ars.els-cdn.com · web viewanthracis phage gamma ami02_c (pf12123) 78 6.3 (fujinami et al. 2007)...

Appendix A. Supporting information

Lateral flow assay-based bacterial detection using engineered cell wall binding domains of a phage endolysin

Minsuk Konga,1, Joong Ho Shinb,1, Sunggi Heuc, Je-Kyun Parkb,*, and Sangryeol Ryua,*

a Department of Food and Animal Biotechnology, Department of Agricultural Biotechnology, Center for Food and Bioconvergence, Research Institute of Agriculture and Life Sciences,

Seoul National University, 1 Gwanak-ro, Gwanak-gu, Seoul 08826, Republic of Korea

b Department of Bio and Brain Engineering, Korea Advanced Institute of Science and Technology (KAIST), 291 Daehak-ro, Yuseong-gu, Daejeon 34141, Republic of Korea

c Crop Cultivation and Environment Research Division, National Institute of Crop Science, RDA, Suwon 16429, Republic of Korea

* Corresponding authors.

Email addresses: [email protected] (J.-K. Park); [email protected] (S. Ryu) 1 These authors contributed equally to this work.

1

Table S1. Summary of phage CBDs targeting pathogenic bacteria.

Target Phage example

Identified domains Size (aa) pI Ref.

Bacillus anthracis phage GammaAmi02_C

(PF12123)78 6.3 (Fujinami et al.

2007)

Bacillus cereus phage PBC1Ami02_C

(PF12123)85 6.4 (Kong et al.

2015)

Bacillus cereusphage

B4

SH3_5

(PF08460)107 9.3 This study

Clostridium perfringens phage phiSM101

SH3_3

(PF08239)133 8.1 (Tamai et al.

2014)

Listeria monocytogenes phage A500 Prokaryotic SH3-

related domain 157 9.4 (Loessner et al. 2002)

Listeria monocytogenes phage P40 No conserved

domains 187 10.1 (Schmelcher et al. 2010)

Staphylococcus aureus phage K SH3_5

(PF08460)95 9.2 (Becker et al.

2009)

Staphylococcus aureus phage SA97 No conserved domains 103 9.1 (Chang and Ryu

2017)

Streptococcus pyogenes phage C1 No conserved

domains 72 8.0 (Nelson et al. 2006)

Streptococcus pneumoniae phage Cp-1

choline binding repeats

(PF01473)140 6.5 (Hermoso et al.

2003)

Streptococcus pneumoniae phage Cp-7 Cpl-7 repeats

(PF08230) 138 4.0 (Bustamante et al. 2010)

Salmonella typhimurium phage SPN1S

PG_binding_1

(PF01471)99 9.9 (Park et al.

2014)

Salmonella enteritidis phage PVP-SE1PG_binding_1

(PF01471)82 9.7 (Walmagh et al.

2012)

Pseudomonas aeruginosa phage PhiKZ144

PG_binding_1

(PF01471)70 6.1 (Briers et al.

2007)

2

Table S2. Plasmids and primers used in this study.

Plasmids Description Reference pET28a KanR expressing vector with a T7 promoter Novagen

pGSTparallel 1 Glutathione S-transferase (GST) gene cloned into AmpR expressing vector

(Sheffield et al. 1999)

pMBPparallel 1 Maltose binding protein (MBP) gene cloned into AmpR expressing vector

(Sheffield et al. 1999)

pET28a::EGFP EGFP gene cloned into NdeI-BamHI site of pET28a (Kong et al. 2015)

pET28a::Cys-GST Cys-GST gene with ‘GSGSGS’ linker cloned into NdeI-BamHI site of pET28a This study

10His-pET28a pET28a expression vector containing 10xHis-tag

(Kong and Ryu 2016)

10His-pET28a::MBP MBP gene cloned into NdeI-BamHI site of10His-pET28a This study

pET28a::B4_CBDThe CBD fragment (Val156-Lys262) of LysB4 cloned into BamHI-HindIII site of pET28a

This study

pET28a::EGFP-B4_CBD

The CBD fragment (Val156-Lys262) of LysB4 cloned into BamHI-HindIII site of pET28a::EGFP

This study

pET28a::Cys-GST-B4_CBD

The CBD fragment (Val156-Lys262) of LysB4 cloned into BamHI-HindIII site of pET28a::Cys-GST

This study

10His-pET28a::MBP-B4_CBD

The CBD fragment (Val156-Lys262) of LysB4 cloned into BamHI-HindIII site of 10His-pET28a::MBP

This study

Primers (5’→3’)fNde_MBP GCGCATATGAAAATCGAAGAAGGTAAACTGGTAATCTGrBamH_MBP GCGGGATCCCCCGAGGTTGTTGTTATTGTTATTGTTGfNde_Cys_GST GCGCATATGTGCTCCCCTATACTAGGTTATTGGAAAATT

AAGGrBamH_Link-GST GCGGGATCCACTACCTGATCCACTACCTTTTGGAGGATG

GTCGCCACCAfBamH_LysB4_CBD GCGGGATCCGGAGGCTCTGGTAGCACAGGCGrHind_LysB4_CBD GCGAAGCTTTTATTTGAACGTACCCCAGTAGTTCTGACG

3

Table S3. Binding spectrum of EGFP-B4_CBD.

