsistent with the presence or absence of yellow FISH signals(Fig. 3) in transduced hepatocytes. Larger molecules consistingof (rAAV-TH)n-(rAAV-FIX)n in either head-to-tail, head-to-

FIG. 5. Determination of rAAV transgene expression in BrdU-labeled hepatocytes. C57BL/6 Rag-1 mice were injected with 1.8 3 1011 particles of rAAV-EF1a-LacZ with (n 5 3) (A) or without (n 5 4) (B) a prior hepatectomy. The animals were continuously labeled with BrdU for 36 days, as described in Materials and Methods.At 36 days, liver sections were costained with X-Gal and BrdU. The cytoplasmic blue and nuclear brown staining represents b-galactosidase and BrdU, respectively.(A) Magnification, 3400. One doubly labeled hepatocyte is present in the lower left corner. (B) Magnification, 3200. The b-galactosidase-positive cells are negativefor BrdU.


head, or tail-to-tail forms may also exist but may not be de-tectable because of heterogeneity, primer selection, or lengthof the PCR product. Thus, further studies are required toestablish the most prevalent molecular structure (if one exists)of the heterogenomes.

The permissive subpopulation of hepatocytes comprisesboth non-S-phase and S-phase cells. Although most hepato-cytes at a single time point are quiescent, a small percentageare in the cell cycle, and some of these do not undergo cyto-kinesis; this results in polyploid nuclei and/or doubly nucleatedhepatocytes (4). Thus, a substantial fraction of hepatocytescould cycle over the 5-week period required for rAAV trans-duction of hepatocytes. In addition, it has been demonstratedthat rAAV vectors preferentially transduce cells in S phase invitro (21). Therefore, we designed studies to determine if thecell cycle status could account for the permissive subpopula-tion of hepatocytes that were transduced by rAAV vectors invivo. We first compared the rAAV-EF1a-LacZ transductionefficiency in the two groups of mice that were not hepatecto-

mized or were partially hepatectomized 48 h (time to maximalhepatocellular division) prior to vector administration. Contin-uous labeling with BrdU for 36 days revealed that 50% of thehepatocytes passed through S phase after vector administra-tion in the hepatectomized group while 15% of the hepatocyteswere labeled in the nonhepatectomized group (Fig. 5; Table 2);however, there was no significant difference in the number ofb-galactosidase-positive hepatocytes between these twogroups. This suggested that cell division at or around the timeof vector injection was not a requirement for transduction ofmouse hepatocytes. More importantly, among the b-galactosi-dase-positive hepatocytes, the BrdU-positive cells appeared tobe of the same or lower prevalence compared with the BrdU-negative cells in both the partially hepatectomized and non-hepatectomized animals (Fig. 5; Table 2). This substantiatesthe notion that there was no preference for transduction inhepatocytes that had passed through the S phase in vivo.

We next wanted to know if stimulating cell division by partialhepatectomy after vector injection would enhance transduc-tion and/or change the molecular forms of the vector. Toaddress this question, C57BL/6 mice (13 to 16 weeks old)injected with rAAV-EF1a-FIX vector intraportally at a dose of1.7 3 1011 particles were partially hepatectomized on days 3,10, 17, and 24 postinjection. All the mice that underwent hep-atectomy were sacrificed 7 days after the procedure (days 10,17, 24, and 31 after vector administration) for rAAV DNAanalysis. Plasma hFIX levels, rAAV genome number per cell,and rAAV vector forms were compared in rAAV-treated, non-hepatectomized and partially hepatectomized animals. Consis-tent with our previous studies, the hFIX levels increased overtime (15) but were accompanied by a reduction in the numberof vector genomes in the nonhepatectomized mice (Fig. 6).The hFIX levels in the partially hepatectomized group wereconsistently lower than those in the nonhepatectomized group,presumably representing loss of the vector genomes that hadthe potential to participate in the protein expression. The lossof vector genomes was most prevalent between the 3- and10-day partial hepatectomy groups, a period when a large pro-portion of vector genomes have not integrated (15). The loss ofDNA and the lower hFIX gene expression may have simplybeen due to the dilution of the nonintegrated vector genomesper hepatocyte during cell division. The smaller decrease in thenumber of vector genomes observed between the 17- and 24-day partially hepatectomized animals (Fig. 6) probably oc-curred because some of the stable transduced hepatocytes con-tained integrated rAAV genomes by this time that would notbe diluted by cellular division. Finally, cell cycle activation after