Species Strain number EGFP-B4_CBD

B. cereus ATCC 27348 +






B. cereus KCTC 3674 +


B. cereus KCTC 1094 +

B. subtilis ATCC 23857 -

B. megaterium JCM 2506 -

B. circulans JCM 2504 -

B. licheniformis JCM 2505 -

B. pumilus JCM 2508 -

S. aureus ATCC 29213 -

C. perfringens FD-1 -

L. monocytogenes ScottA -

E. coli MG1655 -

C. sakazakii ATCC 29544 -

4

Fig. S1. Production of recombinant CBDs used in this study. (A) EGFP-tagged B4_CBD. (B) B4_CBD alone. (C) Cys-GST-tagged B4_CBD. (D) MBP-tagged B4_CBD.

Fig. S2. The effect of pH and NaCl on the mCherry-tagged B4_CBD binding to B. cereus cells. Relative fluorescent intensities (RFI) of B. cereus cells after binding of mCherry-B4_CBD under different pH (A) and NaCl (B) conditions.

5

Fig. S3. Sensitivity of CBD-based lateral flow assay before optimization (with CBD alone). Detection results of B. cereus (ATCC 10987) show that the LOD is 106 CFU/mL (indicated by red box).

Fig. S4. Detection results of different strains of B. cereus using CBD alone, MBP-CBD and antibody. The results show that using MBP-CBD consistently results in stronger test line compared to using CBD alone. It appears that antibody is not capable of detecting the tested strains.

6

Fig. S5. Optimization of capture CBD concentration. (A) Pictures of the detection results of 107 CFU/mL of B. cereus (ATCC10987) cells with increasing concentrations of immobilized MBP-CBD. (B) The quantified signal intensity shows that 3 mg/mL is the optimal capture CBD concentration.

7

References

Becker, S.C., Foster-Frey, J., Stodola, A.J., Anacker, D., Donovan, D.M., 2009. Gene 443, 32–41.

Briers, Y., Volckaert, G., Cornelissen, A., Lagaert, S., Michiels, C.W., Hertveldt, K., Lavigne, R., 2007. Mol Microbiol 65, 1334–1344.

Bustamante, N., Campillo, N.E., Garcia, E., Gallego, C., Pera, B., Diakun, G.P., Saiz, J.L., Garcia, P., Diaz, J.F., Menendez, M., 2010. J Biol Chem 285, 33184–33196.

Chang, Y., Ryu, S., 2017. Appl Microbiol Biotechnol 101, 147–158.

Fujinami, Y., Hirai, Y., Sakai, I., Yoshino, M., Yasuda, J., 2007. Microbiol Immunol 51, 163–169.

Hermoso, J.A., Monterroso, B., Albert, A., Galan, B., Ahrazem, O., Garcia, P., Martinez-Ripoll, M., Garcia, J.L., Menendez, M., 2003. Structure 11, 1239–1249.

Kong, M., Ryu, S., 2016. J Microbiol Biotechnol 26, 38–43.

Kong, M., Sim, J., Kang, T., Nguyen, H.H., Park, H.K., Chung, B.H., Ryu, S., 2015. Eur Biophys J 44, 437–446.

Loessner, M.J., Kramer, K., Ebel, F., Scherer, S., 2002. Mol Microbiol 44, 335–349.

Nelson, D., Schuch, R., Chahales, P., Zhu, S., Fischetti, V.A., 2006. Proc Natl Acad Sci U S A 103, 10765–10770.

Park, Y., Lim, J.A., Kong, M., Ryu, S., Rhee, S., 2014. Mol Microbiol 92, 316–325.

Schmelcher, M., Shabarova, T., Eugster, M.R., Eichenseher, F., Tchang, V.S., Banz, M., Loessner, M.J., 2010. Appl Environ Microbiol 76, 5745–5756.

Sheffield, P., Garrard, S., Derewenda, Z., 1999. Protein Expr Purif 15, 34–39.

Tamai, E., Yoshida, H., Sekiya, H., Nariya, H., Miyata, S., Okabe, A., Kuwahara, T., Maki, J., Kamitori, S., 2014. Mol Microbiol 92, 326-337.

Walmagh, M., Briers, Y., dos Santos, S.B., Azeredo, J., Lavigne, R., 2012. PLoS One 7, e36991.

8

ars.els-cdn.com · web viewanthracis phage gamma ami02_c (pf12123) 78 6.3 (fujinami et al. 2007)...

Documents