FIG. 6. Comparison of transgene expression and vector copy number per cellin the liver between mice partially hepatectomized after rAAV administrationand control mice without hepatectomy. Sixteen adult C57BL/6 mice were in-jected with rAAV-EF1a-FIX. Three mice were partially hepatectomized on days3, 10, 17, and 24 and sacrificed 7 days after the hepatectomy. hFIX levels inmouse plasma were determined by an enzyme-linked immunosorbent assay, andthe vector copy number per diploid amount of DNA in livers was determined bySouthern blot analysis. DNA signals represent all double-stranded vector se-quences (see Materials and Methods). Error bars represent standard deviation.The number above each bar indicates the number of mouse samples analyzed.PHx, partial hepatectomy.

TABLE 2. BrdU and b-galactosidase labeling of hepatocytes

Mouse Labeling index(%)aX-Gal-positive

cells (%)aLabeling index in X-Gal-

positive cells (%)a

Nonhepatectomized group1 13.3 (314/2,367) 0.9 (27/3,117) 4.3 (12/278)2 14.2 (325/2,286) 0.6 (13/2,139) 8.6 (8/93)3 14.3 (346/2,417) 0.7 (16/2,329) 4.7 (6/112)4 16.0 (388/2,420) 0.3 (7/2,367) 4.9 (9/182)Mean 14.5 6 1.0 0.6 6 0.2 5.6 6 1.7

Partially hepatectomized group5 57.9 (1,715/3,014) 0.5 (12/2,217) 46.7 (71/152)6 43.2 (905/2,097) 1.1 (22/2,049) 38.4 (117/305)7 48.7 (1,032/2,121) 0.6 (12/2,133) 38.2 (79/207)Mean 49.9 6 6.1 0.7 6 0.3 41.1 6 4.0

a The numbers in parentheses are the number of BrdU-positive cells or X-Gal-positive cells/total number of cells counted.


vector injection did not promote the conversion of the low-molecular-weight episomal forms to the high-molecular-weightspecies (data not shown). Taken together, the results show thatcell cycling did not facilitate the rAAV transduction in hepa-tocytes.

DISCUSSION

Possible mechanisms of concatemerization leading to stabletransduction. The mechanisms involved in rAAV integrationhave been studied in tissue culture and are now starting to beaddressed in vivo (reviewed in reference 20). It is becomingapparent that the process of integration may not be the sameunder different experimental conditions, and it is likely that themetabolic state of the cell and/or the cell type is a crucialfactor.

Our results are consistent with the mechanism that the ran-dom linkage of two genomes is a critical event or that only afew input rAAV genomes are directly involved in the processof transduction in the absence of helper viruses (12). Thepresence of the concatemeric mixed genomes argues againstthe models where AAV proviral concatemers are the exclusiveresult of the amplification of a single input genome in a rolling-circle model, or as a monomer-length input genome that inte-grates and is then amplified in place. The formation of vectorconcatemers may involve joining of existing single-strandedgenomes and/or rolling-circle replicative mechanisms. Thepresence of mixed concatemeric structures indicates that re-combination between two vector monomers may occur. In viewof the great stability of single-stranded rAAV genomes in theliver for at least 5 weeks (15) and the recent evidence ofcircular intermediates of monomer and dimer viral genomes ina head-to-tail array in muscle tissue (2, 27, 30), our data areconsistent with our current hypothesis that two genomes some-how become linked and then become larger concatermers be-fore, during, or after chromosomal integration. Further exper-iments are required to clarify the molecular mechanism.

Permissive state of cells required for transduction. The rea-son why only a small, changing population of hepatocytes ispermissible to rAAV transduction is not known but may beassociated with a special metabolic state of the cell. Alterna-tively, the permissive state could be nothing more than a sto-chastic event where a large threshold number of genomes isneeded for transduction even if only a few genomes are usedand required in the initial steps of concatemer formation. Ifthis were true, we would expect most, if not all, of the trans-duced hepatocytes to be periportal, because they would havereceived the highest concentration of vector after an intrapor-tal infusion. However, there is only a slight preference fortransduction of periportal hepatocytes (24). Dose-responsestudies with careful quantitation of transgene product and thenumber of transduced hepatocytes may help to distinguishbetween these different possibilities.

Clearly, our studies demonstrate that the cell cycle is not animportant factor for rAAV transduction. In a previous study,regenerating muscle was less permissive to rAAV transductionthan was mature muscle (25). However, the situation for mus-cle is different from that for liver, because regenerating hepa-tocytes are fully differentiated cells whereas the cells involvedin muscle replacement are not terminally differentiated. In ourstudies, we demonstrate that rAAV uptake is not the limitingstep to transduction in regenerating livers. Moreover, in liversthat had taken up rAAV genomes and then underwent a re-generative stimulus by partial hepatectomy, there was no en-hancement in transduction.

There is still no way to easily reconcile these studies with the

studies of Russell et al., who showed enhanced rAAV trans-duction in cultured cells that had passed through the S phase(21). There are multiple issues, including the possibility of lowlevels of wild-type helper virus that may have been present inearlier viral preparations, the difference in timing when thecultured cells were examined for rAAV-mediated gene expres-sion compared to the in vivo studies (48 h and 36 days, respec-tively), and/or the presence of [3H]thymidine (used for S-phaselabeling), which itself can increase rAAV transduction (1).Cultured cells may not behave in the same way as cells in vivo,or the differences may be related to the different cell typesstudied.

It is important to resolve the process involved in the permis-sive nature of hepatocytes that allows stable transduction, be-cause it may allow the presently limited transduction efficiencyin vivo to be expanded. However, the inability to analyze singlecells or their clones at the molecular level makes this a chal-lenging task for future studies.

ACKNOWLEDGMENTS

C.H.M. and H.N. contributed equally to this work.We thank Doug Bolgiano for assistance with the statistical analysis.This work was supported by NIH grant HL53682. C.H.M. was sup-

ported by individual NIH-NRSA grant HL09754.

REFERENCES

1. Alexander, I. E., D. W. Russell, and A. D. Miller. 1994. DNA-damagingagents greatly increase the transduction of non-dividing cells by adeno-associated virus vectors. J. Virol. 68:8282–8287.

2. Duan, D., P. Sharma, J. Yang, Y. Yue, L. Dudus, Y. Zhang, K. Fisher, andJ. Engelhardt. 1998. Circular intermediates of recombinant adeno-associ-ated virus have defined structural characteristics responsible for long-termepisomal persistence in muscle tissue. J. Virol. 72:8568–8577.

3. Fan, D. S., M. Ogawa, K. I. Fujimoto, K. Ikeguchi, Y. Ogasawara, M. Urabe,M. Nishizawa, I. Nakano, M. Yoshida, I. Nagatsu, H. Ichinose, T. Nagatsu,G. J. Kurtzman, and K. Ozawa. 1998. Behavioral recovery in 6-hydroxydo-pamine-lesioned rats by cotransduction of striatum with tyrosine hydroxylaseand aromatic L-amino acid decarboxylase genes using two separate adeno-associated virus vectors. Hum. Gene Ther. 9:2527–2535.

4. Fausto, N. 1996. Hepatic regeneration, p. 35–58. In D. Zakim and T. D.Boyer (ed.), Hepatology, 3rd ed., vol. 1. The W. B. Saunders Co., Philadel-phia, Pa.

5. Ferrari, F. K., T. Samulski, T. Shenk, and R. J. Samulski. 1996. Second-strand synthesis is a rate-limiting step for efficient transduction by recombi-nant adeno-associated virus vectors. J. Virol. 70:3227–3234.

6. Fisher, K. J., G.-P. Gao, M. D. Weitzman, R. DeMatteo, J. F. Burda, andJ. M. Wilson. 1996. Transduction with recombinant adeno-associated virusfor gene therapy is limited by leading-strand synthesis. J. Virol. 70:520–532.

7. Flannery, J. G., S. Zolotukhin, M. I. Vaquero, N. M. LaVail, N. Muzyczka,and W. W. Hauswirth. 1997. Efficient photoreceptor-targeted gene expres-sion in vivo by recombinant adeno-associated virus. Proc. Natl. Acad. SciUSA 94:6916–6921.

8. Herzog, R., E. Yang, L. Couto, J. Hagstrom, D. Elwell, P. Fields, M. Burton,D. Bellinger, M. Read, K. Brinkhous, G. Podsakoff, T. Nichols, G. Hurtz-man, and K. High. 1999. Long-term correction of canine hemophilia B bygene transfer of blood coagulation factor IX mediated by adeno-associatedviral vector. Nat. Med. 5:56–63.

9. Kay, M. A., Q. Li, T. J. Liu, F. Leland, C. Toman, M. Finegold, and S. L. C.Woo. 1992. Hepatic gene therapy: persistent expression of human alpha1-antitrypsin in mice after direct gene delivery in vivo. Hum. Gene Ther.3:641–647.

10. Kessler, P. D., G. M. Podsakoff, X. Chen, S. A. McQuiston, P. C. Colosi, L. A.Matelis, G. J. Kurtzman, and B. J. Byrne. 1996. Gene delivery to skeletalmuscle results in sustained expression and systemic delivery of a therapeuticprotein. Proc. Natl. Acad. Sci. USA 93:14082–14087.

11. Li, Q., M. A. Kay, M. Finegold, L. D. Stratford-Perricaudet, and S. L. C.Woo. 1993. Assessment of recombinant adenoviral vectors for hepatic genetherapy. Hum. Gene Ther. 4:403–409.

12. Linden, R. M., E. Winocour, and K. I. Berns. 1996. The recombinationsignals for adeno-associated virus site-specific integration. Proc. Natl. Acad.Sci. USA 93:7966–7972.

13. Mandel, R. J., K. G. Rendahl, S. K. Spratt, R. O. Snyder, L. K. Cohen, andS. E. Leff. 1998. Characterization of intrastriatal recombinant adeno-associ-ated virus-mediated gene transfer of human tyrosine hydroxylase and humanGTP-cyclohydrolase I in a rat model of Parkinson’s disease. J. Neurosci.18:4271–4284.


14. McLaughlin, S. K., P. Collis, P. L. Hermonat, and N. Muzyczka. 1988.Adeno-associated virus general transduction vectors: analysis of proviralstructures. J. Virol. 62:1963–1973.

15. Miao, C., R. Snyder, D. Schowalter, G. Patijn, B. Donahue, B. Winther, andM. A. Kay. 1998. The kinetics of rAAV integration in the liver. Nat. Genet.19:13–15.

16. Nakai, H., R. Herzog, J. Hagstrom, J. Walter, S.-H. Kung, E. Yang, S. Tai,Y. Iwaki, G. Kurtzman, K. Fisher, P. Colosi, L. Couto, and K. High. 1998.Adeno-associated viral vector-mediated gene transfer of human blood co-agulation factor IX into mouse liver. Blood 91:4600–4607.

17. Nakai, H., Y. Iwaki, M. A. Kay, and L. B. Couto. 1999. Isolation of recom-binant adeno-associated virus (rAAV) vector-cellular DNA junctions frommouse liver. J. Virol. 77:5438–5447.

18. Park, F., K. Ohashi, W. Chiu, and M. A. Kay. 2000. Efficient lentiviraltransduction of liver requires cell cycling in vivo. Nat. Genet. 24:49–52.

19. Rendahl, K. G., S. E. Leff, G. R. Otten, S. K. Spratt, D. Bohl, M. Van Roey,B. A. Donahue, L. K. Cohen, R. J. Mandel, O. Danos, and R. O. Snyder.1998. Regulation of gene expression in vivo following transduction by twoseparate rAAV vectors. Nat. Biotechnol. 16:757–761.

20. Russell, D., and M. A. Kay. 1999. rAAV and hematology. Blood 94:864–874.21. Russell, D. W., A. D. Miller, and I. E. Alexander. 1994. Adeno-associated

virus vectors preferentially transduce cells in S phase. Proc. Natl. Acad. Sci.USA 91:8915–8919.

22. Rutledge, E. A., and D. W. Russell. 1997. Adeno-associated virus vectorintegration junctions. J. Virol. 71:8429–8436.

23. Snyder, R., C. Miao, L. Meuse, J. Tubb, B. Donahue, H. Lin, D. Stafford, S.Patel, A. Thompson, T. Nichols, M. Read, D. Bellinger, K. Brinkhous, andM. Kay. 1999. Correction of hemophilia B in canine and murine models

using recombinant adeno-associated viral vectors. Nat. Med. 5:64–70.24. Snyder, R., C. Miao, G. Patijn, S. Spratt, O. Danos, D. Nagy, A. Gown, B.

Winther, L. Meuse, L. Cohen, A. Thompson, and M. Kay. 1997. Persistentand therapeutic concentrations of human factor IX in mice after hepaticgene transfer of recombinant AAV vectors. Nat. Genet. 16:270–276.

25. Snyder, R. O., S. K. Spratt, C. Lagarde, D. Bohl, B. Kaspar, B. Sloan, L. K.Cohen, and O. Danos. 1997. Efficient and stable adeno-associated virus-mediated transduction in the skeletal muscle of adult immunocompetentmice. Hum. Gene Ther. 8:1891–1900.

26. Szczypka, M. S., R. J. Mandel, B. A. Donahue, R. O. Snyder, and R. D.Palmiter. 1999. Viral gene delivery selectively restores feeding and preventslethality of dopamine-deficient mice. Neuron 22:167–178.

27. Vincent-Lacaze, N., R. O. Snyder, R. Gluzman, D. Bohl, C. Lagarde, and O.Danos. 1999. Structure of adeno-associated virus vector DNA followingtransduction of the skeletal muscle. J. Virol. 73:1949–1955.

28. Xiao, X., J. Li, and R. J. Samulski. 1996. Efficient long-term gene transferinto muscle tissue of immunocompetent mice by adeno-associated virusvector. J. Virol. 70:8098–8108.

29. Yang, C. C., X. Xiao, X. Zhu, D. C. Ansardi, N. D. Epstrein, M. R. Frey, A. G.Matera, and R. J. Samulski. 1997. Cellular recombination pathways and viralterminal repeat hairpin structures are sufficient for adeno-associated virusintegration in vivo and in vitro. J. Virol. 71:9231–9246.

30. Yang, J., W. Zhou, Y. Zhang, T. Zidon, T. Ritchie, and J. F. Engelhardt.1999. Concatamerization of adeno-associated virus circular genomes occursthrough intermolecular recombination. J. Virol. 73:9468–9477.

31. Ye, X., V. M. Rivera, P. Zoltick, F. Cerasoli, M. A. Schnell, G. P. Gao, J. V.Hughes, M. Gilman, and J. M. Wilson. 1999. Regulated delivery of thera-peutic proteins after in vivo somatic gene transfer. Science 283:88–91.


nonrandom transduction of recombinant adeno-associated...

Documents